Рекомбинантная плазмида pad-sm, кодирующая белки sox2 и c-myc человека, являющаяся основой для получения вирулентных аденовирусов, предназначенных для получения индуцированных плюрипотентных клеток человека


 


Владельцы патента RU 2495127:

Учреждение Российской академии наук Институт цитологии и генетики Сибирского отделения РАН (RU)
Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (RU)
Федеральное государственное бюджетное учреждение "Новосибирский научно-исследовательский институт патологии кровообращения имени академика Е.Н. Мешалкина" Министерства здравоохранения Российской Федерации (ФГБУ "ННИИПК им. акад. Е.Н. Мешалкина" Минздрава России) (RU)

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии и биотехнологии. Получена генетическая конструкция pAd-SM, построенная путем гомологичной рекомбинации вектора pAdEasy-1, содержащего основную часть генома аденовируса и плазмиды pAdTrack-CMV, в которую помещены фрагменты кДНК генов SOX2 и C-MYC человека, соединенные нуклеотидной последовательностью, кодирующей Р2А-пептид. Полученная в результате гомологичной рекомбинации плазмида pAd-SM содержит фрагмент SOX2-P2A-C-MYC под контролем конститутивного промотора CMV, что позволяет получать аденовирусные частицы для одновременной доставки генов и экспрессии белков SOX2 и С-MYC в клетках человека. Кроме того, pAd-SM содержит ген, кодирующий флуоресцентный белок EGFP, под контролем промотора CMV, что позволяет отслеживать трансдукцию клеток и элиминацию вирусной ДНК из клетки. Изобретение может быть использовано для получения индуцированных плюрипотентных стволовых клеток человека в клеточной биологии и медицине. 2 з.п. ф-лы, 1 ил.

 

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии и может быть использовано для получения индуцированных плюрипотентных стволовых клеток человека.

Индуцированные плюрипотентные стволовые клетки - это новый тип плюрипотентных клеток, которые могут быть получены из различных типов соматических клеток путем временной сверхэкспрессии определенного набора генов [1-3]. ИПСК близки по своим свойствам эмбриональным стволовым клеткам. Главным из этих свойств является свойство плюрипотентности. Плюрипотентность - это способность давать после дифференцировки производные всех трех примитивных зародышевых листков (эктодермы, мезодермы и энтодермы), то есть, практически все типы клеток, из которых состоит тело взрослого человека. Существуют методы направленной дифференцировки ИПСК в такие типы клеток как кардиомиоциты (клетки сердечной мышцы), гепатоциты (клетки печени), клетки продуцирующие инсулин, нейроны и клетки глии [4]. Данные типы клеток, потенциально, могут быть использованы в терапии заболеваний человека. Кроме того, ИПСК могут быть использованы для моделирования наследственных и приобретенных заболеваний человека [5-8].

На сегодняшний день известно, что ИПСК человека и животных могут быть успешно получены с использованием таких генов, как OCT4, SOX2, KLF4 и C-MYC [1-2]. Однако, на настоящий момент для доставки кДНК генов в соматические клетки с целью получения ИПСК в основном используются рекомбинантные ретро- и лентивирусы [9]. Использование данных векторов для получения ИПСК сопряжено с проблемой интеграции провирусной ДНК в геномы клеток [10]. Интеграция провирусов ретро- и лентивирусов в геном вызывает инсерционный мутагенез, в результате чего может нарушаться работа функциональных генов . Кроме того, реактивация провирусов в дифференцированных производных ИПСК, способна вызывать злокачественное перерождение клеток. Данная проблема существенно ограничивает применение ИПСК в регенеративной медицине и фармакологии.

Поиск способов высокоэффективного получения индуцированных плюрипотентных стволовых клеток (ИПСК) человека без генетической модификации их генома является одной из актуальных задач современной клеточной биологии и медицины.

Одним из возможных способов решения проблемы интеграции чужеродной, векторной ДНК в геномы ИПСК является использование так называемых неинтегрирующихся векторов. Одними из таких векторов являются аденовирусы. Аденовирусы - это ДНК-содержащие вирусы с размером генома около 36 т.п.н., представляющим из себя линейную ДНК, фланкированную длинными концевыми повторами. Основе геномов аденовирусов 2 и 5 серотипов созданы вектора, предназначенные для доставки нуклеотидных последовательностей в различные типы эукариотических клеток (http://www.coloncancer.org/adeasy.htm). Для создания векторов из геномов аденовирусов были удалены гены E1, E3 и E4 (вектор pAdEasy-2), либо E1 и E3 (вектор pAdEasy-1). Для формирования и наработки вирусных частиц на основе векторов pAdEasy-2 и pAdEasy-1 используют специальные трансгенные линии эукариотических клеток способные экспрессировать гены E1 и E4 (ген E3 не нужен для сборки вирусных частиц). Аденовирусные векторы имеют ряд преимуществ: препарат рекомбинантного аденовируса с высоким титром может быть получен в относительно короткий срок, аденовирусы могут заражать широкий спектр типов клеток, в которых затем поддерживается высокий уровень экспрессии трансгена, аденовирусная ДНК с очень низкой частотой встраивается в геном и элиминируется в ряду митотических делений клетки.

Задачей данного изобретения является конструирование на основе вектора pAdEasy-1 рекомбинантной плазмиды, которая является основой для получения вирулентных вирусных частиц и несет кДНК генов SOX2 и C-MYC человека под контролем конститутивного промотора CMV, обеспечивающего транскрипцию этих генов в соматических клетках человека. Для создания плазмиды pAd-SM использовался промежуточный вектор pAdTrack-CMV, в который помещали фрагмент ДНК, состоящий из кодирующих частей генов SOX2 и C-MYC человека объединенных нуклеотидной последовательностью 2А-петида. Данный подход позволил создать конструкцию, обеспечивающую одновременную транскрипцию кДНК генов SOX2 и C-MYC в виде одной бицистронной мРНК, с последующей трансляцией двух отдельных белков. Кроме того, pAdTrack-CMV содержит ген флуоресцентного белка EGFP под контролем промотора CMV.

Плазмида pAd-SM была получена в результате рекомбинации плазмиды pAdTrack-CMV несущей кДНК генов SOX2 и C-MYC и плазмиды pAdEasy-1 в клетках E.coli AdEasier cells (штамм BJ5183 предтрансформированный плазмидой pAdEasy-1).

Реализация изобретения осуществляется следующим образом.

1. Выделяют РНК из клеток известной линии эмбриональных стволовых клеток человека HUES9 [5], и производят синтез кДНК с помощью олиго-(dT) праймеров. Полученную кДНК используют в качестве матрицы для синтеза фрагментов, кодирующих белки;

2. Синтез фрагмента кДНК гена SOX2 (позиции в мРНК 428-1379) (Homo sapiens SRY (sex determining region Y)-box 2) человека, (регистрационный номер в GeneBank NM_003106.2), размером 1023 пар нуклеотидов, содержащего на 3'-конце последовательность P2A-пептида (SOX2-P2A). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hSOX2 5' XbaI 5'-TTTAGTGTCTAGAATGTACAACATGATGGAGACGGAGCTG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Xba I) и hSOX2 P2A 3'5'-TTCTCTTCGACATCCCCTGCTTGTTTCAACAGGGAGAAGTTAGTGGCTCCGCTTCCGGACATGTGTGAGAGGGGCAGTGTGCCGTTAATG-3' (обратный праймер, содержащий нуклеотидную последовательность кодирующую пептид P2A);

3. Синтез фрагмента кДНК гена c-MYC (позиции в мРНК 571-1891) (Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian)) (регистрационный номер в GeneBank NM_002467.4) размером 1397 пар нуклеотидов, содержащего на 5'-конце последовательность P2A-пептида (P2A-c-MYC). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hcMYC P2A 5'5'- GCCACTAACTTCTCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCAATGCCCCTCAACGTTAGCTTCACCAACAGGAAC-3' (прямой праймер, содержащий нуклеотидную последовательность кодирующую пептид P2A) и hcMYC 3' SalI 5'- TTTAGCAGTGGTACGTCGACTTACGCACAAGAGTTCCGTAGCTGTTC-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Sal I);

4. Объединение фрагментов SOX2-P2A и P2A-c-MYC осуществляют методом полимеразной цепной реакции с использованием в качестве матриц перекрывающихся фрагментов SOX2-P2A и P2A-c-MYC, а также праймеров hSOX2 5'XbaI и hcMYC 3' SalI. В результате получают фрагмент SOX2-P2A-c-MYC, размером 2373 пар нуклеотидов;

5. Фрагмент ДНК SOX2-P2A-c-MYC клонируют с помощью набора реагентов pGEM-T Easy Vector Systems (Promega) и штамма E.coli XL-10 Gold;

6. Клоны плазмиды pGEM-T Easy со встройками (pGEM-SOX2-P2A-c-MYC) последовательности выделяют стандартным методом щелочного лизиса (Maniatis, Т., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual, Cold Sping Harbor Laboratory Press);

7. Фрагмент SOX2-P2A-c-MYC вырезают из плазмиды pGEM-SOX2-P2A-c-MYC с помощью эндонуклеазы рестрикции Not I и лигируют с плазмидой pAdTrack-CMV гидролизованной той же нуклеазой рестрикции. В результате получют плазмиду pAdTrack-CMV-SM (SM=SOX2, C-MYC). С помощью полимеразной цепной реакции и секвенирования по Сенгеру определяют ориентацию встройки в плазмиде.

8. Плазмиду pAdTrack-CMV-SM гидролизуют эндонуклеазой рестрикции Pme I, в результате чего образуется линейная молекула. В реакцию берут 4 мкг плазмиды pAdTrack-CMV-SM и 30 ед. эндонуклеазы рестрикции Pme I (New England Biolabs, США), реакцию проводят в объеме 100 мкл, 2 ч, при 37°C. После прохождения реакции Pme I инактивируют нагреванием 65°C, 20 мин. Гидролизованную плазмиду осаждают добавлением 0,1 объема ацетата натрия и 2 объемов 96% этилового спирта с последующем центрифугированием при 10000×g, 15 мин. Осадок дважды промывают 70% этиловым спиртом (с центрифугированием после добавления спирта при 10000×g, 5 мин) и растворяют в 8 мкл бидистиллированной воды.

9. Проводят электропорацию плазмиды pAdTrack-CMV-SM гидролизованной Pme I в электрокомпетентные клетки AdEasier cells (штамм BJ5183 предтрансформированный плазмидой pAdEasy-1), в которых происходит гомологичная рекомбинация между pAdTrack-CMV-SM и pAdEasy-1. Клетки высаживают на агаризованную среду LB содержащую 25 мкг/мл канамицина. Отбирают 10-15 самых мелких колонии, наращивают их в жидкой среде LB содержащей 25 мкг/мл канамицина и выделяют плазмидную ДНК методом щелочного лизиса. Плазмидную ДНК гидролизуют эндонуклеазой рестрикции Pac I. В результате гидролиза должно получаться два фрагмента, один размером более 30 т.п.н., а другой 3 или 4,5 т.п.н. (оба варианта являются пригодными).

10. Один из клонов, дающих правильную картину рестрикции, отбирают и нарабатывают в большом объеме для дальнейшей работы по получению аденовирусных частиц.

На Фиг.1 изображена схема вектора pAd-SM.

Фрагмент ДНК кодирующий белки SOX2 и C-MYC помещен между сайтами Not I. pCMV - промотор цитомегаловируса, pA - сайт полиаденилирования, EGFP - ген кодирующий флуоресцентный белок EGFP, LITR -левый концевой повтор, RITR -правый концевой повтор, Kan-r -ген устойчивости к канамицину, Ori - бактериальный ориджин репликации, Ad5d1,3 - геном аденовируса. серотипа 5 с удаленными генами E1 и E3.

Полученная генетическая конструкция pAd-SM построенная путем гомологичной рекомбинации вектора pAdEasy-1, содержащего основную часть генома аденовируса и плазмиды pAdTrack-CMV, в которую помещены фрагменты кДНК генов SOX2 и C-MYC человека, соединенные нуклеотидной последовательностью кодирующей P2A-пептид. Полученная в результате гомологичной рекомбинации плазмида pAd-SM содержит фрагмент SOX2-P2A-c-MYC под контролем конститутивного промотора CMV, что позволяет получать аденовирусные частицы для одновременной доставки генов и экспрессии белков SOX2 и C-MYC в клетках человека. Кроме того, pAd-SM содержит ген кодирующий флуоресцентный белок EGFP, под контролем промотора CMV, что позволяет отслеживать трансдукцию клеток и элиминацию вирусной ДНК из клетки.

Список использованной литературы

1. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p.663-76.

2. Takahashi, K., et al., Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 2007. 131(5): p.861-72.

3. Yu, J., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p.1917-20.

4. Wu, S.M. and K. Hochedlinger, Harnessing the potential of induced pluripotent stem cells for regenerative medicine. Nat Cell Biol, 2011. 13(5): p.497-505.

5. Park, I.H., et al., Disease-specific induced pluripotent stem cells. Cell, 2008. 134(5): p.877-86.

6. Soldner, F., et al., Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell, 2009. 136(5): p.964-77.

7. Ebert, A.D., et al., Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature, 2009. 457(7227): p.277-80.

8. Dimos, J.T., et al., Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science, 2008. 321(5893): p.1218-21.

9. Yamanaka, S., A fresh look at iPS cells. Cell, 2009. 137(1): p.13-7.

10. Carey, B.W., et al., Reprogramming of murine and human somatic cells using a single polycistronic vector. Proc Natl Acad Sci U S A, 2009. 106(1): p.157-62.

11. Okita, K., et al., Generation of mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p.949-53.

1. Рекомбинантная плазмида pAd-SM, кодирующая белки SOX2 и C-MYC человека, являющаяся основой для получения вирулентных аденовирусов, предназначенных для получения индуцированных плюрипотентных стволовых клеток человека, представляющая собой генетическую конструкцию, построенную путем гомологичной рекомбинации вектора pAdEasy-1, содержащего основную часть генома аденовируса и плазмиды pAdTrack-CMV, включающей фрагмент SOX2-P2A- C-MYC, под контролем конститутивного промотора CMV, встроенный в сайт рестрикции Not I, размер встройки 2360 пар нуклеотидов, где кДНК генов SOX2 и C-MYC, кодирующие белки SOX2 и C-MYC человека, соединены последовательностью, кодирующей Р2А-пептид, и ген, кодирующий флуоресцентный белок EGFP, под контролем промотора CMV.

2. Рекомбинантная плазмида pAd-SM по п.1, где конструктивная основа вектора pAdEasy-1 обеспечивает получение аденовирусных частиц с одновременной доставкой генов и экспрессию белков SOX2, C-MYC и EGFP.

3. Рекомбинантная плазмида pAd-SM по п.1, где фрагмент ДНК, кодирующий белки SOX2 и C-MYC человека, запускает репрограммирование клеток для получения индуцированных плюрипотентных стволовых клеток человека, а фрагмент ДНК, кодирующий флуоресцентный белок EGFP, является маркером трансдукции клеток и последующей элиминации вирусной ДНК.



 

Похожие патенты:

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен способ получения полипептида, включающий культивирование клетки, которая усиленно экспрессирует переносчик бикарбоната и имеет перенесенную ДНК, кодирующую желаемый полипептид, что позволяет клетке продуцировать указанный полипептид, а также соответствующая клетка.

Изобретение относится к соединениям общей Формулы III и их фармацевтически приемлемым солям, где А представляет собой (C1-С6)алкил-O-, фенил-(С1 -С6)алкил-O-; арил, выбранный из фенила, нафтила, и , который возможно замещен 1-3 заместителями, указанными в формуле изобретения; или гетероарил, имеющий четыре или пять атомов углерода и один гетероатом, выбранный из кислорода, азота и серы, который возможно замещен 1-3 заместителями, указанными в формуле изобретения; В представляет собой фенил, возможно замещенный 1-3 заместителями, где заместители выбраны из (С1-С 6)алкила, (С3-С7)циклоалкила, (С 1-С6)алкил-О-, гидрокси, амино и галогено; и R1 и R2 независимо представляют собой (С 1-С6)алкил, фенил-(С1-С6 )алкил-, гидрокси-(С1-С6)алкил, (С 3-С7)циклоалкил, (С2-С6 )алкенил или (С2-С6)алкинил; при условии, что R1 отличается от R2; где абсолютной конфигурацией асимметрического атома углерода, несущего R 1 и R2, преимущественно является R-конфигурация.

Изобретение относится к области биотехнологии, конкретно к получению антител против NR10, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии, а именно к способу получения клетки СНО, способной продуцировать желаемый полипептид с высоким выходом, клетке, полученной данным способом, способу получения желаемого полипептида, способу количественного увеличения продукции полипептида клеткой СНО с сильной экспрессией переносчика таурина.

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии, конкретно к исследованию рецептору, сопряженному с G-белком, и может быть использовано в медицине. .

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии. Получена плазмидная генетическая конструкция pOK-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и KLF4 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид и кДНК гена, кодирующего флуоресцентный белок DsRed2.

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии. Плазмидная генетическая конструкция pSN-ZsGreen построена на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов SOX2 и NANOG человека, соединенные нуклеотидной последовательностью, кодирующей Р2А-пептид и к ДНК гена, кодирующего флуоресцентный белок ZsGreen.

Изобретение относится к области биотехнологии и вирусологии. В настоящем изобретении раскрывается кодон-оптимизированный ген, кодирующий главный капсидный белок L1 вируса папилломы человека, который способен, после трансдукции в клетку дрожжей, к эффективной экспрессии главного капсидного белка L1 вируса папилломы человека.

Изобретение относится к области биотехнологии, конкретно к получению популяции Tr1-клеток, направленных против антигена, ассоциированного с рассеянным склерозом, и может быть использовано в медицине.

Изобретение относится к области медицины, в частности неврологии, и касается фармацевтической композиции, для лечения нейродегенеративных заболеваний, в частности бокового амиотрофического склероза.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано при комплексном лечении пациентов больных раком молочной железы II-IV. .

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для комплексного лечения пациентов с онкологическими заболеваниями. .

Изобретение относится к области медицины, в частности токсикологии и радиологии, к лекарственным средствам на основе антиоксидантных белков и способам их применения.

Изобретение относится к медицине и может быть использовано для профилактики и лечения заболеваний, при которых целесообразна стимуляция эндогенной продукции цитокинов и гемопоэтических факторов. Предложен способ стимуляции эндогенной продукции цитокинов и гемопоэтических факторов, основанный на введении в организм пациента препарата, представляющего собой двуцепочечную геномную фрагментированную ДНК человека с размером фрагментов 200-6000 пар оснований. Препарат применяют в таблетированной форме в количестве 3 таблеток, содержащих 5 мг активной субстанции препарата, ежедневно на протяжении 1-14 дней. Изобретение обеспечивает повышение эффективности стимуляции. 1 н.п. ф-лы, 21 ил.
Наверх