Рекомбинантная плазмида pol-dsred2, кодирующая белки oct4 и lin28 человека и флуоресцентный белок dsred2, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека


 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2495126:

Учреждение Российской академии наук Институт цитологии и генетики Сибирского отделения РАН (RU)
Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (RU)
Федеральное государственное бюджетное учреждение "Новосибирский научно-исследовательский институт патологии кровообращения имени академика Е.Н. Мешалкина" Министерства здравоохранения Российской Федерации (ФГБУ "ННИИПК им. акад. Е.Н. Мешалкина" Минздрава России) (RU)

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии. Предложена плазмидная генетическая конструкция pOL-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и LIN28 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид, и кДНК гена, кодирующая флуоресцентный белок DsRed2. Изобретение обеспечивает одновременную трансляцию белков ОСТ4 и LIN28 человека и флуоресцентного белка DsRed2 при получении индуцированных плюрипотентных стволовых клеток человека и животных в медицине и ветеринарии. 2 з.п. ф-лы, 1 табл., 1 ил.

 

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии и может быть использовано для получения индуцированных плюрипотентных стволовых клеток человека и животных.

Индуцированные плюрипотентные стволовые клетки (ИПСК) - это тип стволовых клеток, которые могут быть получены из соматических клеток животных и человека в результате повышенной экспрессии набора определенных генов . Для получения ИПСК человека и животных успешно используется сверхэкспрессия таких генов как OCT4, SOX2, KLF4 и c-MYC . Позже группой Томсона ИПСК человека были успешно получены с использованием генов OCT4, SOX2, NANOG и LIN28 .

Известно, что для получения большинства новых линий ИПСК в настоящий момент используют генетические конструкции, полученные на основе ретро- и лентивирусных векторов. Этот метод характеризуется тем, что происходит случайное встраивание ДНК-копий геномов ретро- или лентивирусов в геномы клеток, что в свою очередь может приводить к нарушению функционирования генов .

Для полномасштабного применения индуцированных плюрипотентных стволовых клеток в фундаментальных и прикладных исследованиях, таких как скрининг новых лекарственных веществ, исследования в области токсикологии и регенеративной медицины, необходимо решение ряда проблем. Во-первых, необходима разработка методов получения ИПСК без генетической модификации их геномов. Во-вторых, способ получения ИПСК должен быть достаточно эффективным.

Известно, что плазмидные векторы -плазмиды- могут временно существовать в ядрах клеток, обеспечивая стабильную транскрипцию нуклеотидных последовательностей, находящихся под контролем конститутивных промоторов. Кроме того, известен метод, основанный на использовании специфических последовательностей - 2А-пептидов, позволяющий получать генетические конструкции, обеспечивающие трансляцию нескольких полипептидов (белков) с одной молекулы матричной РНК [5].

Задачей данного изобретения является конструирование полицистронной неинтегрирующейся плазмидной конструкции, кодирующей белки OCT4 и LIN28 человека и флуоресцентный белок DsRed2, обеспечивающей одновременную трансляцию данных белков и являющейся вектором при получении индуцированных плюрипотентных стволовых клеток. Белки OCT4 и LIN28 необходимы для запуска репрограммирования клеток, а флуоресцентный белок DsRed2 служит маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Реализация изобретения осуществляется следующим образом.

Конструирование рекомбинантной плазмидной ДНК выполняется на основе плазмиды pIRES (Clontech) и включает следующие стадии:

1. выделяют РНК из клеток известной линии эмбриональных стволовых клеток человека HUES9 и производят синтез кДНК с помощью олиго-(dT) праймеров. Полученную кДНК используют в качестве матрицы для синтеза фрагментов, кодирующих белки;

2. синтез фрагмента кДНК гена OCT4 - позиции в мРНК 53-1135- (Homo sapiens POU domein, class 5, Transcription factor 1 (POU5F1)) человека, (регистрационный номер в GeneBank NM_002701), размером 1152 пар нуклеотидов, содержащего на 3'-конце последовательность F2A-пептида (OCT4-F2A). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hOCT45'NheI 5'-TTTTGCGCTAGCCATGGCGGGACACCTGGCTTCGG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Nhe I) и hOCT4 F2A 3'5'-CCTGCAAGTTTCAGCAAATCAAAGTTTAATGTCTGCTTTACTGGCGCACCCGAACCCGAGTTTGAATGCATGGGAGAGCCCAGAGTGGTG-3' (обратный праймер, содержащий нуклеотидную последовательность кодирующую пептид F2A);

3. синтез фрагмента кДНК гена LIN28 - позиции в мРНК 100-796- (Homo sapiens lin-28 homolog A (C. elegans)) (регистрационный номер в GeneBank NM_024674.4) размером 775 пар нуклеотидов, содержащего на 5'-конце последовательность F2A-пептида (F2A-KLF4). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hLIN28 F2A5' 5'- GCAGACATTAAACTTTGATTTGCTGAAACTTGCAGGTGATGTAGAGTCAAATCCAGGTCCAGCTCAGCCGACGACCATGGGCTCC-3' (прямой праймер, содержащий нуклеотидную последовательность кодирующую пептид F2A) и hLIN28 3'MluI 5'- CACTTTCTCCAACGCGTCTGCTCCTCAAAACTTCCTG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Mlu I);

4. объединение фрагментов OCT4-F2A и F2A-LIN28 осуществляют методом полимеразной цепной реакции с использованием в качестве матриц перекрывающихся фрагментов OCT4-F2A и F2A-LIN28, а также праймеров hOCT45'NheI и hLIN28 3'MluI. В результате получают фрагмент OCT4-F2A-LIN28, размером 1891 пар нуклеотидов;

5. фрагмент ДНК, кодирующий белок DsRed2, вырезают из плазмиды pDsRed2 (Clontech) эндонуклеазой рестрикции Xba I, клонирован в сайт Xba I, находящийся в полилинкере B плазмиды pIRES (Clontech). В результате получают плазмида pIRES-DsRed2;

6. фрагмент ДНК OCT4-F2A-LIN28 клонируют с помощью набора реагентов pGEM-T Easy Vector Systems (Promega) и штамма E.coli XL-10 Gold;

7. клоны плазмиды pGEM-T Easy со встройками - pGEM-OCT4-F2A-LIN28 последовательности выделяют стандартным методом щелочного лизиса (Maniatis, Т., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual, Cold Sping Harbor Laboratory Press);

8. фрагмент OCT4-F2A-LIN28 вырезают из плазмиды pGEM-OCT4-F2A-LIN28 с помощью эндонуклеазы рестрикции EcoR I и лигируют с плазмидой pIRES-DsRed2 гидролизованной эндонуклеазой рестрикции EcoR I, сайт которой расположен в полилинкере А.

В результате получена плазмида pOL-DsRed2 размером 8714 п.н. (OL=OCT4, LIN28).

На Фиг.1 изображена карта плазмидной генетической конструкции pOL-DsRed2. Фрагмент ДНК кодирующий белки OCT4 и LIN28 встроен в сайт EcoR I в полилинкер А плазмиды pIRES, а ДНК кодирующая DsRed2 встроена в сайт Xba I полилинкера В плазмиды pIRES.

Описание и позиции в нуклеотидной последовательности (п.н., пара нуклеотидов) функциональных элементов генетической плазмидной конструкции pOL-DsRed2 представлены в таблице 1.

Таблица 1
Элемент плазмидной генетической конструкции Позиции в последовательности конструкции, п.н.
p CMV IE - энхансер/промотор цитомегаловируса 1-750
IVS - интрон 890-1022
Промотор РНК-полимеразы T7 1067-1085
Фрагмент ДНК OCT4-F2A-LIN28 1096-2984
IRES - внутренний сайт посадки рибосом 3020-3601
DsRed2- кДНК гена DsRed2 3624-4350
Промотор РНК-полимеразы T3 4396-4418
SV40 poly A - фрагмент содержащий сигнал полиаденилирования мРНК вируса SV40 4429-4651
Ориджин репликации f1 4747-5203
p SV40 - энхансер/ранний промотор вируса SV40 5268-5686
SV40 ori - ориджин репликации вируса SV40 5584-5650
Neo-r - ген устойчивости к неомицину 5731-6526
Синтетический сигнал полиаденилирования 6591-6640
Amp-r - ген устойчивости к ампициллину 7052-7913

Полученная плазмидная генетическая конструкция pOL-DsRed2 построена на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов OCT4 и LIN28 человека, соединенные нуклеотидной последовательностью кодирующей F2A-пептид и кДНК гена, кодирующего флуоресцентный белок DsRed2.

Транскрипция единой мРНК OCT4-F2A-LIN28-IRES-DsRed2 осуществляется с конститутивного промотора p CMV IE, обеспечивающего высокий уровень наработки мРНК.

Наличие последовательностей F2A и IRES позволяет одновременно транслировать белки OCT4, LIN28 и DsRed2 с одной молекулы мРНК.

Фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Плазмидная генетическая конструкция pOL-DsRed2 предназначена для временной или постоянной экспрессии генов OCT4, LIN28 и DsRed2 в культивируемых клетках человека, обеспечивает стабильную экспрессию введенного гена.

Рекомбинантная плазмида pOL-DsRed2 может использоваться в качестве вектора для получения индуцированных плюрипотентных стволовых клеток человека.

Список использованной литературы

1. Takahashi K. and S. Yamanaka. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p.663-76.

2. Takahashi K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 2007. 131(5): p.861-72.

3. Yu J. et al. Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p.1917-20.

4. Okita K. et al. Generation of mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p.949-53.

5. Szymczak A.L. and Vignali D.A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther, 2005. 5(5): p.627-38.

6. Cowan C.A. et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med, 2004. 350(13): p.1353-6.

1. Рекомбинантная плазмида pOL-DsRed2, кодирующая белки ОСТ4 и LIN28 человека и флуоресцентный белок DsRed2, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека, представляющая собой генетическую конструкцию на основе плазмиды pIRES, содержащая следующие конструктивные элементы: фрагмент ДНК, кодирующий белки ОСТ4 и LIN28 человека, включающий последовательность, кодирующую F2A, расположенную между последовательностями ОСТ4 и LIN28, встроен в сайт рестрикции EcoR I в полилинкер А плазмиды pIRES, размер встройки 1888 пар нуклеотидов, и фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, встроенный в сайт ХЬа I полилинкера В плазмиды pIRES; транскрипция полицистронной мРНК OCT4-F2A-LIN28-IRES-DsRed2 осуществляется с конститутивного промотора р CMV IE.

2. Рекомбинантная плазмида pOL-DsRed2 по п.1, где разделение нуклеотидных последовательностей элементами F2A и IRES позволяет экспрессировать три белка с одной плазмиды одновременно.

3. Рекомбинантная плазмида pOL-DsRed2 по п.1, где фрагмент ДНК, кодирующий белки ОСТ4 и LIN28 человека, запускает репрограммирование клеток для получения индуцированных плюрипотентных стволовых клеток человека, а фрагмент ДНК, кодирующий флуоресцентный белок DsRed2, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано для получения рекомбинантных белков в культуре клеток.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантного плазминогена человека, и может быть использовано в медицине для создания новых лекарственных препаратов с антиангиогенным терапевтическим эффектом.

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии, а именно к способу получения клетки СНО, способной продуцировать желаемый полипептид с высоким выходом, клетке, полученной данным способом, способу получения желаемого полипептида, способу количественного увеличения продукции полипептида клеткой СНО с сильной экспрессией переносчика таурина.

Изобретение относится к соединению и его фармацевтически приемлемой соли, предназначенному для использования в качестве противогрибкового средства, в частности терапевтического средства против глубокого микоза.

Изобретение относится к области биотехнологии, конкретно к получению белка, представляющего собой растворимый рецептор, в культуре клеток млекопитающего, и может быть использовано в медицине для получения фармацевтических композиций растворимого рецептора.

Изобретение относится к области биотехнологии, конкретно к продукции терапевтически активных полипептидов с использованием клеток млекопитающих, и может быть использовано для продуцирования полипептида фактора VIII.
Изобретение относится к биотехнологии и представляет собой способ получения композиции на основе белково-минеральных компонентов. .

Изобретение относится к области биотехнологии, конкретно к получению генно-инженерных генетических конструкций для экспрессии рекомбинантного белка лактоферрина человека, и может быть использовано для создания трансгенных животных, несущих ген лактоферрина человека, и получения в промышленных масштабах изоформ рекомбинантного лактоферрина человека.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантного плазминогена человека, и может быть использовано в медицине для создания новых лекарственных препаратов с антиангиогенным терапевтическим эффектом.

Изобретение относится к области биотехнологии, а именно к полипептидам и составу для профилактики или лечения гипертрофии миокарда, применению и способам получения указанных полипептидов.

Изобретение относится к области иммунологии. .

Изобретение относится к области биотехнологии, конкретно к получению рецептора фактора некроза опухоли, и может быть использовано в медицине. .

Изобретение относится к генетике и спортивной медицине. .

Изобретение относится к области биотехнологии, конкретно к получению белков шелка различных насекомых, и может быть использовано в медицине для создания фармацевтически приемлемого носителя.

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии. Получена плазмидная генетическая конструкция pOK-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и KLF4 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид и кДНК гена, кодирующего флуоресцентный белок DsRed2.
Наверх