Композиции рекомбинантных антител против рецептора эпидермального фактора роста



Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста
Композиции рекомбинантных антител против рецептора эпидермального фактора роста

 


Владельцы патента RU 2540146:

СИМФОГЕН А/С (DK)

Изобретение относится к биохимии и представляет собой композицию антител для применения в способе лечения злокачественного новообразования у субъекта, который проходил предшествующий курс лечения с применением антитела против EGFR человека, или злокачественного новообразования, являющегося устойчивым или частично устойчивым к лечению по меньшей мере одним другим антителом против EGFR человека, выбранным из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, при этом указанная композиция антител содержит по меньшей мере первую молекулу антитела против EGFR человека и вторую молекулу антитела против EGFR человека и ее использование. Изобретение позволяет осуществить эффективную терапию второй линии рака, не реагирующего на предшествующее лечение. 14 н. и 43 з.п. ф-лы, 47 ил., 19 табл., 25 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к области рекомбинантных антител для применения в противораковой терапии человека.

Уровень техники

Рецептор эпидермального фактора роста (EGFR) играет важную роль в клеточной пролиферации, а также в апоптозе, ангиогенезе и распространении метастазов, процессах, которые являются критическими для развития опухоли (Salomon et al, Crit. Rev. Oncology/Haematology, 19:183-232 (1995); Wu et al, J. Clin. Invest., 95:1897-1905 (1995); Karnes et al, Gastroenterology, 114:930-939 (1998); Woodburn et al, Pharmacol. Therap. 82: 241-250 (1999); Price et al, Eur. J. Cancer, 32A:1977-1982 (1996)). Действительно, исследования показали, что EGFR-опосредованный клеточный рост увеличивается в ряде солидных опухолей, включая немелкоклеточный рак легкого, рак простаты, рак груди и опухоли головы и шеи (Salomon DS et al, Critical Reviews in Oncology/Haematology, 19:183-232 (1995)). Кроме того, в настоящий момент известно, что повышенная активация EGFR на поверхности раковой клетки связана с прогрессированием заболевания, развитием метастатического фенотипа и неблагоприятным прогнозом для раковых пациентов (Salomon DS et al., Critical Reviews in Oncology/Haematology 19:183-232 (1995)).

Кроме того, экспрессия EGFR часто сопровождается продуцированием EGFR-лигандов, среди прочего, TGF-альфа и EGF, экспрессирующими EGFR клетками опухоли, что предполагает участие аутокринной петли в развитии данных клеток (Baselga, et al.(1994) Pharmac. Therapeut. 64: 127-154; Modjtahedi, et al. (1994) Int. J. Oncology. 4: 277-296). Блокирование взаимодействия между такими EGFR-лигандами и EGFR, следовательно, может подавить рост и выживаемость опухоли (Baselga, et al. (1994) Pharmac. Therapeut. 64: 127-154).

EGFR представляет собой мембраносвязанный гликопротеин с молекулярным весом около 170 кДа. EGFR состоит из гликозилированного внешнего лиганд-связывающего домена (621 остаток) и цитоплазматического домена (542 остатка), соединенных коротким 23-аминокислотным трансмембранным линкером. Внеклеточная часть EGFR содержит 25 дисульфидных связей и 12 N-связанных сайтов гликозилирования, и обычно считается, что она состоит из четырех субдоменов. Полученные посредством рентгеноструктурного анализа структуры кристаллов EGFR предполагают, что рецептор принимает как конформацию, связанную с аутоингибированием, которая не может связывать EGF (Ferguson et al, Mol Cell, 2003, vol 11: 507-517), так и активную конформацию, которая может опосредовать связывание лиганда EGF и димеризацию рецептора (Garret et al, Cell 2002, vol 1 10:763-773; Ogiso et al, Cell, 2002, vol 1 10:775-787). В частности, предполагалось, что домен I и домен III обеспечивают аддитивный вклад в формирование сайта высокоаффинного связывания лиганда. Домены II и IV представляют собой богатые цистеином ламинин-подобные области, которые стабилизируют укладку белка и содержат возможную границу димеризации EGFR.

Известно, что EGFR существует в различных конформациях на поверхности клетки, при этом связанная или закрытая конформация встречается наиболее часто. Связанная конформация не может димеризоваться, и, следовательно, является неактивной. Известно, что терапевтическое антитело эрбитукс стабилизирует связанную конформацию путем связывания с доменом III и создания стерических помех рецептору в достижении несвязанного состояния. Однако некоторые рецепторы могут все еще быть способными к принятию несвязанной конформации, связыванию лиганда и димеризации. Моноклональное антитело (mAb) обычно будет эффективным только в связывании с одной из конформаций, и, следовательно, не может быть нацелено на раковые клетки, демонстрирующие другие конформации или раковые клетки, демонстрирующие множество конформаций.

Моноклональные антитела (mAb), нацеленные на лиганд-связывающий домен EGFR, могут блокировать взаимодействие с лигандами EGFR и, одновременно, результирующий внутриклеточный сигнальный путь.

Эрбитукс™ (цетуксимаб) представляет собой рекомбинантное химерное моноклональное антитело человека/мыши, которое специфично связывается с внеклеточным доменом человеческого EGFR. Эрбитукс состоит из Fv-областей мышиного антитела против EGFR с константными областями тяжелой и каппа-легкой цепи человеческого IgG1 и имеет молекулярный вес, приблизительно составляющий 152 кДа. Эрбитукс продуцируется в культуре клеток млекопитающего (мышиной миеломе). Эрбитукс одобрен для лечения пациентов с метастатическим колоректальным раком, опухоли которого экспрессируют EGFR. Кроме того, эрбитукс применяется в комбинации с радиационной терапией для лечения пациентов с плоскоклеточным раком головы и шеи, который не может быть удален хирургическим путем, или в качестве терапии второй линии для плоскоклеточного рака головы и шеи, для которого стандартная, основанная на платине терапия была неудачной.

Вектибикс™ (панитумумаб) представляет собой рекомбинантное человеческое каппа-моноклональное антитело IgG2, которое специфически связывается с человеческим EGFR. Вектибикс имеет молекулярный вес, приблизительно составляющий 147 кДа. Панитумумаб продуцируется в полученных методами генетической инженерии клетках млекопитающих (яичник китайского хомячка). Вектибикс одобрен для лечения пациентов с метастатическим колоректальным раком, опухоли которого экспрессируют EGFR, при прогрессировании заболевания во время или после курсов лечения химиотерапией, включающих применение фторпиримидина, оксалиплатина и иринотекана.

Цетуксимаб, продаваемый фирмой Imclone под торговым наименованием эрбитукс, описан в патенте США 4943533 и WO 96/40210. Панитумумаб, продаваемый фирмой Abgenix под торговым наименованием вектибикс, описан в патенте США 6235883. Залутузумаб (Humax-EGFR) представляет собой еще одно антитело против EGFR, в настоящее время проходящее клиническую разработку. Антитело было разработано Genmab и описано в WO 02/100348 и WO 2004/056847. Цетуксимаб, панитумумаб и залутумумаб связывают один и тот же эпитоп на EGFR.

Нимотузумаб (TheraCIM hR3), описанный в патентах США 5891996 и 6506883, одобрен для лечения рака в ряде стран мира, но не в Европе и США.

Другие моноклональные антитела против EGFR, которые находятся или находились на стадии клинической разработки, включают:

- ICR62, разработанное Институтом исследования рака. Антитело описано в WO 95/20045.

- mAb806, представляющее собой моноклональное антитело, направленное против мутантной формы EGFR (EGFR vIII). Антитело разработано Институтом исследований рака Людвига и описано в WO 02/092771.

- Матузумаб (EMD72000), разрабатываемый Merck-Serono, описан в WO 02/66058. Мышиный предшественник, mAb425, описан в WO 92/15683.

В технике известно, что продолжительное воздействие моноклонального антитела может привести к селекции устойчивых опухолей. Такая ситуация может иметь место у пациентов, получающих длительное лечение моноклональным антителом. При широкомасштабном использовании эрбитукса (от Imclone) и вектибикса (от Abgenix), двух моноклональных антител, связывающих один и тот же эпитоп, существует вероятность, что врачи-клиницисты будут встречаться с опухолями, устойчивыми к данным антителам. Другие моноклональные антитела проходят клинические испытания и могут выйти на рынок в ближайшие годы, среди них Humax-Egfr (залутумумаб от Genmab), который связывает тот же эпитоп, что и эрбитукс и вектибикс. Можно предположить, что опухоль, устойчивая к любому из этих трех моноклональных антител, также будет устойчивой и к двум другим.

Аналогично, могут иметься клинические примеры опухолей, устойчивых к любому другому моноклональному антителу против EGFR, находящемуся в настоящий момент в процессе клинических испытаний: нимотузумабу (YM Biosciences, Куба), матузумабу (Merck KGaA), mAb806 (институт Людвига) и ICR62 (Институт исследования рака).

Полная или частичная устойчивость опухоли к любому из этих моноклональных антител может быть проанализирована с использованием образца, выделенного у пациента, в результате чего будет заранее известно, является ли опухоль устойчивой или нет.

Помимо устойчивости к терапии моноклональным антителом (или рефракторных опухолей), другая проблема при лечении форм рака с экспрессией EGFR заключается в повторном появлении или прогрессировании опухоли после хирургического вмешательства, радиационной терапии и/или медицинского лечения с химиотерапевтическими средствами, ингибиторами тирозинкиназ (TKI) и/или моноклональными антителами. Существует предположение, что повторно появившаяся или прогрессирующая опухоль должна лечиться другим медикаментом, поскольку повторное появление или прогрессирование может быть следствием устойчивости или, по меньшей мере, частичной устойчивости. Таким образом, существует потребность в терапии второй или третьей линии для рака, не реагирующего на предшествующее лечение антителами против EGFR или прогрессирующего после вышеупомянутого предшествующего лечения антителами против EGFR.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Авторы настоящего изобретения обнаружили, что линия раковых клеток, устойчивая к эрбитуксу (цетуксимабу) может эффективно обрабатываться in vitro композицией антител по настоящему изобретению, при этом воздействие вектибикса (панитумумаба) на устойчивую клеточную линию является таким же неэффективным, как и обработка эрбитуксом. Ожидается, что залутумумаб также будет неэффективным против данной клеточной линии. Данные результаты привели к заключению, что композиция антител по настоящему изобретению является эффективной против опухолей, устойчивых к эрбитуксу, вектибиксу и залутумумабу. Таким образом, композиция антител по настоящему изобретению может применяться для лечения пациентов, не имеющих ответа на любой из этих продуктов. Аналогично, композиция антител по настоящему изобретению может применяться для лечения опухолей, которые с самого начала являются устойчивыми к любому из этих моноклональных антител. Устойчивость к моноклональному антителу, такому как эрбитукс, может быть проанализирована in vitro с использованием методов, описанных в примере 21. При этом если линия раковых клеток пролиферирует в среде, содержащей 10 мкг/мл эрбитукса, то она считается частично устойчивой к эрбитуксу. Устойчивость к панитумумабу и залутумумабу может быть проанализирована аналогично.

На основании данных наблюдений авторы также предполагают применение композиции антител по настоящему изобретению для лечения рака, устойчивого или частично устойчивого к любому из других антител против EGFR, которые в настоящий момент находятся в разработке, включая, но не ограничиваясь перечисленным, цетуксимаб, панитумумаб, залутумумаб, нимотузумаб, ICR62, mAb806, матузумаб и антитела, способные связывать тот же эпитоп, что и любое из перечисленных антител.

Результаты были подтверждены исследованием in vivo (Пример 23), в котором агрессивная линия раковых клеток была имплантирована мышам. После первоначального лечения эрбитуксом были отобраны мыши, имеющие частичный ответ, и были подвергнуты продолжительному лечению эрбитуксом или лечению композицией антител по настоящему изобретению. В последнем случае наблюдалось быстрое сокращение размера опухолей, тогда как продолжение лечения эрбитуксом приводило к поддержанию размера опухоли. Предклиническая эффективность достигалась даже несмотря на наличие частичного перекрытия в связывании между эрбитуксом и антителами 1024 и 992 по настоящему изобретению. Таким образом, сразу после переключения с терапии эрбитуксом на терапию 1024/992, в опухолях будет содержаться остаточный эрбитукс, и будет иметь место конкуренция за связывание между эрбитуксом и двумя антителами из композиции по настоящему изобретению, что потенциально может снизить эффективность композиции антител по настоящему изобретению. Однако это не оказало значительного влияния на эффективность терапии 1024/992.

Исследование in vivo также подтвердило (пример 25), что устойчивые к эрбитуксу клетки могут эффективно обрабатываться комбинацией антител по настоящему изобретению. Таким образом, приобретенный механизм устойчивости к эрбитуксу не влияет на эффективность композиции антител по настоящему изобретению.

В заключение, композиция антител изобретения может применяться для лечения рака, являющегося устойчивым или частично устойчивым к моноклональному антителу против EGFR, такому как эрбитукс, и для лечения рака у субъекта, который получил терапию моноклональным антителом против EGFR, таким как эрбитукс, в предшествующем курсе лечения.

На основании идентичности связывания эрбитукса, вектибикса и залутумумаба ожидается, что для этих трех mAb могут быть достигнуты аналогичные результаты. На основании данных наблюдений изобретатели также предполагают применение композиции антител по настоящему изобретению для лечения рака, который ранее подвергался лечению другим моноклональным антителом против EGFR, включая, но не ограничиваясь перечисленным, цетуксимаб, панитумумаб, залутумумаб, нимотузумаб, ICR62, mAb806, матузумаб и антитела, способные связывать тот же эпитоп, что и любое из перечисленных антител. Эффективность такого лечения может быть проверена в предклиническом исследовании, аналогичном исследованию, описанному в примере 23.

Кроме того, изобретатели настоящего изобретения определили, что рецидив роста опухоли после лечения композицией антител по настоящему изобретению может быть успешно устранен с использованием композиции антител по настоящему изобретению. Это было продемонстрировано в предклиническом исследовании, описанном в примере 22. Рецидивирующие опухоли были ликвидированы так же эффективно, как и исходно имплантированные опухоли, что указывает на то, что эти опухоли не были устойчивыми к лечению композицией антител изобретения.

Таким образом, в первом аспекте изобретение относится к композиции антител для применения в способе лечения рака у субъекта, который проходил предшествующий курс лечения с использованием антитела против человеческого EGFR, где указанная композиция антител содержит по меньшей мере 2 отдельных молекулы антител против человеческого EGFR,

a. при этом первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992, антитела, содержащего последовательности VL (аминокислоты 3-109 из SEQ ID (последовательности под идентификатором) No: 72) и VH (аминокислоты 3-124 из SEQ ID No: 40) антитела 992, антитела, имеющего CDR3 антитела 992 (SEQ ID No: 116 и 111), антитела, связывающего тот же эпитоп, что и антитело 992, и антитела, способного ингибировать связывание антитела 992 с человеческим EGFR; и

b. при этом вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 1024, антитела, содержащего последовательности VL (аминокислоты 3-114 из SEQ ID No: 73) и VH (аминокислоты 3-120 из SEQ ID No: 41) антитела 1024, антитела, имеющего CDR3 антитела 1024 (SEQ ID No: 120 и 114), антитела, связывающего тот же эпитоп, что и антитело 1024, и антитела, способного ингибировать связывание антитела 1024 с человеческим EGFR.

В одном из вариантов осуществления вышеупомянутый предшествующий курс лечения включает применение композиции антител, идентичных вышеупомянутой композиции антител.

В другом варианте осуществления вышеупомянутый предшествующий курс лечения включает применение антитела против человеческого EGFR, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител. Предпочтительно, вышеупомянутое антитело против человеческого EGFR выбирают из группы, состоящей из цетуксимаба, панитумумаба и залутумумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител. Более предпочтительно, вышеупомянутое антитело против человеческого EGFR выбирают из группы, состоящей из цетуксимаба и панитумумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител. Более предпочтительно, вышеупомянутое антитело против человеческого EGFR представляет собой цетуксимаб или антитело, способное связывать тот же эпитоп, что и цетуксимаб.

Рак может быть выбран из группы, состоящей из рака головы и шеи, рака толстой кишки, рака груди, рака почки, рака легких, рака яичников, рака простаты, глиомы, рака поджелудочной железы, рака мочевого пузыря, немелкоклеточной карциномы легких (NSCLC), рака желудка, рака шейки матки, гепатоцеллюлярного рака, желудочно-пищеводного рака, колоректального рака, рака прямой кишки, эпителиоидной карциномы, RCC, плоскоклеточной карциномы головы и шеи (SCCHN), рака пищевода, мультиформной глиобластомы, плоскоклеточной карциномы и рака почек, меланомы, карциномы и саркомы, в соответствии с описанным в настоящем документе.

Лечение антителом может являться вспомогательной терапией, следующей за хирургическим вмешательством и/или радиационной терапией.

Лечение может представлять собой комбинационную терапию, включающую лечение химиотерапией и/или по меньшей мере одним ингибитором тирозинкиназы и/или по меньшей мере одним ингибитором ангиогенеза и/или по меньшей мере одним гормоном и/или по меньшей мере одним индуцирующим дифференциацию агентом.

Предшествующий курс лечения может представлять собой терапию первой линии, терапию второй линии или терапию третьей линии.

Терапия первой линии может дополнительно включать курс лечения химиотерапией и/или по меньшей мере одним ингибитором тирозинкиназы и/или по меньшей мере одним ингибитором ангиогенеза и/или по меньшей мере одним гормоном и/или по меньшей мере одним индуцирующим дифференциацию агентом.

Химиотерапия, предпочтительно, включает введение химиотерапевтического препарата, выбранного из группы, состоящей из адриамицина, цисплатина, таксола, доксорубицина, топотекана, фторпиримидина, оксалиплатина и иринотекана.

В некоторых вариантах осуществления изобретения субъект прогрессировал во время или после предшествующего курса лечения. В других вариантах осуществления объект прогрессировал после вышеупомянутого предшествующего курса лечения.

Рак может быть устойчивым или частично устойчивым к предшествующему курсу лечения.

В еще одном аспекте изобретение относится к композиции антител для применения в способе лечения рака, при этом вышеупомянутый рак является устойчивым или частично устойчивым к лечению по меньшей мере одним другим антителом против EGFR, выбранным из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба, и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител; где указанная композиция антител содержит по меньшей мере 2 отдельных молекулы антител против человеческого EGFR,

a. при этом первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992, антитела, содержащего последовательности VL (аминокислоты 3-109 из SEQ ID No: 72) и VH (аминокислоты 3-124 из SEQ ID No: 40) антитела 992, антитела, имеющего CDR3 антитела 992 (SEQ ID No: 116 и 111), антитела, связывающего тот же эпитоп, что и антитело 992, и антитела, способного ингибировать связывание антитела 992 с человеческим EGFR; и

b. при этом вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 1024, антитела, содержащего последовательности VL (аминокислоты 3-114 из SEQ ID No: 73) и VH (аминокислоты 3-120 из SEQ ID No: 41) антитела 1024, антитела, имеющего CDR3 антитела 1024 (SEQ ID No: 120 и 1 14), антитела, связывающего тот же эпитоп, что и антитело 1024, и антитела, способного ингибировать связывание антитела 1024 с человеческим EGFR.

В соответствии с данным аспектом, композиция может применяться для терапии первой линии.

В других вариантах осуществления данного аспекта, композиция применяется для терапии второй линии, следующей после курса лечения, включающего лечение химиотерапией и/или по меньшей мере одним ингибитором тирозинкиназы и/или по меньшей мере одним ингибитором ангиогенеза и/или по меньшей мере одним гормоном и/или по меньшей мере одним индуцирующим дифференциацию агентом. Композиция также может применяться для терапии третьей линии.

Композиция может использоваться в комбинационной терапии вместе с химиотерапией и/или по меньшей мере одним ингибитором тирозинкиназы и/или по меньшей мере одним ингибитором ангиогенеза и/или по меньшей мере одним гормоном и/или по меньшей мере одним индуцирующим дифференциацию агентом.

В некоторых вариантах осуществления, композиция применяется для вспомогательной терапии после хирургического вмешательства и/или радиационной терапии.

Полная или частичная устойчивость предпочтительно определяется путем анализа образца раковых клеток, выделенных из вышеупомянутого субъекта. Данный анализ может включать измерение связывания цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, с раковыми клетками из вышеупомянутого субъекта. Отсутствие связывания указывает на устойчивость к антителу. В качестве альтернативы, полная или частичная устойчивость может быть определена в анализе пролиферации, аналогичном анализу в примере 21.

В других связанных аспектах изобретение относится к

- способу снижения передачи сигналов EGFR,

- способу уничтожения клеток, экспрессирующих EGFR,

- способу индуцирования апоптоза в клетках, экспрессирующих EGFR,

- способу подавления пролиферации клеток, экспрессирующих EGFR,

- способу индуцирования дифференциации клеток опухоли in vivo, и

- способу индуцирования интернализации EGFR,

при этом указанные способы включают введение композиции антител в композицию экспрессирующих EGFR клеток, при этом указанные клетки ранее подвергались воздействию антитела против EGFR, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител соответствует описанной в настоящей заявке.

В других аспектах изобретение относится к

- способу снижения передачи сигналов EGFR,

- способу уничтожения клеток, экспрессирующих EGFR,

- способу индуцирования апоптоза в клетках, экспрессирующих EGFR,

- способу подавления пролиферации клеток, экспрессирующих EGFR,

- способу индуцирования дифференциации клеток опухоли in vivo, и

- способу индуцирования интернализации EGFR,

при этом указанные способы включают введение композиции антител в композицию экспрессирующих EGFR клеток, при этом указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител соответствует описанной в настоящей заявке.

В данных аспектах изобретения композиция антител по настоящему изобретению может представлять собой любую композицию, описанную в настоящем документе. Предпочтительно, композиция антител по настоящему изобретению соответствует описанной в разделе, озаглавленном «предпочтительная композиция антител», то есть, композиции антител, основанной на антителах 1024 и 992, в соответствии с описанным в настоящем документе.

Определения

Термин "антитело" описывает функциональный компонент сыворотки крови и часто относится к множеству молекул (антитела или иммуноглобулин) или к одной молекуле (молекула антитела или молекула иммуноглобулина). Молекула антитела способна к связыванию или реагированию со специфичной антигенной детерминантой (антигеном или антигенным эпитопом), которая, в свою очередь, может привести к индуцированию иммунологических эффекторных механизмов. Отдельная молекула антитела обычно называется моноспецифичной, а композиция молекул антитела может быть моноклональной (то есть, состоящей из идентичных молекул антитела) или поликлональной (то есть, состоящий из двух или более различных молекул антитела, реагирующих с одним и тем же или разными эпитопами на одном и том же антигене или даже на различных антигенах). Каждая молекула антитела имеет уникальную структуру, которая позволяет ей специфически связываться с соответствующим ей антигеном, и все природные молекулы антител имеют одну и ту же общую базовую структуру из двух идентичных легких цепей и двух идентичных тяжелых цепей. Антитела в совокупности также известны как иммуноглобулины. Термины «антитело» или «антитела» при использовании в настоящем документе также предназначены для включения химерных и одноцепочечных антител, а также связывающих фрагментов антител, таких как фрагменты Fab, Fv или фрагменты scFv, а также мультимерных форм, таких как димерные молекулы IgA или пятивалентные IgM. Антитело может быть человеческим, мышиным, химерным, гуманизированным или реорганизованным.

Термин "пара, кодирующая родственные VH и VL" описывает исходную пару последовательностей, кодирующих VH и VL, содержащихся или полученных из одной и той же продуцирующей антитело клетки. Таким образом, пара родственных VH и VL представляет собой парное соединение VH и VL, исходно присутствующее у донора, из которого была получена такая клетка. Термин "антитело, экспрессируемое из пары, кодирующей VH и VL" указывает, что антитело или фрагмент антитела продуцируется из вектора, плазмиды или аналогичной структуры, содержащей последовательность, кодирующую VH и VL. При экспрессировании пары, кодирующей родственные VH и VL, в виде полного антитела или его стабильного фрагмента, они сохраняют связывающую способность и специфичность антитела, исходно экспрессированного из клетки, из которой они были получены. Библиотека родственных пар также называется репертуаром или коллекцией родственных пар, и может храниться отдельно или в виде пула.

Термин "CDR" - участок, отвечающий за комплементарное взаимодействие с антигеном, определен в соответствии с работой Lefranc et al (2003) IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev. Comp Immunol 27, 55-77.

Термины "отдельный элемент рекомбинантного поликлонального белка" обозначают одну молекулу белка из белковой композиции, содержащей различные, но гомологичные молекулы белка, при этом каждая молекула белка гомологична другим молекулам композиции, но также содержит один или более фрагментов вариабельной полипептидной последовательности, который(-ые) характеризуется(-ются) различиями в аминокислотной последовательности между отдельными элементами поликлонального белка.

Термин "промоторы типа голова-к-голове" относится к паре промоторов, помещаемых в непосредственной близости, с тем чтобы транскрипция двух фрагментов генов, управляемая промоторами, происходила в противоположных направлениях. Промотор типа «голова-к-голове» также может быть создан с наполнителем, состоящим из не относящихся к делу нуклеиновых кислот между двумя промоторами. Такой фрагмент-наполнитель легко может содержать более 500 нуклеотидов. Промоторы типа «голова-к-голове» также могут называться двунаправленными промоторами.

Термин "иммуноглобулин" обычно используется в качестве собирательного обозначения смеси антител, обнаруженных в крови или сыворотке крови, но также может использоваться для обозначения смеси антител, полученных из других источников.

Термин "молекула иммуноглобулина" обозначает отдельную молекулу антитела, например, являющуюся частью иммуноглобулина, или частью композиции поликлональных или моноклональных антител.

Термин "библиотека различных представляющих интерес молекул нуклеиновых кислот" используется для описания набора молекул нуклеиновых кислот, которые в совокупности кодируют "представляющий интерес рекомбинантный поликлональный белок". При использовании для трансфекции, библиотека различных представляющих интерес молекул нуклеиновых кислот содержится в библиотеке экспрессионных векторов. Такая библиотека обычно содержит, по меньшей мере, 2, 3, 5, 10, 20, 50, 1000, 104, 105 или 106 различных представителей.

Термин "массовый перенос" используется для описания переноса представляющих интерес последовательностей нуклеиновых кислот из одной популяции векторов в другую популяцию векторов, что выполняется одновременно для каждой ДНК без обращения к выделению отдельной представляющей интерес ДНК. Такие популяции векторов могут представлять собой библиотеки, содержащие, например, представляющие интерес вариабельные области, промоторы, лидерные последовательности или энхансерные элементы. Данные последовательности могут затем быть перемещены без предшествующего выделения, например, из фагового вектора в экспрессионный вектор млекопитающего. В особенности, для последовательностей антител данная методика обеспечивает сохранение связи между многообразием VH и VL при перемещении библиотек, например, из вектора выбора (например, вектора фагового дисплея) в экспрессионный вектор млекопитающего. Таким образом, сохраняется исходное парное соединение VH и VL.

При использовании в настоящем документе, термин "функционально связанный" относится к сегменту, связываемому с другим сегментом в условиях функционального взаимодействия с другим сегментом. Например, ДНК, кодирующая сигнальную последовательность, функционально связана с ДНК, кодирующей полипептид, если она экспрессируются как лидерная последовательность, участвующая в переносе полипептида в эндоплазматический ретикулум. Также промотор или энхансер является функционально связанным с кодирующей последовательностью, если он стимулирует транскрипцию последовательности.

Термин "поликлональное антитело" описывает композицию различных молекул антител, которые способны связываться или реагировать с несколькими различными специфичными антигенными детерминантами на одном и том же антигене или на различных антигенах. Обычно считается, что вариабельность поликлонального антитела концентрируется в так называемых вариабельных областях поликлонального антитела. Однако в контексте настоящего изобретения поликлональность также может пониматься как описание различий между отдельными молекулами антитела, находящимися в так называемых константных областях, например, как в случае смесей антител, содержащих два или более изотипов антител, таких как человеческие изотипы IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2, или мышиные изотипы IgG1, IgG2a, IgG2b, IgG3 и IgA. Для целей настоящего изобретения такое поликлональное антитело также может называться "композицией антител".

Термин "эпитоп" широко используется для описания доли большей по размеру молекулы или части большей по размеру молекулы (например, антигена или антигенного сайта), имеющей антигенную или иммуногенную активность в животном, предпочтительно, млекопитающем, и, наиболее предпочтительно, у человека. Эпитоп, обладающий иммуногенной активностью, является долей большей по размеру молекулы, которая устанавливает выработку антитела у животного. Эпитоп, обладающий антигенной активностью, является долей большей по размеру молекулы, с которой антитело иммуноспецифично связывается, что определяется любым методом, хорошо известным в технике, например, посредством иммунных анализов, описанных в настоящем документе. Антигенные эпитопы не обязательно должны быть иммуногенными. Антиген представляет собой вещество, с которым иммуноспецифично связывается антитело или фрагмент антитела, например, токсин, вирус, бактерия, белки или ДНК. Антиген или антигенный сайт обычно имеет более одного эпитопа, если они не очень маленькие, и часто имеет способность стимулирования иммунного ответа. Эпитопы могут быть линейными или конформационными. Линейный эпитоп состоит из от около 6 до 10 смежных аминокислот в молекуле белка, которые распознаются антителом. В отличие от этого, конформационный эпитоп состоит из аминокислот, которые не расположены последовательно. В этом случае антитело распознает только 3-мерную структуру. При сворачивании молекулы белка в трехмерную структуру аминокислоты, формирующие эпитоп, помещаются рядом друг с другом, что позволяет антителу распознать последовательность. В денатурированном белке может быть распознан только линейный эпитоп. Конформационный эпитоп, по определению, должен находиться с внешней стороны свернутого белка. Антитело, которое распознает конформационный эпитоп, может связываться только при мягких, не приводящих к денатурации процедурах. Антитела, связывающиеся с различными эпитопами на одном антигене, могут иметь различное влияние на активность антигена, который они связывают, в зависимости от размещения эпитопа. Антитело, связывающееся с эпитопом в активном сайте антигена, может полностью блокировать функционирование антигена, тогда как другое антитело, связывающееся с другим эпитопом, может само по себе не иметь влияния или иметь слабое влияние на активность антигена. Такие антитела все же могут, однако, активировать комплементарный участок, что в результате приводит к устранению антигена, и может приводить к синергетическим эффектам при комбинировании с одним или более антителами, связывающимися с различными эпитопами на одном и том же антигене. В настоящем изобретении эпитоп предпочтительно представляет собой часть внеклеточного домена EGFR. Антигены по настоящему изобретению предпочтительно являются белками внеклеточного домена EGFR, их полипептидами или фрагментами, с которыми иммуноспецифично связывается антитело или фрагмент антитела. Ассоциированный с EGFR антиген также может быть аналогом или производным от внеклеточного домена полипептида EGFR или его фрагментом, с которым иммуноспецифично связывается антитело или фрагмент антитела.

Антитела, способные к конкурированию друг с другом за связывание с одним и тем же антигеном, могут связывать одни и те же или перекрывающиеся эпитопы, или могут иметь сайты связывания, расположенные близко друг от друга, в результате чего конкуренция возникает в основном из-за стерического препятствия. Методы определения конкуренции между антителами описаны в примерах.

При использовании в настоящем документе, термин "поликлональный белок" или "поликлональность" относится к композиции белков, содержащей различные, но гомологичные молекулы белка, предпочтительно выбранные из суперсемейства иммуноглобулинов. Таким образом, каждая молекула белка является гомологичной к другим молекулам композиции, но также содержит один или более участков вариабельной полипептидной последовательности, которые характеризуются различиями в аминокислотной последовательности между отдельными элементами поликлонального белка. Известные примеры таких поликлональных белков включают молекулы антитела или иммуноглобулина, рецепторы T-клеток и рецепторы B-клеток. Поликлональный белок может состоять из определенного подмножества белковых молекул, которое было определено по общему свойству, такому как общая связывающая активность с определенной мишенью, например, в случае поликлонального антитела против желаемого целевого антигена.

Под "белком" или "полипептидом" понимается произвольная цепочка аминокислот, независимо от длины или посттрансляционной модификации. Белки могут существовать в форме мономеров или мультимеров, содержащих две или более собранных полипептидных цепей, фрагментов белков, полипептидов, олигопептидов или пептидов.

Термин "RFLP" относится к "полиморфизму длины фрагментов рестрикции", методу, посредством которого подвижный гелевый профиль фрагментов молекулы нуклеиновой кислоты анализируется после расщепления рестрикционными ферментами.

Термин "перемешивание" описывает ситуации, в которых два или более различных элемента поликлонального белка, содержащего две различных полипептидных цепи, например, из суперсемейства иммуноглобулинов, экспрессируются из отдельной клетки. Данная ситуация может возникнуть в случае, когда отдельная клетка имеет более одной пары сегментов генов, интегрированных в геном, при этом каждая пара сегментов генов кодирует отдельный элемент поликлонального белка. В таких ситуациях могут быть получены непредусмотренные комбинации полипептидных цепей, экспрессируемых из сегментов генов. Эти непредусмотренные комбинации полипептидных цепей могут не иметь терапевтического эффекта.

Термин "перемешивание цепей VH-VL" является примером перемешивания, определенного выше. В данном примере сегменты генов, кодирующие VH и VL, составляют пару сегментов генов. Перемешивание происходит в случае, когда непредусмотренные комбинации полипептидов VH и VL продуцируются из клетки, при этом две различных пары сегментов генов, кодирующих VH и VL, интегрированы в ту же клетку. Маловероятно, что такая перемешанная молекула антитела будет сохранять исходную специфичность, и, следовательно, она может не иметь терапевтического эффекта.

Термин "трансфекция" в настоящем документе используется в широком смысле для описания введения чужеродной ДНК в клетку. Также считается, что термин охватывает другие функционально эквивалентные методы введения чужеродной ДНК в клетку, такие как, например, трансформация, инфекция, трансдукция или слияние клетки-донора и клетки-акцептора.

Термины "вариабельная полипептидная последовательность" и "вариабельная область" используются взаимозаменяемо.

Термин "различные эпитопы" означает, что когда два различных антитела связывают различные эпитопы, существует менее чем 100% конкуренция за связывание с антигеном, предпочтительно менее чем 50% конкуренция за связывание с антигеном, более предпочтительно, в основном отсутствует конкуренция за связывание с антигеном. Анализ "различных эпитопов" для пар антител обычно проводится с помощью экспериментов по связыванию, в условиях насыщения антителами, посредством FACS-анализа на клетках, экспрессирующих EGFR, и использования помеченных индивидуальной флуоресцентной меткой антител, или посредством поверхностного плазмонного резонанса с использованием антигена EGFR, захваченного или конъюгированного с поверхностью проточной кюветы, в соответствии с описанным в примерах.

Термин «способность к ингибированию связывания EGF» при применении к одной молекуле антитела означает, что молекула антитела демонстрирует значение IC 50 в отношении EGF, связывающего EGFR, менее чем 10 нМ, предпочтительно, менее чем 8 нМ, более предпочтительно, менее чем 7 нМ, более предпочтительно, менее чем 5 нМ, более предпочтительно, менее чем 4 нМ, более предпочтительно, менее чем 3 нМ, более предпочтительно, менее чем 2 нМ, более предпочтительно, менее чем 2 нМ, более предпочтительно, менее чем 1 нМ.

Термины "рецептор эпидермального фактора роста" "EGFR" и "антиген EGFR" используются взаимозаменяемо в настоящем документе, и включают варианты, изоформы и видовые гомологи человеческого EGFR. В предпочтительном варианте осуществления, связывание антитела изобретения с антигеном EGFR подавляет рост клеток, экспрессирующих EGFR (например, клеток опухоли) путем ингибирования или блокирования связывания лиганда EGFR с EGFR. Термин "лиганд EGFR" охватывает все (например, физиологические) лиганды EGFR, включая, но не ограничиваясь перечисленным, EGF, TGF-альфа, связывающий гепарин EGF (HB-EGF), амфирегулин (AR), херегулин, бета-целлюлин и эпирегулин (EPI). В другом предпочтительном варианте осуществления, связывание антитела изобретения с антигеном EGFR опосредует фагоцитоз эффекторных клеток и/или уничтожение клеток, экспрессирующих EGFR.

Доменная структура EGFR: внеклеточная часть зрелого EGFR (код SwissProt #P00533) состоит из 621 аминокислоты и четырех рецепторных доменов: домен I охватывает остатки 1-165, домен II - остатки 166-312, домен III - остатки 313-481 и домен IV - остатки 482-621 (Cochran et al. 2004 J immunol. Methods 287, 147-158). Предполагается, что домены I и III вносят вклад в формирование высокоаффинных сайтов связывания для лигандов. Домены II и IV являются богатыми цистеином ламинин-подобными областями, которые стабилизируют укладку белка и содержат возможную границу димеризации EGFR.

При использовании в настоящем документе, предполагается, что термин "подавляет рост" (например, в отношении клеток) включает произвольное измеримое снижение пролиферации (увеличения количества клеток) или метаболизма клетки при контактировании с антителом против EGFR по сравнению с ростом тех же самых клеток при отсутствии контакта с антителом против EGFR, например, ингибирование роста культуры клеток, по меньшей мере, на около 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% или 100%.

При использовании в настоящем документе, термины "ингибирует связывание" и "блокирует связывание" (например, в отношении ингибирования/блокирования связывания лиганда EGFR с EGFR) используются взаимозаменяемо и охватывают как частичное, так и полное ингибирование/блокирование. Ингибирование/блокирование связывания лиганда EGFR с EGFR, предпочтительно, снижает или изменяет нормальный уровень или тип клеточной сигнализации, которая имеет место в случае связывания лиганда EGFR с EGFR при отсутствии ингибирования или блокирования. Также предполагается, что ингибирование/блокирование включает произвольное измеримое снижение связывающей способности лиганда EGFR с EGFR при контактировании с антителом против EGFR по сравнению с лигандом, не контактирующим с антителом против EGFR, например, блокирование связывания лигандов EGFR с EGFR, по меньшей мере, на около 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% или 100%.

Термин "рекомбинантное антитело" используется для описания молекулы антитела или нескольких молекул, которые экспрессируются из клетки или клеточной линии, трасфецированной экспрессионным вектором, содержащим кодирующую последовательность антитела, которое в естественном состоянии не ассоциировано с клеткой.

Рак - рак (медицинский термин: злокачественное новообразование) представляет собой класс заболеваний, при которых группа клеток демонстрирует неконтролируемый рост (деление за пределами нормальных границ), инвазию (проникновение и разрушение прилегающих тканей), и, иногда, метастазирование (распространение в другие области тела через лимфу или кровь). Эти три злокачественных свойства рака отличают его от доброкачественных опухолей, которые являются самоограничивающимися, не имеют инвазии или метастазирования. Большинство форм рака образует опухоль, но некоторые, такие как лейкемия, не делают этого. Рак также может называться неопластическим ростом и нарушениями с гиперпролиферацией.

Вспомогательная терапия: лечение, производимое после первичного лечения с целью повышения шансов на излечение. Вспомогательная терапия может включать химиотерапию, радиационную терапию, гормональную терапию или биологическую терапию.

Химиотерапия: лечение низкомолекулярными препаратами.

Радиационная терапия: лечение радиацией.

Терапия первой линии: первое лечение заболевания или состояния. У раковых пациентов терапия первой линии может представлять собой хирургическое вмешательство, химиотерапию, радиационную терапию, терапию антителами или комбинацию данных видов терапии. Также называется первичной терапией и первичным лечением.

Терапия второй линии: лечение, которое выполняется в случае, когда первоначальное лечение (терапия первой линии) не работает или перестает работать.

Терапия третьей линии: лечение, которое выполняется в случае, когда терапия второй линии не работает или перестает работать.

TKI - ингибиторы тирозинкиназ.

Прогрессирование: в медицине, течение заболевания, такого как рак, в процессе которого оно ухудшается или распространяется в организме.

Устойчивый рак: рак, который не отвечает на лечение. Рак может быть устойчивым в начале лечения или может стать устойчивым в течение лечения. Также называется рефракторным раком. В отличие от этого, эффективное лечение вызывает уничтожение опухоли.

Частично устойчивый рак: частично устойчивый рак отвечает на лечение, но лечение не вызывает уничтожения опухоли. При частично устойчивом раке рост опухоли может подавляться частично или полностью, но опухоль не регрессирует или регрессирует только незначительно.

Устойчивость или частичная устойчивость к антителу против EGFR, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb425, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, может наблюдаться у пациента, получающего одно или более антител, или может быть измерено в анализе in vitro, например, путем определения экспрессии EGFR и отсутствия связывания или низкого связывания моноклонального антитела, или путем анализа пролиферации, в соответствии с описанным в примере 21.

ОПИСАНИЕ ФИГУР

Фиг. 1: сортировка спленоцитов (подробнее см. в примере 1). Созданы следующие дискриминационные окна (изображены):

• Дискриминационное окно 1: живые клетки (график FSC/ пропидиум иодид) (левый нижний блок)

• Дискриминационное окно 2: клетки плазмы дискриминируются как CD43-положительные/CD138-положительные (правый нижний блок)

• Дискриминационное окно 3: разделение дубликатов (правый верхний блок)

Фиг. 2: ПЦР мыши - mSymplex™. Мультиплексная ПЦР ОТ с удлинением перекрытий для амплификации родственного соединения генов тяжелой и легкой цепи антитела из одной клетки. Подробнее см. в примере 1.

Фиг. 3: Клонирование мышиного репертуара. Пул ПЦР-продуктов mSymplex™, кодирующих пары генов VH/VL из единичных клеток плазмы, был сплайсирован с геном, кодирующим человеческую каппа-константную легкую цепь путем сплайсинга посредством удлинения перекрытий. Пул генов, кодирующих полные химерные антитела человека-мыши, был вставлен в экспрессионный вектор, после чего следовала вставка кассеты двунаправленных промоторов (2xCMV).

Фиг. 4: Схематическое представление экспрессионного вектора 00-VP-002 для полноразмерного антитела млекопитающего. Amp и Amp pro - ген устойчивости к ампициллину и его промотор; начало pUC - точка начала репликации pUC; CMV, промотор млекопитающего, управляющий экспрессией легкой цепи и тяжелой цепи; IGHV-лидер, геномная лидерная последовательность человеческой тяжелой цепи; H-наполнитель, вставка, которая заменяется на последовательность, кодирующую вариабельную область тяжелой цепи; IGHG1, последовательность, кодирующая константную область тяжелой цепи изотипа G1 геномного иммуноглобулина (последовательность приведена в приложении 2); B-глобин A кролика, последовательность polyA бета-глобина кролика; IGKV-лидер, лидерная последовательность мышиной каппа; L-наполнитель, вставка, которая заменяется на последовательность, кодирующую легкую цепь; SV40-терминатор, терминаторная последовательность вируса обезьяны 40; FRT, целевой сайт распознавания Flp; Neo, ген устойчивости к неомицину; SV40 poly A, сигнальная poly A последовательность вируса обезьяны 40.

Фиг. 5: кластерный анализ различия поглощающей способности при 450-620 нм. Супернатанты кластеризуются по реактивности, в соответствии с указанным номером (от 1 до 4) после номера клона. Темно-серым показано снижение количества метаболически активных клеток, тогда как светло-серым показано увеличение количества метаболически активных клеток. Черным показаны супернатанты, не оказывающие влияние на количество метаболически активных клеток.

Фиг. 6: Степень ингибирования антитела против EGFR с приведенными контрольными антителами, направленными против конкретных доменов EGFR, в соответствии с определенным в конкурентном анализе ELISA. A) Расчет ингибирования. B) оценка ингибирования в соответствии со следующим: 25-49%: умеренная конкуренция (+); 50-74%: сильная конкуренция (++); 75-100%: очень сильная конкуренция (+++). Ячейки, в которых показано значимое ингибирование (50-100%), заштрихованы серым. Эрбитукс и вектибикс показаны с дубликатами (четыре независимых эксперимента) с целью иллюстрации воспроизводимости анализа. Ab2 (225) является мышиным предшественником, приводящим к эрбитуксу.

Фиг. 7: Иллюстрация одного цикла картирования эпитопов, выполненного на аппарате Biacore 3000 SPR, при этом mAb из образца конкурировало за связывание с внеклеточным доменом EGFR с четырьмя различными контрольными антителами.

Фиг. 8: Степень ингибирования антитела против EGFR с приведенными контрольными антителами, направленными против конкретных доменов EGFR, в соответствии с определенным в конкурентном анализе с помощью технологии SPR. A) Расчет ингибирования. B) оценка ингибирования в соответствии со следующим: 25-49%: умеренная конкуренция (+); 50-74%: сильная конкуренция (++); 75-100%: очень сильная конкуренция (+++). Ячейки, в которых показано значимое ингибирование (50-100%), заштрихованы серым. Клон 1229, помеченный *, не связывался в анализе Biacore.

Фиг. 9: Определение кластеров эпитопов в пределах репертуара антител против EGFR посредством конкурентного SPR-анализа пар антител против EGFR. Антитела сгруппированы в соответствии с предполагаемым распознаванием доменов EGFR. Клетки, в которых было обнаружено, что комбинации антител связывают перекрывающиеся эпитопы, что приводит к более чем 50% ингибированию, заштрихованы серым. Клетки, в которых определение не проводилось, закрашены черным. A) Расчет ингибирования. B) оценка ингибирования в соответствии со следующим: 25-49%: умеренная конкуренция (+); 50-74%: сильная конкуренция (++); 75-100%: очень сильная конкуренция (+++).

Фиг. 10: Карты эпитопов для контрольных антител и антител против EGFR, направленных на внеклеточный домен EGFR, в соответствии с определенным посредством анализа на Biacore. A) Карта эпитопов для антител, направленных против домена I или домена I/II внеклеточного домена (ECD) EGFR. B) Карта эпитопов для антител, направленных против домена III ECD EGFR.

Фиг. 11: Исследование одновременного связывания олигоклональной смеси антител, направленных против неперекрывающихся эпитопов на EGFR. A) Последовательное добавление антител против домена III, домена I или с неизвестной специфичностью. Значения ингибирования для образцов единичных mAb, протестированных относительно различных смесей mAb или единичных mAb, показаны в заштрихованных ячейках. Также показаны максимальные значения Усл.ед., использованные для расчета ингибирования. B) Анализ конкуренции для шести различных образцов mAb, направленных против неперекрывающихся эпитопов на EGFR, и смеси антител, содержащей шесть тестируемых антител. Смеси антител, в которых тестируемое антитело не содержалось, использовались в качестве положительного контроля. Значения ингибирования для образцов единичных mAb, протестированных с различными смесями mAb, показаны в заштрихованных ячейках. Также показаны максимальные значения Усл.ед., использованные для расчета ингибирования. C) Соответствующие сенсограммы для анализов из B, иллюстрирующие блокирование антитела и, в некоторых случаях, повышения связывания антитела. D) Тестирование дополнительных антител, направленных против домена I, I/II и с неизвестной специфичностью, по сравнению со смесью из шести антител mAb.

Фиг. 12: Определение опосредованного антителом блокирования лиганда EGF посредством титрации антитела на всей длине EGFR и детектирование связывания биотинилированного лиганда EGF с реагентом стрептавидином-HRP. Эрбитукс, вектибикс и IgG Synagis (паливизумаб) были использованы в качестве положительного и отрицательного контролей, соответственно. После блокирования распознанного эпитопа антитела тестируемыми антителами, степень конкурирования с лигандом EGF визуализировалась путем добавления 0,1 мкг/мл биотинилированного лиганда EGF и вторичного конъюгата стрептавидин-HRP для обнаружения.

Фиг. 13: Влияние предварительной обработки указанными антителами на индуцированное EGF (50 нг/мл) фосфорилирование EGFR в клетках HN5. Антитела (10 мкг/мл), обозначенные на графике, инкубировались с клетками в течение 30 минут до добавления EGF в течение 7,5 минут. Множества данных, помеченные *, значимо отличались от контрольного ((-)ctrl) множества данных (p<0,05). A. 1208 обладало значительным защитным эффектом против фосфорилирования EGFR. B. 1277 и 1320 в значительной степени защищали от индуцированного EGF фосфорилирования. Величина ошибки представляет собой стандартные отклонения для трех независимых экспериментов.

Фиг. 14: Вестерн-анализ в клетке фосфорилированного EGFR (pEGFR) и EGFR в клетках HN5. 'Mix' обозначает эквимолярную смесь антител 992, 1030 и 1042 до итоговой концентрации 10 мкг/мл, другие антитела использовались в концентрации 10 мкг/мл каждое. 50 мкг/мл EGF было добавлено за 7,5 минут до фиксации с целью стимулирования фосфорилирования EGFR. Величина ошибки представляет собой стандартные отклонения для 6 отдельных (ctlr-), или 3 отдельных точек данных (992, 1030, 1042, mix или эрбитукс). 992, 1030, mix и эрбитукс имели значимый защитный эффект (*=p<0,05) против фосфорилирования.

Фиг. 15: Влияние инкубирования антител на интернализацию EGFR. Данные показаны в виде процента рецепторов, удаленных с клеточной поверхности, по отношению к первоначальному окрашиванию. Величина ошибки соответствует стандартной ошибке среднего (SEM).

Фиг. 16: Кривые роста клеток A431-NS в присутствии изменяющихся концентраций антител 992, 1030 и 1042 и их смесей, в соответствии с измеренным по проценту метаболически активных клеток по сравнению с необработанным контролем. 1001 является нефункциональным антителом с аналогичным изотипом, использованным в качестве отрицательного контроля.

Фиг. 17: Кривые роста клеток A431-NS в присутствии 10 мкг/мл антител 992, 1030 и 1042 и их смесей, и при изменяющихся концентрациях лиганда EGFR EGF, в соответствии с измеренным по поглощению при 450 нм. 1001 является нефункциональным антителом с аналогичным изотипом, использованным в качестве отрицательного контроля.

Фиг. 18: Кривые роста клеток A431-NS в присутствии изменяющихся концентраций антитела 992 и смесей 992 с антителами с неперекрывающимися эпитопами, присутствующими в домене I, II или III. 1001 является нефункциональным антителом с аналогичным изотипом, использованным в качестве отрицательного контроля.

Фиг. 19: Апоптоз в клетках A431 NS. Смешанные с EGFR отдельные моноклональные антитела, эрбитукс и вектибикс, тестировались при 10-кратном разбавлении. Комплекс гистон-ДНК из апоптозных клеток был измерен с использованием набора для ELISA фирмы Roche.

Фиг. 20: Четырем группам из 10 мышей Balb/C Nu/Nu без волосяного покрова было привито 1x106 клеток A431 NS. Когда опухоли составляли приблизительно 100 мм3, начиналось лечение. Группам инъецировались антитела в концентрации 1 мг/мл пять раз в течение эксперимента, что показано стрелками. Диаметры опухолей измерялись цифровыми микрометрами. Результаты показаны для среднего объема опухолей (+/-SEM).

Фиг. 21: После умерщвления мышей в эксперименте, показанном на Фиг. 20, опухоли вырезались и взвешивались. Показаны средние значения +/-SEM. Звездочками показана значимость на уровне P<0,05.

Фиг. 22: Рост сфероидов A431-NS в присутствии 10 мкг/мл антитела 1001, эрбитукса, вектибикса и смеси трех антител с неперекрывающимися эпитопами 992+1030+1042. 1001 является нефункциональным антителом с аналогичным изотипом, использованным в качестве отрицательного контроля.

Фиг. 23: Последовательности ДНК (SEQ ID No: 100) и белка (SEQ ID No: 101) внеклеточного домена EGFR яванского макака, клонированного из кДНК, полученной из эпидермиса кожи яванского макака.

Фиг. 24: Выравнивание полученной белковой последовательности ECD EGFR яванского макака (SEQ ID No: 101) с человеческим ECD EGFR (SEQ ID No: 108), полученным из GENBANK под идентификатором X00588. Также показана консенсусная последовательность (SEQ ID No: 109).

Фиг. 25: Пример разделения с помощью анализа ELISA между обладающими перекрестной реактивностью и специфичными для вида антителами, связывающими ECD EGFR человека, яванского макака, или обоих.

Фиг. 26: Микрофотография типичных срезов опухолей для каждой из четырех экспериментальных групп подвергавшихся ксенотрансплантации мышей. При 200-кратном увеличении, стрелки указывают на очаги конечной дифференцировки клеток A431 in vivo. Следует отметить заметно большие и многочисленные очаги конечной дифференцировки в опухоли, обработанной смесью трех клонов против EGFR (992+1030+1042), в двух верхних блоках.

Фиг. 27: A) Полученные при 40-кратном увеличении изображения сфероидов HN5 через 24 часа после добавления 10 мкг/мл контрольного антитела (ритуксимаб, против CD-20) или смеси антител 992 и 1024 против EGFR. B) Количественный анализ площади, покрываемой клетками, с применением программного обеспечения Image J (* p<0,01).

Фиг. 28: Диаграмма, показывающая уровни инволюкрина в четырех подвергавшихся лечению группах в виде процента от не подвергавшейся лечению контрольной группы (*#¤ p<0,005 по сравнению с эрбитуксом, вектибиксом и группой отрицательного контроля, соответственно).

Фиг. 29: A) Полученные при 60-кратном увеличении изображения клеток HN5 и A431 NS, инкубированных с 10 мкг/мл помеченным Alexa-488 эрбитуксом или 992+1024 в течение 2 часов. B) Полученные при 60-кратном увеличении изображения через диафрагму малого сечения для клеток A431 NS, инкубированных с 10 мкг/мл помеченным Alexa-488 эрбитуксом или 992+1024 в течение 2 часов.

Фиг. 30: A) Полученные при 60-кратном увеличении изображения клеток HN5, инкубированных с 10 мкг/мл помеченным Alexa-488 эрбитуксом или 992+1024 в течение указанных периодов времени.

Фиг. 31: Определение специфичности презентации антигена для Fab 992, 1024 & 1030 посредством последовательного титрования антитела на клетках A431-NS и на очищенном полноразмерном EGFR в анализе ELISA. Связанные Fab-антитела визуализировались вторичным Fab-специфичным HRP-конъюгатом козьего антитела против человека. A) Fab-антитела, протестированные относительно очищенного полноразмерного EGFR из клеток A431. B) Fab-антитела, протестированные против EGFR, экспрессированного на поверхности клеток A431-NS.

Фиг. 32: Определение функциональной аффинности IgG- и Fab-фрагментов антител 992, 1024, 1030, эрбитукса & вектибикса посредством последовательного титрования на фиксированных в параформальдегиде клетках A431-NS в анализе ELISA. Связанные Fab и IgG-антитела визуализировались вторичным Fab-специфичным HRP-конъюгатом козьего антитела против человека. F-антитело Synagis против RSV-белка было использовано в качестве антитела отрицательного контроля, и не показало наличия связывания в проведенном ELISA-анализе. A) Функциональное связывание IgG-антител с клетками A431-NS. B) Функциональное связывание Fab-антител с клетками A431-NS.

Фиг. 33: Определение повышения связывания IgG с EGFR на клетках A431-NS после предшествующего насыщения рецептора Fab-фрагментами, связывающими неперекрывающиеся эпитопы. Указанные Fab-фрагменты насыщали распознанный EGFR-эпитоп на клетках A431-NS в течение 30 минут, после чего IgG-антитела последовательно титровались, и связанные IgG с добавлением или без добавления Fab визуализировались с помощью вторичного HRP-конъюгата мышиного антитела против Fc человека. A) Характеристики связывания IgG 992 с клетками A431-NS с проведением или без проведения предшествующего насыщения рецептора указанными Fab-фрагментами. B) Характеристики связывания IgG 1024 с клетками A431-NS с проведением или без проведения предшествующего насыщения рецептора указанными Fab-фрагментами. C) Характеристики связывания 1030 с клетками A431-NS с проведением или без проведения предшествующего насыщения рецептора указанными Fab-фрагментами.

Фиг. 34: Полноразмерная кДНК-копия EGFR яванского макака (Фиг. 34A; SEQ ID No: 102) и кодируемый белок (Фиг. 34B; SEQ ID No: 103).

Фиг. 35: Апоптоз, полученный в A431 NS с 1 мкг/мл указанных антител/комбинаций. Комплексы гистон-ДНК детектировались с использованием набора для ELISA фирмы Roche. Уровни апоптоза были получены относительно положительного контроля (максимального апоптоза).

Фиг. 36: Мышам Balb/C nu/nu было инъецировано 1x106 клеток A431 NS. Когда опухоли составляли приблизительно 100 мм3, начиналось лечение. Мыши получали 17 инъекций антитела. Первое лечение начиналось на 8 день и заканчивалось на 34 день. Антитело/композиции инъецировались в объеме 0,5 мг/доза или 0,17 мг/доза. Показаны средние значения объема опухолей +/-SEM.

Фиг. 37: Подавление пролиферации A431 NS. На оси X показаны различные типовые комбинации 3 антител изобретения. На оси Y показана метаболическая активность в виде процентной доли от необработанного контроля (контроль). Величины ошибок представляют +/-SEM. Подробнее см. в примере 6.

Фиг. 38: Эффект подавления роста для двух различных доз смеси 992+1024 по сравнению с эрбитуксом в ксенотрансплантатах A431 NS опухоли человека. Мышам BALB/c nu/nu было привито 106 клеток A431 NS. При достижении опухолями среднего размера в 100 мм3 (день 8) мыши случайным образом распределялись в группы по 9, и начиналось лечение. Указанные антитела были инъецированы в объеме 0,5 мг/доза или 1 мг/доза, два раза в неделю, при этом было сделано 9 инъекций. Светло-серая область на графике указывает период лечения. Начало точечного пунктира обозначает временную точку, в который первая мышь в заданной группе подвергалась эвтаназии по причине чрезмерного размера опухоли. Статистически значимые различия между 2 мг/неделю 992+1024 и 2 мг/неделю эрбитукса, и 1 мг/неделю 992+1024 и 2 мг/неделю эрбитукса были рассчитаны на 60 день, до которого все группы кроме группы с 2 мг/неделю 992+1024 были завершены. Таким образом, размеры опухолей у животных, исключенных до 60 дня, были продолжены; на графике показан накопленный объем опухоли для всех мышей в заданной группе. Показаны средние значения +/-SEM.

Фиг. 39: График Каплан-Мейера для выживания мышей, подвергавшихся лечению смесью антител 992+1024, эрбитуксом или контрольным антителом (тот же эксперимент, что и показанный на Фиг. 38). Результаты представлены в виде процента выживаемости для подвергавшихся лечению мышей. Значимое различие между процентом выживания мышей в группе высокой дозы (2 мг/неделю, P=0,0008)) и низкой дозы (1 мг/неделю, P=0,0004) наблюдалось при сравнении 992+1024 и эрбитукса. Также, низкая доза 992+1024 была значимо лучше при сравнении с высокой дозой эрбитукса (P=0,0087). Статистическое расхождение было рассчитано с использованием логарифмического рангового критерия (Мантела-Кокса).

Фиг. 40: Анализ перекрестной реактивности IgG 992, 1024 & 1320 против полноразмерных EGFR человека и яванского макака, трансфицированных в клетки CHO, посредством FACS-анализа. Связанное антитело детектировалось с PE-помеченным козьим F(ab')2 против человеческого IgG FC. Установка дискриминационного окна выполнялась на единообразных клетках (свойства SCC/FCS), экспрессирующих EGFR. Связывание выражено в % от максимального связывания антитела при концентрации 1 нМ.

Фиг. 41: полученное с помощью Clustalw2 выравнивание аминокислотных последовательностей вариабельных областей мышиных (chi) и гуманизированных (hu) вариабельных областей - кандидатов для тяжелой и легкой цепей 992 (A) и 1024 (B). CDR области, определенные в соответствии с IMGT, подчеркнуты; разрывы обозначены (-), идентичные аминокислоты - (*), консервативные мутации как (:), полуконсервативные - (.). Выделенные жирным аминокислоты указывают позиции, в которых будут выполнены обратные мутации к исходно идентифицированным мышиным остаткам, если варианты с полностью человеческим каркасом продемонстрируют пониженную связывающую способность. Номера идентификаторов последовательностей следующие: гуманизированное 992 VH (SEQ ID No: 104). Гуманизированное 992 VL (SEQ ID No: 105). Гуманизированное 1024 VH (SEQ ID No: 106). Гуманизированное 1024 VL (SEQ ID No: 107). Химерное 992 VH (аминокислоты 3-124 из SEQ ID No: 40). Химерное 992 VL (аминокислоты 3-109 из SEQ ID No: 72). Химерное 1024 VH (аминокислоты 3-120 из SEQ ID No: 41). Химерное 1024 VL (аминокислоты 3-114 из SEQ ID No: 73).

Фиг. 42A: Схематическое изображение двойных кодирующих вариабельный домен генов для 992L1024; 992L1024 IGHV (751 п.н. -пар нуклеотидов) представлено от 5'-сайта рестрикции AscI, после которого следует 992 IGHV, линкер ASTKGP, 1024 IGHV, и с окончанием в 3'-сайте рестрикции XhoI, 992L1024 IGKV (1071 п.н.) представлено от 5'-сайта рестрикции NheI, после которого следует 992 IGKV, линкер TVAAP, 1024 IGKV, IGKC, и с окончанием в 3'-сайте рестрикции NotI.

Фиг. 42B: Схематическое изображение двойных кодирующих вариабельный домен генов для 1024L992; 1024L992 IGHV (751 п.н.) представлено от 5'-сайта рестрикции AscI, после которого следует 1024 IGHV, линкер ASTKGP, 992 IGHV, и с окончанием в 3'-сайте рестрикции XhoI, 1024L992 IGKV (1071 п.н.) представлено от 5' 5'-сайта рестрикции NheI, после которого следует 1024 IGKV, линкер TVAAP, 992 IGKV, IGKC, и с окончанием в 3'-сайте рестрикции NotI.

Фиг. 43: Метаболическая активность клеток HN5 дикого типа в 0,5% FBS (вверху) и устойчивых к эрбитуксу клеток HN5 (внизу) в присутствии изменяющихся концентраций указанного антитела. Подпись: антитела 992 и 1024 определены в соответствии с настоящей заявкой. Sym004 является композицией антител с антителами 992 и 1024.

Фиг. 44: Кривые роста опухолей отдельных опухолей A431 NS после начальной обработки 1 мг композиции антител с антителами 992+1024 с общим количеством инъекций, равным 9 (левый серый прямоугольник). Все опухоли отвечали на терапию, но более чем через 80 дней после обработки три опухоли снова начали расти. Повторная обработка опухолей композицией антител с антителами 992+1024 индуцировала регрессию опухоли (серые прямоугольники справа).

Фиг. 45: Мыши BALB/c nu/nu с ксенотрансплантатом опухолей A431 NS подвергались предварительному лечению эрбитуксом, и затем разделялись на случайные группы для продолжения лечения эрбитуксом или переключения на лечение композицией антител с антителами 992+1024 (Sym004 в подписи к Фигуре), когда опухоли имели средний размер, составлявший приблизительно 500 мм3. Значительное сокращение опухолевой массы было замечено в группе, переключенной на лечение композицией антител с антителами 992+1024, по сравнению с группой, в которой продолжалось лечение эрбитуксом.

Фиг. 46: Метаболическая активность клонов HN5, устойчивых к эрбитуксу, в 0,5% FBS в присутствии изменяющихся концентраций указанных антител.

Фиг. 47: Рост ксенотрансплантатов опухоли устойчивого к эрбитуксу клона #7 HN5, обработанного 50 мг/кг Sym004 или эрбитуксом. На графике показана стандартная ошибка среднего.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Смеси антител

Изобретение относится к композиции антител для применения в способе лечения рака у субъекта, который подвергался предшествующему курсу лечения, включающему применение антитела против человеческого EGFR, или у которого вышеупомянутый рак является устойчивым или частично устойчивым к лечению по меньшей мере одним другим антителом против EGFR, и вышеупомянутая композиция антител содержит по меньшей мере 2 различных молекулы антитела против человеческого EGFR. В настоящем изобретении по меньшей мере 2 различных антитела против человеческого EGFR связываются с неперекрывающимися эпитопами. Отсутствие перекрытия в природе антител предпочтительно определяется с использованием помеченных различным образом антител в FACS-анализе с экспрессирующими EGFR клетками или посредством применения поверхностного плазмонного резонанса с использованием антигена EGFR, захваченного или конъюгированного с поверхностью проточной кюветы. Также могут быть использованы основанные на ELISA методы, в соответствии с описанным в примерах. Композиция, связывающая два или более неперекрывающихся эпитопа EGFR, может быть применена против широкого диапазона EGFR-зависимых типов рака, поскольку она может быть менее чувствительной к различиям в конформации EGFR и менее чувствительной к мутациям по сравнению с композицией моноклональных антител, нацеленных на один или два эпитопа. Кроме того, композиция антител, связывающая два или более неперекрывающихся эпитопа EGFR, может обеспечивать превосходящую эффективность по сравнению с нацеливанием только на один эпитоп. В частности, композиция антител может обеспечивать превосходящую эффективность в отношении конечной дифференцировки раковых клеток in vivo. При терапии моноклональным антителом против EGFR определенная доля пациентов может не отвечать эффективным образом на лечение антителом. У некоторых пациентов это может происходить по причине быстрого вывода антитела, или по причине того, что антитело продуцирует у пациента иммунный ответ против антитела. У некоторых пациентов недостаточный ответ может иметь место потому, что их конкретный EGFR-зависимый рак экспрессирует EGFR в конформации, в которой моноклональное антитело не может связать его эпитоп. Это может происходить из-за различий в гликозилировании, по причине удаления домена или из-за мутаций и/или SNP.

Также в некоторых формах рака аутокринная EGFR-стимуляция, вызванная продуцированием лиганда раковыми клетками, является важной, тогда как в других случаях EGFR, экспрессируемый раковыми клетками, не нуждается в стимуляции лигандом. В последнем случае антитело, способное ингибировать связывание лиганда, может быть неэффективным.

Композиция антител, в которой антитела способны связывать по меньшей мере два различных эпитопа на EGFR, будет иметь более широкое применение, поскольку снижается вероятность того, что оба эпитопа изменятся по сравнению с эпитопами, распознаваемыми антителами. Кроме того, вероятность того, что все антитела будут выведены пациентом, намного меньше. Превосходство было показано яснее относительно индуцирования конечной дифференцировки раковых клеток с использованием двух антител с неперекрывающимися эпитопами домена III. Такая эффективная индуцируемая антителом конечная дифференцировка раковых клеток не была показана ранее и представляет собой значительный шаг вперед в разработке эффективных форм терапии рака, основанных на использовании антител. Более поздние результаты показали, что аналогичные или даже превосходящие результаты могут быть получены для конкретной комбинации двух антител.

В целях повышения клинической эффективности и более широкого применения против широкого диапазона EGFR-зависимых типов рака, количество антител в композиции может быть увеличено. Таким образом, композиция может содержать антитела, способные связывать три неперекрывающихся эпитопа. Композиция может содержать антитела, способные связывать четыре неперекрывающихся эпитопа. Композиция может содержать антитела, способные связывать пять неперекрывающихся эпитопов. Композиция может содержать антитела, способные связывать шесть неперекрывающихся эпитопов. Примеры в настоящей заявке показывают, что по меньшей мере шесть различных антител могут одновременно связываться с EGFR (пример 3). Это не исключает того, что является возможным или даже полезным разработка композиции, содержащей антитела, способные связывать более чем шесть, например, семь или восемь неперекрывающихся эпитопов, путем тщательного подбора антител.

Использование антител с перекрывающимися эпитопами может давать преимущества, поскольку это повышает вероятность связывания эпитопа. Одним из объяснений этого является то, что эпитоп у некоторых пациентов и/или в некоторых раковых клетках может быть изменен по причине конформационных изменений, или мутаций, или SNP. Хотя это может повлиять на связывание одного из антител, это может не повлиять на связывание другого антитела, связывающего перекрывающийся эпитоп. Кроме того, существует риск того, что одно из антител будет выведено пациентами, поскольку оно будет принято за антиген. Путем использования двух антител, связывающих различные, но перекрывающиеся эпитопы, уменьшаются последствия выведения одного из двух антител и последствия мутации в эпитопе.

Превосходящие результаты были получены для специфичных комбинаций антител, способных связывать два неперекрывающихся эпитопа EGFR. Такие предпочтительные композиции "двух антител" подробнее описаны ниже вместе с руководством, относящимся к тому, каким образом следует создавать композиции антител изобретения. Оказалось, что, по сравнению с композицией из трех антител, содержащей антитела 992, 1030 и 1042, аналогичная или даже более высокая эффективность могла быть получена при использовании композиции только из двух антител: 992 и 1024. Поскольку антитела 1024 и 1042 принадлежат к одному и тому же кластеру, и, следовательно, обладают одной и той же специфичностью связывания, то, фактически, результаты, наблюдаемые для композиции из трех антител, включая влияние на конечную дифференцировку, могут быть приписаны только двум из специфичностей связывания (992 и 1024/1042) в композиции.

Антитела композиции могут представлять собой химерные антитела с нечеловеческими вариабельными цепями и человеческими константными цепями. Нечеловеческие вариабельные цепи могут быть получены из мыши, крысы, овцы, свиньи, курицы, не являющихся человеком приматов или другого подходящего животного. В целях получения полностью человеческих антител, антитела могут быть созданы в трансгенном животном с генами человеческих антител. Антитела могут также представлять собой так называемые гуманизированные антитела, в которых нечеловеческие последовательности CDR были пересажены в каркасные последовательности человека.

Предпочтительно, человеческая константная цепь относится к изотипу IgG1 или IgG2. Более предпочтительно, все антитела в композиции имеют один и тот же изотип в целях облегчения производства. Однако может иметь преимущества включение в композицию антител различных изотипов.

Предпочтительно, композиции антител изобретения содержат антитела, способные связываться с EGFR, выбираемым из группы, состоящей из человеческого EGFR, мутированного человеческого EGFR и делеционных вариантов человеческого EGFR. Предпочтительно, антитела способны связывать EGFR и человека, и не являющегося человеком примата, в результате чего они могут быть протестированы в соответствующих токсикологических исследованиях до начала клинических экспериментов. Предпочтительно, не являющийся человеком примат является яванским макаком (Macaca fascicularis).

С целью поддержки вышеуказанной концепции лечения EGFR-зависимого рака с применением антител, связывающих два или более различных эпитопов, авторы настоящего изобретения идентифицировали, изготовили и охарактеризовали серии химерных антител мыши/человека, направленные против EGFR. Данные химерные антитела сравнивались, по отдельности или в смесях, с самыми современными моноклональными антителами, примеры которых включают эрбитукс™ и вектибикс™.

В таблице 1 показано краткое описание отдельных химерных антител и ассоциированных с ними свойств. Номер антитела представляет собой идентификационный номер, используемый на всем протяжении настоящей заявки. «Специфичность» - это домен EGFR, с которым антитело связывается, что доказывается в примере 3. «deltaEGFR» представляет собой способность антитела связываться с мутантом EGFR (EGFRvIII), в соответствии с описанным в пример 1. Столбец «EGFR яванского макака» описывает способность антитела связывать EGFR яванского макака (пример 10). «Ингибирование EGF» показывает способность антитела ингибировать связывание EGF (пример 4). «Пролиферация» - способность антитела подавлять пролиферацию линий раковых клеток, A431 и HN-5 (пример 6).

Таблица 1
Антитела изобретения
Номер антитела Специфич-ность DeltaEGFR EGFR яванского макака Ингибирование EGF Пролиферация
992 Домен III нет/ слабая да да/ слабая да
1030 Домен III да да да да
1024 Домен III да да да
1042 Домен III слабая да (да) да
1277 Домен III да да да HN5
1254 Домен III да да да HN5
1208 Домен III да да да да HN5+/-992
1320 Домен III слабая нет да да
1257 Домен I/II нет да нет да
1261 Домен I нет да нет да
1229 Не домен I/II да нет нет да (А431)
1284 Домен I нет да да да
1344 Домен I/II нет да не определялось HN5 w/992
1260 Домен I/II нет да A431
1308 Домен I нет да не определялось HN5 w/992
1347 Домен I нет да не определялось HN5 w/992
1428 Домен I и II нет да да HN5 w/992

На основании данных, полученных для химерных антител, протестированных отдельно и совместно с анализами пролиферации, связывания, деградации/инактивации рецептора и подвижности, а также в модельных животных, может быть сделан ряд выводов.

Результаты, полученные для двух линий раковых клеток, HN-5 и A431 (Пример 6), были повторены с различными линиями раковых клеток (MDA-MB-468 - линия клеток рака груди; DU 145 - линия клеток рака простаты). На основании этих экспериментов становится очевидным, что антитела, представленные авторами настоящего изобретения, демонстрируют эффективность против широкого диапазона линий раковых клеток, что подтверждает эффективность композиций антител против ряда конформаций EGFR.

Также было показано, что превосходство смеси антител выше в анализах пролиферации, в которых физиологические концентрации лиганда (EGF) были добавлены в среду роста, чем когда EGF не был добавлен (Фиг. 17). Согласно литературе (Hayashi and Sakamoto 1998 J Pharmacobiodyn 11; 146-51), сыворотка крови содержит приблизительно 1-1,8 нг/мл или 0,2-0,3 нМ EGF, тогда как сообщалось, что желудочный сок содержит 0,3 нг/мл (приблизительно 0,05 нМ) (Pessonen et al. 1987 Life Sci. 40; 2489-94). В окружении in vivo вероятно наличие EGF и других лигандов EGFR, и, следовательно, эффективность смеси антител в присутствии лиганда EGFR является важным свойством смесей антител по настоящему изобретению.

Химерные антитела мыши/человека по настоящему изобретению обеспечивают улучшенные результаты при использовании в комбинации, чем при использовании по отдельности. Примеры этого приведены в нескольких экспериментах (см., например, Пример 6), в которых антитела при тестировании по отдельности продемонстрировали только умеренное противопролиферационное влияние на линию раковых клеток (A431-NS), но при использовании в любой комбинации показали значительно превосходящие результаты. Эти результаты были подтверждены для многочисленных комбинаций химерных антител по настоящему изобретению. Особенно превосходящие результаты были получены для композиции, содержащей 992 и 1024.

Например, несколько антител было протестировано в противопролиферационном анализе с A431-NS и HN-5 вместе с одним из антител 992, 1208, 1254 и 1277.

Исследования связывания рецептора показали, что некоторые антитела действительно могут стимулировать связывание других антител, в результате чего конкретное антитело связывается с рецептором в больших количествах после насыщения рецептора одним или несколькими антителами. Связывание антитела 992, направленного против домена III, явно получает преимущества от такого синергетического эффекта, полученного посредством предварительного насыщения рецептора одним или более антителами, связывающими неперекрывающиеся эпитопы. Другой пример такого совместного эффекта имел место, когда антитело 1396, направленное против неизвестного эпитопа, тестировалось против EGFR, насыщенного антителами, связывающими неперекрывающиеся эпитопы.

Исследования связывания рецептора также показали, что имеется возможность одновременного связывания по меньшей мере 6 антител с внеклеточным доменом EGFR. Эти 6 антител представляют собой 3 антитела домена III, одно антитело домена I, одно антитело домена I/II и одно антитело, связывающее неизвестный эпитоп. Интересно, что связывание трех антител домена III представляется способствующим последующему связыванию других антител. Это очевидно поддерживает концепцию предоставления композиции антител с несколькими антителами, связывающими различные эпитопы.

При проектировании состава композиции антител против EGFR, антитела с неперекрывающимися эпитопами используются предпочтительно, поскольку они обеспечивают повышенный синергетический эффект.

Домен III EGFR является важным для связывания лиганда с рецептором. Кроме того, антитело, связывающееся с доменом III, может стабилизировать EGFR связанной мономерной конформации, что не приводит к передаче сигналов рецептором. По этим причинам является предпочтительным, чтобы композиция антител содержала по меньшей мере два антитела со специфичностью для домена III. Предпочтительные антитела домена III включают антитела 992, 1024, 1030, 1208, 1254, 1277 и 1320. Композиция антител может предпочтительно содержать более двух антител домена III, например, по меньшей мере 3 антитела домена III, например, по меньшей мере 4 антитела домена III, например, по меньшей мере 5 антител домена III, например, по меньшей мере 6 антител домена III.

В другом предпочтительном варианте осуществления, композиция антител содержит по меньшей мере одно антитело домена I. Предпочтительно, по меньшей мере одно антитело домена I выбрано из группы, состоящей из антител 1284, 1308, 1344 и 1347. Более предпочтительно, по меньшей мере одно антитело домена I выбрано из группы, состоящей из антител 1284 и 1347.

В другом предпочтительном варианте осуществления, композиция антител содержит по меньшей мере одно антитело домена I/II. Предпочтительно, по меньшей мере одно антитело домена I/II выбрано из группы, состоящей из антител 1257, 1260, 1261, 1428 и 1434. Более предпочтительно, по меньшей мере одно антитело домена I/II выбрано из группы, состоящей из антител 1261 и 1260.

Предпочтительные смеси с тремя антителами включают:

Антитела 992+1320+1024; 992+1024+1030; 992+1255+1024; 992+1024+1214; 992+1024+1284; 992+1024+1211; 992+1024+1030.

Предпочтительные смеси с четырьмя антителами включают:

Антитела 992+1320+1024+1030; 992+1024+1030+1284.

Предпочтительные смеси с пятью антителами включают:

992+1030+1024+1260+1347;

992+1030+1024+1261+1347;

992+1030+1024+1261+1284.

Одна предпочтительная смесь с восемью антителами включает:

992+1030+1024+1277+1254+1320+1260+1261+1284+1347.

Кроме того, в целях обеспечения возможности проведения токсикологического исследования в не являющемся человеком примате, является предпочтительным, чтобы все антитела в композиции связывались с EGFR человека, а также по меньшей мере с одним EGFR примата, таким как EGFR из шимпанзе, Macaca mulatta, макака-резус и других обезьян, или из яванского макака. Яванский макак является сравнительно небольшим животным, и очень хорошо подходит для токсикологических исследований. Следовательно, EGFR еще одного примата предпочтительно представляет собой EGFR яванского макака. Предпочтительно, антитела связываются приблизительно с одинаковой аффинностью с EGFR человека и не являющегося человеком примата.

Настоящее изобретение показало превосходящие результаты в одном или более функциональных анализах при объединении 2, 3, 4, 5, 6, 7 и 8 антител в одной композиции. Несмотря на то, что эти данные предоставляют руководство по выбору количества антител в композиции, они никоим образом не должны интерпретироваться как ограничивающие. Композиция может содержать более 8 антител, даже хотя экспериментальные данные показали одновременное связывание только для 6 антител. Могут иметься другие причины для включения более 6 антител в композиции, такие как, например, различия в скорости выведения представителей антител.

Еще одним предпочтительным свойством антител из композиций является белковая гомогенность, с тем чтобы антитела легко могли быть очищены. Для отдельных представителей антител является предпочтительным профиль ионообменной хроматографии с одним явным пиком для облегчения характеризации. Очевидный профиль ионообменной хроматографии также является предпочтительным для облегчения характеризации конечной композиции антител. Также является предпочтительным при объединении антител, чтобы они были различимыми посредством ионообменной хроматографии, с тем чтобы композиция всех антител могла быть охарактеризована за один цикл.

Антитела могут иметь любой источник, такой как человек, мышь, кролик, курица, свинья, лама, овца. Антитела также могут быть химерными, как описано в примерах, или могут быть гуманизированными, сверхгуманизированными, или перестроенными их версиями, полученными с использованием хорошо известных методов, описанных в технике.

Предпочтительная композиция антител

Как показано в прилагаемых примерах, композиция против EGFR, основанная на антителах 992 и 1024, обладает уникальными и отличительными свойствами. Связывание антитела 992 усиливается посредством связывания других антител, включая 1024. В отличие от коммерческих антител, 992 и 1024 предпочтительно связываются с конформационными эпитопами, представленными в клетках (Примеры 14 и 15). Эпитопы как 992, так и 1024, перекрываются с эпитопом(-ами) эрбитукса и вектибикса, но отличаются от них. В отличие от ряда других композиций из двух антител, в которых отдельные антитела связываются с неперекрывающимися эпитопами, композиция, основанная на специфичностях связывания антител 992 и 1024, запускает интернализацию рецептора быстро и эффективно. Новый механизм действия, включающий конечную дифференцировку, сопровождаемую повышенной экспрессией инволюкрина и появлением холестеатом, наблюдается у модельных животных после лечения композициями антител, основанными на антителах 992 и 1024. Данный уникальный механизм действия приводит к более эффективному и длительному подавлению роста in vitro и in vivo. Это наиболее четко видно в примерах in vivo, в которых опухоли продолжают уменьшаться после завершения лечения. В контрольной группе, получавшей эрбитукс, опухоли начинали расти вскоре после завершения лечения. Это явно указывает на другой механизм действия.

Считается, что новый механизм действия реализуется посредством использования комбинации дух специфичностей связывания, демонстрируемых антителами 992 и 1024 в одной композиции антител. Данный механизм действия также наблюдается в случае использования третьего антитела, которое не конкурирует с антителами 992 и 1024, например, в комбинации трех антител 992, 1024 и 1030.

Данные наблюдения позволили создать композицию антител, содержащую по меньшей мере 2 различных молекулы антител против человеческого EGFR, при этом первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992, антитела, содержащего последовательности VL (аминокислоты 3-109 из SEQ ID No: 72) и VH (аминокислоты 3-124 из SEQ ID No: 40) антитела 992, антитела, имеющего CDR3 антитела 992 (SEQ ID No: 116 и 111), антитела, связывающего тот же эпитоп, что и антитело 992, и антитела, способного ингибировать связывание антитела 992 с человеческим EGFR; и при этом вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 1024, антитела, содержащего последовательности VL (аминокислоты 3-114 из SEQ ID No: 73) и VH (аминокислоты 3-120 из SEQ ID No: 41) антитела 1024, антитела, имеющего CDR3 антитела 1024 (SEQ ID No: 120 и 114), антитела, связывающего тот же эпитоп, что и антитело 1024, и антитела, способного ингибировать связывание антитела 1024 с человеческим EGFR.

Предпочтительно, вышеупомянутая первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992, антитела, содержащего последовательности VL и VH антитела 992, антитела, имеющего CDR3 антитела 992, и антитела, связывающего тот же эпитоп, что и антитело 992; и вышеупомянутая вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из 1024, антитела, содержащего последовательности VL и VH антитела 1024, антитела, имеющего CDR3 антитела 1024, и антитела, связывающего тот же эпитоп, что и антитело 1024.

В настоящем изобретении предполагаются мутации в последовательностях CDR3 антител 992 и 1024 в целях предоставления антител с одной и той же специфичностью связывания. Следовательно, в одном из вариантов осуществления антитело, имеющее ту же специфичность связывания, что и антитело 992, содержит CDRH3, имеющую следующую формулу: CTX1X2X3X4X5X6X7X8X9X10X11X12X13X14X15W, где X1-X15 выбраны индивидуально из групп аминокислот, приведенных ниже:

X1=R или K;

X2=N, D, E или Q;

X3=G, A, V или S;

X4=D, E, N или Q;

X5=Y, F, W или H;

X6=Y, F, W или H;

X7=V, I, L или A;

X8=S, T, G или A;

X9=S, T, G или A;

X10=G, A, V или S;

X11=D, E, N или Q;

X12=A, G, V или S;

X13=M, L, I или V

X14=D или E; и

X15=Y или F;

и CDRL3 описывается следующей формулой: CX1X2X3X4X5X6PPTF, где X1-X6 выбраны индивидуально из групп аминокислот, приведенных ниже:

X1=Q или H;

X2=H, E или Q;

X3=Y, F, W или H;

X4=N, Q или H;

X5=T, S, G или A; и

X6=V, I, L или A.

В одном из вариантов осуществления, антитело, имеющее ту же специфичность связывания, что и антитело 1024, содержит CDRH3, имеющую следующую формулу: CVX1X2X3X4X5X6X7X8X9X10X11W, где X1-X11 выбраны индивидуально из групп аминокислот, приведенных ниже:

X1=R или K;

X2=Y, F, W или H;

X3=Y, F, W или H;

X4=G, A, V, или S;

X5=Y, F, W или H;

X6=D, E, N или Q;

X7=E или D;

X8=A, G, V или S;

X9=M, L, I или V;

X10=D, E, N или Q; и

X11=Y или F.

и CDRL3 описывается следующей формулой: CX1X2X3X4X5X6PX7TF, где X1-X7 выбраны индивидуально из групп аминокислот, приведенных ниже:

X1=A, G или V;

X2=Q или H;

X3=N, Q или H;

X4=L, I, M или V;

X5=E, D, N или Q;

X6=L, I, M или V; и

X7=Y, F, W или H.

Антитела с мутированными CDR3 могут быть созданы с использованием стандартных методик, и могут быть экспрессированы и протестированы относительно связывания с использованием способов, описанных в настоящем документе.

Антитела в соответствии с данным аспектом изобретения могут быть химерными, человеческими, гуманизированными, перестроенными или сверхгуманизированными. Это может выполняться с использованием известных в технике методов. Например, антитела 992 и 1024 могут подвергаться гуманизации с использованием методов, описанных в примере 18. Способы "сверхгуманизации" описаны в патенте США No: 6881557.

Более предпочтительно, вышеупомянутая первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992, антитела, содержащего последовательности VL и VH антитела 992, и антитела, имеющего CDR3 антитела 992; и вышеупомянутая вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 1024, антитела, содержащего последовательности VL и VH антитела 1024, и антитела, имеющего CDR3 антитела 1024.

Более предпочтительно, вышеупомянутая первая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 992 и антитела, содержащего последовательности VL и VH антитела 992; и вышеупомянутая вторая отдельная молекула антитела против EGFR выбрана из группы, состоящей из антитела 1024 и антитела, содержащего последовательности VL и VH антитела 1024.

Наиболее предпочтительно, композиция содержит антитела 992 и 1024.

В соответствии с описанным, первое и второе антитела против EGFR, предпочтительно, не ингибируют связывание друг друга с человеческим EGFR. Даже более предпочтительно, по меньшей мере одно из антител способно увеличивать максимальную связывающую способность другого антитела в отношении человеческого EGFR. Данный эффект наблюдается для антител 992 и 1024 (Пример 16).

Соотношение между двумя антителами не обязательно должно составлять точно 1:1. Таким образом, пропорция первого антитела относительно второго антитела в композиции может находиться между 5 и 95%, например, между 10 и 90%, предпочтительно, между 20 и 80%, более предпочтительно, между 30 и 70, более предпочтительно, между 40 и 60, например, между 45 и 55, например, составляет около 50%.

Предпочтительно, первое и второе антитела принадлежат к изотипу IgG1 или IgG2.

Примеры антител, связывающихся с тем же эпитопом, что и антитело 992, идентифицированные авторами настоящего изобретения, являются антителами из кластера антител, содержащего клоны 1209, 1204, 992, 996, 1033 и 1220.

Примеры антител, связывающихся с тем же эпитопом, что и антитело 1024 идентифицированные авторами настоящего изобретения, являются антителами из кластера антител, содержащего клоны 1031, 1036, 1042, 984, 1024, 1210, 1217, 1221 и 1218.

CDR3 определяет специфичность связывания антител. В предпочтительных вариантах осуществления, антитело, содержащее CDR3 антитела 992, дополнительно содержит CDR1 и CDR2 из VH и VL антитела 992. Аналогично, антитело, содержащее CDR3 антитела 1024, предпочтительно, дополнительно содержит CDR1 и CDR2 из VH и VL антитела 1024. Последовательности CDR антител приведены в таблице 12, пример 17.

В других вариантах осуществления, антитело, конкурирующее с антителом 992, выбрана из группы, состоящей из антител 1208, 1254 и 1277. Аналогично, антитело, конкурирующее с антителом 1024, может быть выбрано из группы, состоящей из антител 1042 и 1320.

В одном из вариантов осуществления, композиция не содержит другие антитела в дополнение к первому и второму антителам, более предпочтительно, не содержит других антител против EGFR.

В других вариантах осуществления, композиция дополнительно содержит третье отличающееся антитело против EGFR, при этом молекула вышеупомянутого третьего отличающегося антитела против EGFR выбрана из группы, состоящей из антитела 1030, антитела, содержащего последовательности VL (аминокислоты 3-113 из SEQ ID No: 74) и VH (аминокислоты 3-120 из SEQ ID No: 42) антитела 1030, антитела, имеющего CDR3 антитела 1030 (SEQ ID No: 112 и 119), антитела, связывающего тот же эпитоп, что и антитело 1030, и антитела, способного ингибировать связывание антитела 1030 с человеческим EGFR. Вышеупомянутое третье антитело, предпочтительно, приводит к повышению связывания с человеческим EGFR вышеупомянутых первого и/или второго антител. В одном из вариантов осуществления, композиция не содержит другие антитела в дополнение к вышеупомянутым первому, втором и третьему антителам, более предпочтительно, не содержит других антител против EGFR.

Антитело, связывающее тот же эпитоп, что и антитело 1030 может быть выбрано из кластера антител, состоящего из клонов 1195, 1030, 1034, 1194, 980, 981, 1246 и 1223.

Антитело, содержащее CDR3 антитела 1030, может дополнительно содержать CDR1 и CDR2 из VH и VL антитела 1030.

Антитела могут быть объединены в одном контейнере для введения. Однако они могут быть произведены, очищены и охарактеризованы по отдельности, и могут быть предоставлены в двух или трех отдельных контейнерах в форме набора частей, по одному антителу в каждом контейнере. Таким образом, они могут быть введены одновременно, последовательно или отдельно друг от друга.

В следующем аспекте две специфичности связывания антител 992 и 1024 комбинируются в одной биспецифичной связывающей молекуле. Предпочтительно, биспецифичная связывающая молекула содержит CDR антител 992 и 1024, более предпочтительно, последовательности VH и VL антител 992 и 1024. Биспецифичная связывающая молекула может представлять собой антитело с двумя вариабельными доменами, описанное в примере 19. Биспецифичная связывающая молекула также может быть создана в форме биспецифичного Fab-фрагмента, биспецифичного scFV или диатела, в соответствии с описанным в литературе.

Композиции антител, основанные на специфичностях связывания антител 992 и 1024, предпочтительно, вызывают интернализацию одного или более рецепторов, регрессию опухолей A431 NS in vivo, индуцирование конечной дифференциации клеток A431 NS in vivo, и повышение регуляции экспрессии инволюкрина в опухоли in vivo.

В настоящем описании представлено несколько примеров антител, имеющих одинаковый или аналогичный эффект относительно комбинации антител 992 и 1024. Такие примеры включают антитела, полученные в результате той же иммунизации и принадлежащие к тем же кластерам, и антитела, индивидуально конкурирующие с одним или более антителами. Композиции антител, имеющие одинаковый или аналогичный эффект, могут быть спроектированы на основании последовательностей VL и VH антител 992 и 1024, и также на основании CDR данных антител, в частности, CDR3 двух антител.

Кроме того, композиции антител, имеющие одинаковый или аналогичный эффект, могут быть созданы путем выполнения иммунизации и скрининга, в основном в соответствии с описанным в примерах. Антитела с той же специфичностью связывания, что и антитела 992 и 1024, могут быть идентифицированы в двух отдельных исследованиях конкуренции в соответствии с описанным в настоящем документе. В заключение, композиции антител, в которых одно из антител увеличивает связывание другого антитела, могут быть идентифицированы путем проведения экспериментов по связыванию, в основном в соответствии с описанным в примере 16. Композиции антител могут подвергаться скринингу, в соответствии с описанным в примерах, относительно влияния на интернализацию рецептора, эффективность in vitro и in vivo, связывающую способность и т.д.

Применение композиций антител изобретения

В целях применения в лечении in vivo и профилактике заболеваний, связанных с экспрессией EGFR (например, сверхэкспрессией), антитела изобретения вводятся пациентам (например, человеку) в терапевтически эффективных дозах (например, дозах, которые приводят к подавлению роста, фагоцитозу, снижению подвижности, конечной дифференцировке и/или уничтожению клеток опухоли, экспрессирующих EGFR) с использованием любого подходящего пути введения, такого как инъекция и другие пути введения, известные в технике для основанных на антителах клинических продуктов.

Типичные EGFR-связанные заболевания, которые могут подвергаться лечению, улучшению состояния и/или профилактике с применением антител изобретения, включают аутоиммунные заболевания и рак, но не ограничиваются перечисленным. Например, формы рака, которые могут подвергаться лечению, улучшению состояния и/или профилактике, включают рак мочевого пузыря, груди, рак матки/цервикальный рак, рак толстой кишки, почек, яичников, простаты, клеток почечного эпителия, поджелудочной железы, толстой кишки, прямой кишки, желудка, плоских клеток, легкого (немелкоклеточный), пищевода, головы и шеи, кожи. Аутоиммунные заболевания, которые могут подвергаться лечению, включают, например, псориаз.

В еще одном варианте осуществления, изобретение относится к способу лечения, улучшения состояния и/или профилактики глиобластомы, включая мультиформную глиобластому; астроцитомы, включая детскую астроцитому; глиомы; нейробластомы; нейроэндокринных опухолей желудочно-кишечного тракта; бронхоальвеолярной карциномы; саркомы фолликулярных дендритных клеток; карциномы слюнных желез; амелобластомы; злокачественной опухоли пласта периферийного нерва; эндокринных опухолей поджелудочной железы; или опухолей тестикулярных зародышевых клеток, включая семиному, эмбриональную карциному, опухоль эндодермального синуса, тератому и хориокарциному.

Выделение и выбор кодирующих пар вариабельной

тяжелой цепи и вариабельной легкой цепи

Процесс создания композиции рекомбинантных антител против EGFR включает выделение последовательностей, кодирующих вариабельные тяжелые цепи (VH) и вариабельные легкие цепи (VL), из соответствующего источника, посредством чего создается репертуар кодирующих пар VH и VL. Как правило, подходящими источниками получения последовательностей, кодирующих VH и VL, являются содержащие лимфоциты клеточные фракции, такие как кровь, пробы селезенки или костного мозга из не являющегося человеком животного, иммунизированного/вакцинированного человеческим пептидом или полипептидом EGFR, или белками EGFR, полученными из клетки, экспрессирующей EGFR, или клетками, экспрессирующими человеческий EGFR, или фракциями таких клеток. Предпочтительно, содержащие лимфоциты клеточные фракции собираются у не являющихся человеком млекопитающих или трансгенных животных с генами иммуноглобулинов человека. Собранная содержащая лимфоциты клеточная фракция может быть дополнительно обогащена с целью получения популяции конкретных лимфоцитов, например клеток из линии B-лимфоцитов. Предпочтительно, обогащение выполняется с применением магнитной сортировки клеток (MACS) и/или флуоресцентной сортировки клеток (FACS), что позволяет использовать преимущество специфичных для линии белков-маркеров клеточной поверхности для B-клеток, плазмобластов и/или клеток плазмы. Предпочтительно, содержащая лимфоциты клеточная фракция обогащается или сортируется относительно B-клеток, плазмобластов и/или клеток плазмы. Даже более предпочтительно, клетки с высокой экспрессией CD43 и CD138 выделяются из селезенки или крови. Данные клетки иногда называются циркулирующими клетками плазмы, ранними клетками плазмы или плазмобластами. Для простоты в настоящем изобретении они называются просто клетками плазмы, хотя другие термины также могут использоваться взаимозаменяемо.

Выделение последовательностей, кодирующих VH и VL, может выполняться классическим способом, в котором кодирующие последовательности VH и VL объединяются в вектор случайным образом для создания комбинаторной библиотеки пар кодирующих последовательностей VH и VL. Однако в настоящем изобретении предпочтительным является отражение разнообразия, аффинности и специфичности антител, продуцируемых при гуморальном иммунном ответе на иммунизацию EGFR. Это включает поддержание парного соединения VH и VL, исходно присутствовавшего у донора, посредством чего создается репертуар пар последовательностей, в котором каждая пара кодирует вариабельную тяжелую цепь (VH) и вариабельную легкую цепь (VL), соответствующую паре VH и VL, исходно присутствующей в антителе, продуцируемом донором, из которого были выделены последовательности. Такие пары также называются родственными парами последовательностей, кодирующих VH и VL, и антитело называется родственным антителом. Предпочтительно, кодирующие пары VH и VL по настоящему изобретению, комбинаторные или родственные, получены из доноров-мышей, и, следовательно, последовательности являются мышиными.

Существует несколько различных подходов к получению родственных пар кодирующих VH и VL последовательностей, среди которых один подход включает амплификацию и выделение кодирующих VH и VL последовательностей из единичных клеток, отсортированных из содержащей лимфоциты клеточной фракции. В целях получения репертуара пар кодирующих последовательностей VH и VL, которые обладают разнообразием, похожим на пары последовательностей VH и VL у донора, предпочтительным является метод с высокой пропускной способностью, в котором перемешивание (случайная комбинация) пар VH и VL является настолько низкой, насколько это возможно, например, как описано в WO 2005/042774 (включенной в настоящий документ посредством ссылки).

Последовательности, кодирующие VH и VL, могут быть амплифицированы отдельно или парно на втором этапе, или они могут быть спарены в процессы амплификации (Coronella et al. 2000. Nucleic Acids Res. 28: E85; Babcook et al 1996. PNAS 93: 7843-7848 и WO 2005/042774). Второй подход включает внутриклеточную амплификацию и спаривание кодирующих VH и VL последовательностей (Embleton et al. 1992. Nucleic Acids Res. 20: 3831-3837; Chapal et al. 1997. BioTechniques 23: 518-524). Третий подход представляет собой метод создания антител на основе выбора из лимфоцитов (SLAM), который объединяет пробу на гемолитические бляшки с клонированием кДНК VH и VL (Babcook et al. 1996. PNAS 93:7843-7848). Другой метод, который может быть использован для мышей, представляет собой стандартную методику гибридом, после которой выполняется скрининг и отбор главных кандидатов и последующее клонирование закодированных антител.

В предпочтительном варианте осуществления настоящего изобретения репертуар кодирующих пар VH и VL, в котором участвующие пары отражают пары генов, ответственных за гуморальный иммунный ответ, возникающий в результате иммунизации EGFR, создается в соответствии со способом, включающим стадии i) получения содержащей лимфоциты клеточной фракции из животного-донора, иммунизированного человеческим EGFR; ii) опционально, обогащения B-клеток или клеток плазмы из вышеупомянутой клеточной фракции; iii) получения популяции выделенных единичных клеток, содержащей распределенные клетки из вышеупомянутой клеточной фракции, отдельно во множестве емкостей; iv) амплификации и выполнения связывания пар, кодирующих VH и VL в процедуре мультиплексной ПЦР ОТ с удлинением перекрытий, с использованием шаблона, полученного из вышеупомянутых выделенных единичных клеток и v) опционально, выполнение вложенной ПЦР для соединенных кодирующих пар VH и VL. Предпочтительно, выделенные родственные кодирующие пары VH и VL подвергаются процедуре скрининга в соответствии с описанным ниже.

После того, как пары последовательностей VH и VL были созданы, выполняется процедура скрининга для идентификации последовательностей, кодирующих пары VH и VL, со связывающей реактивностью в отношении ассоциированного с EGFR антигена. Предпочтительно, ассоциированный с EGFR антиген содержит внеклеточную часть EGFR, такую как домен III, II, I и/или IV, фрагменты доменов или полный внеклеточный домен. Другие антигены включают мутантов, таких как делеционные мутанты EGFR или SNP, или их фрагменты. Если пары последовательностей VH и VL являются комбинаторными, то процедура фагового дисплея может быть применена для обогащения пар VH и VL, кодирующих фрагменты антитела, связывающие EGFR, до проведения скрининга.

В целях отражения разнообразия, аффинности и специфичности антител, продуцируемых в гуморальном иммунном ответе после иммунизации EGFR, в настоящем изобретении была разработана процедура для родственных пар с целью получения наибольшего возможного разнообразия. Для целей скрининга репертуар родственных кодирующих пар VH и VL экспрессируется отдельно в виде фрагментов антител (например, scFv или Fab) или в виде полноразмерных антител с использованием вектора скрининга, бактериального или вектора для млекопитающего, трансфицированного в соответствующую клетку-хозяина. Репертуар Fab/антител может подвергаться скринингу - без ограничений - на предмет реактивности с EGFR, антипролиферационной активности против линий раковых клеток, экспрессирующих EGFR, и на предмет способности ингибировать связывание лиганда (например, EGF) с EGFR, способности ингибировать фосфорилирование, индуцировать апоптоз, осуществлять интернализацию EGFR.

Параллельно, репертуар Fab/антител подвергается скринингу относительно выбранных антигенов, таких как человеческие и, опционально, пептиды EGFR яванского макака, шимпанзе или макака-резус. Антигенные пептиды могут, например, выбираться из внеклеточного домена человеческого EGFR, мутантного внеклеточного домена человеческого EGFR и внеклеточного домена EGFR яванского макака, или из их фрагментов. Пептиды могут подвергаться биотинилированию в целях способствования иммобилизации на микрочастицах или планшетах во время скрининга. Также могут использоваться альтернативные средства иммобилизации. Антигены выбираются на основании знаний о биологии EGFR и ожидаемого нейтрализующего и/или защитного эффекта, который потенциально могут обеспечить антитела, способные связываться с данными антигенами. Процедура скрининга может быть аналогично применена к комбинаторной библиотеке фагового дисплея.

Рекомбинантные белки EGFR, используемые для скрининга, могут быть экспрессированы в бактериях, клетках насекомых, клетках млекопитающих или другой подходящей системе экспрессии. В целях корректного процессинга (включая гликозилирование) белки экспрессируются в клетках млекопитающих. Белок EGFR-ECD может быть экспрессирован в виде растворимого белка (без трансмембранной и внутриклеточной области), или он может быть слит с третьим белком в целях повышения стабильности. Если белок EGFR экспрессируется с меткой слияния, то партнер слияния может подвергаться расщеплению до начала скрининга. В дополнение к первичному скринингу, описанному выше, может быть выполнен вторичный скрининг, в целях обеспечения того, что ни одна из выбранных последовательностей не кодирует ложноположительные случаи.

Как правило, иммунологические анализы являются подходящими для скрининга, выполняемого в настоящем изобретении. Такие исследования хорошо известны в технике и включают, например, ELISPOT, ELISA, FLISA, мембранные анализы (например, вестерн-блоты), матрицы на фильтрах и FACS. Исследования могут выполняться без проведения предварительных этапов обогащения, с использованием белков, продуцируемых из последовательностей, кодирующих пары VH и VL. В случае, когда репертуар кодирующих пар VH и VL представляет собой родственные пары, не требуется обогащения, посредством, например, фагового дисплея, до начала скрининга. Однако при скрининге комбинаторных библиотек иммунные анализы предпочтительно выполняются совместно или после применения методов обогащения, таких как фаговый дисплей, рибосомный дисплей, дисплей бактериальной поверхности, дрожжевой дисплей, дисплей вирусов эукариот, РНК-дисплей или ковалентный дисплей (обзор в работе FitzGerald, K., 2000. Drug Discov. Today 5, 253-258).

Последовательности, кодирующие пары VH и VL и отобранные в процессе скрининга, обычно секвенируются и анализируются в отношении многообразия вариабельных областей. В частности, интерес представляет разнообразие в CDR-областях, но также представляет интерес и представление семейств VH и VL. На основании данных анализов, отбираются последовательности, кодирующие пары VH и VL и представляющие общее многообразие связывающих EGFR антител, выделенных из одного или более животных-доноров. Предпочтительно, выбираются последовательностями с различиями во всех CDR-областях (CDRH1, CDRH2, CDRH3 и CDRL1, CDRL2 и CDRL3). Если имеются последовательности с одной или более идентичными, или очень похожими, CDR-областями, которые принадлежат к различным семействам VH или VL, то они также отбираются. Предпочтительно, по меньшей мере, CDR3-область вариабельной тяжелой цепи (CDRH3) отличается от остальных выбранных пар. Потенциально, выбор пар последовательностей VH и VL может быть основан только на вариабельности области CDRH3. Во время установки праймеров и амплификации последовательностей могут происходить мутации в каркасных областях вариабельной области, в частности, в первой каркасной области. Предпочтительно, ошибки, появившиеся в первой каркасной области, исправляются в целях обеспечения того, чтобы последовательности соответствовали полностью, или, по меньшей мере, на 98%, последовательностям зародышевой линии, например, с тем чтобы последовательности VH и VL были полностью мышиными.

Если обеспечено, что общее разнообразие коллекции выбранных последовательностей, кодирующих пары VH и VL, является в высокой степени репрезентативным относительно разнообразия, наблюдаемого на генетическом уровне при гуморальном ответе на иммунизацию EGFR, то ожидается, что суммарная специфичность антител, экспрессируемых из коллекции кодирующих пар VH и VL, является репрезентативной по отношению к специфичности антител, продуцируемых в иммунизированных EGFR животных. Данные о том, является ли специфичность антител, экспрессированных из коллекции выбранных кодирующих пар VH и VL, репрезентативной относительно специфичности антител, вырабатываемых донорами, могут быть получены путем сравнения титров антител относительно выбранных антигенов в крови донора со специфичностью антител, экспрессированных из коллекции выбранных кодирующих пар VH и VL. Кроме того, специфичность антител, экспрессированных из коллекции выбранных кодирующих пар VH и VL, может быть проанализирована дополнительно. Степень специфичности коррелирует с количеством различных антигенов, относительно которых может быть обнаружена реактивность связывания. В еще одном варианте осуществления настоящего изобретения специфичность отдельных антител, экспрессированных из коллекции выбранных кодирующих пар VH и VL, анализируется с помощью картирования эпитопов.

Картирование эпитопов может быть выполнено посредством ряда методологий, которые не обязательно исключают друг друга. Одним из способов картирования специфичности эпитопов молекулы антитела является оценка связывания с пептидами различной длины, полученными из первичной структуры целевого антигена. Такие пептиды могут быть как линейными, так и конформационными, и могут быть использованы в нескольких типах исследований, включая ELISA, FLISA и поверхностный плазмонный резонанс (SPR, Biacore, FACS). Кроме того, пептиды могут быть рационально выбраны с использованием доступных данных по последовательности и структуре для представления, например, внеклеточных областей или консервативных областей целевого антигена, или могут быть спроектированы в виде группы перекрывающихся пептидов, представляющих выбранную часть антигена или антиген целиком (Meloen RH, Puijk WC, Schaaper WMM. Epitope mapping by PEPSCAN. In: Immunology Methods Manual. Ed Iwan Lefkovits 1997, Academic Press, pp 982-988). Специфичная реактивность клона антитела с одним или более такими пептидами может являться индикацией специфичности эпитопов. Однако пептиды во многих случаях плохо отражают эпитопы, распознаваемые антителами, выработанными против белковоподобных антигенов, по причине как отсутствия естественной или специфичной конформации, так и в целом большей внутренней площади поверхности взаимодействия между антителом и белковым антигеном по сравнению с антителом и пептидом. Второй способ картирования эпитопов, позволяющий определять специфичность непосредственно на белковом антигене, состоит в селективном экранировании эпитопов с использованием существующих хорошо охарактеризованных антител. Снижение связывания второго антитела-зонда с антигеном после блокирования обычно указывает на наличие совместных или перекрывающихся эпитопов. Картирование эпитопов посредством селективного экранирования может быть выполнено в ряде иммунных анализов, включая хорошо известные в технике ELISA и Biacore, но не ограничиваясь ими (например, Ditzel et al. 1997. J. Mol. Biol. 267:684-695; Aldaz-Carroll et al. 2005. J. Virol. 79: 6260-6271). Еще один потенциальный способ определения специфичности эпитопов антител против EGFR состоит в выборе «ускользающих» мутантов в присутствии антитела. Это может быть выполнено с применением, например, аланинного сканирования. Секвенирование представляющего(-их) интерес гена(-ов) из таких ускользающих мутантов обычно позволяет обнаружить, какие аминокислоты в антигене(-ах) являются важными для распознавания антителом, и, следовательно, составляют эпитоп или его часть.

Продуцирование композиции антител против EGFR

из выбранных кодирующих пар V H и V L

Композиция антител по настоящему изобретению может быть продуцирована из поликлональной экспрессионной линии клеток в одном или нескольких биореакторах или их эквивалентах. После применения данного подхода антитела против EGFR могут быть очищены из реактора во время процесса в форме единичной композиции без необходимости выделения отдельных представителей, составляющих композицию антител против EGFR. Если композиция антител продуцируется более чем в одном биореакторе, то очищенная композиция антител против EGFR может быть получена путем создания пула антител, полученных из отдельно очищенных супернатантов из каждого биореактора.

Один из способов продуцирования композиции рекомбинантных антител описан в WO 2004/061104 и WO 2006/007850 (данные документы включены в настоящий документ посредством ссылки). Способ, описанный в этих документах, основан на сайт-специфичной интеграции последовательности, кодирующей антитело, в геном отдельных клеток-хозяев, что обеспечивает сохранение исходного парного соединения белковых цепей VH и VL в течение продуцирования. Кроме того, сайт-специфичная интеграция минимизирует позиционные эффекты, и, следовательно, ожидается, что характеристики роста и экспрессии отдельных клеток в поликлональной клеточной линии будет аналогичными. Обычно способ включает следующее: i) клетку-хозяина с одним или более сайтами распознавания рекомбиназы; ii) экспрессионный вектор по меньшей мере с одним сайтом распознавания рекомбиназы, совместимым с соответствующим сайтом клетки-хозяина; iii) создание коллекции экспрессионных векторов посредством передачи выбранных кодирующих пар VH и VL из вектора скрининга в экспрессионный вектор, с тем чтобы полноразмерное антитело или фрагмент антитела могли экспрессироваться из вектора (такая передача может не быть необходимой, если вектор скрининга идентичен экспрессионному вектору); iv) трансфекция в клетку-хозяина коллекции экспрессионных векторов и вектора, кодирующего рекомбиназу, способную объединять сайты распознавания рекомбиназы в геноме клетки-хозяина с соответствующими сайтами вектора; v) получение/создание поликлональной клеточной линии из трансфицированной клетки-хозяина и vi) экспрессирование и сбор композиции антител из поликлональной клеточной линии.

При использовании небольшого количества (2-3 или более) антител для одной композиции, они могут быть экспрессированы или очищены отдельно аналогично производству моноклональных антител, например, в соответствии с описанным в WO 2004/085474. Очищенные антитела могут быть смешаны после очистки или могут быть упакованы в отдельные ампулы для смешивания до введения или для отдельного введения.

Предпочтительно, используются клетки млекопитающих, такие как клетки CHO, клетки COS, клетки BHK, клетки миеломы (например, клетки Sp2/0 или NSO), фибробласты, такие как NIH 3T3, и иммортализированные человеческие клетки, такие как клетки HeLa, клетки HEK 293 или PER.C6. Однако также могут использоваться не являющиеся клетками млекопитающих эукариотические или прокариотические клетки, такие как клетки растений, клетки насекомых, клетки дрожжей, грибов, E. coli и т.д. Подходящая клетка-хозяин содержит один или более подходящих сайтов распознавания рекомбиназы в своем геноме. Клетка-хозяин также должна включать вариант выбора, функционально связанный с сайтом интеграции, с тем чтобы иметь возможность выбора компонентов для объединения (то есть, клеток, имеющих интегрированную копию экспрессионного вектора антитела против EGFR или фрагмент экспрессионного вектора в сайте интеграции). Приготовление клеток, имеющих сайт FRT в заранее определенной позиции в геноме, было описано, например, в патенте США No: 5677177. Предпочтительно, клетка-хозяин имеет только один сайт интеграции, который размещен в месте, допускающем высокую степень экспрессии интегрируемого компонента (так называемая «горячая точка»).

Подходящий экспрессионный вектор содержит сайт распознавания рекомбинации, соответствующий сайту(-ам) распознавания рекомбиназы клетки-хозяина. Предпочтительно, сайт распознавания рекомбиназы связан с соответствующим селекционным геном, отличным от селекционного гена, использованного для построения клетки-хозяина. Селекционные гены хорошо известны в технике и включают ген глутаминсинтетазы (GS), ген дигидрофолатредуктазы (DHFR) и неомицин, при этом GS или DHFR могут быть использованы для амплификации генов вставленной последовательности VH и VL. Вектор также может содержать два различных сайта распознавания рекомбиназы в целях обеспечения опосредованного рекомбиназой кассетного обмена (RMCE) кодирующей антитело последовательности вместо полной интеграции в вектор. RMCE описывается в работе (Langer et al 2002; Schlake and Bode 1994). Подходящие сайты распознавания рекомбиназы хорошо известны в технике и включают сайты FRT, lox и attP/attB. Предпочтительно, интегрирующий вектор представляет собой вектор, кодирующий изотип, при этом константные области (предпочтительно, содержащие интроны) присутствуют в векторе до передачи кодирующей пары VH и VL из вектора скрининга (или константные области уже присутствуют в векторе скрининга, если скрининг выполняется на полноразмерных антителах). Константные области, присутствующие в векторе, могут представлять собой константную область всей тяжелой цепи (от CH1 до CH3 или до CH4) или константную область, кодирующую Fc-часть антитела (от CH2 до CH3 или до CH4). Каппа- или лямбда-константная область легкой цепи также может присутствовать до передачи. Выбор количества присутствующих константных областей, при их наличии, зависит от используемых систем скрининга и передачи. Константные области тяжелой цепи могут выбираться из изотипов IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM, IgD и IgE. Предпочтительными изотипами являются IgG1, IgG2 и/или IgG3. Кроме того, экспрессионный вектор для сайт-специфичной интеграции нуклеиновой кислоты, кодирующей антитело против EGFR, содержит подходящие промоторы или эквивалентные последовательности, обеспечивающие высокие уровни экспрессии каждой из цепей VH и VL. Фиг. 4 иллюстрирует один из возможных способов конструирования экспрессионного вектора, но при этом также является возможным ряд других конструкций.

Передача выбранных кодирующих пар VH и VL из вектора скрининга может быть выполнена посредством обычного расщепления рестрикционными ферментами и сшивания, в результате чего молекула экспрессионного вектора будет содержать одну кодирующую пару VH и VL. Предпочтительно, кодирующие пары VH и VL передаются по отдельности, однако при необходимости они могут передаваться совместно. После передачи всех выбранных кодирующих пар VH и VL в экспрессионный вектор формируется коллекция или библиотека экспрессионных векторов. Также при необходимости могут быть использованы альтернативные пути передачи. Если вектор скрининга идентичен экспрессионному вектору, то библиотека экспрессионных векторов составляется из пар последовательностей VH и VL, выбранных в процессе скрининга, которые расположены в векторе скрининга/экспрессии.

Методы трансфицирования последовательности нуклеиновой кислоты в клетку-хозяина известны в технике. Для обеспечения сайт-специфичной интеграции, в клетке-хозяине также должна присутствовать соответствующая рекомбиназа. Это предпочтительно достигается путем одновременной трансфекции плазмиды, кодирующей рекомбиназу. Подходящими рекомбиназами являются, например, Flp, Cre или интеграза фага ΦC31, при использовании совместно с системой клетки-хозяина/вектора с соответствующими сайтами распознавания рекомбиназы. Клетка-хозяин может быть трансфицирована целиком, что означает трансфекцию библиотеки экспрессионных векторов в клеточную линию в одной реакции, посредством чего получается поликлональная клеточная линия. В качестве альтернативы, коллекция экспрессионных векторов может трансфицироваться в клетку-хозяина по отдельности, посредством чего создается коллекция отдельных клеточных линий (каждая клеточная линия продуцирует антитело с конкретной специфичностью). Клеточные линии, сгенерированные после трансфекции (отдельные или поликлональные) затем отбираются по сайт-специфичному интегрированию компонентов, и приспосабливаются для роста в суспензии и бессывороточных средах, если они еще не обладают этими свойствами до трансфицирования. Если трансфекция выполнялась по отдельности, то отдельные клеточные линии также анализируются в отношении их характеристик роста и продуцирования антител. Предпочтительно, для создания поликлональной клеточной линии выбираются клеточные линии с аналогичными скоростями пролиферации и уровнями экспрессии антител. Затем создается поликлональная клеточная линия путем смешивания отдельных клеточных линий в заранее определенной пропорции. Обычно из поликлональной клеточной линии создается банк базовых поликлональных клеток (pMCB), банк исследуемых поликлональных клеток (pRCB) и/или банк рабочих поликлональных клеток (pWCB). Поликлональная клеточная линия создается путем смешивания отдельных клеточных линий в заранее определенной пропорции. Поликлональная клеточная линия распределяется по ампулам, посредством чего создается банк исследуемых поликлональных клеток (pRCB) или базовых поликлональных клеток (pMCB), из которых может быть получен банк рабочих поликлональных клеток (pWCB) путем выращивания клеток из банка исследуемых или базовых клеток. Банк исследуемых клеток в основном используется для подтверждения концептуальных исследований, в которых поликлональная клеточная линия может не содержать столько же отдельных антител, сколько содержит поликлональная клеточная линия в банке базовых клеток. Обычно pMCB расширяется далее с образованием pWCB для производственных целей. После исчерпания pWCB новая ампула из pMCB может быть расширена с целью образования нового pWCB.

Одним из вариантов осуществления настоящего изобретения является поликлональная клеточная линия, способная экспрессировать композиции рекомбинантных антител против EGFR по настоящему изобретению.

Еще один вариант осуществления настоящего изобретения представляет собой поликлональную клеточную линию, в которой каждая отдельная клетка способна экспрессировать одну кодирующую пару VH и VL, и поликлональная клеточная линия в целом способна экспрессировать коллекцию кодирующих пар VH и VL, в которой каждая пара VH и VL кодирует антитело против EGFR. Предпочтительно, коллекция кодирующих пар VH и VL представляет собой родственные пары, полученные в соответствии со способами по настоящему изобретению.

Композиция рекомбинантных антител по настоящему изобретению может быть произведена посредством культивирования одной ампулы из pWCB в соответствующей среде в течение периода времени, допускающего достаточную экспрессию антитела, и в течение которого поликлональная клеточная линия остается стабильной (окно составляет приблизительно от 15 дней до 50 дней). Могут быть использованы такие методы культивирования как периодическая подпитка или перфузия. Композиция рекомбинантных антител получается из культуральной среды и очищается посредством обычных методик очистки. Аффинная хроматография, комбинируемая с последующими шагами очистки, такими как ионообменная хроматография, гидрофобные взаимодействия и фильтрация в геле, часто использовалась для очистки IgG. После очистки оценивается присутствие всех отдельных представителей в поликлональной композиции антител, например, посредством ионообменной хроматографии. Характеризация такой композиции антител подробно описана в WO 2006/007853 (включенной в настоящий документ посредством ссылки).

Альтернативный способ экспрессии смеси антитела в рекомбинантном хозяине описан в WO 2004/009618. В данном способе продуцируются антитела с различными тяжелыми цепями, ассоциированными с одной и той же легкой цепью из одной клеточной линии. Данный подход может быть применим, если композиция антител против EGFR продуцируется из комбинаторной библиотеки.

Терапевтические композиции

Другим аспектом изобретения является фармацевтическая композиция, содержащая в качестве активного ингредиента композицию антител против EGFR, или композицию рекомбинантных Fab против EGFR, или композицию других фрагментов рекомбинантных антител против EGFR, или биспецифичную связывающую молекулу по изобретению. Предпочтительно, активным ингредиентом такой композиции является композиция рекомбинантных антител против EGFR, в соответствии с описанным в настоящем изобретении. Такие композиции предназначены для улучшения состояния и/или профилактики и/или лечения рака. Предпочтительно, фармацевтическая композиция вводится человеку, сельскохозяйственному животному или домашнему животному.

Фармацевтическая композиция также содержит фармацевтически приемлемый эксципиент.

Композиция антител против EGFR или их фрагментов может вводиться в фармацевтически приемлемом разбавителе, носителе или эксципиенте, в единичной дозированной форме. Обычная фармацевтическая практика может быть применена для получения подходящих препаратов или композиций для введения раковым пациентам. В предпочтительном варианте осуществления, введение является терапевтическим, что означает введение после того, как было диагностировано раковое заболевание. Может быть использован любой подходящий путь введения, например, введение может быть парентеральным, внутривенным, внутриартериальным, подкожным, внутримышечным, внутрибрюшинный, интраназальным, аэрозольным, суппозиторным или оральным введением. Например, фармацевтические препараты могут представлять собой жидкие растворы или суспензии. Для орального введения необходима защита от разложения в желудке. При интраназальном введении антитела могут вводиться в форме порошков, капель в нос или аэрозолей.

Фармацевтические композиции по настоящему изобретению приготовляются способом, известным per se, например, посредством процессов обычного растворения, лиофилизации, смешивания, гранулирования или способом приготовления лекарств с наполнителем. Фармацевтические композиции могут быть приготовлены в соответствии с обычной фармацевтической практикой (см., например, в работе Remington: The Science and Practice of Pharmacy (20th ed.), ed. A.R. Gennaro, 2000, Lippincott Williams & Wilkins, Philadelphia, PA и Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York, NY).

Предпочтительно, для приготовления фармацевтических композиций по настоящему изобретению используются растворы или суспензии активного ингредиента, в частности, изотонические водные растворы или суспензии. В случае лиофилизированных композиций, которые содержат только активный ингредиент или его вместе с носителем, например, маннитолом, такие растворы или суспензии могут, при наличии возможности, производится до применения. Фармацевтические композиции могут быть стерилизованными и/или могут содержать эксципиенты, например, консерванты, стабилизаторы, смачивающие агенты и/или эмульгаторы, растворители, соли для регулирования осмотического давления и/или буферы, и приготовляются способом, известным per se, например, посредством обычных процессов растворения или лиофилизации. Указанные растворы или суспензии могут содержать повышающие вязкость вещества, такие как карбоксиметилцеллюлоза натрия, карбоксиметилцеллюлоза, декстран, поливинилпирролидон или желатин.

Композиции для инъецирования готовят стандартным способом в стерильных условиях; то же самое относится к внесению композиций в ампулы или флаконы и запечатыванию контейнеров.

Фармацевтические композиции содержат от приблизительно 1% до приблизительно 95%, предпочтительно, от приблизительно 20% до приблизительно 90% активного ингредиента. Фармацевтические композиции в соответствии с изобретением могут быть, например, в единичной дозированной форме, например, в виде ампул, флаконов, суппозиториев, таблеток, пилюль или капсул. Композиции могут вводиться пациентам в терапевтически или профилактически эффективных объемах (например, в объемах, которые предотвращают, устраняют или сокращают патологическое состояние) в целях проведения терапии для заболевания или состояния. Предпочтительная предназначенная для введения дозировка терапевтического агента, вероятно, зависит от таких параметров, как тяжесть рака, общее состояние здоровья конкретного пациента, состава эксципиентов и пути введения.

Терапевтическое применение композиций

в соответствии с изобретением

Фармацевтические композиции в соответствии с настоящим изобретением могут применяться для лечения или улучшения состояния при заболевании млекопитающего. Состояния, которые могут подвергаться лечению или профилактике настоящими фармацевтическими композициями, предпочтительно включают профилактику и лечение рака у пациентов посредством терапевтического лечения фармацевтическими композициями в соответствии с настоящим изобретением.

Один из вариантов осуществления настоящего изобретения представляет собой способ профилактики, лечения или облегчения одного или более симптомов, связанных с раком у млекопитающего, включающий введение эффективного количества композиции рекомбинантных антител против EGFR по настоящему изобретению вышеупомянутому млекопитающему.

Еще один вариант осуществления настоящего изобретения представляет собой применение композиции рекомбинантных антител против EGFR по настоящему изобретению для приготовления композиции для лечения, облегчения или профилактики одного или более симптомов, связанных с раком у млекопитающего.

Предпочтительно, млекопитающее в указанных выше вариантах осуществления является человеком, сельскохозяйственным животным или домашним животным.

Антитела в соответствии с настоящим изобретением показаны для лечения определенных солидных опухолей. На основании ряда факторов, включая, помимо прочего, уровни экспрессии EGFR, опухоли следующих типов могут демонстрировать предпочтительные показания: рак груди, яичников, толстой кишки, прямой кишки, простаты, мочевого пузыря, поджелудочной железы, головы и шеи, немелкоклеточный рак легких.

Другие примеры форм рака включают карциному и саркому. Карцинома включает, по меньшей мере, следующее:

эпителиальные новообразования, NOS

плоскоклеточные новообразования

плоскоклеточную карциному, NOS

новообразования базальных клеток

карциному базальных клеток, NOS

карциномы и папилломы «переходных» клеток

аденомы и аденокарциномы (гланды)

аденому, NOS

аденокарциному, NOS

пластический линит

инсулиному, NOS

глюкагоному, NOS

гастриному, NOS

випому

холангиокарциному

гепатоцеллюлярную карциному, NOS

аденокистозную карциному

карциноидную опухоль, NOS, см. в приложении

пролактиному

онкоцитому

аденому из клеток Гюртле

почечноклеточную карциному

опухоль Гравитца

множество эндокринных аденом

эндометриоидную аденокарциному, NOS

новообразования придатков и кожных придатков

мукоэпидермоидные новообразования

кистозные, муцинозные и серозные новообразования

кистозную аденому, NOS

псевдомиксому брюшины

дуктальные, лобулярные и медуллярные новообразования

ациноцитные новообразования

комплексные эпителиальные новообразования

опухоль Уортина

тимому, NOS

специализированные гонадные новообразования

опухоль стромы полового тяжа яичников

текому, NOS

гранулезоклеточную опухоль, NOS

арренобластому, NOS

опухоль из клеток Сертоли-Лейдига

параганглиомы и гломусные опухоли

параганглиому, NOS

феохромоцитому, NOS

гломусные опухоли

невусы и меланомы

меланоцитарный невус

злокачественную меланому, NOS

меланому, NOS

глобулярную меланому

диспластический невус

злокачественную лентиго-меланому

поверхностно распространяющуюся меланому

злокачественную акральную лентигинозную меланому.

Примеры саркомы включают следующее. Саркомам дан ряд различных названий на основании типа ткани, из которой они возникают. Например, остеосаркома возникает из кости, хондросаркома возникает из хрящей и лейомиосаркома возникает из гладких мышц. Саркомы мягких тканей, такие как лейомиосаркома, хондросаркома и желудочно-кишечная стромальная опухоль (GIST), чаще встречаются у взрослых, чем у детей.

В связи с каждым из данных показаний к применению, оказывается, что три клинических протокола обладают определенным потенциалом для клинического успеха:

Смежная терапия: в смежной терапии пациенты будут подвергаться лечению антителами в соответствии с настоящим изобретением в комбинации с химиотерапевтическими или противоопухолевыми агентами и/или радиационной терапией. Первичные мишени, указанные выше, будут обрабатываться по протоколу путем добавления антител по изобретению к стандартным терапиям первой и второй линии, или третьей линии. Схемы протоколов будут обращены к эффективности, оцениваемой по сокращению массы опухоли, а также по возможности снижения дозировок стандартной химиотерапии. Такие снижения доз позволят осуществлять дополнительную и/или пролонгированную терапию за счет снижения связанной с дозировками токсичности химиотерапевтического агента. Ранее известные в технике антитела против EGFR были применены, или применяются, в нескольких дополнительных клинических испытаниях в комбинации с химиотерапевтическими или противоопухолевыми агентами адриамицином (эрбитукс: прогрессирующая карцинома простаты), цисплантином (эрбитукс: прогрессирующие карциномы головы и шеи и легких), таксолом (эрбитукс: рак груди) и доксорубицином (эрбитукс).

Изобретение предоставляет фармацевтические препараты, содержащие композицию антител по изобретению и, по меньшей мере, один компонент, способный индуцировать дифференцировку раковых клеток, в виде комбинации для одновременного, отдельного или последовательного введения в терапии рака. Путем объединения композиций антител по изобретению с агентами, о которых известно, что они индуцируют конечную дифференцировку раковых клеток, эффект может быть дополнительно улучшен.

По меньшей мере один компонент может выбран из группы, состоящей из ретиноевой кислоты, трансретиноевых кислот, цис-ретиноевых кислот, фенилбутирата, фактора роста нервов, диметилсульфоксида, активной формы витамина D(3), активируемой пролифератором пероксисом рецептограммы, 12-О-тетрадеканоилфорбол 13-ацетата, гексаметилен-бис-ацетамида, трансформирующего фактора роста-бета, масляной кислоты, циклического AMP и веснаринона. Предпочтительно, компонент выбирают из группы, состоящей из ретиноевой кислоты, фенилбутирата, политрансретиноевой кислоты, активной формы витамина D.

Фармацевтические препараты, содержащие композиции антител изобретения и, по меньшей мере, один химиотерапевтический или противоопухолевый компонент, могут применяться в комбинации для одновременного, отдельного или последовательного введения в терапии рака. Химиотерапевтический компонент может быть выбран из группы, состоящей из адриамицина, цисплатина, таксола, доксорубицина, топотекана, фторпиримидина, оксалиплатина и иринотекана.

Монотерапия: в связи с применением антител в соответствии с настоящим изобретением в монотерапии опухолей, антитела могут вводиться пациентам без химиотерапевтического или противоопухолевого агента. Доклинические результаты, полученные посредством применения антител в соответствии с настоящим изобретением и обсуждаемые в настоящем документе, продемонстрировали положительные результаты в качестве самостоятельной терапии.

Визуализирующее средство: при связывании радионуклида (например, иттрия (90Y)) с антителами в соответствии с настоящим изобретением, ожидается, что помеченные радиоактивным изотопом антитела в соответствии с настоящим изобретением могут применяться в качестве диагностического визуализирующего средства. В такой роли антитела по изобретению будут локализовывать как солидные опухоли, так и метастатические очаги клеток, экспрессирующих EGFR. В связи с применением антитела по изобретению в качестве визуализирующих средств, антитела могут применяться для содействия хирургическому лечению солидных опухолей как для предшествующего хирургическому вмешательству обследования, так и для послеоперационного обследования с целью определения сохранения и/или повторного появления опухоли. Антитело (111In)-эрбитукс было применено в качестве визуализирующего средства в фазе I клинического испытания на человеке у пациентов, имеющих нерезектабельные плоскоклеточные карциномы легких (Divgi et al. J. Natl. Cancer Inst. 83:97-104 (1991)). Отслеживание пациентов проводилось с помощью стандартных предшествующих и последующих исследований в гамма-камере. Предварительные данные показали, что были идентифицированы все первичные очаги и крупные метастатические очаги, но при этом была обнаружена только половина небольших метастатических очагов (менее 1 см).

Ингибиторы тирозинкиназ (TKI) представляют собой синтетические, в основном хиназолин-производные, молекулы с низким молекулярным весом, которые взаимодействуют с внутриклеточным тирозинкиназным доменом рецепторов и ингибируют индуцируемое лигандом фосфорилирование рецептора посредством конкуренции за внутриклеточный сайт связывания Mg-ATP. Некоторые TKI, находящиеся в клинической разработке, включая гефитинив (Iressa, ZD1839), эрлотиниб (Tarceva, OSI-774), лапатинив, (Tykerb, GW572016), канертиниб (CI-1033), EKB-569 и PKI-166, нацелены на EGFR. Было показано, что совместное лечение с TKI и антителами против EGFR является благоприятным in vivo и in vitro против EGFR-зависимых раковых клеток. Фармацевтические препараты, содержащие композицию антител изобретения и, по меньшей мере, один нацеленный на EGFR TKI, могут применяться в виде комбинации для одновременного, отдельного или последовательного введения в терапии рака. Другие низкомолекулярные ингибиторы включают: сорафиниб (raf и множество RTK), сунитиниб (множество RTK), темсиролимус (mTOR), RAD001 (mTOR) и AZD217 (VEGFR2).

В других вариантах осуществления, композиции антител по настоящему изобретению применяются в комбинации с другими терапевтическими средствами, содержащими антитела. Примеры этого включают, например, антитела против HER2 (герцептин) и VEGF (авастин). В дополнительных вариантах осуществления, композиции антител по настоящему изобретению применяются в комбинации с агентом, о котором известно, что он стимулирует клетки иммунной системы, например, в комбинационном лечении, приводящем к иммунно-опосредованному повышению эффективности композиций антител изобретения. Примеры таких иммуностимулирующих агентов включают рекомбинатные интерлейкины (например, IL-21 и IL-2), но не ограничиваются ими.

Доза и путь введения

Хотя конкретные дозировки для антител в соответствии с изобретением еще не были определены, определенные соображения относительно дозировок могут быть получены путем сравнения с аналогичным одобренным продуктом (ImClone C225 (Эрбитукс)). Антитело C225 обычно вводится в дозировках в диапазоне от 5 до 400 мг/м2, с использованием более низких доз только в связи с исследованием безопасности. Соответственно, мы можем ожидать, что дозировка для пациентов антитела в соответствии с изобретением может находиться в данном диапазоне или быть более низкой, возможно, в диапазоне от 50 до 300 мг/м2, и при этом оставаться эффективной. Дозировка мг/м2, в отличие от обычных измерений дозы в мг/кг, является измерением, основанным на площади поверхности, и является удобным измерением дозы, предназначенным для охвата пациентов всех диапазонов, от детей до взрослых.

Указания по применению препарата, имеющиеся для эрбитукса (цетуксимаба), включают первоначальное 120-минутное IV-вливание 400 мг/м2, и последующие еженедельные вливания в течение 60 минут 250 мг/м2. Данные дозировки рекомендуются для автономного лечения, а также для комбинации с радиационной терапией. Для вектибикса (панитумумаба) рекомендованная дозировка составляет 6 мг/кг, вводимые в течение 60 минут каждые 14 дней.

Ожидаемая клиническая дозировка антитела Genmab HuMaxEGFr (залутумумаб) включает первоначальную дозу 8 мг/кг HuMax-EGFr, после которой проводятся еженедельные вливания поддерживающей дозы до прогрессирования заболевания. Поддерживающая доза может меняться при необходимости до появления у пациента лимитирующей дозу кожной сыпи, до максимальной дозы в 16 мг/кг HuMax-EGFr (дозировки для опорного исследования фазы III, полученные из описания продукта Genmab).

Клиническая дозировка композиций антител по настоящему изобретению, вероятно, будет ограничиваться площадью кожной сыпи, что наблюдается для моноклональных антител против EGFR (эрбитукс и вектибикс), имеющих клиническое применение в настоящее время. Данные, полученные в результате шестинедельного токсикологического исследования на яванских макаках, не показали наличия кожной сыпи при введении композиции антител изобретения в дозах, эквивалентных используемым при лечении одним из моноклональных антител, имеющих клиническое применение (пример 20). Таким образом, композиции антител изобретения могут вводиться внутривенно с еженедельной дозировкой 250 мг/м2, что соответствует 7,5 мг/кг для человека с площадью поверхности тела 1,8 м2 и массой тела 60 кг. Кроме того, первоначальная нагрузочная доза 400 мг/м2 (соответствует 12 мг/кг для человека с площадью поверхности тела 1,8 м2 и массой тела 60 кг) может быть дана до последующей еженедельной дозы.

Ожидается, что три различных подхода к доставке будут полезными для доставки антител в соответствии с изобретением. Обычная внутривенная доставка, предположительно, будет стандартной методикой доставки для большинства опухолей. Однако в отношении опухолей в брюшной полости, таких как опухоли яичников, желчных протоков, других протоков и т.п., внутрибрюшинное введение может оказаться предпочтительным для получения высоких доз антител в опухоли и для минимизации выведения антител. Аналогично, определенные солидные опухоли имеют сосудистую систему, которая является подходящей для регионарной перфузии. Регионарная перфузия позволит получить высокие дозы антител в месте расположения опухоли и минимизирует краткосрочное выведение антител.

Как и для любой терапии, основанной на инфузии произвольного белка или антитела, факторы опасности относятся в основном к (i) синдрому выброса цитокинов, то есть, гипотензии, лихорадке, дрожательному параличу, ознобу, (ii) выработке иммуногенного ответа на материал (то есть, выработке у пациентов человеческих антител к терапевтическим антителам, HAHA или HACA-ответ) и (iii) токсичности для нормальных клеток, которые экспрессируют рецептор EGF, например, гепатоцитов, которые экспрессируют EGFR. Стандартные тесты и наблюдения будут применяться для отслеживания каждого из факторов опасности. В частности, функция печени может часто отслеживаться в течение клинических испытаний с целью оценки повреждений печени, при их наличии.

Диагностическое применение

Еще один вариант осуществления изобретения относится к наборам для диагностики. Наборы в соответствии с настоящим изобретением содержат композицию антител против EGFR, приготовленную в соответствии с изобретением, белок которой может быть помечен детектируемой меткой, или может не быть помечен при не основанном на метке детектировании. Набор может применяться для идентификации лиц, пораженных раком, ассоциированным со сверхэкспрессией EGFR.

ПРИМЕРЫ

Пример 1: Клонирование антител против EGFR

Иммунизации

Самки BALB/c, штамм A или C57B16 мыши (возраст 8-10 недель) подвергались иммунизации посредством инъекций с различными очищенными белками в дополнение к клеткам, имеющим сверхэкспрессию EGFR.

Коммерчески доступные белки EGFR (R&D systems каталожный номер 1095-ER или Sigma #E3641) были использованы для некоторых иммунизаций. Для других иммунизаций были использованы рекомбинантный человеческий EGFR и EGFRvIII, продуцированные в виде слитых белков, состоящих из ECD EGFR или EGFRvIII и человеческого гормона роста (hGH), которые также содержали сайт расщепления вируса гравировки табака (TEV) в дополнение к His-тегу, описанному в примере 10b. В некоторых случаях ECD EGFR был выделен посредством TEV-протеазного расщепления и последующей очистке в колонке Nickel.

Линия клеток рака головы и шеи человека, HN5 (Easty DM, Easty GC, Carter RL, Monaghan P, Butler LJ. Br J Cancer. 1981 Jun;43(6):772-85. Ten human carcinoma cell lines derived from squamous carcinomas of the head and neck.), экспрессирующая приблизительно 107 рецепторов/клетку, была использована для основанных на клетках иммунизаций. Клетки культивировались в среде DMEM, дополненной 10% FBS (фетальная телячья сыворотка), 3 мМ глицерола, 5 мМ пируватом натрия и 1% пенициллином/ стрептомицином. Перед каждой из иммунизаций клетки промывались в PBS, трипсинизировались с TrypLE и ресуспендировались в среде для роста. После этого клеточные суспензии дважды промывались в PBS посредством центрифугирования при 250Xg в течение 5 минут, извлекались и ресуспендировались в 15 мл стерильном PBS.

Клетки и антиген разводились в PBS и затем смешивались 1:1 с адъювантом Фрейнда. Адъювант используется для улучшения и модулирования иммунного ответа. В первых иммунизациях использовался полный адъювант Фрейнда (CFA), тогда как для последующих иммунизаций использовался неполный адъювант Фрейнда (IFA). IFA представляет собой эмульсию типа «масло в воде», состоящую из минеральных масел, а CFA представляет собой IFA, в который были добавлены убитые нагреванием высушенные виды микобактерий. Оба адъюванта обладают депо-эффектом. CFA возбуждает долгосрочную устойчивость иммунного ответа и используется в первых иммунизациях для форсирования иммунного ответа, а IFA используется в последующих иммунизациях. Эмульсии были протестированы путем добавления капли на поверхность стакана с водой. Если капля сохраняется в форме одной капли, то эмульсия является стабильной, и могут выполняться ее инъекции. Мышам вводились только стабильные эмульсии.

В зависимости от графика (см. Таблицу 2), 25-100 мкг антигена или 107 клеток использовалось для каждой инъекции. Суммарно мыши получили 4 инъекции. Всем мышам инъецировалось 300 мкл или 200 мкл эмульсии. В зависимости от графика, инъекции выполнялись подкожно (s.c), внутрибрюшинно (i.p.) или внутривенно (i.v.).

В конце мыши были умерщвлены посредством сакрификации, селезенки были удалены и перенесены на 74 мкм клеточный фильтр (Corning#136350-3479). Клетки мацерировались через фильтр, ресуспендировались в охлажденном RPMI 1640 с 10% FBS и центрифугировались на 300Xg в течение 5 минут. Клеточная масса ресуспендировалась в RPMI 1640 с 1% FBS, фильтровалась через 50 мкм шприцевой фильтр (BD# 340603) и собиралась посредством центрифугирования. Клеточная масса подвергалась криоконсервации после ресуспендирования в FCS с 10% DMSO, и замороженные клетки хранились на -80°C до FACS-сортировки.

FACS-сортировка мышиных клеток плазмы

Флаконы с замороженными спленоцитами размораживались при 37°C и переносились в 15 мл пробирки, в которых все еще находился лед. 10 мл ледяного RPMI, 10% FBS (фетальная бычья сыворотка) были по каплям добавлены в пробирки при перемешивании. После одного промывания в 10 мл FACS PBS, добавлялось 5 мл FCS PBS до фильтрации клеток через 50 мкм Filcon. Клетки затем пеллетировались и ресуспендировались в 1 мл PBS с 2% FBS (конечный объем) и окрашивались анти-CD43-FITC и анти-CD138-PE в соответствии с конкретным разведением до конечной концентрации приблизительно 5 мкг/мл. Клетки инкубировались при 4°C в течение 20 минут в темноте. После этого клетки промывались 2 раза 2 мл FACS-буфера. Было добавлено вплоть до 15 мл FACS PBS. Пропидиум иодид (PI) был добавлен в концентрации 1:100 (1 часть PI на 100 частей буфера FACS PBS), и затем клетки сортировались в 96-луночных планшетах для ПЦР, содержащих рабочий буферный раствор для ПЦР (см. ниже), и центрифугировались в течение 2 минут при 400Xg, после чего планшеты замораживались при -80°C. Клетки плазмы пропускались через дискриминационное окно как CD43-положительные/CD-138 положительные, как показано на Фиг. 1.

Соединение перемешанных родственных пар V H и V L

Соединение последовательностей, кодирующих VH и VL, выполнялось на единичных клетках, дискриминированных как клетки плазмы, что способствовало образованию родственных пар кодирующих VH и VL последовательностей. В процедуре использовалась двухстадийная ПЦР-процедура, основанная на одностадийной мультиплексной ПЦР ОТ с удлинением перекрытий и последующей вложенной ПЦР. Смеси праймеров, используемые в настоящем примере, амплифицировали только каппа-легкие цепи. Однако праймеры, способные амплифицировать лямбда-легкие цепи, могут быть при необходимости добавлены в смесь праймеров для мультиплексирования или смесь праймеров для вложенной ПЦР. При добавлении лямбда-праймеров, процедура сортировки должна быть изменена таким образом, чтобы не исключать лямбда-положительные клетки. Принцип соединения родственных последовательностей VH и VL проиллюстрирован на Фиг. 2.

Полученные 96-луночные планшеты для ПЦР были разморожены, и отсортированные клетки использовались в качестве шаблона для мультиплексной ПЦР ОТ с удлинением перекрытий. Сортировочный буфер, добавлявшийся в каждую лунку до одноклеточной сортировки, содержал рабочий буфер (буфер для одностадийной ПЦР ОТ; Qiagen), праймеры для ПЦР ОТ (см. таблицу 3) и ингибитор РНКазы (RNasin, Promega). Смесь дополнялась смесью ферментов для одностадийной ПЦР ОТ (25x разбавление; Qiagen) и смесью dNTP (200 мкМ каждого) с целью получения заданной конечной концентрации в 20-мкл реакционной смеси. Планшеты инкубировались в течение 30 минут при 55°C для обеспечения обратной транскрипции РНК из каждой клетки. После обратной транскрипции планшеты участвовали в следующем цикле ПЦР: 10 минут при 94°C, 35x(40 секунд при 94°C, 40 секунд при 60°C, 5 минут при 72°C), 10 минут при 72°C.

ПЦР реакции выполнялись в термоциклере H20BIT с запечатываемым контейнером для 24 96-луночных планшетов (ABgene) для обеспечения высокой пропускной способности. ПЦР-планшеты хранились при -20°C после процедуры.

Для этапа вложенной ПЦР подготавливались 96-луночные ПЦР-планшеты со следующей смесью в каждой лунке (20-мкл реакции) для получения заданной конечной концентрации: 1x FastStart-буфер (Roche), смесь dNTP (200 мкМ каждого), смесь праймеров для вложенной ПЦР (см. Таблицу 4), ДНК-полимераза Phusion (0,08 единиц; Finnzymes) и смесь высококачественных ферментов FastStart (0,8 единиц; Roche). В качестве шаблона для вложенной ПЦР, 1 мкл был перенесен из реакций мультиплексной ПЦР с удлинением перекрытий. Планшеты для вложенной ПЦР подвергались следующему термоциклированию: 35x(30 секунд при 95°C, 30 секунд при 60°C, 90 секунд при 72°C), 10 минут при 72°C.

Случайно выбранные реакции анализировались на 1% агарозном геле с целью проверки наличия фрагмента удлинения перекрытий с длиной приблизительно 890 пар нуклеотидов (п.н.).

Планшеты хранились при -20°C до начала дальнейшей обработки ПЦР-фрагментов.

Репертуары соединенных кодирующих пар VH и VL из вложенной ПЦР объединялись в пул, без перемешивания пар от различных доноров, и очищались посредством препаративного электрофореза в 1% агарозном геле. Последовательность, кодирующая человеческую каппа-константную легкую цепь, сплайсировалась посредством удлинения перекрытий с кодирующей областью VL помещенных в пул ПЦР-продуктов соединенных кодирующих пар VH и VL (Фиг. 3). Последовательность, кодирующая человеческую каппа-константную легкую цепь, амплифицировалась из плазмиды, содержащей кодирующую последовательность человеческого антитела с каппа-легкой цепью в реакции, содержащей: Phusion-фермент (2 единицы; Finnzymes), 1x Phusion-буфер, смесь dNTP (200 мкМ каждого), праймер hKCforw-v2 и праймер каппа3' (Таблица 5), и плазмидный шаблон pLL138 (10 нг/мкл) в общем объеме 50 мкл. Реакция подвергалась следующему термоциклированию: 25x(30 секунд при 95°C, 30 секунд при 55°C, 45 секунд при 72°C), 10 минут при 72°C. Полученный в результате ПЦР-фрагмент очищался посредством препаративного электрофореза в 1% агарозном геле.

Очищенные собранные в пул ПЦР-фрагменты для каждого репертуара сплайсировались с амплифицированным и очищенным ПЦР-фрагментом области, кодирующей человеческую каппа-константную цепь (приложение 2) посредством последующего сплайсинга с применением ПЦР с удлинением перекрытий (общий объем 50 мкл), содержащим: фрагмент области, кодирующей человеческую каппа-константную цепь (1,4 нг/мкл), очищенный помещенный в пул ПЦР-фрагмент (1,4 нг/мкл), ДНК-полимеразу Phusion (0,5 единиц; Finnzymes) и смесь высококачественных ферментов FastStart (0,2 единицы; Roche), 1x FastStart-буфер (Roche), смесь dNTP (200 мкМ каждого), праймер mhKCrev и праймер mJH (см. таблицу 5). Реакция подвергалась следующему термоциклированию: 2 минуты при 95°C, 25x(30 секунд при 95°C, 30 секунд при 55°C, 1 минута при 72°C), 10 минут при 72°C. Полученный в результате ПЦР-фрагмент (приблизительно 1070 п.н.) очищался посредством препаративного электрофореза в 1% агарозном геле.

Вставка родственных кодирующих пар V H и V L

в вектор скрининга

В целях идентификации антитела со специфичностью связывания с EGFR, полученные кодирующие последовательности VH и VL были экспрессированы как полноразмерные антитела. Это включало вставку репертуара кодирующих пар VH и VL в экспрессионный вектор и трансфекцию в клетку-хозяина.

Двухстадийная процедура клонирования применялась для создания репертуара экспрессионных векторов, содержащих соединенные кодирующие пары VH и VL. Статистически, если репертуар экспрессионных векторов содержит в десять раз больше рекомбинантных плазмид, чем количество ПЦР-продуктов родственных пар VH и VL, использованных для создания репертуара скрининга, то имеется 99% вероятность того, что будут представлены все уникальные пары генов. Таким образом, если посредством удлинения перекрытия было получено 400 фрагментов V-генов, то для скрининга создавался репертуар, по меньшей мере, из 4000 клонов.

Кратко, очищенный ПЦР-продукт из репертуаров соединенных кодирующих пар VH и VL, сплайсированных с кодирующей областью человеческой каппа-константной цепи, был расщеплен ДНК эндонуклеазами XhoI и NotI в сайтах распознавания, внесенных на концах ПЦР-продуктов. Расщепленные и очищенные фрагменты сшивались в экспрессионный вектор IgG млекопитающего, расщепленный XhoI/NotI, OO-VP-002 (Фиг. 4), посредством стандартных процедур сшивания. Смесь сшивания была электропорирована в E. coli и добавлена в 2xYT планшеты, содержащие соответствующий антибиотик, и инкубировалась в течение ночи при 37°C. Амплифицированный репертуар был очищен из клеток, восстановленных из планшета, с использованием стандартных методов очистки ДНК (Qiagen). Плазмиды были подготовлены для вставки промоторных-лидерных фрагментов путем расщепления с использованием эндонуклеаз AscI и NheI. Сайты рестрикции для данных ферментов располагались между кодирующими парами генов VH и VL. После очистки вектора, расщепленный AscI-NheI двунаправленный промоторно-лидерный фрагмент млекопитающего был вставлен в сайты рестрикции AscI и NheI с помощью стандартных процедур сшивания. Сшитый вектор амплифицировался в E. coli, и плазмида очищалась с использованием стандартных методов. Созданный репертуар векторов скрининга трансформировался в E. coli посредством обычных процедур. Полученные колонии объединялись в 384-луночные базовые планшеты и хранились. Количество сгруппированных колоний превышало количество входных ПЦР-продуктов по меньшей мере в 3 раза, что давало 95% вероятность наличия всех полученных уникальных пар V-генов.

Скрининг связывания с внеклеточным доменом EGFR

Как правило, скрининг выполнялся в виде двухстадийной процедуры. Библиотеки антител подвергались скринингу относительно выявления реактивности с рекомбинантным белком EGFR в ELISA, после которого FMAT (FLISA) применялся как основанный на клетках подход с клеточной линией NR6EGFR дикого типа с целью обнаружения связывания EGFR-антител с экспрессированными на клеточной поверхности EGFR. Для 101 и 108/109 библиотек (Таблица 2) анализ ELISA выполнялся с рекомбинантным EGFR, представляющим внеклеточный домен EGFR.

Кратко, для проведения ELISA, планшеты Nunc maxisorb (каталожный номер 464718) покрывались 1 мкг/мл белка (продуцированного на месте), разбавлялись в PBS при 4°C в течение ночи. До блокирования в 50 мкл 2%-молоке-PBS-T планшеты однократно промывались PBS+0,05% Tween 20 (PBS-T). Планшеты однократно промывались PBS-T, было добавлено 20 мкл 2%-молока-PBS-T и 5 мкл супернатантов из трансфектантов Freestyle CHO-S (см. ниже), и выполнялось инкубирование в течение 1,5 часов при комнатной температуре, после чего планшеты однократно промывались 20 мкл PBS-T на лунку. Вторичное антитело (HRP-антитело козла против человеческого IgG, Jackson, каталожный номер 109-035-097), разбавленное 1:10000 в 2% молоке-PBS-T, добавлялось с целью обнаружения антител, связанных с лунками, и инкубировалось в течение 1 часа при комнатной температуре. Планшеты однократно промывались в PBS-T до добавления 25 мкл субстрата (Kem-en-tec Diagnostics, каталожный номер 4390), который инкубировался в течение 5 минут. 25 мкл 1 M серной кислоты добавлялось после инкубирования для остановки реакции. Специфичный сигнал детектировался на аппарате для прочтения ELISA на 450 нм.

Для основанном на клетках FMAT-обнаружении антител против EGFR, клетки SKBR-3 (ATCC #HTB-30) или NR6EGFR дикого типа (Welsh et al, 1991, J Cell Biol, 114, 3, 533-543) сохранялись в ростовой среде в соответствии с описанным. Клетки подсчитывались и разбавлялись до концентрации 125000 клеток/мл конъюгированным козьим антителом против человеческого IgG (H-L) Alexa-647 (молекулярные зонды No: A21445, номер лота 34686A), разведенным в соотношении 1:40000. Суммарно 20 мкл такой суспензии было нанесено на 384-луночные планшеты Nunc с чистым дном. После этого к клеткам было добавлено 10 мкл трансфекционного супернатанта. FMAT-сигнал реакции измерялся через 6-10 часов инкубации.

Данные скрининга показали, что 221 (4,8%) из общего количества клонов были положительными по ELISA. 93 (2,0%) этих клонов также были положительными по FMAT. Суммарно 220 (4,8%) были положительными по FMAT, и среди них 127 (220-93) были уникально положительными для антигена клеточной поверхности. Библиотека 111 подвергалась скринингу аналогичным образом, но поскольку процедура иммунизации была выполнена для генерации антител, специфичных для делеционного мутанта рецептора EGFR, EGFRvIII, то скрининг ELISA включал анализы на обнаружение и EGFR дикого типа, и EGFRvIII. Было идентифицировано семь клонов, являющихся специфичными для EGFRvIII в ELISA, и интересно, что данные клоны были отрицательными по окрашиванию клеток, экспрессирующих EGFR дикого типа, в FMAT. Было идентифицировано 13 клонов, положительных по EGFR дикого типа в FMAT и ELISA, но не по EGFRvIII, которые были уникальными для данной библиотеки по сравнению с библиотеками 101 и 108/109. Все клоны, положительные по ELISA, были выбраны для дальнейшего анализа.

Анализ последовательности и выбор клонов

Клоны, идентифицированные как EGFR-специфичные в ELISA, извлекались из исходных базовых планшетов (384-луночный формат) и объединялись в новых планшетах. ДНК выделялась из клонов и отправлялась на ДНК-секвенирование V-генов. Последовательности выравнивались, и отбирались все уникальные клоны. Множественные выравнивания полученных последовательностей выявляли уникальность каждого конкретного клона и позволяли идентифицировать уникальные антитела. В результате анализа последовательностей 220 клонов было идентифицировано 70 генетически различных кластеров последовательностей антител. Каждый кластер родственных последовательностей, вероятно, возник в результате соматических гипермутаций общего клона-предшественника. В целом, от одного до двух клонов из каждого кластера было выбрано для проверки последовательности и специфичности. Последовательности для вариабельных последовательностей выбранных антител приведены в Приложении 1. Нуклеотидные последовательности содержали сайты рестрикции на обоих концах. Следовательно, соответствующие оттранслированные аминокислотные последовательности (полученные с использованием третьей рамки считывания для последовательности ДНК) содержали на N-конце две аминокислоты, которые не являлись частью последовательностей VH и VL в соответствии с определением IMGT (Lefranc et al (2003) IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev. Comp Immunol 27, 55-77). Все показанные последовательности VL содержали одну и ту же человеческую каппа-константную область, которая начиналась с аминокислот TVAAP- и заканчивалась C-концевой -NRGEC. Для целей настоящего изобретения, термин «последовательность VL» при ссылке на конкретное антитело исключает каппа-константную область и две N-концевых аминокислоты (LA-). Термин «последовательность VH» при ссылке на конкретное антитело исключает две N-концевых аминокислоты (RA-).

Проверка последовательности и специфичности

В целях проверки клонов, кодирующих антитела, была приготовлена ДНК-плазмида, и была выполнена трансфекция в клетки FreeStyle CHO-S (Invitrogen) в 2-мл масштабе для экспрессии. Супернатант был собран через 96 часов после трансфекции. Уровни экспрессии оценивались посредством стандартного анти-IgG анализа ELISA, и специфичность определялась по EGFR- и EGFRvIII-специфичной ELISA. Было показано, что 85% клонов имели правильную специфичность и последовательность.

Скрининг относительно противопролиферационных эффектов

Повреждение клетки неизбежно приведет к потере способности клетки поддерживать и обеспечивать энергию для метаболической клеточной функции и роста. Исследования метаболической активности основаны на данном предположении. Обычно они измеряют митохондриальную активность. Реагент клеточной пролиферации WST-1 (Roche, каталожный номер 11 644 807 001) представляет собой готовый к использованию субстрат, который измеряет метаболическую активность в жизнеспособных клетках. Таким образом, предполагается, что метаболическая активность коррелирует с количеством жизнеспособных клеток. В данном примере анализ WST-1 был использован для измерения множества метаболически активных клеток после обработки супернатантами культуры клеток, содержащими различные антитела против EGFR.

До выполнения анализа WST-1 различные объемы 2-мл супернатантов (0, 10, 25, 50 и 150 мкл) помещались в соответствующие лунки 96-луночного планшета.

Затем клетки HN5 были промыты 1xPBS и отделены посредством трипсинизации 3 мл раствора трипсина. Затем было добавлено 17 мл полной среды, и клетки перемешивались на 300xg (1200 ед. относительной центробежной силы) в течение 5 минут. Супернатант был удален, и клетки ресуспендировались в DMEM+0,5% FBS. Клетки подсчитывались, настраивалась их концентрация, и в лунки с супернатантами было добавлено 1500 клеток, в результате чего каждая лунка суммарно содержала 200 мкл среды. Планшеты инкубировались в течение 4 дней во влажной камере при 37°C. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Различие в уровнях метаболически активных клеток (MAC) рассчитывалось как процентная доля от контрольных супернатантов в соответствии с формулой:

% M A C = ( 1 ( O D э к с п . O D с р е д ы ) ( O D н е о б р а б . O D с р е д ы ) ) × 100

Эти значения затем были использованы в качестве основы для контролируемого иерархического кластерного анализа (кластеризация на основании реактивности в ELISA), выполненного с использованием бесплатного программного обеспечения Cluster и TreeView.

Является предпочтительным обеспечение возможности скрининга функциональных антител на ранней стадии процесса отбора антител. Культуральные супернатанты из 83 2-мл трансфекций были использованы для скрининга относительно функций подавления роста в анализе пролиферации с использованием клеток HN5 в 0,5% FBS. Результаты были визуализированы посредством иерархического кластерного анализа. Как можно видеть в кластерном анализе (Фиг. 5), было обнаружено, что ряд супернатантов снижает количество метаболически активных клеток HN5 (показано темно-серым) зависимым от концентрации образом (кластер 2). Аналогично, некоторые супернатанты повышали количество метаболически активных клеток HN5 (показано светло-серым) зависимым от концентрации образом (кластеры 1, 3 и 4). Интересное наблюдение состояло в том, что супернатанты, которые снижали количество метаболически активных клеток HN5, имели реактивность 2 (черные стрелки), тогда как супернатанты, которые повышали количество метаболически активных клеток HN5, имели реактивность 1 (серые стрелки). Супернатанты с реактивностью 2 были положительными в ELISA как для EGFR дикого типа, так и для EGFRvIII, тогда как супернатанты с реактивностью 1 имели реактивность только относительно EGFR дикого типа. Таким образом, данные анализы могут установить взаимосвязь между реактивностью антител в ELISA и функциональностью в клеточных анализах.

Восстановление клонов

При использовании подхода мультиплексного ПЦР, ожидается определенная степень перекрестного примирования внутри семейств V-генов и между ними по причине вырожденности праймеров и высокой степени гомологии. Перекрестное примирование вводит аминокислоты, которые в естественном состоянии не появляются в каркасе иммуноглобулина, что приводит к нескольким потенциальным последствиям, например, структурным изменениям и повышению иммуногенности, что в целом приводит к снижению терапевтической активности.

В целях устранения данных недостатков и обеспечения того, чтобы выбранные клоны отражали природный гуморальный иммунный ответ, такие мутации перекрестного примирования исправляются в процессе, называемом восстановлением клонов.

На первом этапе процедуры восстановления клонов последовательность VH была амплифицирована посредством ПЦР с множеством праймеров, содержащим последовательность, соответствующую VH-гену, из которого происходит представляющий интерес клон, посредством чего исправляются все мутации, внесенные посредством перекрестного примирования. ПЦР-фрагмент был расщеплен с XhoI и AscI и сшит обратно в расщепленный XhoI/AscI экспрессионный вектор млекопитающего (Фиг. 4) с использованием обычных процедур сшивания. Сшитый вектор амплифицировался в E. coli, и плазмида очищалась стандартными методами. Последовательность VH секвенировалась с целью проверки исправления, и вектор был расщеплен NheI/NotI с целью его подготовки для вставки в легкую цепь.

На втором этапе полная легкая цепь была амплифицирована посредством ПЦР с множеством праймеров, содержащим последовательность, соответствующую VL-гену, из которого происходит представляющий интерес клон, посредством чего исправляются все мутации, внесенные в результате перекрестного примирования. ПЦР-фрагмент был расщеплен с NheI/NotI и вшит в содержащий VH вектор, приготовленный выше. Продукт сшивания амплифицировался в E. coli, и плазмида очищалась стандартными методами. После этого легкая цепь секвенировалась с целью проверки исправления.

В случае, когда каппа-константная область выбранного клона содержит мутации, внесенные во время амплификации генов, она заменяется немутированной константной областью. Это выполнялось в ПЦР с перекрытиями, в котором восстановленный VL-ген (амплифицированный без константной области) был слит с константной областью с правильной последовательностью (полученной в отдельном ПЦР). Последовательность целиком амплифицировалась и клонировалась в содержащий VH вектор в соответствии с описанным выше, и восстановленная легкая цепь секвенировалась с целью проверки исправления.

Таблица 2
Графики иммунизации, использованные для генерации стартового материала для клонирования антител против EGFR
График, группа мышей Штамм Инъекция 1 Инъекция 2 Инъекция 3 Инъекция 4 Окончание
101 Balb/c День 1
25 мкг rhEGFR (R&D systems 1095-ER) CFA s.c.
День 35
25 мкг rhGH-EGFR (Symphogen) IFA s.c
День 56
25 мкг rhEGFR* (Symphogen) IFA s.c
День 70
25 мкг rhEGFR* (Symphogen) IFA s.c
День 73
108 Balb/c День 1
1x107 клеток HN5
CFA i.p.
День 28
25 мкг rhEGFR* (Symphogen) IFA s.c.
День 42
1x107 клеток HN5 IFA i.p.
День 56
25 мкг rhEGFR*, (Symphogen) IFA s.c.
День 59
109 Balb/c День 1
1x107 клеток HN5
CFA i.p.
День 28
25 мкг rhEGFR* (Symphogen)
IFA s.c.
День 42
1x107 клеток HN5 IFA i.p.
День 56
25 мкг rhEGFR* (Symphogen) PBS i.v.
День 59
111 Balb/c День 1
25 мкг rhEGFR* (Symphogen)
CFA s.c.
День 28
25 мкг rhEGFR+ rhEGFRvIII** (Symphogen) IFA s.c.
День 42
25 мкг rhEGFR+ rhEGFRvIII** (Symphogen) IFA s.c.
День 56
25 мкг rhEGFR+ rhEGFRvIII** (Symphogen) IFA s.c.
День 59
118 Balb/c День 1
1x107 клеток HN5
CFA i.p.
День 29
100 мкг rhGH-EGFR (Symphogen) IFA s.c.
День 44
1x107 клеток HN5
IFA i.p.
День 58
25 мкг rhEGFR, (Sigma E3641)
IFA s.c.
День 61
119 C57B День 1
1x107 клеток HN5
CFA i.p.
День 29
100 мкг rhGH-EGFR (Symphogen) IFA s.c.
День 44
1x107 клеток HN5
IFA i.p.
День 58
25 мкг rhEGFR, (Sigma E3641)
IFA s.c.
День 61
Таблица 3
Смесь праймеров для мультиплексной ПЦР ОТ с удлинением перекрытий
Название праймера Конечная концентрация (нМ) Последовательность SEQ ID
mHCrev1 0,2 GACSGATGGGCCCTTGGTGG 1
mKappar1 0,2 GCTGTAGGTGCTGTCTTTGC 2
множество mVH
mVH A 0,04 TATTCCCATGGCGCGCCSAGGTCCARCTGCARCAGYCTG 3
mVH B 0,04 TATTCCCATGGCGCGCCGARGTGMAGCTKGTKGAGTC 4
mVH C 0,04 TATTCCCATGGCGCGCCSAGGTGCAGCTKMAGGAGTC 5
mVH 8 0,04 TATTCCCATGGCGCGCCCAGGTTACTCTGAAAGAGTC 6
mVH 9 0,04 TATTCCCATGGCGCGCCCAGATCCAGTTGGTGCAGTCTG 7
множество mVK
mVK D 0,04 GGCGCGCCATGGGAATAGCTAGCCGAYATCCAGATGACHCARWCT 8
mVK E 0,04 GGCGCGCCATGGGAATAGCTAGCCRACATTGTGMTGACHCAGTC 9
mVK F 0,04 GGCGCGCCATGGGAATAGCTAGCCSAMATTGTKCTSACCCARTCTC 10
mVK 1-2 0,04 GGCGCGCCATGGGAATAGCTAGCCGATRTTGTGATGACBCARRCT 11
W=A/T, R=A/G, S=G/C, Y=C/T, K=G/T, M=A/C, H=ACT, B=GCT;
Conc. - конечная концентрация
Таблица 4
Праймеры для вложенной ПЦР
Название праймера Конечная концентрация (нМ) Последовательность SEQ ID
mHCrev1-ext 0,2 GGACAGGGMTCCAKAGTTCCADKT 16
множество hmJK
hmJK1-v2 0,2 GACAGATGGTGCAGCCACAGTTCGTTTGATTTCCAGCTTGGTG 17
hmJK2-v2 0,2 GACAGATGGTGCAGCCACAGTTCGTTTTATTTCCAGCTTGGTC 18
hmJK4-v2 0,2 GACAGATGGTGCAGCCACAGTTCGTTTTATTTCCAACTTTGTC 19
hmJK5-v2 0,2 GACAGATGGTGCAGCCACAGTTCGTTTCAGCTCCAGCTTGGTC 20
K=G/T, M=A/C, D=AGT; Conc. - конечная концентрация
Таблица 5
Множество праймеров для сплайсинга каппа-константных фрагментов
Название праймера Конечная концентрация (нМ) Последовательность SEQ ID
Амплификация каппа-константной области человека
hKCforw-v2 0,2 GAACTGTGGCTGCACCATCTGTC 21
Kappa3' 0,2 ACCGCCTCCACCGGCGGCCGCTTATTAACACTCTCCCCTGTTG 22
Сплайсинг посредством удлинения наложений
mhKCrev 0,2 ACCGCCTCCACCGGCGGCCGCTTATTAACACTCTCCCCTGTTGAAGCTCTT 23
множество mJH
mJH1 0,2 GGAGGCGCTCGAGACGGTGACCGTGGTCCC 12
mJH2 0,2 GGAGGCGCTCGAGACTGTGAGAGTGGTGCC 13
mJH3 0,2 GGAGGCGCTCGAGACAGTGACCAGAGTCCC 14
mJH4 0,2 GGAGGCGCTCGAGACGGTGACTGAGGTTCC 15

Пример 2: Продуцирование в млекопитающих антител против EGFR

Экспрессионная система FreeStyle MAX CHO (Invitrogen) была использована для транзиентной экспрессии антител против EGFR. Антитела экспрессировались в объеме 200-2000 мл.

Приблизительно за 24 часа до трансфекции клетки CHO-S пассировались до достижения концентрации клеток 0,5×106 клеток/мл. Плазмида (1,25 мкг на мл культуральной клеточной среды) была разведена в бессывороточной среде OptiPro и смешана с раствором реагента для трансфекции FreeStyle MAX в соответствии с рекомендациями поставщика. Реагенты для трансфекции были помещены в клеточную культуру, и супернатант собирался по прошествии 6 дней.

Экспрессированные антитела были очищены от культуры супернатанта с применением этапа аффинной хроматографии с использованием белковой A-сефарозной колонки (MabSelect Sure, GE Health Care) для очистки молекул IgG1. Антитела были элюированы из колонки с использованием 0,1 M глицина, 2,7. Фракции, содержащие антитела, определенные по измерениям поглощения при 280 нм, объединялись в пул и подвергались диализу с 5 мМ ацетатом натрия, 150 мМ NaCl, pH 5. Очищенные образцы антител тестировались на наличие эндототоксина посредством анализа LAL.

Пример 3: Определение специфичностей эпитопов

Конкурентный ELISA с контрольными антителами

Посредством использования контрольных антител, связывающихся с известными доменами EGFR, в соответствии с опубликованным в работе J. R. Cochran et. al., JIM 2004: 287; 147-158, был разработан конкурентный ELISA-анализ, который позволяет различать связывающие эпитопы антител против EGFR путем инкубации со вторым реагентом, являющимся специфичным для человеческой Fc-области антител против EGFR и не демонстрирующим перекрестную реактивность с IgG Fc мыши или крысы. ELISA был настроен на основании описаний, опубликованных в работе Ditzel et al, 1995, The Journal of Immunology, Vol 154, Issue 2, 893-906.

ELISA с блокированием эпитопов выполнялся путем разведения полноразмерного антигена рецептора EGFR до 0,5 мкг/мл в PBS; и нанесения 50 мкл в лунки для ELISA на ночь при 4°C. На следующее утро лунки дважды промывались PBS-T и блокировались на один час с PBS-T-1% BSA при комнатной температуре, после чего проводилось двукратное промывание в PBS-T. Затем 25 мкл мышиных или крысиных контрольных mAb было добавлено в независимые лунки ELISA в условиях разбавления, о котором из предыдущих экспериментов было известно, что оно дает 200-кратное максимальное связывание антигена. После 15 минут, 25 мкл антитела против EGFR в концентрации 2 мкг/мл было добавлено в лунки, предварительно инкубированные с контрольными антителами, или лунки, содержащие 25 мкл PBS. Это дало конечную концентрацию 1 мкг/мл антитела против EGFR и 100-кратное максимальное связывание антигена контрольных антител после смешивания. Антитела инкубировались в течение 45 минут при комнатной температуре, после чего лунки четыре раза промывались PBS-T. Вторичный HRP-конъюгат козьего антитела против человеческого IgG разводился в соотношении 1:3000, и 50 мкл было добавлено в каждую лунку, после чего в течение 30 минут проводилась инкубация при комнатной температуре. В конце лунки четыре раза промывались PBS-T, планшеты подготавливались путем добавления 50 мкл/лунку TMB и прочитывались на 620 нм каждые 5-15-30 минут. Степень ингибирования рассчитывалась по формуле: % ингибирования = (1-(OD при конкуренции/OD при отсутствии конкуренции (PBS)))×100.

Реагенты для ELISA:

1) Покрывающий буфер: 1×PBS; Gibco каталожный номер:20012-019

2) Антигены: Полноразмерный EGFR дикого типа, очищенный из клеток A431; Sigma E3641

3) Планшет для ELISA: NUNC Maxisorp; каталожный номер: 442404

4) Блокирующий/разбавляющий буфер: 1% BSA в PBS-T (PBS-T-1% BSA)

5) Отмывочный буфер: 1×PBS/0,05% Tween 20 (PBS-T)

6) Положительный контроль: эрбитукс (Merck KGaA, 64271 Darmstadt, Germany, каталожный номер 018964; цетуксимаб), вектибикс (Amgen Inc, One Amgen Center Drive, Thousand Oaks CA 91320-1799, USA, каталожный номер 3241400; панитумумаб)

7) Контрольные антитела:

• ICR10 (крысиное), Abeam, Ab231

• 199.12 (мышиное), Lab Vision Ab-11, MS-396-PABX

• EGFR.1 (мышиное), Lab Vision Ab-3, MS-31 1-PABX

• H11 (мышиное), Lab Vision Ab-5, MS-316-PABX

• B1D8 (мышиное), Lab Vision Ab-16, MS-666-PABX

• 111.6 (мышиное), Lab Vision Ab-10, MS-378-PABX

• 225 (мышиное), Lab Vision Ab-2, MS-269-PABX

• 528 (мышиное), Lab Vision Ab-1, MS-268-PABX

8) HRP-конъюгат козьего антитела против человеческого IgG; Serotec, Star 106P

9) TMB Plus; KemEnTec, каталожный номер 4390L

10) 1 M H2SO4

Результат конкурентного ELISA показан на Фиг. 6. Конкурентные анализы ELISA применялись для ранжирования супернатантов антител против EGFR в соответствии с доменной специфичностью используемых контрольных антител, вырабатываемых против внеклеточного домена EGFR. Значения ингибирования от 50 до 100% принимались за указание на значимую конкуренцию между парами антител, связывающими перекрывающиеся эпитопы или эпитопы вблизи антигена, тогда как значения ингибирования ниже 50% указывали, что распознаваемые парами антител эпитопы не находились близко друг от друга, что приводило к уменьшению стерических препятствий. Было обнаружено, что антитела против EGFR связывают ряд эпитопов на ECD EGFR, включая домены I, II & III. Для некоторых антител данный анализ не смог различить, было ли направлено специфичное mAb против домена I или домена II. Такие специфичности были обозначены как домен I/II. Кроме того, было обнаружено, что некоторые антитела связывали уникальные эпитопы, которые не могли быть конкретно установлены в используемом конкурентном ELISA (например, клоны 1229 & 1320, Фиг. 6). Возможно, некоторые из этих антител направлены против домена IV, для которого не было реактивностей контрольных антител. Интересно, что антитела домена III могли быть дополнительно разделены на четыре подгруппы на основании различных профилей конкурирования, полученных с тестируемыми мышиными контрольными антителами против данного домена. Группа I состояла только из антитела mAb 992, которое, как было обнаружено, конкурировало за связывание с контрольными антителами Ab1 & Ab2. Группа II состояла из mAb 1024 & 1042, которые были получены из одной и той же перестройки Ig, и, следовательно, имели очень близкую гомологию последовательности на уровне ДНК и аминокислот. Было обнаружено, что эти два антитела конкурируют за связывание только с Ab2. Группа III состояла из mAb 1030, 1208 & 1277, которые конкурировали за связывание с контрольными антителами Ab1, Ab5 & Ab10. Наконец, группа IV состояла из mAb 1254, которое конкурировало за связывание со всеми использованными контрольными антителами домена III Ab1, Ab2, Ab5 & Ab10.

Анализ конкуренции для различных эпитопов в отношении антител одного и того же вида с использованием технологии поверхностного плазмонного резонанса

SPR-анализ был выполнен на устройстве Biacore 3000, содержащем четыре проточных кюветы. Чип CM5 Biacore был конъюгирован с 10000 резонансными единицами (Ru) поликлонального антитела против His в проточных кюветах 1-4 в соответствии с инструкциями производителя. При использовании скорости течения 5 мкл/мин, 15 мкл 6xHis ECD EGFR в концентрации 20 мкг/мл было впрыснуто и захвачено во всех четырех проточных кюветах, с которыми было конъюгировано поликлональное антитело против His. Сразу же после впрыскивания антигена было установлено максимальное связывание mAb против EGFR без конкуренции в каждой проточной кювете во время контрольного цикла. Кратко, 5 мкл антитела в концентрации 40 мкг/мл было впрыснуто во все проточные кюветы с захваченным EGFR, после чего проводилось удаление комплекса антитело/антиген посредством кислотного промывания с низким pH (10-секундный контакт с 10 мМ глицина-HCl, pH 2). После определения максимального связывания антитела против EGFR с каждой проточной кюветой, выполнялся прогон с конкуренцией в течение того же цикла Biacore. Проточные кюветы сначала насыщались антигеном ECD EGFR, после чего проводилось инжектирование различных контрольных антител или антител против EGFR в отдельные проточные кюветы с использованием тех же условий насыщений антигена, что и указанные выше. После данного этапа сразу же выполнялось второе инжектирование антител против EGFR в проточные кюветы, насыщенные антигеном EGFR и конкурирующим антителом, в целях минимизации диссоциации антигена или блокирующего антитела. Затем комплексы антитело/антиген удалялись посредством кислотного промывания с низким pH (10-секундный контакт с 10 мМ глицина-HCl, pH 2), и все начало цикла с контрольным прогоном повторялось с новым антителом против EGFR. Степень ингибирования тестируемых антител против EGFR определялась путем сравнения максимального значения Усл.ед. отдельного антитела против EGFR до и после конкурирования посредством установки точек контрольных записей за две секунды до и после инжектирования каждого образца. Пример одного из циклов Biacore показан на Фиг. 7.

Реагенты:

1. Чип CM5; Biacore, каталожный номер BR-1000-14

2. NHS; Biacore BR-1000-50

3. EDC; Biacore BR-1000-50

4. 10 мМ ацетатный буфер pH 4,5; Biacore, каталожный номер BR-1003-50

5. Тетра-His антитело (без BSA); Qiagen, каталожный номер 34670

6. Этаноламин, 1,0M pH 8,5; Biacore BR-1000-50

7. 10 x HBS-EP подвижный бефер: 0,01 M HEPES pH 7,4, 0,15 M NaCl, 3 мМ EDTA, 0,005% по объему сурфактанта P20

8. Антиген: продуцированный собственными силами рекомбинантный внеклеточный домен EGFR с 6xHis

9. 10 мМ глицин-HCl pH 2,0

10. Контрольные антитела:

• ICR10 (крысиное), Abeam, Ab231

• 199.12 (мышиное), Lab Vision Ab-11, MS-396-PABX

• EGFR.1 (мышиное), Lab Vision Ab-3, MS-31 1-PABX

• H11 (мышиное), Lab Vision Ab-5, MS-316-PABX

• B1D8 (мышиное), Lab Vision Ab-16, MS-666-PABX

• 111.6 (мышиное), Lab Vision Ab-10, MS-378-PABX

• 225 (мышиное), Lab Vision Ab-2, MS-269-PABX

• 528 (мышиное), Lab Vision Ab-1, MS-268-PABX

В целях подтверждения анализа эпитопов, проведенного в конкурентном ELISA, и для выполнения дополнительного анализа эпитопов посредством конкурирования между парами антител против EGFR одного вида, был проведен анализ конкуренции на основании связывания антитела, измеренного в реальном времени с помощью поверхностного плазмонного резонанса. Полученная карта эпитопов клонов против EGFR, протестированных против панели контрольных антител, показана ниже на Фиг. 8. Значения ингибирования от 50 до 100% принимались за указание на значимую конкуренцию между парами антител, связывающими перекрывающиеся эпитопы или эпитопы вблизи антигена, тогда как значения ингибирования ниже 50% указывали, что распознаваемые парами антител эпитопы не находились близко друг от друга, что приводило к уменьшению стерических препятствий. Значения ингибирования ниже 25% не включались в анализ перекрывающихся эпитопов, поскольку они считались представляющими незначительное ингибирование. Было обнаружено, что все протестированные антитела кроме 1320 конкурируют с одним или более использованными контрольными антителами, что указывает на то, что 1320 было направлено на неизвестный эпитоп, для которого у нас не было реактивностей контрольных антител. Полностью человеческие или гуманизированные антитела вектибикс и эрбитукс были включены в анализ, и было обнаружено, что они связывают перекрывающиеся эпитопы. Данные, полученные в результате конкурентного ELISA и конкурентного SPR-анализа, в основном хорошо коррелируют в отношении установленной доменной специфичности антител против EGFR. Однако небольшие различия в профиле конкуренции между отдельными контрольными антителами иногда наблюдались в двух исследованиях, возможно, по той причине, что в конкурентном анализе ELISA использовался полноразмерный антиген рецептора EGFR, тогда как в конкурентном анализе SPR использовался рекомбинантный внеклеточный домен EGFR.

После подтверждения картирования эпитопов антител против EGFR в двух различных анализах конкуренции, был проведен анализ конкуренции комбинаций пар антител против EGFR одного вида с целью выявления того, какие пары антител распознавали различные эпитопы, и могли ли пары антител, распознающие перекрывающиеся эпитопы, быть дополнительно разделены на кластеры эпитопов. Результаты данного анализа показаны на Фиг. 9. В данном анализе опять значения ингибирования от 50 до 100% принимались как указание на значительную конкуренцию между парами антител, связывающими перекрывающиеся эпитопы. Данный критерий представляется обоснованным, поскольку антитела тестировались друг против друга, и, следовательно, распознавание полностью перекрывающихся эпитопов приводило к значениям ингибирования между 70% и 100%, как показано на Фиг. 9. Кроме того, данное наблюдение иллюстрирует тот факт, что диссоциация антигена или пар антител во время анализа, как оказывается, не влияла на исход эксперимента для протестированных антител. При группировке антител в соответствии с предполагаемой специфичностью относительно домена ECD EGFR, определенной в предыдущих разделах, было обнаружено, что антитела, связывающиеся исключительно с доменом I или с доменами I или II (I/II), кластеризуются в основном с представителями антител с теми же специфичностями, а не с представителями антител, распознающими домен III. Аналогично, было обнаружено, что антитела домена III конкурируют за связывание только с представителями антител, распознающими домен III, и не конкурируют с антителами, распознающими домен EGFR I или I/II. Хотя было обнаружено, что два антитела домена III 1024 & 1042, полученные в результате перестройки одного и того же Ig, распознают перекрывающиеся эпитопы, не было обнаружено, что парные комбинации 1024 или 1042 с 992 или 1030 приводят к значительной конкуренции. Следовательно, был сделан вывод о том, что антитела 992, 1030 & 1024/1042 распознавали три неперекрывающихся эпитопа на домене III ECD EGFR. Наконец, было обнаружено, что mAb 1320 конкурирует за связывание с mAb 1024 и 1449, направленными против домена III, и не конкурирует с другими протестированными антителами домена III (конкуренция 1320 с 1042 не была определена). Следовательно, предполагалось, что mAb 1320 связывалось на периферии домена III на внеклеточном домене EGFR. Обзор специфичностей эпитопов можно увидеть на Фиг. 10, где проиллюстрированы карты эпитопов антител, направленных против доменов ECD EGFR I, I/II или III.

После обнаружения того, что парные комбинации 992, 1030 & 1024/1042 не приводили к значительной конкуренции антител, в соответствии с определенным посредством SPR, были запланированы новые эксперименты на Biacore для изучения того, сколько антител могло одновременно связываться с антигеном рецептора. Сначала исследовалось, какое влияние насыщения домена III тремя антителами 992, 1024 и 1030 оказывает на связывание антител, направленных против других специфичностей EGFR, не относящихся к домену III. Результаты данного анализа показаны на Фиг. 11 A. Ингибирование одиночных антител устанавливалось путем их тестирования в комбинации с другими одиночными антителами или смесями антител, содержащими вплоть до трех антител, созданными посредством последовательного добавления одного дополнительного антитела в течение каждого цикла Biacore. В целях обеспечения полного блокирования распознанного эпитопа, антитела тестировались в индивидуальных концентрациях 40 мкг/мл. Как показано на Фиг. 11 A, было обнаружено, что антитела домена III 992, 1024 & 1030 одновременно связываются с рецептором при отсутствии какого-либо ингибирования связывания. Наблюдаемые отрицательные значения ингибирования, возрастающие при добавлении каждого антитела, предполагают наличие синергии при связывании следующего добавляемого антитела. Важно, что после инкубирования домена III с тремя антителами, оказалось, что другие антитела, направленные против неперекрывающихся эпитопов на домене I/II (mAb 1261), домене I (1347) или с неизвестной специфичностью (1361), связываются без блокирования эпитопов смесью трех mAb. Кроме того, данные протестированные антитела имели небольшие отрицательные значения ингибирования, что указывало на то, что они стали связываться лучше после насыщения рецептора смесью трех mAb. Следовательно, данный эксперимент предполагает, что шесть протестированных антител могут одновременно связываться с ECD EGFR. В целях дальнейшего тестирования наблюдаемого явления, была создана смесь антител, состоящая из всех протестированных антител (1261, 1347, 992, 1024, 1030 & 1361), и она была протестирована относительно ингибирования каждого отдельного образца антитела в смеси. Смеси антител, в которые не было включено тестируемое антитело, также тестировались и служили в качестве положительного контроля. Как представлено на Фиг. 11 B/C, было обнаружено, что все шесть протестированных антител ингибируются от 80 до 116% при тестировании на связывание с рецептором EGF, инкубированным с полной смесью антител. Однако когда отдельные образцы антител были удалены из смеси, не было отмечено значительного ингибирования конкретного антитела-образца, что является иллюстрацией того, что антитела в смеси блокировались от связывания с рецептором EGF только самими собой. Данный эксперимент ясно иллюстрирует, что по меньшей мере шесть антител, распознающих неперекрывающиеся эпитопы, могут одновременно связываться с EGFR. В качестве последнего эксперимента, было исследовано, могут ли другие антитела, направленные против домена I (1284), I/II (1257), или из кластера с неизвестной специфичностью (1183, 1255), связываться с EGFR после того, как он был инкубирован со смесью из шести антител. Как показано на Фиг. 11D, ни одно из тестируемых антител не могло существенно связываться с EGFR после предварительного инкубирования со смесью из шести антител. Это могло происходить, поскольку коллекции антител не содержали антитела против какого-либо из сайтов, оставшихся незанятными шестью связанными антителами. В качестве альтернативы, возможно, что действительно все сайты на тестируемых доменах были блокированы антителами.

Таблица 6
Коммерчески доступные антитела с документированными специфичностями против внеклеточных доменов EGFR
Клон Вид Домен I Домен II Домен III
ICR10 крыса X
199.12/Ab11 мышь X
EGFR.1/Ab3 мышь X
H11/Ab5 мышь X
111.6/Ab10 мышь X
528/Ab-1 мышь X
225/Ab-2 мышь X

Пример 4: Ингибирование активации EGFR

Определение опосредованного антителами блокирования связывания лиганда EGF с рецептором EGFR посредством конкурентного ELISA

Для проверки того, что тестируемые антитела против EGFR связывались с рецептором EGFR и одновременно блокировали связывание биотинилированного лиганда EGF, лунки ELISA были покрыты 80 мкл/лунку полноразмерного EGFR в концентрации 0,5 мкг/мл в PBS и оставлены на ночь при 4°C. На следующее утро лунки дважды промывались PBS-T и блокировались на один час с 150 мкл PBS-T-1% BSA при комнатной температуре, после чего проводилось двукратное промывание в PBS-T. Затем 80 мкл последовательно разведенных антител против EGFR и контрольных антител было добавлено в лунки, и проводилась инкубация в течение 30 минут при комнатной температуре. После инкубации антитела 20 мкл биотинилированного лиганда EGF в концентрации 0,5 мкг/мл было добавлено во все лунки, содержащие разведенные антитела против EGFR, или в лунки, содержащие только PBS-T 1% BSA, и проводилось инкубирование при комнатной температуре в течение 1 часа. Затем лунки пять раз промывались PBS-T, после чего выполнялось инкубирование со 100 мкл/лунку вторичного реагента стрептавидин-HRP, разведенного 1:1000 в блокирующем буфере, при комнатной температуре в течение 30 минут. В конце лунки пять раз промывались PBS-T, и были сформированы планшеты путем добавления 100 мкл/лунку субстрата TMB, после чего проводилась инкубация в течение 60 минут. После инкубации реакция останавливалась путем добавления 1 M H2SO4; 100 мкл/лунку и планшеты прочитывались при OD 450 нм.

Реагенты для ELISA:

1) Покрывающий буфер: 1×PBS; Gibco, каталожный номер:20012-019

2) Антиген: полноразмерный EGFR дикого типа, очищенный из клеток A431; Sigma E2645

3) Планшет для ELISA: NUNC Maxisorp; каталожный номер: 442404

4) Блокирующий/разбавляющий буфер: 1% BSA в PBS-T (PBS-T-1% BSA)

5) Отмывочный буфер: 1x PBS/0,05% Tween 20 (PBS-T)

6) Положительный контроль: эрбитукс, вектибикс

7) Отрицательный контроль: Synagis (Medimmune Inc, паливизумаб, каталожный номер NDC 60574-4111-1)

8) Биотинилированный лиганд EGF; Invitrogen, каталожный номер E3477

9) Стрептавидин-HRP, сверхчувствительный: Sigma S 2438

10) TMB Plus; KemEnTec, каталожный номер 4390L

11) 1 M H2SO4

Конкурентные анализы ELISA применялись для ранжирования антител против EGFR в соответствии со способностью ингибирования связывания биотинилированного лиганда EGF с полноразмерным рецептором EGFR, нанесенным на лунки ELISA. Как показано на Фиг. 12, оказалось, что и эрбитукс, и вектибикс очень эффективно блокируют лиганд EGF, тогда как антитело отрицательного контроля Synagis, не направленное против EGFR, не ингибировало связывание лиганда EGF. Как показано на Фиг. 12A, три антитела 992, 1030 и 1042, направленных против домена III и распознающих неперекрывающиеся эпитопы, тестировались по отдельности или в эквимолярной смеси на предмет их способности ингибировать связывание лиганда EGF. Из трех протестированных антител только mAb 1030 продемонстрировало умеренную активность по ингибированию лиганда EGF по сравнению с эрбитуксом и вектибиксом. Эквимолярная смесь mAb 992, 1030 и 1042 оказалась более эффективной для ингибирования связывания лиганда EGF, чем единичные антитела, протестированные по отдельности. При суммарной концентрации IgG 1 мкг/мл, было обнаружено, что эквимолярная смесь ингибирует связывание лиганда EGF приблизительно в два раза эффективнее, чем mAb 1030, и в четыре раза эффективнее, чем mAb 992 & 1042, протестированные по отдельности, что демонстрирует синергетический эффект смешивания трех антител домена III, распознающих неперекрывающиеся эпитопы. Как показано на Фиг. 12B, клоны антител против EGFR 1208, 1260, 1277 & 1320 также были протестированы в данном анализе. Эти четыре клона были способны подавлять связывание лиганда EGF зависящим от дозы образом и более эффективно, чем наблюдалось для клонов 992, 1030 и 1042 при сравнении с контролем-эрбитуксом. При концентрациях выше 0,33 мкг/мл клоны антител против EGFR 1208, 1260, 1277 & 1320, как оказалось, были настолько же эффективны в блокировании связывания лиганда EGF, как и эрбитукс, протестированный при тех же концентрациях.

Способность к подавлению индуцированного EGF

фосфорилирования EGFR в клетках HN5

Антитела против EGFR были протестированы на реактивность при фосфорилировании EGFR в вестерн-анализе в клетках. Процедура вестерн-анализа в клетках позволяет детектировать EGFR и фосфорилированный EGFR (pEGFR) из того же образца, что, в свою очередь, позволяет сравнить отношение экспрессии EGFR к экспрессии pEGFR для каждой обработки антителом и каждого множества данных. Клетки HN5 культивировались в соответствии с инструкциями, предоставленными ATCC, в DMEM, дополненной 10% FCS и пенициллином/стрептомицином (pen/strep). 43000 клеток HN5 было высеяно на 96-луночные планшеты от Nunc (каталожный номер 167008) за 24 часа до выращивания на минимальной среде. Клетки выращивались с недостатком компонента среды в DMEM в течение 16 часов. Антитела были добавлены в конечной концентрации 10 мкг/мл в 200 мкл DMEM, и смесь перемешивалась посредством пипетирования вверх и вниз по меньшей мере пять раз. После 30 минут обработки антител в соответствующие лунки был добавлен EGF в концентрации 50 мкг/мл, и оставлен на 7,5 минут. Вестерн-анализы в клетках выполнялись в основном в соответствии с инструкциями, предоставленными производителем набора для вестерн-анализа в клетках (Odyssey, LI-COR biosciences).

Клетки фиксировались в 3,7% формальдегиде (Sigma F-8775, лот 71K500, содержащем ~1% метанол) в течение 20 минут после стимуляции EGF. Пять промываний PBS-Triton X-100 (0,1%) в течение 5 минут использовались для установки проницаемости клеточных мембран до блокирования в блокирующем буфере (927-40000). Первичные антитела были добавлены в концентрациях, соответствующих предоставленным инструкциям, и инкубировались при мягком встряхивании при комнатной температуре в течение 2,5 часов (тотальный мышиный EGFR, разведенный 1:500, Biosource International, каталожный номер AHR5062 и фосфо-EGFR Tyr1173 кролика, разведенный 1:100, Biosource, Каталожный номер 44-794G).

После инкубации с первичными антителами клетки промывались пять раз в течение пяти минут в PBS-T (0,1% tween-20), после чего добавлялись вторичные козьи антитела (против кролика IRDye 680, разведение 1:200, LI-COR, каталожный номер 926-32221 и козьи антитела против мыши, IRDye 800CW, разведение 1:800; LI-COR, каталожный номер 926-32210) и инкубировались в течение 1 часа при комнатной температуре при мягком встряхивании планшета, покрытого алюминиевой фольгой.

До проведения измерений на устройстве считывания флуоресценции Tecan планшет пять раз промывался PBS-T в течение пяти минут. Все промывания завершались резким прерыванием со сбрасывающим движением, открытой стороной вниз, для рассеивания промывочного раствора, после чего планшет выбивался на бумажное полотенце. (Аналогично обработке планшетов для ELISA, важно отметить, что клетки остаются в планшете во время данной обработки, и что промывающий раствор может быть удален посредством данной процедуры, а не откачки, которая может повредить целостность монослоя клеток). Остатки промывочного раствора, оставшиеся от последнего промывания, удалялись аккуратным откачиванием со стороны лунок с помощью мультиканальной пипетки. Сигнал флуоресценции измерялся для канала 680 нм (возбуждение на 675 нм и излучение на 705 нм, оба в диапазоне 10 нм) и для канала 800 нм (возбуждение на 762 нм и излучение на 798 нм, оба в диапазоне 10 нм).

При использовании вестерн-анализа в клетках становится очевидным, что три антитела значимо (p<0,05) влияют на pEGFR-состояние клеток HN5; (антитела 1208, 1277 и 1320, Фиг. 13).

Смесь антител против EGFR (992, 1030 и 1042) и отдельные антитела в ней были протестированы в вестерн-анализе в клетках относительно влияния на ингибирование индуцированного EGF фосфорилирования EGFR. Как видно на Фиг. 14, 992 и 1030 и смесь антител против EGFR значимо ингибировали индуцированное EGF фосфорилирование EGFR (p<0,05).

Пример 5: Интернализация рецепторов EGF в клетках A431 NS

Клетки A431 NS (ATCC# CRL-2592) были трипсинизированы из 80-90% конфлюентной колбы с культурой T175 с использованием TrypLE. Отделенные клетки промывались в PBS и суспендировались в DMEM без сыворотки. Клетки разделялись на порции 1-2 мл и инкубировались 30 минут на льду с анализируемыми антителами. Концентрация антител составляла 10 мкг/мл. Клетки промывались три раза DMEM (250g, 4 мин, 4°C) и ресуспендировались в 1,8 мл DMEM. Каждая порция была разделена на шесть FACS-пробирок, каждая из которых содержала 300 мкл клеточной суспензии. Три пробирки из каждой порции помещались в водяную баню на 37°C ровно на 40 минут, и другие три сразу же помещались на лед. После инкубирования клетки дважды промывались при (250g, 4 минут, 4°C), и осадок повторно растворялся в 100 мкл антитела кролика против человеческого IgG Fcγ F(ab')2-FITC в DMEM. Клетки инкубировались в течение 30 минут при 4°C до трехкратного промывания в 4°C DMEM и анализа на FACSCalibur.

Результаты показаны на Фиг. 15. Инкубирование с эрбитуксом и вектибиксом показало одинаковый уровень интернализации рецептора около 30%, оставляя 70% первоначального окрашивания поверхности. Инкубирование только с 992 привело к 45% пониженной регуляции рецептора. Инкубирование со смесью антител, содержащей два дополнительных антитела с неперекрывающимися эпитопами, привело к увеличению понижения регуляции рецептора: 992+1024, 74%; 992+1024+1030, 83%.

Добавление дополнительных антител не приводило к дальнейшему повышению интернализации рецептора. Таким образом, по-видимому, для достижения максимального уровня интернализации в клетках A431 требуется, по меньшей мере, три антитела.

Пример 6: Исследование пролиферации

Клеточное повреждение будет обязательно приводить к потери способности клеток охранять и предоставлять энергию для метаболической функции клеток и роста. Реагент клеточной пролиферации WST-1 (Roche, каталожный номер 11644807001) представляет собой готовый к использованию субстрат, который измеряет метаболическую активность в жизнеспособных клетках. Таким образом, предполагается, что метаболическая активность коррелирует с количеством жизнеспособных клеток. В данном примере анализ WST-1 был использован для измерения множества метаболически активных клеток после лечения различными антителами в различных концентрациях.

До выполнения анализа WST-1 соответствующие антитела и смеси антител были разведены до конечной суммарной концентрации антител 20 мкг/мл в DMEM, дополненном 0,5% FBS и 1% P/S, что давало конечную концентрацию антител 10 мкг/мл в лунке с наибольшей концентрацией антител. Затем 150 мкл данных растворов было добавлено в лунки в столбце 2 96-луночного планшета, и было выполнено трехкратное последовательное разведение до столбца 9, с тем чтобы каждая лунка содержала 100 мкл раствора антител. 100 мкл среды было добавлено в столбец 11. 200 мкл среды было добавлено в ряды 1 и 8, а также в столбцы 1 и 12, с целью понижения влияния испарения среды для использовавшихся в эксперименте лунок.

Затем клетки A431-NS промывались 1xPBS и отсоединялись посредством трипсинизации с 3 мл раствора трипсина. Затем было добавлено 17 мл полной среды, и подвергали центрифугированию при 300xg (1200 ед. относительной центробежной силы) в течение 5 минут. Супернатант удалялся, и клетки ресуспендировались в DMEM+0,5% FBS. Затем подсчитывалось количество клеток, и их концентрация доводилась до 15000 клеток/мл. Затем в экспериментальные лунки в столбцах 2-11 добавлялось 100 мкл клеточной суспензии (1500 клеток/мл). Планшеты инкубировались в течение 4 дней во влажной камере при 37°C. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Количество метаболически активных клеток (MAC) рассчитывалось как процентная доля от необработанного контроля в соответствии с формулой:

% M A C = ( 1 ( O D э к с п . O D с р е д ы ) ( O D н е о б р а б . O D с р е д ы ) ) × 100

Для исследований титрования EGF, лиганд разбавлялся до концентрации 20 нМ/мл в DMEM+0,5% FBS, что давало конечную концентрацию 10 нМ/мл в лунке с наибольшей концентрацией. Затем 150 мкл данного раствора было добавлено в лунки в столбце 2 96-луночного планшета, и было выполнено трехкратное последовательное разведение до столбца 9, с тем чтобы каждая лунка содержала 100 мкл раствора EGF. 100 мкл среды было добавлено в столбец 11. 200 мкл среды было добавлено в ряды 1 и 8, а также в столбцы 1 и 12, с целью понижения влияния испарения среды для использовавшихся в эксперименте лунок. Соответствующие антитела и смеси антител были разведены до конечной суммарной концентрации антител 40 мкг/мл в DMEM, дополненном 0,5% FBS и 1% P/S, что давало конечную концентрацию антител в лунках 10 мкг/мл. Затем 50 мкл данных растворов было добавлено в лунки в столбцах 2-9 96-луночного планшета.

Затем клетки A431-NS промывались 1xPBS и отсоединялись посредством трипсинизации с 3 мл раствора трипсина. Затем было добавлено 17 мл полной среды, и подвергали центрифугированию при 300xg (1200 ед. относительной центробежной силы) в течение 5 минут. Супернатант удалялся, и клетки ресуспендировались в DMEM+0,5% FBS. Затем подсчитывалось количество клеток, и их концентрация доводилась до 40000 клеток/мл. Затем в экспериментальные лунки в столбцах 2-11 добавлялось 50 мкл клеточной суспензии (2000 клеток/мл). Планшеты инкубировались в течение 4 дней во влажной камере при 37°C. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Количество метаболически активных клеток измерялось путем вычитания из поглощения при 450 нм поглощения на опорной длине волны 620 нм.

Количество метаболически активных клеток (MAC) рассчитывалось как процентная доля от необработанного контроля в соответствии с формулой:

% M A C = ( 1 ( O D э к с п . O D с р е д ы ) ( O D н е о б р а б . O D с р е д ы ) ) × 100

Результаты

Для того чтобы показать, что смесь трех антител против EGFR с неперекрывающимися эпитопами в пределах домена III является превосходящей по отношению к отдельным антителам, был выполнен эксперимент, в котором исследовалось подавление роста A431-NS. Как можно видеть на Фиг. 16A, сами по себе антитела являются слабыми ингибиторами роста A431-NS, но при их объединении возникает синергетический ингибирующий эффект на рост 431-NS. Несмотря на то, что смеси 992 с 1042 или 1030 также достаточно сильные, смесь всех трех антител превосходит их во всех диапазонах концентраций антител.

Исследовалось влияние отдельных антител и смесей антител на рост клеток A431-NS, стимулируемых различными концентрациями EGF, и результаты показаны на Фиг. 17. Как можно видеть на Фиг. 17, концентрации EGF выше 0,1 нМ в отсутствие антител являются токсичными для клеток. Однако является очевидным, что смесь трех антител с неперекрывающимися эпитопами в пределах домена III EGFR (992, 1030 и 1042) действует синергетически при подавлении роста клеток A431-NS в присутствии EGF при тестировании, по меньшей мере, с 0,3 нМ EGF, и смесь превосходит все моноклональные антитела.

Затем мы демонстрируем, что синергетический эффект ингибирования роста A431-NS также может быть достигнут путем комбинирования антител с неперекрывающимися эпитопами в домене III EGFR с антителами с эпитопами в пределах доменов I или II EGFR. Как можно видеть на Фиг. 18, комбинации антител 992 и 1024, которые относятся к домену III EGFR, с антителом, имеющим реактивность в домене I (1284) или домене I/II (1434) EGFR, имеют такую же силу, что и три антитела, реагирующих с неперекрывающимися эпитопами в пределах домена III EGFR (992+1024+1030). Кроме того, данные смеси антител являются более сильными ингибиторами роста A431-NS, чем терапевтические антитела против EGFR эрбитукс и вектибикс.

Аналогичные исследования были проведены для двух других линий раковых клеток, DU145 (ATCC#HTB-81) и MDA-MB-468 (ATCC#HTB-132). Результаты этих исследований пролиферации показаны на Фиг. 16B и 16C. В обоих случаях смесь трех антител (992, 1030 и 1042) превосходила смеси двух антител и одиночные антитела. В клетках DU145 смесь трех антител превосходила вектибикс при всех концентрациях, и в MDA-MB-468 - при высоких концентрациях.

Используя метод, аналогичный описанному выше, мы протестировали различные комбинации трех антител против EGFR.

Результаты

Влияние различных комбинаций трех антител исследовалось в клеточной линии A431 NS. Активность по подавлению роста двадцати наиболее сильных комбинаций показана на Фиг. 37. Все комбинации подавляли пролиферацию клеточной линии A431 NS более чем на 60% по сравнению с необработанным контролем. Другое интересное наблюдение состоит в том, что за исключением комбинаций (992+1024+1254 и 992+1024+1320 и 992+1277+1320), все комбинации содержали антитела с неперекрывающимися эпитопами. Это демонстрирует возможность разработки нескольких комбинаций трех антител, связывающих различные эпитопы.

Пример 7: Апоптоз

Апоптоз представляет собой биологической механизм, приводящий к смерти клетки. О данном механизме сообщалось ранее в отношении использования антител против EGFR, таких как эрбитукс (Baselga J. The EGFR as a target for anticancer therapy - focus on cetuximab. Eur J Cancer. 2001 Sep:37, Suppl 4:S16-22). Таким образом, было исследовано, до какой степени отдельные антитела против EGFR 992, 1042 и 1030, а также смесь (992+1042+1030), способны индуцировать апоптоз.

1x104 клеток A431 NS инкубировалось в DMEM, дополненном 0,5% FBS и антибиотиками в тройном анализе в 96-луночных планшетах с культурой в присутствии смеси EGFR (равные части 992, 1030, 1042), 992, 1030, 1042, эрбитукс или вектибикс, в концентрациях в диапазоне от 0,01 мкг/мл до 10 мкг/мл. Клетки и антитела инкубировались в течение 22 часов. Затем супернатанты были собраны, и были проведены измерения с помощью набора для ELISA от Roche, Каталожный номер: 11774425001 (Базель, Швейцария) с целью выявления наличия комплексов гистон-ДНК.

Эффект смеси сравнивался с каждым из моноклональных антител по отдельности, а также с контрольными антителами вектибикс и эрбитукс, с использованием клеток A431 NS (результаты на Фиг. 19). Антитела были протестированы в 10-кратном разбавлении. Смесь являлась более эффективной на значимом уровне (P<0,05) по сравнению с отдельными моноклональными антителами, а также с вектибиксом при тестировании в концентрациях 1 мкг/мл и 10 мкг/мл. Смесь повышала апоптоз на статистически значимом уровне (p<0,05) относительно эрбитукса при 1 мкг/мл.

Пример 7b

В дополнение к примеру 7, смесь 992+1024, а также смесь 992+1024+1030, были проанализированы на апоптозную активность в соответствии с тем же методом, что был описан в примере 7 (Фиг. 35). Фактический уровень апоптоза представлен относительно максимального положительного контроля. Обе смеси сравнивались с эрбитуксом и отдельными моноклональными антителами 992, 1024 и 1030, а также с контрольным антителом при 1 мкг/мл с использованием клеток A431 NS. Смесь 992+1024 была значимо лучше, чем эрбитукс и отдельные моноклональные антитела (для всех случаев P<0,05).

Пример 8: Эффективность in vivo

Исследовалась эффективность in vivo смеси против EGFR, состоящей из антител 992, 1030 и 1042, в ксенотрансплантатной модели в мышах без волосяного покрова с использованием клеток A431 NS. Данная модель широко используется для исследования силы действия моноклональных антител против рака, включая антитела против EGFR. Мыши без волосяного покрова имели ослабленный иммунитет и недостаток T-клеток. Это позволило вырастить человеческие клетки в мышах.

Двум группам мышей без волосяного покрова в возрасте 6-8 недель было подкожно инъецировано 1x106 клеток A431 NS. Лечение начиналось при достижении опухолью среднего размера 100 мм3. Мыши получали пять инъекций с 1 мг антитела, внутрибрюшинно, с интервалом 2-3 дня. Размеры опухолей измерялись по двум диаметрам с использованием цифровых микрометров, и объем рассчитывался по формуле: объем опухоли (мм3) = L×W2×0,5, где L - больший по длине диаметр и W - меньший по длине диаметр (Teicher BA, Tumor Models in Cancer Research. Humana Press, NJ, USA 2002, p 596). К концу эксперимента опухоли были вырезаны и взвешены.

В качестве контрольного антитела использовалось Synagis. Эксперимент также включал лечение эрбитуксом и вектибиксом в том же количестве и с использованием того же графика, что и для смеси против EGFR (антитела 992, 1030 и 1024).

Как можно видеть на Фиг. 20, смесь 992, 1030 и 1042 значимо подавляла рост опухоли A431 NS (P<0,05). Средние веса показаны на Фиг. 21. Результат имел корреляцию с измеренными размерами опухолей. Имеются значимые различия между группой лечения и контрольной группой.

Пример 8b: Эффективность in vivo

В дополнение к описанному в примере 8 in vivo эксперименту, также исследовались смеси 992+1024 и 992+1024+1030 в ксенотрансплантатной модели A431 NS, описанной выше (Фиг. 36). Четырем группам, состоящим из 9 мышей без волосяного покрова в возрасте 6-8 недель каждая, подкожно инъецировалось 1x106 клеток A431 NS. Когда средний размер опухоли достигал 100 мм3, мыши получали инъекцию первого антитела. Три группы получали смесь 992+1024, 992+1024+1030, эрбитукс или контрольное антитело, Synagis. В целом, мыши получили 17 инъекций по 0,5 мг 4 раза в неделю. Первая инъекция проводилась на 8 день, и последняя инъекция проводилась на 34 день. Размеры опухолей измерялись 56 дней. После завершения лечения антителами опухоли у мышей, получавших эрбитукс, начали увеличиваться в размере, тогда как у мышей в двух группах, получавших смесь 992+1024 или 992+1024+1030, опухоли продолжали уменьшаться в размере. На 91 день не наблюдалось увеличения размера опухоли для группы 992+1024 (через 57 дней после окончания лечения). Средний размер опухоли для комбинации 992+1024 был значимо меньше (P<0,01) на 56 день, чем средний размер опухоли у мышей, получавших эрбитукс.

Также отслеживалась выживаемость мышей в эксперименте. Мыши считались мертвыми, когда опухоли достигали максимального разрешенного размера. В приведенной ниже таблице показано количество выживших мышей через 56 дней после прививки раковых клеток. Можно видеть повышенную выживаемость для обеих комбинаций по сравнению с эрбитуксом.

Группа 992+1024 992+1024+1030 Эрбитукс Антитело-контроль
Первоначальное количество мышей 9 9 9 9
Мыши, оставшиеся после 5 дня 9 9 2 0

Дополнительные эксперименты

Предварительные данные по лизатам опухолей из эксперимента с ксенотрансплантатами, описанного в примере 8, показывают, что комбинация 992+1042+1030 индуцирует сильное снижение регуляции продуцирования VEGF в A431 NS, который является важным медиатором ангиогенеза. Повышенное образование кровеносных сосудов является явлением, наблюдаемым во многих солидных опухолях, и представляет собой механизм, участвующий в непрерывной поставке питательных веществ и т.д., посредством чего осуществляется влияние на условия выживаемости.

Кроме того, другие предварительные данные показывают, что в лизатах опухолей из эксперимента с ксенотрансплантатами, описанного в примере 8, может наблюдаться повышенный уровень комбинации антител 992+1042+1030 по сравнению с эрбитуксом и вектибиксом.

Пример 8c: Усиленная дифференцировка клеток опухоли in vivo

Конечная дифференцировка клеток представляет собой сложный процесс, который включает активацию программ экспрессии генов, специфичных для типов клеток, приводящих к многостадийному процессу необратимой потери их пролиферационной способности. При злокачественном заболевании раковые клетки часто находятся в дедифференцированном состоянии, характеризуемом повышенной скоростью пролиферации, и было высказано предположение, что лекарства, способные индуцировать конечную дифференцировку раковых клеток, могли бы уничтожить злокачественные клетки и восстановить нормальный клеточный гомеостаз (Pierce GB, Speers WC: Tumors as caricatures of the process of tissue renewal: prospects for therapy by directing differentiation. Cancer Res 48:1996-2004, 1988). Ранее сообщалось, что при определенных условиях эксперимента моноклональные антитела против EGFR могут повышать скорость конечной дифференцировки клеток плоскоклеточного рака человека, выросших в виде ксенотрансплантатных опухолей в мышах с ослабленным иммунитетом (Milas L, Mason K, Hunter N, Petersen S, Yamakawa M, Ang K, Mendelsohn J, Fan Z: In vivo enhancement of tumor radioresponse by C225 antiepidermal growth factor receptor antibody. Clin Cancer Res 6:701-8, 2000; Modjtahedi H, Eccles S, Sandle J, Box G, Titley J, Dean C: Differentiation or immune destruction: two pathways for therapy of squamous cell carcinomas with antibodies to the epidermal growth factor receptor. Cancer Res 54:1695-701, 1994).

Мы исследовали гистологически конечную дифференцировку в обработанных антителами против EGFR клетках A431 NS, выросших в виде ксенотрансплантатов в мышах. Гистологическое исследование включало 3 случайно выбранных ксенотрансплантатных мышиных опухоли из каждой из четырех экспериментальных групп из эксперимента, описанного в примере 8.

Ткани были рассечены и быстро заморожены, затем установлены с помощью Tissue-Tek на криомикротоме (Leitz, модель 1720), разрезаны на 5 мкм срезы и помещены на кассеты Superfrost plus, и затем обработаны окрашиванием гематоциклином/эозином. Затем два независимых наблюдателя проводили микроскопическое исследование всех срезов тканей слепым методом, оценивая кератинизированные области ("кератиновые жемчужины" (холестеатомы)) в качестве меры степени конечной дифференцировки (Modjtahedi et al., 1994). В таблице 7 представлены полученные результаты. Мыши, подвергавшиеся лечению смесью трех антител против EGFR (992+1024+1030, группа 1), имели заметно большие по размеру и количеству очаги дифференцированных раковых клеток по сравнению с мышами, подвергавшимися лечению контрольными антителами эрбитуксом и вектибиксом (группы 2 и 3, соответственно). В контрольной группе, получавшей PBS вместо антител (группа 4), не было обнаружено конечной дифференцировки.

Репрезентативные микроскопические изображения были получены с использованием микроскопа, оборудованного цифровой камерой, см. Фиг. 26.

В заключение, комбинация трех антител против EGFR с неперекрывающимися эпитопами в пределах домена III (клоны 992, 1030 и 1042) продемонстрировала неожидаемый эффект повышенного индуцирования дифференцировки клеток опухолей in vivo по сравнению с моноклональными антителами эрбитуксом и вектибиксом. Наблюдаемое влияние на конечную дифференцировку приводит к выводу, что композиции антител изобретения могут применяться в совместной терапии с другими индуцирующими дифференциацию агентами, такими как ретиноевая кислота, 4-фенил бутират.

Таблица 7
Группа Номер опухоли Оценка количества холестеатом Комментарии
1 16 ++++ Большие холестеатомы
1 17 +++ Большие холестеатомы
1 54 ++++ Большие холестеатомы
2 14 ++ Маленькие холестеатомы
2 45 ++ Маленькие холестеатомы
2 49 ++ Маленькие холестеатомы
3 11 ++ Маленькие холестеатомы
3 34 ++ Маленькие холестеатомы
3 56 ++ Маленькие холестеатомы
4 43 -
4 60 -
4 31 -

Пример 8d: Продолжительный эффект подавления роста у композиции антител изобретения

Было выполнено повторение эксперимента с ксенотрансплантатом опухоли, представленного в примерах 8 и 8b, с целью исследования in vivo эффективности смеси антител 992+1024. Кратко, мышам BALB/c nu/nu подкожно инъецировалось в бок 106 клеток A431 NS. Допускался рост ксенотрансплантатов опухоли до среднего размера опухоли 100 мм3 (день 7), после чего мыши случайным образом разделялись на пять групп из девяти животных, и начиналось лечение антителами. Пять групп получали высокую (2 мг/неделю) или низкую (1 мг/неделю) дозу смеси 992+1024 или контрольного антитела эрбитукса, или высокую дозу (2 мг/неделю) контрольного антитела Synagis. Все мыши суммарно получали 9 инъекций 0,5 или 1 мг антитела дважды в неделю, начиная с 7 дня и заканчивая 33 днем.

Высокая доза (2 мг/неделю) смеси 992+1024 была очень эффективной для контроля роста первоначальной опухоли и для индуцирования долговременной регрессии опухоли по сравнению с эрбитуксом (P=0,0002, Фиг. 38). Ни одно из животных, получавших 2 мг/неделю смеси 992+1024, не умерло в течение исследуемого периода (118 дней после начала эксперимента, Фиг. 38 и 39), что является значимо лучшим результатом по сравнению с группой, получавшей высокую дозу эрбитукса 2 мг/неделю, в которой осталось только одно из девяти животных на 60 день (P=0,0008, Фиг. 39). Это демонстрирует продолжительный эффект лечения 992+1024 относительно долговременной выживаемости. Хотя и менее эффективно, чем высокая доза, низкая доза смеси 992+1024 (1 мг/неделю) также была способна контролировать рост опухоли и была значимо лучше по сравнению с высокой дозой 2 мг/неделю эрбитукса при рассмотрении подавления опухоли (P=0,0135, Фиг. 38) и выживаемости (P=0,0087, Фиг. 39). Данные результаты демонстрируют превосходящую силу комбинации 992+1024 по сравнению с эрбитуксом даже при низкой дозировке. Результаты также демонстрируют продолжительное подавление роста, вызываемое комбинацией 992+1024, по сравнению с утвержденным для использования моноклональным антителом.

Пример 9: Рост сфероидов

При проведении исследования сфероидов в круглодонный 96-луночный планшет было добавлено 35 мкл 120 мг/мл раствора Poly-HEMA, после чего он был оставлен для испарения в течение ночи в вытяжном шкафу. Poly-HEMA предотвращает прикрепление клеток. Клетки A431-NS обрабатывались в соответствии с описанным выше, пересчитывались, и их концентрация доводилась до 100000 клеток/мл. Затем в экспериментальные лунки в столбцах 2-11 добавлялось 50 мкл клеточной суспензии (5000 клеток/лунку) вместе с 5% раствором матригеля. 200 мкл среды было добавлено в ряды 1 и 8, а также в столбцы 1 и 12, с целью понижения влияния испарения среды для использовавшихся в эксперименте лунок. Планшеты центрифугировались при 300xg в течение 5 минут и оставлялись на ночь для формирования во влажной камере при 37°C. На следующий день соответствующие антитела и смеси антител были разведены до конечной суммарной концентрации антител 20 мкг/мл в пустом 96-луночном планшете. Разведение было выполнено в DMEM, дополненном 0,5% FBS и 1% P/S, что давало конечную концентрацию антител 10 мкг/мл в лунке с наибольшей концентрацией антител. Затем 150 мкл данных растворов было добавлено в лунки в столбце 2 96-луночного планшета, и было выполнено трехкратное последовательное разведение до столбца 9, с тем чтобы каждая лунка содержала 100 мкл раствора антител. 100 мкл среды было добавлено в столбец 11. 100 мкл данных растворов было перенесено на планшет, содержащий сфероиды, и оставлено для инкубации в течение 7 дней. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Количество метаболически активных клеток (MAC) рассчитывалось как процентная доля от необработанного контроля в соответствии с формулой:

% M A C = ( 1 ( O D э к с п . O D с р е д ы ) ( O D н е о б р а б . O D с р е д ы ) ) × 100

Смесь трех антител с неперекрывающимися эпитопами в пределах домена III (992+1030+1042) эффективно подавляла рост сфероидов A431-NS и являлась более сильной по сравнению с моноклональными терапевтическими антителами против EGFR эрбитуксом и вектибиксом (Фиг. 22).

Пример 10: Связывание с ECD EGFR яванского макака

Клонирование внеклеточного домена EGFR яванского макака

Внеклеточный домен EGFR яванского макака, за исключением сигнального пептида, был клонирован из кДНК яванского макака, выделенной из эпидермиса с использованием вложенной ПЦР и специфичных для последовательности праймеров, полученных на основании опубликованной последовательности полноразмерного человеческого EGFR (GENBANK X00588, Ullrich A et. al. Nature 309(5967),418-425 (1984)).

ПЦР-реагенты:

ДНК яванского макака, выделенная из нормального эпидермиса кожи:

CytoMol Unimed, каталожный номер: ccy34218, номер лота: A711054.

Рабочий буфер Phusion (5X): Finnzymes, каталожный номер: F-518, номер лота: 11.

Phusion-фермент: Finnzymes, F-530S (2 Единицы/мкл).

dNTP 25 мМ: Bioline, Каталожный номер: BIO-39029, Номер лота: DM-103F.

Праймеры для амплификации ECD EGFR яванского макака, включая частичную сигнальную последовательность и трансмембранный домен:

5' ATG праймер: 5'-TCTTCGGGAAGCAGCTATGC-3' (SEQ ID No: 135)

3' Tm 2 прамер: 5'-TTCTCCACTGGGCGTAAGAG-3' (SEQ ID No: 136)

Праймеры для вложенного ПЦР, амплифицирующие ECD EGFR яванского макака, 1-1863 п.н., и включающие сайты рестрикции XbaI, MIuI и стоп-кодон перед трансмембранным доменом:

5' EGFR Xbal: 5'-ATCTGCATTCTAGACTGGAGGAAAAGAAAGTTTGCCAAGGC-3' (SEQ ID No: 137)

3' EGFR MIuI: 5'-TACTCGATGACGCGTTTAGGATGGGATCTTAGGCCCGTTCC-3' (SEQ ID No: 138)

Параметры ПЦР:

30 циклов: 98°C/30 секунд - плавление, 55°C/30 секунд - отжиг, 72°C/60 секунд - элонгация. После 30 циклов ПЦР-продукты могли элонгироваться дополнительные 5 минут.

ПЦР-реакции выполнялись с 1 мкл шаблона и 2 единицами Phusion-фермента в суммарном объеме 50 мкл рабочего буфера, содержащего 0,2 мМ dNTP, 0,5 мкМ праймера.

Конечная полоса ПЦР с видимой длиной приблизительно 1800-1900 п.н. была получена и клонирована в экспрессионный вектор. Последовательности ДНК и белка клонированного внеклеточного домена EGFR яванского макака показаны на Фиг. 23, и выравнивание белковых последовательностей ECD EGFR яванского макака и человеческого ECD EGFR показаны на Фиг. 24. Выравнивание последовательностей ДНК человеческого ECD EGFR и ECD EGFR яванского макака показало 97,6% идентичности последовательностей, тогда как выравнивание соответствующих белковых последовательностей показало 98,6% идентичности последовательностей.

Демонстрация перекрестной реактивности антител между внеклеточным доменом EGFR человека и яванского макака в ELISA-анализе

Для проверки того, что тестируемые антитела против EGFR одинаково хорошо связываются как с ECD EGFR человека, так и с ECD EGFR яванского макака, и, соответственно, для обоснования токсикологических исследований на яванских макаках, четырехкратные последовательные разведения антител, начиная с 1 мкг/мл, были протестированы посредством ELISA относительно связывания с рекомбинантными белками ECD EGFR человека и яванского макака. Антитела, показавшие идентичные профили связывания в данном анализе, были взяты в качестве указания на хорошую перекрестную реактивность между видами EGFR. Лунки ELISA покрывались 50 мкл/лунку полноразмерного EGFR в концентрации 1 мкг/мл в PBS, и были оставлены на ночь при 4°C. На следующее утро лунки дважды промывались PBS-T и блокировались на один час со 100 мкл PBS-T-1% BSA при комнатной температуре, после чего проводилось двукратное промывание в PBS-T. Затем 50 мкл последовательно разведенных антител против EGFR и контрольных антител было добавлено в лунки, и проводилась инкубация в течение 1 часа при комнатной температуре. После инкубирования антител лунки пять раз промывались PBS-T, после чего выполнялось инкубирование с 50 мкл/лунку вторичного реагента стрептавидин-HRP, разведенного 1:3000 в блокирующем буфере, при комнатной температуре в течение 30 минут. В конце лунки пять раз промывались PBS-T, и были сформированы планшеты путем добавления 50 мкл/лунку субстрата TMB, после чего проводилась инкубация при комнатной температуре. После инкубации реакция останавливалась путем добавления 1 M H2SO4; 100 мкл/лунку и планшеты прочитывались при OD 450 нм.

Реагенты для ELISA:

1. Планшет для ELISA; NUNC Maxisorp; каталожный номер: 442404

2. Антиген: человеческий ECD rEGFR; ECD rEGFR яванского макака

3. Покрывающий буфер: 1 x PBS; Gibco каталожный номер:20012-019

4. Отмывочный буфер: 1xPBS/0,05% Tween 20 (PBS-T)

5. Блокирующий/разбавляющий буфер: 1% BSA в PBS-T

6. HRP-конъюгат козьего антитела против человеческого IgG: Serotec, Star 106P

7. TMB Plus (KemEnTec каталожный номер 4390L)

8. (1 M H2SO4)

Как показано на Фиг. 25, описанный ELISA-анализ позволяет разделить антитела, обладающие перекрестной реактивностью против ECD EGFR человека и яванского макака (Фиг. 25A), и специфичные для вида антитела, распознающие ECD EGFR человека, используемые для иммунизации мышей (Фиг. 25B).

Пример 11: Подавление подвижности

Большинство смертей от рака происходит вследствие распространения раковых клеток и их последующего роста в отдаленных местах. Локальная инвазия прилегающей нормальной ткани подвергает риску функции гомеостаза и не позволяет проводить хирургическое или радиационное удаление опухоли. Последние исследования выделили центральную роль, которую индуцированная подвижность играет в стимулировании такого распространения. Известно, что EGFR способствует подвижности и распространению клеток, и, следовательно, подавление EGFR-опосредованной подвижности является важным механизмом действия нацеленных на EGFR лекарств.

Было исследовано влияние смеси двух антител 992 и 1024 на подвижность клеточной линии карциномы головы и шеи. Сфероиды, состоящие из 10000 клеток, были приготовлены в течение ночи в соответствии с описанным в примере 9. Затем сфероиды были перенесены в колбы с клеточной культурой NUNC T25, после чего допускалось прилипание в течение ночи. Затем было добавлено 10 мкг/мл смеси антител 992+1024 или антитела отрицательного контроля, и сфероиды инкубировались в течение других 24 часов. Изображения были получены при 40x увеличении, и площадь, покрытая клетками, измерялась с использованием программного обеспечения Image J.

Результаты: Как можно видеть на Фиг. 27A, добавление специфичных для EGFR антител 992 и 1024 приводит к значительному уменьшению площади, покрытой раковыми клетками. Подвижность выражена в количественной форме на Фиг. 27B, на которой показано, что подвижность снижается приблизительно на 60% по сравнению с антителом отрицательного контроля. Данное снижение подвижности имеет высокую значимость p<0,01.

Таким образом, комбинация антител 992 и 1024 сильно подавляет опосредованную EGFR подвижность раковых клеток, что указывает на возможность применения комбинаций антител против EGFR для лечения диссеминированного поражения.

Пример 12: Повышенная регуляция инволюкрина с помощью композиции антител Sym004

Инволюкрин является маркером ранней дифференциации плоских клеток и белком, вовлеченным в образование рогового конверта. Следовательно, уровни инволюкрина могут быть использованы в качестве меры количества раковых клеток, прошедших дифференцировку. Уровни инволюкрина оценивались в лизатах белков из ксенотрансплантатных опухолей A431 NS, обработанных или не обработанных эрбитуксом, вектибиксом или смесью антител 992+1030+1042, с использованием коммерчески доступного набора для ELISA-анализа инволюкрина (Biomedical Technologies). Лизаты опухолей приготовлялись путем гомогенизации 30-40 мг тканей опухолей в 1 мл RIPA-буфера с использованием TissueLyzer производства Qiagen. Концентрация белка в каждом очищенном лизате определялась с использованием набора для BCA-анализа белков производства Pierce, и уровень инволюкрина оценивался посредством анализа ELISA в 0,4 мкг белка из каждого образца.

Результаты: Как можно видеть на Фиг. 27, значимо большие уровни инволюкрина были обнаружены в группе, обработанной 992+1030+1042, по сравнению с группами, обработанными отрицательным контролем и эрбитуксом или вектибиксом. Таким образом, комбинация антител 992, 1030 и 1042 повышает уровни инволюкрина в ксенотрансплантатных опухолях, и, следовательно, предположительно индуцирует большую степень дифференцировки A431. Результат хорошо коррелирует с высоким количеством холестеатом, обнаруженным в данной группе обработки (см. пример 8).

Пример 13: Интернализация EGFR композицией антител Sym004

Некоторые антитела функционируют посредством индуцирования интернализации их поверхностной мишени. Известно, что EGFR претерпевает интернализацию при активации лиганда, такого как EGF.

Способность смеси двух антител 992 и 1024 индуцировать интернализацию EGFR была исследована с помощью конфокальной микроскопии. Клетки A431 NS и HN5 были высеяны на 8-луночные камеры LabTek и инкубировались в течение ночи в DMEM, содержащем 0,5% FBS. Затем к клеткам добавлялось 10 мкг/мл помеченной Alexa-488 смеси антител 992+1024 или контрольного антитела эрбитукса, и затем проводилась инкубация в течение различных периодов времени. После этого были получены изображения при 60x увеличении с использованием конфокального микроскопа с большой или малой диафрагмой.

Результаты: Как показано на Фиг. 29A, добавление помеченных Alexa-488 EGFR-специфичных антител 992 и 1024 на 2 часа приводит к накоплению антител во внутриклеточных полостях клеточных линий A431 NS и HN5. Напротив, эрбитукс был в основном обнаружен на клеточной поверхности. На Фиг. 29B показаны изображения клеток A431 NS, полученные с использованием малой диафрагмы, в результате чего получаются изображения более тонких сечений клеток. Исходя из этих изображений ясно, что антитела 992+1024 размещаются внутри клеток, тогда как эрбитукс в основном обнаруживается на клеточной поверхности. На Фиг. 30 показаны временные рамки опосредованной 992+1024 интернализации, и через 30 минут после добавления антител они могли быть обнаружены во внутриклеточных полостях. После 4 часов практически все из антител 992+1024 были обнаружены в клетках с низким или очень слабым поверхностным окрашиванием. Напротив, эрбитукс оставался на клеточной поверхности. Также было получено доказательство того, что интернализация, индуцируемая 992+1024, приводит к продолжительной деградации и удалению EGFR из клеток.

Таким образом, комбинация антител 992 и 1024 быстро и действенно индуцирует интернализацию EGFR, тогда как эрбитукс не делает этого.

Пример 14: Измерение аффинностей антител посредством поверхностного плазмонного резонанса

Измерение моновалентных аффинностей антител IgG Sym004

для рекомбинантного растворимого ECD EGFR

Кинетический анализ полноразмерных IgG-антител изобретения был выполнен на Biacore 2000, и включал исследование, описанное в работе (Canziani, Klakamp, et al. 2004, Anal. Biochem, 325:301-307), позволяющее измерять моновалентные аффинности целых молекул IgG относительно растворимого антигена. Кратко, приблизительно 10000 Усл.Ед. поликлонального антитела против Fc IgG человека было конъюгировано с поверхностью чипа CM5 в соответствии с инструкциями производителя, после чего происходил захват 25 мкг отдельных антител против EGFR изобретения или отрицательного контроля Synagis на поверхности анти-Fc чипа. Плотность захваченных IgG оптимизировалась для каждого клона, с тем чтобы наибольшая концентрация антигена, используемая в анализе, не превышала 25 Усл.Ед. Затем 250 мкл растворимого человеческого ECD EGFR, относительно которого ранее было показано посредством гелевой эксклюзионной хроматографии, что он содержит только моновалентный белок, было впрыснуто с мощностью потока 25 мкл/мин в последовательных двукратных разбавлениях в буфере HBS-EP с целью получения характеристических кривых. Поверхность чипа регенерировалась между циклами путем удаления захваченных комплексов антитело/антиген посредством 10-секундной инъекции 100 мМ H3PO4. Кинетический анализ выполнялся путем вычитания ответа для проточной кюветы, содержавшей антитело отрицательного контроля Synagis, после чего проводилось вычитание ответа, сгенерированного посредством инъекции только буфера HBS-EP ("двойное сопоставление"). Константы скорости ассоциации (ka) и скорости диссоциации (kd) были оценены в целом на основании сгенерированных сенсограмм с помощью программного обеспечения для оценки BIA 4.1, предоставленного производителем.

Реагенты:

1. Чип CM6: Biacore, каталожный номер BR-1000-14

2. NHS: Biacore BR-1000-50

3. EDC: Biacore BR-1000-50

4. 10 мМ ацетатный буфер, pH 4,5: Biacore, каталожный номер BR-1003-50

5. Антитело козла против Fc IgG человека: Caltag, каталожный номер H10500

6. Этаноламин, 1,0 M pH 8,5: Biacore BR-1000-50

7. 10× HBS-EP подвижный буфер: 0,01 M HEPES pH 7,4, 0,15 M NaCl, 3 мМ EDTA, 0,005% по объему сурфактанта P20

8. Антиген: Человеческий внеклеточный домен EGFR с 6×His.

9. 100 мМ H3PO4

Рассчитанные моновалентные аффинности полноразмерных IgG изобретения относительно человеческого ECD EGFR показаны ниже в Таблице 8.

Таблица 8. Измеренные аффинности IgG-антител против EGFR относительно растворимого рецептора. Измерения для антител были выполнены посредством поверхностного плазмонного резонанса на Biacore 2000 с использованием программного обеспечения для оценки, предоставленного производителем. *Аффинность 992 была определена посредством анализа Скэтчарда. NA - не применимо.

Большинство протестированных антител Sym004 распознавали растворимый человеческий ECD EGFR с аффинностями в диапазоне 10-20 нМ, за исключением 1260, 1277 и 1284, которые имели наиболее высокую аффинность 4,2 нМ, 0,4 нМ и 4,6 нМ, соответственно. Наконец, было обнаружено, что 992 связывает растворимый ECD EGFR с намного меньшей аффинностью, чем другие протестированные антитела. Следовательно, кинетический анализ данного антитела должен был быть проведен посредством анализа Скрэтчарда, который выявил аффинность 170 нМ относительно растворимого человеческого ECD EGFR.

Измерение аффинностей Fab-антител Sym004 относительно иммобилизованного рекомбинантного ECD EGFR

Для измерения возможных различий в презентации антигена между ECD EGFR, присутствующем в растворимой и иммобилизованной форме, было выполнено новое измерение аффинности на антигене иммобилизованного химерного рецептора EGFR, названном EGFR-Fc (R&D Systems, 344-ER), состоящем из человеческого ECD EGFR, слитого с человеческим IgG Fc. Для этой цели были сгенерированы Fab-фрагменты IgG-антител 992, 1024 & 1030 для обеспечения возможности измерения моновалентных аффинностей.

Продуцирование Fab:

Fab-фрагменты 992, 1024 и 1030 были продуцированы посредством расщепления папаином с использованием набора для приготовления Fab производства Pierce и со следованием инструкциям производителя. Кратко, 2 мг каждого IgG-антитела подвергалось замене буфера в колонках NAP-5 (Amersham Biosciences) со свежеприготовленным расщепляющим буфером, содержащим 20 мМ цистеин-HCl, pH 7,0, в соответствии с инструкциями производителя. Затем 350 мкл суспензии капель папаина дважды промывалось в одном и том же расщепляющем буфере, после чего капли осаждались, и удалялся супернатант. Антитела были расщеплены путем добавления 1 мл IgG-антитела, подвергнутого замене буфера, к каплям, и инкубирования в течение ночи при 37°C со встряхиванием на 1000 об/мин. На следующее утро нерасщепленные IgG выделялись из сырых Fab путем обеднения полноразмерных IgG в колонках HiTrap Protein A (Ge Healthcare). В конце продуцированные Fab подвергались диализу в PBS в течение ночи, и анализировались посредством SDS-PAGE в редуцирующих и нередуцирующих условиях. Полоса белка в районе приблизительно 50 кДа в нередуцирующих условиях была принята за указание на успешное продуцирование Fab.

Реагенты:

1. Набор для подготовки Fab ImmunoPure; Pierce; каталожный номер 44885

2. Колонка для обессоливания NAP5; Amersham, каталожный номер 17-0853-02

3. PBS pH 7,2; Gibco; каталожный номер 20012-019

4. HiTrap Protein A HP, 1 мл колонка; GE Healthcare; каталожный номер 17-0402-01

5. NuPAGE 4-12% Novex бис-трис гель; Invitrogen; #NP0322BOX

6. Молекулярный маркер; Seeblue Plus 2; Invitrogen; каталожный номер LC5925

7. Антитела против EGFR - 2,0 мг каждого

Кинетический анализ полноразмерных Fab-антител изобретения был выполнен на Biacore 2000 с использованием рекомбинантного антигена, иммобилизованного на поверхности сенсора при очень низкой плотности во избежание ограничений при массовом переносе. Кратко, суммарно 285 Усл.Ед. рекомбинантного химерного ECD EGFR-Fc (R&D Systems, каталожный номер 344-ER) было конъюгировано с поверхностью чипа CM5 в соответствии с инструкциями производителя. Затем Fab-фрагменты, полученные из антител изобретения, были протестированы в последовательных двукратных разбавлениях, начиная с оптимизированной концентрации, которая не приводила к максимальным значениям Усл.Ед. более 25 при тестировании на чипе с иммобилизованным EGFR. Кинетический анализ выполнялся путем вычитания ответа для проточной кюветы, содержавшей антитело отрицательного контроля Synagis, после чего проводилось вычитание ответа, сгенерированного посредством инъекции только буфера HBS-EP. Константы скорости ассоциации (ka) и скорости диссоциации (kd) были оценены в целом на основании сгенерированных сенсограмм с помощью программного обеспечения для оценки BIA 4.1, предоставленного производителем.

Рассчитанные моновалентные аффинности протестированных Fab-фрагментов изобретения относительно иммобилизованного человеческого ECD EGFR показаны ниже в Таблице 9.

Таблица 9. Измеренные аффинности Fab-фрагментов антител против EGFR относительно иммобилизованного рецептора. Измерения для антител были выполнены посредством поверхностного плазмонного резонанса на Biacore 2000 с использованием программного обеспечения для оценки, предоставленного производителем. *Аффинность 992 была определена посредством анализа Скэтчарда. NA - не применимо.

Как показано выше в таблице 9, было обнаружено, что Fab-фрагменты 992 и 1024 имели аффинности 150 нМ и 26 нМ, соответственно, что согласуется с аффинностями, представленными в предыдущем примере, и иллюстрирует небольшие различия между распознаванием антител для растворимого и иммобилизованного EGFR для двух рассматриваемых антител. Однако антитело 1030 продемонстрировало в 10 раз большую активность, чем 2,3 нМ, против иммобилизованного антигена по сравнению с растворимым рецептором, и, следовательно, предпочтительно распознает эпитоп, расположенный на иммобилизованном антигене.

Пример 15: Исследование презентации антигена EGFR и ранжирование функциональных аффинностей на клетках A431-NS

Сравнение между презентацией антигена на клетках A431-NS и очищенном полноразмерном рецепторе EGFR

Поскольку кинетический анализ выявил, что антитело 992 распознает рекомбинантный ECD EGFR с аффинностью между 150 и 170 нМ, то было исследовано, является ли слабая аффинность следствием того факта, что mAb 992 предпочтительно связывает нативные конформации EGFR, экспрессированные в клетках A431-NS, в отличие от конформаций, представленных в рекомбинантном ECD EGFR или полноразмерном EGFR, очищенном из клеток A431. В целях исследования различий в представлении антигена рецептора EGF, были проведены одновременные ELISA-анализы связывания субпопуляции антител изобретения для Fab-фрагментов с целью устранения влияния авидности на протестированных клетках A431- NS и очищенных полноразмерных EGFR из тех же клеток.

Продуцирование Fab: продуцирование Fab-фрагментов выполнялось в соответствии с описанным в примере 14.

Непрямой ELISA-анализ: для проведения непрямого ELISA полноразмерный EGFR (Sigma E2645) был нанесен в концентрации 1 мкг/мл в карбонатный буфер (50 мкл/лунку) и оставлен на ночь при 4°C. На следующее утро лунки дважды промывались PBS-T и блокировались на один час PBS-T, содержащим 1% BSA, при комнатной температуре, после чего проводилось двукратное промывание в PBS-T. Затем 50 мкл последовательно разведенных в DMEM, содержащем 1% BSA, Fab-антител было добавлено в независимые лунки для ELISA, и проводилась инкубация в течение 1 часа при комнатной температуре, после чего лунки четыре раза промывались PBS-T. Затем было добавлено 50 мкл/лунку вторичного реагента (Fab-специфичного) HRP-конъюгата козьего антитела против человека, разведенного 1:5000 в DMEM, содержащем 1% BSA, и выполнялось инкубирование на льду в течение 30 минут. В конце лунки четыре раза промывались PBS-T, и были сформированы планшеты путем добавления 50 мкл/лунку субстрата TMB, и прочитывались на 620 нм каждые 5-15-30 минут. После инкубации с субстратом, реакция останавливалась путем добавления 1 M H2SO4, и поглощение считывалось на 450 нм.

Реагенты, непрямой ELISA:

1) Покрывающий буфер: 50 мМ карбонатный буфер, pH 9,8

2) Антигены: Полноразмерный EGFR дикого типа, очищенный из клеток A431; Sigma E2645

3) Планшет для ELISA: NUNC Maxisorp; Каталожный номер: 442404

4) Отмывочный буфер: 1x PBS/0,05% Tween 20 (PBS-T)

5) Блокирующий/разбавляющий буфер: 1% BSA в PBS-T (PBS-T-1% BSA)

6) Буфер для разведения антитела: DMEM, содержащий 1% BSA

7) (Fab-специфичный) HRP-конъюгат козьего антитела против человека: Jackson, каталожный номер 109-035-097

8) Субстрат TMB Plus: KemEnTec, каталожный номер 4390L

9) 1 M H2SO4

Клеточный ELISA: относительные связывающие способности, определенные как молярные концентрации, дающие половину максимального OD (ED50), были получены посредством титрования антител на клетках A431-NS. Кратко, 10000 клеток A431-NS было выращено в течение ночи в 96-луночных планшетах для ELISA, содержащих DMEM с добавлением 0,5% FCS и 1% P/S при 37°C, 5% CO2. На следующее утро сливающиеся клетки (приблизительно 20000/лунку) были дважды промыты PBS и фиксированы посредством инкубирования с 1% раствором параформальдегида в течение 15 минут при комнатной температуре, после чего проводилось четырехкратное промывание PBS. Затем тестируемые EGFR-антитела и антитело отрицательного контроля Synagis были последовательно разведены в DMEM, содержащем 1% BSA, и 50 мкл каждого раствора было добавлено в лунки, и проведена инкубация в течение 1 часа при комнатной температуре, после чего лунки четыре раза промывались PBS. Затем было добавлено 50 мкл/лунку вторичного реагента (Fab-специфичного) HRP-конъюгата козьего антитела против человека, разведенного 1:5000 в DMEM, содержащем 1% BSA, и выполнялось инкубирование на льду в течение 30 минут. В конце лунки четыре раза промывались PBS-T, и были сформированы планшеты путем добавления 50 мкл/лунку субстрата TMB, и прочитывались на 620 нм каждые 5-15-30 минут. После инкубации с субстратом, реакция останавливалась путем добавления 1 M H2SO4, и поглощение считывалось на 450 нм. Функциональная активность, выраженная в виде значений ED50, была рассчитана путем вычитания среднего фонового связывания только с вторичным реагентом и последующей нормализацией кривых связывания путем построения графиков для процентной доли от максимального связывания в отношении каждого тестируемого антитела.

Реагенты, клеточный ELISA:

1) Среда DMEM: Gibco, Каталожный номер 41966-029

2) FCS: Gibco, каталожный номер 10099-141

3) Пенициллин-стрептомицин (P/S): Gibco, каталожный номер 15140-122

4) Планшет для ELISA: Costar, каталожный номер 3595

5) Промывочный буфер (PBS): Gibco, каталожный номер 20012-019

6) Буфер для разведения антитела: DMEM, содержащий 1% BSA

7) Раствор для фиксации клеток: BD Biosciences, каталожный номер 340181

8) (Fab-специфичный) HRP-конъюгат козьего антитела против человека: Jackson, каталожный номер 109-035-097

9) Субстрат TMB Plus: KemEnTec, каталожный номер 4390L

10) 1 M H2SO4

Различия в презентации антигена на рецепторе EGF, экспрессированном в клетках A431-NS, и на очищенном рецепторе из тех же клеток были определены посредством одновременных анализов связывания в ELISA, использующих один и тот же реагент вторичного антитела и те же периоды инкубации. Результаты показаны на Фиг. 31. Эксперимент ясно показывает, что Fab- антитела 992 и 1024 слабо связываются с очищенным полноразмерным EGFR, нанесенным на лунки для ELISA, в сравнении со связыванием при тех же концентрациях Fab 1030. Однако такая слабая связывающая активность 992 и 1024 была восстановлена, когда антитела тестировались на клетках A431-NS, для которых все три Fab продемонстрировали сильную связывающую активность. Сравнение двух различных ELISA явно проиллюстрировало предпочтение Fab 992 и 1024 относительно связывания нативных конформаций EGFR, экспрессируемых на клеточных поверхностях, в отличие от конформаций, представленных на очищенном антигене в лунках ELISA. Результат также позволяет предположить, что явно слабая аффинность 992, измеренная посредством поверхностного плазмонного резонанса на рекомбинантных растворимых и иммобилизованных ECD EGFR, имела место из-за неблагоприятной презентации эпитопа антитела 992 в протестированных системах.

Ранжирование функциональных аффинностей на клетках A431-NS

Клеточные ELISA, выполненные в соответствии с описанным выше, были использованы для ранжирования функциональных аффинностей IgG и Fab-фрагментов 992, 1024, 1030, вектибикса и эрбитукса посредством расчета полумаксимальных значений OD, выраженных как значения ED50. Результаты данного анализа показаны на Фиг. 32, а рассчитанные значения ED50 представлены ниже в Таблице 10.

Таблица 10: Ранжирование функциональных аффинностей, выраженных как значения ED50, на основании эффектов авидности IgG или моновалентной активности Fab. Значения ED50 были определены посредством последовательных титрований антител на клетках A431-NS. SD: стандартное отклонение аппроксимации кривой.

Эксперимент ясно показывает, что в случае, когда эффекты авидности принимались во внимание, оказывалось, что IgG 992 и 1024 связывают клетки A431-NS с более высокой авидностью, чем эрбитукс и вектибикс, тогда как IgG 1030 имело самое низкую активность среди протестированных IgG-антител. Однако когда определялась моновалентная активность с использованием Fab-фрагментов, 992 имело самую низкую активность, составлявшую приблизительно 10 нМ. Тем не менее, данная моновалентная функциональная активность все же была, по меньшей мере, в 15 раз ниже, чем при тестировании на Biacore.

Пример 16: Исследование индуцированного антителами улучшения связывания

Конкурентный BIAcore-эксперимент, выполненный для пар антител изобретения, показал, что связывание 992 и 1024 было улучшено приблизительно на 55% и 58%, соответственно (Фиг. 9A), в случае, когда данные антитела тестировались друг против друга в обоих направлениях. Для дальнейшего исследования данного явления, был разработан клеточный ELISA-анализ с использованием нефиксированных клеток с целью изучения эффекта связывания IgG одного клона антител после предшествующего насыщения рецептора Fab-фрагментов антитела, связывающего неперекрывающийся эпитоп.

Клеточный ELISA: ELISA выполнялся в основном в соответствии с описанным в примере 15, но с изменениями. Клетки оставлялись нефиксированными с целью обеспечения конформационной гибкости EGFR после добавления антител. Кратко, 10000 клеток A431-NS было выращено в течение ночи в 96-луночных планшетах для ELISA, содержащих DMEM с добавлением 0,5% FCS и 1% P/S при 37°C, 5% CO2. На следующее утро сливающиеся клетки (приблизительно 20000/лунку) были дважды промыты PBS, и лунки для исследования индуцированного антителами улучшения связывания предварительно инкубировались с 25 мкл 40 нМ одиночных Fab-фрагментов 992, 1024 или 1030, или с 12,5 мкл 80 нМ каждого одиночного Fab-фрагмента в двойных комбинациях, для которых ранее было показано наличие насыщенного связывания. 25 мкл DMEM, содержащего 1% BSA, было добавлено в лунки, использованные для тестирования IgG-антител без добавления Fab-фрагментов. После добавления Fab и среды, лунки ELISA инкубировались в течение 30 минут при комнатной температуре, после чего 25 мкл трехкратно последовательно разведенных IgG изобретения или отрицательного контроля Synagis, начиная с концентрации 360 нМ, было добавлено в лунки, и проведена инкубация на льду в течение одного часа. Затем лунки четыре раза промывались PBS, было добавлено 50 мкл вторичного реагента (Fab-специфичного) HRP-конъюгата козьего антитела против человека, разведенного 1:5000 в DMEM, содержащем 1% BSA, и выполнялось инкубирование на льду в течение 30 минут. В конце лунки четыре раза промывались PBS-T, и были сформированы планшеты путем добавления 50 мкл/лунку субстрата TMB, и прочитывались на 620 нм каждые 5-15-30 минут. После инкубации с субстратом, реакция останавливалась путем добавления 1 M H2SO4, и поглощение считывалось на 450 нм. Функциональная активность, выраженная в виде значений ED50, была рассчитана путем вычитания среднего фонового связывания только с вторичным реагентом и последующей нормализацией кривых связывания путем построения графиков для процентной доли от максимального связывания в отношении каждого тестируемого антитела.

Реагенты, клеточный ELISA:

1) Среда DMEM: Gibco, каталожный номер 41966-029

2) FCS: Gibco, каталожный номер 10099-141

3) Пенициллин-стрептомицин (P/S): Gibco, каталожный номер 15140-122

4) Планшет для ELISA: Costar, каталожный номер 3595

5) Промывочный буфер (PBS): Gibco, каталожный номер 20012-019

6) Буфер для разведения антитела: DMEM, содержащий 1% BSA

7) Мышиный (Fc-специфичный) HRP-конъюгат против человека: Ab-direct, каталожный номер MCA647P

8) Субстрат TMB Plus: KemEnTec, каталожный номер 4390L

9) 1 M H2SO4

Исследования индуцированного антителами улучшения связывания проводились посредством одновременных анализов связывания в ELISA, использующих один и тот же реагент вторичного антитела и те же периоды инкубации. Результаты данного анализа показаны на Фиг. 33, а рассчитанные значения ED50 представлены ниже в Таблице 11.

Таблица 11: Ранжирование функциональных аффинностей, выраженных как значения ED50, на основании эффектов авидности IgG с предшествующим насыщением рецептора или без насыщения рецептора, для указанных Fab-фрагментов. Значения ED50 были определены посредством последовательных титрований антител IgG на клетках A431-NS. SD: стандартное отклонение аппроксимации кривой.

Как показано на Фиг. 33 и выше в Таблице 11, IgG 992 продемонстрировало явное повышение связывания после предшествующего насыщения рецептора Fab-фрагментами 1024 или 1030, или 1024 вместе с 1030. Инкубирование с Fab-фрагментами приводило к снижению значений ED50 до 0,5; 0,4 & 0,5 нМ, соответственно, по сравнению со значением 0,6 нМ при тестировании только IgG 992.

Аналогично, было продемонстрировано повышение связывания для IgG 1024 и 1030, когда клетки были сначала насыщены Fab 992, и только для 1024, когда к клеткам добавлялись и Fab 992, и 1030 до добавления IgG. Данный результат явно иллюстрирует преимущество использования более одного антитела против неперекрывающихся эпитопов на одном и том же целевом рецепторе.

Немного более низкие функциональные аффинности были определены в данном эксперименте, по сравнению с примером 2. Данный результат, вероятно, имеет место по причине использования другого вторичного реагента в настоящем примере и по той причине, что тестируемые IgG инкубировались с нефиксированными клетками на льду во избежание интернализации.

Пример 16B: Клонирование полноразмерного EGFR яванского макака

Полноразмерный EGFR яванского макака, содержащий сигнальный пептид, был клонирован из кДНК яванского макака, выделенной из эпидермиса с использованием вложенной ПЦР и специфичных для последовательности праймеров, полученных на основании опубликованной последовательности полноразмерного человеческого EGFR (GENBANK X00588, Ullrich A et. al. Nature 309(5967),418-425 (1984)).

ПЦР-реагенты:

ДНК яванского макака, выделенная из нормального эпидермиса кожи:

CytoMol Unimed, каталожный номер: ccy34218, номер лота: A711054.

Рабочий буфер FastStart (10X): Roche, каталожный номер: 03 553 361001

Фермент FastStart: Roche, Roche, каталожный номер: 03 553 361001

Phusion-фермент: Finnzymes, F-530S (2 Единицы/мкл).

dNTP 25 мМ: Bioline, каталожный номер: BIO-39029

Праймеры для амплификации полноразмерного EGFR яванского макака, включая сигнальную последовательность:

5' ATG праймер: 5'-TCTTCGGGAAGCAGCTATGC-3' (SEQ ID No: 135)

3' СТОП-праймер: 5'-TCATGCTCCAATAAATTCACTG-3' (SEQ ID No: 139)

Параметры ПЦР:

95°C/2 минуты, 40 циклов: 95°C/30 секунд, 55°C/30 секунд, 72°C/3 минуты 30 секунд, с завершающей инкубацией при 72°C в течение 5 минут.

Праймеры для вложенного ПЦР, амплифицирующие полноразмерный EGFR яванского макака, и включающие сайты рестрикции Not и Xho:

E579 Cyn Not5' 5' - GGAGTCGGCGGCCGCACCATGCGACCCTCCGGGACGG-3 (SEQ ID No: 140)

E580 Cyn Xho5' 5' - GCATGTGACTCGAGTCATGCTCCAATAAATTCACTGC-3 (SEQ ID No: 141)

Параметры ПЦР:

95°C/2 минуты, затем 30 циклов: 95°C/30 секунд - плавление, 55°C/30 секунд - отжиг, 72°C/3 минуты - элонгация. После 30 циклов ПЦР-продукты могли элонгироваться дополнительные 10 минут.

ПЦР-реакции выполнялись с 0,5 мкл шаблона и 0,1 мкл Phusion-фермента, 0,4 мкл FastStart-фермента, в суммарном объеме 50 мкл рабочего буфера с конечной концентрацией 1x FastStart-буфера, 0,2 мМ dNTP и 0,2 мкМ каждого праймера.

ПЦР-фрагмент с видимой длиной приблизительно 4000 п.н. был получен и клонирован с использованием набора для клонирования TOPO TA (Invitrogen, Part No. 4506-41), и был секвенирован. Последовательности ДНК и белка клонированного EGFR яванского макака показаны на Фиг. 34. Выравнивание белковых последовательностей EGFR яванского макака и человеческого EGFR показало 99,2% идентичность последовательностей.

Демонстрация перекрестной реактивности антител между полноразмерным EGFR человека и яванского макака

в FACS-анализе

Полноразмерные EGFR человека и яванского макака были экспрессированы на поверхности клеток CHO посредством стабильной трансфекции, и клетки тестировались на связывание с панелью последовательно разведенных антител EGFR посредством FACS-анализа. Определение выполнялось в KD-зависимых условиях путем сохранения молярной избыточности антитела, которая была по меньшей мере в 5 раз выше, чем количество молекул антигена EGFR, экспрессированных на клеточной поверхности фиксированного количества клеток во всех последовательных разведениях антител. Такая настройка позволила провести FACS-анализ связывания антител при полном насыщении рецептора для всех протестированных концентраций антител.

Кратко, количественный FACS-анализ был выполнен на системе биоанализа BD FACSarray с целью определения количества молекул EGFR, экспрессированных на поверхности клеток CHO, трасфецированных полноразмерным EGFR человека или яванского макака. Анализ был выполнен посредством титрования PE-помеченного IgG эрбитукса на клетках и определения количества эквивалентных PE молекул путем сравнения со стандартной кривой, полученной для калибровочных частиц Rainbow с известной плотностью PE. Количественный анализ показал, что трансфицированные EGFR клетки CHO имели приблизительно 350000 молекул на поверхности каждой клетки. Затем последовательные пятикратные разведения антител изобретения, начиная с 5 нМ, сравнивались путем инкубирования с 10000 трансфицированных EGFR клеток в увеличивающихся объемах, обеспечивающих по меньшей мере 5-кратную молярную избыточность антител по отношению к отображенному на поверхности антигену EGFR в каждом анализе. Антитела инкубировались с клетками в течение 14 часов на вибрационной установке в целях способствования полному насыщению антигена для всех тестируемых концентраций антител, при этом добавлялся FACS-буфер 0,02% NaN3 и температура сохранялась на 4°C с целью предотвращения интернализации рецептора. После инкубирования клетки центрифугировались при 1200 об/мин в течение 5 минут при 4°C и ресуспендировались в 200 мкл FACS-буфера. Затем клетки окрашивались вторичным антителом козла F(ab')2 против IgG FcGamma человека PE, разведенным 1:500, и инкубировались в течение 30 минут при 4°C на вибрационной установке. В конце клетки дважды промывались в FACS-буфере и анализировались на системе биоанализа BD FACSarray с дискриминационным окном для экспрессирующих EGFR клеток CHO, отображающим единообразные свойства прямого/бокового рассеивания света.

FACS-Реагенты:

Калибровочные частицы Rainbow: BD, каталожный номер: 559123

FACS буфер: 1xPBS+2%FCS+0,02% NaN3

Козье антитело F(ab')2 против IgG FcGamma человека PE: Jackson ImmunoResearch, каталожный номер 109-116-170

Описанное FACS-исследование связывания было использовано для определения перекрестной реактивности антител EGFR IgG 992 и 1024 и сравнения с контрольным антителом IgG 1320, которое не имело перекрестной реакции с EGFR яванского макака. Как показано ниже на Фиг. 40, описанный FACS-анализ позволил очень хорошо разделить антитела, демонстрирующие хорошую перекрестную реактивность между полноразмерными EGFR человека и яванского макака (Фиг. 40A, IgG 992 и Фиг. 40B, IgG 1024) и видоспецифичными антителами, распознающими полноразмерный EGFR человека (Фиг. 40C, IgG 1320). На основании данного анализа был сделан вывод о том, что IgG 992 и 1024 продемонстрировали отличную перекрестную реактивность против полноразмерных EGFR человека и яванского макака, экспрессированных на поверхности стабильно трансфицированных клеток CHO. Различие в связывании EGFR человека и яванского макака является неожиданным ввиду большой степени подобия последовательностей и подчеркивает важность тестирования антител на связывание с точной целевой последовательностью в животных, используемых в предклинических токсикологических исследованиях.

Пример 17: Клоны, гомологичные 992, 1024 и 1030

Скрининг EGFR-связывающих клонов антител на основании иммуносорбентных анализов (ELISA и основанные на клетках анализы) привел к идентификации клонов 992, 1024, 1030, в соответствии с описанным в предыдущих примерах. Также были идентифицированы EGFR-специфичные клоны, гомологичные 992, 1024, 1030 (Таблица 12).

Ожидается, что клоны, принадлежащие к одному кластеру, будут иметь одинаковую специфичность связывания, но могут связываться с разными аффинностями. Следовательно, клоны из одного и того же кластера могут заменять друг друга в композициях антител по настоящему изобретению, при условии что связывающие способности клонов несильно различаются.

Таблица 12

Таблица 12 (продолжение)

Пример 18: Гуманизация антител 922 и 1024

Все антитела обладали потенциалом для вызывания ответа против антитела у человека. До некоторой степени, ответ коррелировал с уровнем "человечности" применяемого терапевтического антитела. Невозможно предсказать иммуногенность и, посредством этого, человеческого анти-антитело, но существует тенденция предпочтения антител с большей степенью «человечности» для клинического применения. «Человечность» антител, описанных в настоящем изобретении, может быть повышена с помощью процесса гуманизации [Reichert JM. Monoclonal antibodies in the clinic. Nature Biotechnol, 2001; 19:819-822; Reichert JM, Rosensweig CJ, Faden LB and Dewitz MC. Monoclonal antibody successes in the clinic. Nature Biotechnol, 2005; 23:1073-1078].

Гуманизация мышиных mAb, в принципе, достигается путем прививки участков, отвечающих за комплементарное взаимодействие с антигеном (CDR), на человеческие каркасные области (FR) доменов IGHV и IGKV с близкородственной последовательностью посредством процедуры, обычно называемой прививкой CDR (Jones PT, Dear PH, Foote J, Neuberger MS and Winter G. Replacing the complementarity-determining regions in a human antibody with those from a mouse. Nature, 1986; 321:522-525). Однако простая прививка CDR только из гипервариабельных областей может привести к снижению аффинности, поскольку некоторые каркасные аминокислоты или области создают критические взаимодействия с антигеном или поддерживают конформацию связывающих антиген петель CDR [Queen C, Schneider WP, Selick HE, Payne PW, Landolfi NF, Duncan JF, Avdalovic НМ, Levitt M, Junghans RP and Waldmann TA. A humanized antibody that binds to the interleukin 2 receptor. Proc Natl Acad Sci U S A, 1989;86: 10029-10033; Al-Lazikani B, Lesk AM and Chothia C. Standard conformations for the canonical structures of immunoglobulins. J Mol. Biol, 1997;273:927-948]. Следовательно, гуманизация антитела должна включать прививку петель CDR полученных из мышей вариабельных областей на имеющий высокую гомологию с ними человеческий каркас, и при этом должны сохраняться ключевые каркасные аминокислотные остатки мыши с документированным влиянием на активность связывания антигена (Winter, G. and W. J. Harris. "Humanized antibodies." Immunol. Today 14.6 (1993): 243-46). Было разработано и успешно применено несколько методов достижения гуманизации при условии сохранения аффинности и функциональности антитела (обзор в работе Almagro, J. C. and J. Fransson. "Humanization of the antibodies." Front Biosci. 13 (2008): 1619-33.). Гуманизация может быть достигнута рациональными методами, такими как прививка CDR, ремоделирование, сверхгуманизация, оптимизация содержания человеческих последовательностей, которые основываются на конструировании нескольких гуманизированных антител-кандидатов. Аминокислотная последовательность кандидатов основывается на интуиции и предсказании структуры антитела и вклада отдельных аминокислот в связывание антигена, напрямую и косвенно, через стабилизацию общей структуры областей, взаимодействующих с антигенами. Обычно кандидаты должны быть очищены, и некоторые аминокислоты подвергаются обратным мутациям в исходные мышиные аминокислотные остатки, поскольку каждое антитело обладает некоторыми непредвиденными индивидуальными ограничениями. Общим для этих методов является то, что для сохранения аффинности и функций может потребоваться несколько последовательных раундов проектирования, тестирования и повторного проектирования. Альтернативу представляют более эмпирические методы, в которых создаются большие комбинаторные библиотеки, и антитела с желаемыми характеристиками обогащаются в пуле вариантов посредством методов выбора, таких как дрожжевой или фаговый дисплей, или методы альтернативного скрининга.

Антитела против EGFR, описанные в настоящем изобретении, могут быть гуманизированы посредством прививки CDR в человеческие V-области. В предпочтительном сценарии человеческая V-область выбрана на основании гомологии с исходной мышиной V-областью. Также могут быть использованы человеческие области V-генов с другими желаемыми характеристиками, например, с низкой иммуногенностью. В настоящем примере описывается метод для гуманизации химерных антител против EGFR 992 и 1024. Гуманизированные последовательности, представленные на Фиг. 41A, были сгенерированы посредством прививки IMGT-определенных CDR-областей из 992 IGHV в IGHV1-46/IGHJ4 и 992 IGKV в IGKV1-27/IGKJ1-01. Аминокислотные последовательности, приведенные на Фиг. 41 B, были сгенерированы in silico путем прививки IMGT-определенных CDR-областей из 1024 IGHV в IGHV1-2*02/IGHJ6*02 и 1024 IGKV в IGKV2-28*01/IGKJ2*01. Искусственные гены, кодирующие указанные гуманизированные антитела, были синтезированы и вставлены в экспрессионный вектор млекопитающего. Антитела экспрессировались, очищались и тестировались на активность в соответствии с описанным в примере 3. После первоначального тестирования, кинетика связывания гуманизированных антител может быть определена посредством поверхностного плазмонного резонанса в соответствии с описанным в примере 14. Аналогично, связывание с hEGFR, экспрессируемым на поверхности клеток, может быть определено в соответствии с описанным в примере 15.

Если связывающая активность гуманизированных аминокислот значительно ниже, чем наблюдалось для исходных антител, то будет использована схема последовательных обратных мутаций для восстановления аффинности, начиная с каркасных гуманизированных остатков, расположенных в зоне Вернье, или остатков, которые предполагаются поддерживающими структуру CDR-областей (Foote, J. and G. Winter. "Antibody framework residues affecting the conformation of the hypervariable loops." J Mol. Biol. 224.2 (1992): 487-99; Padlan, E. A. "Anatomy of the antibody molecule." Mol. Immunol 31.3 (1994): 169-217.). Данные остатки имеют номера в IMGT для 992 IGHV 13, 45, и 80; 992 IGKV -аминокислоты 25; 1024 IGHV - аминокислоты 13, 45, 80 и 82; 1024 IGKL - аминокислота 78. Такие мутанты могут быть сконструированы путем применения ПЦР-опосредованного сайт-направленного мутагенеза с использованием стандартных методов молекулярной биологии. Сконструированные мутанты будут протестированы в соответствии с описанным выше. Ожидается, что данные множества кандидатов в результате приведут к образованию гуманизированных антител с сохраненными характеристиками связывания антигенов. Однако нельзя исключить необходимость дополнительных обратных мутаций или созревания аффинности путем внесения аминокислотных замен в области CDR посредством сайт-направленного мутагенеза.

Пример 19: Антитело с двумя вариабельными доменами

Антитело с двумя вариабельными доменами (DVD) может быть создано путем слияния IGHV-доменов 992 и 1024 последовательно с линкером из 6 аминокислот (ASTKGP) и IGKV-доменов 992 и 1024 с линкером из 5 аминокислот (TVAAP) [Wu C, Ying H, Grinnell C, Bryant S, Miller R, Clabbers A, Bose S, McCarthy D, Zhu RR, Santora L, vis-Taber R, Kunes Y, Fung E, Schwartz A, Sakorafas P, Gu J, Tarcsa E, Murtaza A and Ghayur T. Simultaneous targeting of multiple disease mediators by a dual-variable-domain immunoglobulin. Nature Biotechnol, 2007;25:1290-1297]. За двойными слияниями доменов IGHV и IGKV следуют домены IGHC и IGKC, соответственно. В одном полноразмерном DVD-антителе (992L1024) 992 IGHV и IGKV являются N-концевыми, после чего следуют линкер и 1024 IGHV и IGKV, соответственно. Во втором полноразмерном DVD-антителе (1024L992) 1024 IGHV и IGKV являются N-концевыми, после чего следуют линкер и 992 IGHV и IGKV, соответственно. Плазмидная ДНК, кодирующая антитела 992 и 1024, используется в качестве шаблона для двухстадийного ПЦР-опосредованного конструирования генов, кодирующих DVD. Два кодирующих вариабельные домены участка IGHV и IGKV сначала амплифицируются отдельно, в результате чего они содержат области удлинения перекрытий на месте кодирующей линкер области (шаблон и комбинации праймеров см. в таблице 13 и таблице 14). Ген IGKV, кодирующий C-концевой ближний вариабельный домен, амплифицируется таким образом, чтобы в кодирующую последовательность был включен ген, кодирующий константный домен человеческой легкой цепи (IGKC). Кодирующие последовательности и аминокислотные последовательности субъединиц антитела с двойным вариабельным доменом показаны в Приложении 3.

Первая ПЦР была приготовлена со следующей смесью в каждой пробирке (50-мкл реакции) с получением заданной конечной концентрации: 1x FastStart-буфер (Roche), смесь dNTP (200 мкМ каждого), праймеры (10 пМ каждого) (см. таблицу 14), смесь ферментов высокого качества FastStart (2,2 единицы; Roche) и 100 нг плазмидного шаблона (см. таблицу 14). ПЦР проводилась при следующем термическом цикле: 2 минуты при 95°C, 20× (30 секунд при 95°C, 30 секунд при 55°C, 1 минута при 72°C), 10 минут при 72°C. Полученные в результате ПЦР-продукты с правильной длиной из первой ПЦР-реакции (см. таблицу 14) были очищены посредством препаративного электрофореза в агарозном геле и использованы на втором этапе, на котором два вариабельных домена соединялись посредством ПЦР с удлинением перекрытий. Вторая ПЦР, представляющая собой сплайсинг ДНК-фрагментов посредством ПЦР с удлинением перекрытий, приготавливалась со следующей смесью в каждой пробирке (50-мкл реакции) с получением заданной конечной концентрации: 1x FastStart-буфер (Roche), смесь dNTP (200 мкМ каждого), праймеры (10 пМ каждого, см. таблицу 15), смесь ферментов высокого качества FastStart (2,2 единицы; Roche) и шаблон (100 нг ПЦР-фрагмента, см. таблицу 15). ПЦР проводилась при термическом цикле, определенном выше. Полученные в результате второго этапа ПЦР-продукты были очищены посредством препаративного электрофореза в агарозном геле и обработаны рестрикционными ферментами, AscI и XhoI для двойного IGHV и NheI и NotI для двойного IGKV (включая IGKC). Фрагменты последовательно сшивались в экспрессионный IgG-вектор млекопитающего 00-VP-002 (Фиг. 4) посредством стандартных процедур расщепления рестрикционными ферментами и сшивания. Полученный в результате экспрессионный плазмидный вектор был амплифицирован в E. coli, и набор плазмид очищался стандартными методами. DVD-антитела экспрессируются и очищаются, как в примере 2, и характеризуются по активности в соответствии с примерами 3-13.

В случае если полученные в результате антитела демонстрируют сниженное связывание или отсутствие связывания с целевым hEGFr, то могут быть протестированы другие линкеры.

Таблица 13
Праймеры для конструирования DVD-антитела из 992 и 1024
SEQ ID No: Название праймера Последовательность
121 3'JH GGAGGCGCTCGAGACGGTGACTGAGGTTCCTTGAC
122 992_5'VH CCAGCCGGGGCGCGCCGAGGTCCAACTGCAGCAACCTGGGTCTGAGCTGGTG
123 1024_5'VH CCAGCCGGGGCGCGCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAACTG
124 992_5'VK catgggaatagctagccGACATTCAGATGACTCAGACTACATCCTCCCTG
125 1024_5'VK catgggaatagctagccGACATCGTGATGACACAAGCTGCATTCTCCAATC
126 Kappa3' ACCGCCTCCACCGGCGGCCGCTTATTAACACTCTCCCCTGTTG
127 992H_O3' CTGGGGGCCCTTGGTGCTGGCTGACGAGACGGTGACTGAGGTTC
128 1024H_O5' GCCAGCACCAAGGGCCCCCAGGTCCAACTGCAGCAGC
129 1024H_O3' CGGGGCCCTTGGTGCTGGCTGACGAGACGGTGACTGAG
130 992H_O5' GCCAGCACCAAGGGCCCCGAGGTCCAACTGCAGCAAC
131 992K_O3' GTCTGGTGCAGCCACAGTTCGTTTGATTTCCAGCTTGGTG
132 1024K_O5' CGAACTGTGGCTGCACCAGACATCGTGATGACACAAGC
133 1024K_O3' GTCTGGTGCAGCCACAGTTCGTTTTATTTCCAGCTTGGTCC
134 992K_O5' CGAACTGTGGCTGCACCAGACATTCAGATGACTCAGACTAC
Таблица 14
Комбинации праймеров и шаблонов для 1го этапа ПЦР, конструирования кодирующих DVD генов из 992 и 1024
DVD Шаблон для ПЦР Праймеры для амплификации гена IGHV Праймеры для амплификации гена IGKV
1-й этап ПЦР 1-й ПЦР-продукт (размер в п.н.) 1-й этап ПЦР 1-й ПЦР-продукт (размер в п.н.)
992L1024 992 992_5'VH
992H_O3'
992HO
(406 bp)
992_5'VK
992K_O3'
992KO
(359 bp)
1024 1024H_O5'
3'JH
HO1024
(381 bp)
1024K_O5'
Kappa3'
KO1024*
(702 bp)
1024L992 992 992H_O5'
3'JH
HO992
(393 bp)
992K_O5'
Kappa3'
KO992
(687 bp)
1024 1024_5'VH
1024H_O3'
1024HO
(392 bp)
1024_5'VK
1024K_O3'
1024KO*
(374 bp)
*Амплифицированная кодирующая последовательность содержит IGKC-ген
Таблица 15
Комбинации праймеров и шаблонов для 2го этапа, сплайсинга посредством удлинения перекрытий, для конструирования кодирующих DVD генов из 992 и 1024
IGHV IGKV
DVD Шаблон Праймеры Продукт (п.н.) Шаблон Праймеры Продукт (п.н.)
992L1024 992HO
HO1024
992_5'VH
3'JH
766 992KO
KO1024
992_5'VK
Kappa3'
1040
1024L992 HO992
1024HO
1024_5'VH
3'JH
766 KO992
1024KO
1024_5'VK
Kappa3'
1040

Пример 20: 6-недельное изучение токсичности при внутривенном введении в комбинации с эрбитуксом на яванском макаке

Цель исследования: цель исследования состояла в определении токсичности тестируемого образца, 992+1024, после еженедельного внутривенного введения яванскому макаку в течение 6 недель.

Поскольку токсичность является лимитирующим дозу фактором в клинической практике с ингибиторами EGFR, такими как эрбитукс и вектибикс, то считалось важным оценить на ранней стадии переносимость 992+1024 в клинически релевантной дозе. Эта важность подчеркивается тем фактом, что 992+1024, вероятно, имеет механизм действия, отличающийся от других нацеленных на EGFR продуктов. Потенциально это может привести к новым вредным эффектам или ухудшению эффектов, наблюдавшихся для других ингибиторов EGFR.

Группы из трех самок яванского макака обрабатывались еженедельными внутривенными дозами 992+1024 4/2,7 и 12/8 мг/кг, и 12/8 мг/кг эрбитукса в течение 6 недель. Первые дозы из 4 и 12 мг/кг были нагрузочными дозами, 2,7 и 8 мг/кг были поддерживающими дозами, вводимыми 5 раз. Доза 12/8 мг/кг эквивалентна клинической дозе эрбитукса для людей, используемой в клинической практике.

План исследования

Номер группы Описание группы Уровень дозы (мг/кг/день) Объем дозы (мл/кг) Номера животных, самки
1 Контроль 0 19/12# 1-3
2 992+1024 Низкая доза 4,2/2,7# 19/12# 4-6
3 992+1024 Высокая доза 12,6/8# 19/12# 7-9
4 Эрбитукс 12,6/8# 19/12# 10-12
# Уровень первой дозы приведен для нагрузочной дозы, уровень второй дозы приведен для введения через 8 дней после нее

Следующие параметры оценивались в процессе исследования: смертность, клинические признаки, масса тела, потребление пищи, гематология, клиническая химия, масса органов, макроскопические данные.

Результаты

Смертность: в течение курса исследования не наблюдалось незапланированных смертей.

Клинические признаки: не имелось относящихся к обработке наблюдений вредных симптомов

Масса тела: влияние обработки 992+1024 или эрбитуксом на массу тела отсутствовало.

Потребление пищи: не имелось видимого влияния на потребление пищи.

Гематология: не было обнаружено воздействия на гематологические параметры, которое можно было бы приписать влиянию обработки 992+1024 или эрбитуксом.

Клиническая химия: не наблюдалось изменений в параметрах клинической химии, которые можно было бы приписать влиянию обработки каким-либо из тестируемых изделий.

На 4 неделе у одного животного, получившего дозы 4,2/2,7 мг/кг 992+1024/день наблюдались повышенные уровни аспартат-аминотрансферазы и аланин-аминотрансферазы в сравнении со значениями до начала обработки. Данные уровни вернулись к нормальным диапазонам на 6 неделе. В условиях отсутствия аналогичного эффекта у других обработанных животных, токсикологическое значение данного повышения уровня ферментов печени неизвестно.

Масса органов: не имелось различий, имеющих токсикологическое значение, между массами органов между обработанными и контрольными животными.

Макроскопические данные: не имелось убедительных наблюдений, замеченных при вскрытии, для предположения наличия влияния 992+1024 или эрбитукса.

Предварительный вывод: предварительные данные показывают, что смесь 992+1024 хорошо переносилась в тестируемых дозах, и не наблюдалось неблагоприятного влияния обработки.

Пример 21: Подавление роста клеточных линий рака легких

Известно, что клеточные линии рака легких экспрессируют EGFR с мутациями в тирозинкиназном домене (Steiner et al. Clin Cancer Res 13.5 (2007): 1540-51). Посредством метода, аналогичного использованному в примере 6, была исследована способность комбинации двух антител 992 и 1024 подавлять рост клеточных линий рака легких HCC827 и H1975, имеющих различные мутации EGFR.

Результаты

Как можно видеть в таблице 16 и таблице 17, комбинация 992 и 1024 способна подавлять рост обеих клеточных линий. Комбинация является превосходящей по отношению к моноклональным антителам 992 и 1024 и к вектибиксу.

Таблица 16
Значения IC50 и максимальное подавление роста указанных антител для клеточной линии HCC827
НСС827 IC50 (мкг/мл) Максимальное ингибирование
Эрбитукс 0,013 80%
Вектибикс 0,100 60%
992 0,050 80%
1024 0,034 40%
992+1024 0,031 80%
Таблица 17
Значения IC50 и максимальное подавление роста указанных антител для клеточной линии H1975
H1975 IC50 (мкг/мл) Максимальное ингибирование
Эрбитукс 0,010 30%
Вектибикс 0,141 30%
992 0,056 30%
1024 - 0%
992+1024 0,024 30%

Пример 21: Эффективность для устойчивых к эрбитуксу клеток

Для исследования того, может ли композиция антител с антителами 992+1024 ингибировать устойчивые к эрбитуксу клетки, были созданы устойчивые к эрбитуксу клетки HN5 путем продолжительного подвергания родительских клеток HN5 воздействию повышенных уровней эрбитукса. После того, как пул устойчивых к эрбитуксу клеток был получен, были протестированы эффекты ингибирования для эрбитукса, вектибикса и композиции антител с антителами 992+1024 с использованием анализа выживаемости WST-1.

Метод

Устойчивые к эрбитуксу клетки HN5 были созданы на основе чувствительной к эрбитуксу (цетуксимабу) клеточной линии HN5 человеческого рака головы и шеи посредством продолжительного подвергания воздействию возрастающих концентраций эрбитукса в течение 6-месячного периода. Начиная со стартовой дозы, соответствующей IC50 цетуксимаба (0,05 мкг/мл), доза воздействия поступательно нарастала до тех пор, пока клетки не стали успешно пролиферировать в среде, содержащей 10 мкг/мл эрбитукса. Клетки были выращены в DMEM, дополненной 10% FBS и соответствующими концентрациями эрбитукса, и пассировались два раза в неделю.

Реагент клеточной пролиферации WST-1 представляет собой готовый к использованию субстрат, который измеряет метаболическую активность в жизнеспособных клетках, при этом предполагается, что метаболическая активность коррелирует с количеством жизнеспособных клеток. В данном примере анализ WST-1 был использован для измерения количества метаболически активных клеток после лечения различными антителами в различных концентрациях.

До выполнения анализа WST-1 соответствующие антитела и смеси антител были разведены до конечной суммарной концентрации антител 20 мкг/мл в DMEM, дополненном 0,5% FBS и 1% P/S, что давало конечную концентрацию антител 10 мкг/мл в лунке с наибольшей концентрацией антител. Затем 150 мкл данных растворов было добавлено в лунки в столбце 2 96-луночного планшета, и было выполнено трехкратное последовательное разведение до столбца 9, с тем чтобы каждая лунка содержала 100 мкл раствора антител. 100 мкл среды было добавлено в столбец 11. 200 мкл среды было добавлено в ряды 1 и 8, а также в столбцы 1 и 12, с целью понижения влияния испарения среды для использовавшихся в эксперименте лунок.

Родительские клетки HN5 и устойчивые клетки HN5 промывались 1xPBS и отсоединялись посредством трипсинизации с 3 мл раствора трипсина. Затем было добавлено 17 мл полной среды, и клетки откручивались на 300xg (1200 ед. относительной центробежной силы) в течение 5 минут. Супернатант удалялся, и клетки ресуспендировались в DMEM+0,5% FBS. Затем подсчитывалось количество клеток, и их концентрация доводилась до 15000 клеток/мл. Затем в экспериментальные лунки в столбцах 2-11 добавлялось 100 мкл клеточной суспензии (1500 клеток/мл). Планшеты инкубировались в течение 4 дней во влажной камере при 37°C. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Количество метаболически активных клеток (MAC) рассчитывалось как процентная доля от необработанного контроля в соответствии с формулой, использованной в примере 6.

IC50 для каждой смеси рассчитывалось с использованием GraphPad Prism путем аппроксимации кривых титрования уравнением Y=Bottom+(Top-Bottom)/(1+10^((LogIC50-X)*HillSlope)).

Результаты

Результаты титрований показаны на Фиг. 43 для родительских клеток и устойчивых к эрбитуксу клеток HN5. Очевидно, что активность и эффективность эрбитукса значительно снизилась в устойчивых к эрбитуксу клетках по сравнению с родительскими клетками. Эффективность эрбитукса и вектибикса снизилась примерно на 50%, и значение IC50 увеличилось более чем в 10 раз (Таблица 18). В отличие от этого, активность композиции антител с антителами 992+1024 (Sym004) снизилась только на 43%, и IC50 увеличилось в 2 раза. Данные результаты показывают, что композиция антител с антителами 992+1024 является более активной и подавляет рост устойчивых к эрбитуксу клеток HN5 с большей эффективностью, чем эрбитукс и вектибикс.

Таблица 18
Значения IC50 и эффективность подавления HN5 дикого типа и устойчивых к эрбитуксу клеток HN5 указанными антителами.
ND: не определялось
IC50 (мкг/мл) эффективность
(% необработанных)
родительские HN5 устойчивые к эрбитуксу HN5 родительские HN5 устойчивые к эрбитуксу HN5
Эрбитукс 0,050 0,750 88,1% 34,4%
Вектибикс 0,035 0,500 88,3% 32,3%
992 0,420 ND 85,5% 1,7%
1024 0,048 ND 84,8% 1,3%
992+1024 (Sym004) 0,053 0,110 88,2% 45,0%

Пример 22: Повторное лечение in vivo с использованием композиции антител с антителами 992+1024

Метод

Самкам мышей BALB/c nu/nu в возрасте 6-8 недель было подкожно инъецировано 1×106 клеток A431 NS в правый бок. Опухоли измерялись три раза в неделю микрометрами, и объем опухоли (V) рассчитывался по следующей формуле: V=(ширина)2×(длина)×0,5. Когда опухоли достигли среднего размера приблизительно 100 мм3, начиналось лечение, и мыши подвергались лечению 1 мг антител 992+1024 внутрибрюшинно дважды в неделю с общим количеством инъекций, равным девяти. После периода первоначального лечения проводилось исследование мышей в течение 159 дней. Если в течение этого периода был обнаружен рост опухоли, то мыши подвергались повторному лечению 1 мг антител 992+1024 дважды в неделю до окончания исследования.

Результаты

Все опухоли отвечали на первоначальные четыре недели терапии (Фиг. 44). Экспоненциальный рост опухоли был остановлен, и опухоли регрессировали до объемов от 0 до ~200 мм3. В дальнейшем объем опухолей оставался стабильным в течение более чем 85 дней, после чего три из девяти опухолей опять начали расти. Три опухоли, имевшие различные размеры до начала второго раунда терапии, обрабатывались 1 мг антитела 992+1024 дважды в неделю в течение оставшегося периода исследования. Во всех трех случаях повторное лечение привело к немедленной регрессии опухолей, что указывает на то, что опухоли не стали устойчивыми после первоначальных четырех недель лечения композицией антител с антителами 992+1024.

Пример 23: Лечение in vivo опухолей, имевших частичный ответ на эрбитукс, с использованием композиции антител с антителами 992+1024

Методы

Самкам мышей BALB/c nu/nu в возрасте 6-8 недель было подкожно инъецировано 1x106 клеток A431 NS в правый бок. Опухоли измерялись три раза в неделю микрометрами, и объем опухоли (V) рассчитывался по следующей формуле: V=(ширина)2×(длина)×0,5. Когда опухоли достигли среднего размера приблизительно 130 мм3, мыши были разделены на две группы из 10 и 30 животных. Группа из 10 животных обрабатывалась контрольным антителом, тогда как группа из 30 животных обрабатывалась 1 мг эрбитукса в трех дозах. В этом момент группа, обрабатываемая эрбитуксом, случайным образом разделялась на две сбалансированных группы по 12 животных со средним размером опухоли 500 мм3. Две группы животных подвергались лечению 1 мг антител 992+1024 дважды в неделю или для них продолжалось лечение эрбитуксом. Шесть выбросов было удалено из исследования.

Результаты

Первоначальное лечение эрбитуксом частично подавило рост опухоли A431 NS (Фиг. 45). После 11 дней лечения эрбитуксом половина животных была переведена на лечение композицией антител с антителами 992+1024 (Sym004 в подписи к Фиг.). В группе мышей, которая была переведена на лечение антителами 992+1024, наблюдалась значимая регрессия опухолей по сравнению с группой, для которой продолжалось лечение эрбитуксом. Этот явный эффект композиции антител с антителами 992+1024 на больших опухолях, предварительно подвергавшихся лечению эрбитуксом, указывает, что композиция антител с антителами 992+1024 является более активной, чем эрбитукс, в модели A431 NS, и что композиция антител с антителами 992+1024 может представлять собой вариант лечения для объектов, имеющих частичный ответ на эрбитукс.

Пример 24: Обработка in vivo устойчивых к эрбитуксу клеток

Для дальнейшего изучения того, может ли потенциальное лекарство Sym004 подавлять устойчивые к эрбитуксу клетки, были получены устойчивые к эрбитуксу клоны HN5 из пула устойчивых к эрбитуксу клеток HN5. Клоны были получены посредством ограниченного разведения, и после того, как устойчивые к эрбитуксу клоны были получены, проводилось тестирование эффектов подавления для эрбитукса, вектибикса и Sym004 с использованием анализа жизнеспособности WST-1.

Метод

Устойчивые к эрбитуксу HN5 клоны были получены из пула устойчивых к эрбитуксу клеток (см. пример 21) посредством ограниченного разведения. Клонирование посредством ограниченного разведения представляет собой процедуру разделения клеток на основании предположения, что если суспензия клеток разводится в достаточном объеме культуральной среды, то можно продуцировать такую концентрацию клеток, чтобы точно измеренный объем разведенной суспензии содержал 1 клетку. Когда данный объем разведенной суспензии помещается в отдельные лунки 96-луночного планшета, каждая лунка должна получить 1 клетку/лунку. Если данная клетка остается жизнеспособной (обычно требуются слои питающих клеток и/или "кондиционированная" среда по причине очевидно низкой плотности клеток 1 клетка/лунку) и пролиферирует, то в лунке был установлен выделенный клон клеток. Клетки выращивались DMEM, дополненной 10% FBS и соответствующими концентрациями эрбитукса.

Реагент клеточной пролиферации WST-1 представляет собой готовый к использованию субстрат, который измеряет метаболическую активность в жизнеспособных клетках, при этом предполагается, что метаболическая активность коррелирует с количеством жизнеспособных клеток. В данном примере анализ WST-1 был использован для измерения количества метаболически активных клеток после лечения различными антителами в различных концентрациях.

До выполнения анализа WST-1 соответствующие антитела и смеси антител были разведены до конечной суммарной концентрации антител 20 мкг/мл в DMEM, дополненном 0,5% FBS и 1% P/S, что давало конечную концентрацию антител 10 мкг/мл в лунке с наибольшей концентрацией антител. Затем 150 мкл данных растворов было добавлено в лунки в столбце 2 96-луночного планшета, и было выполнено трехкратное последовательное разведение и добавление в последующие столбцы вплоть до столбца 9, с тем чтобы каждая лунка содержала 100 мкл раствора антител. 100 мкл среды было добавлено в столбец 11. 200 мкл среды было добавлено в ряды 1 и 8, а также в столбцы 1 и 12, с целью понижения влияния испарения среды для использовавшихся в эксперименте лунок.

Родительские клетки HN5 и устойчивые клетки HN5 промывались 1xPBS и отсоединялись посредством трипсинизации с 3 мл раствора трипсина. Затем было добавлено 17 мл полной среды, и клетки откручивались на 300xg (1200 ед. относительной центробежной силы) в течение 5 минут. Супернатант удалялся, и клетки ресуспендировались в DMEM+0,5% FBS. Затем подсчитывалось количество клеток, и их концентрация доводилась до 15000 клеток/мл. Затем в экспериментальные лунки в столбцах 2-11 добавлялось 100 мкл клеточной суспензии (1500 клеток/мл). Планшеты инкубировались в течение 4 дней во влажной камере при 37°C. Затем в каждую лунку добавлялось 20 мкл реагента WST-1, и планшеты инкубировались в течение одного часа при 37°C. Затем планшеты были помещены на кольцевой планшетный шейкер и оставлены еще на один час. Поглощение измерялось для 450 и 620 нм (опорная длина волны) в устройстве считывания ELISA. Количество метаболически активных клеток (MAC) рассчитывалось как процентная доля от необработанного контроля в соответствии с формулой:

% M A C = ( 1 ( O D э к с п . O D с р е д ы ) ( O D н е о б р а б . O D с р е д ы ) ) × 100

IC50 для каждой смеси рассчитывалось с использованием GraphPad Prism путем аппроксимации кривых титрования уравнением Y=Bottom+(Top-Bottom)/(1+10^((LogIC50-X)*HillSlope)).

Результаты

Результаты титрования показаны на Фиг. 46 для четырех репрезентативных клонов. Очевидно, что клоны обладают различными уровнями устойчивости к эрбитуксу. Однако Sym004 является превосходящим в ингибировании роста всех четырех клонов по сравнению с эрбитуксом и вектибиксом. Превосходство было доказано повышенной эффективностью (клоны #7, #11 и #14) и/или активностью (клоны #8, #11 и #14) (Таблица 19).

Таблица 19
Значения IC50 и эффективности ингибирования четырех устойчивых к эрбитуксу клонов HN5 указанными антителами
Активность IC50 (мкг/мл)
родительские HN5 Клон#7 Клон #8 Клон #11 Клон #14
Эрбитукс 0,050 0,016* 1,06 0,366* 0,314*
Вектибикс 0,035 0,023* 2,70 0,311* 0,190*
Sym004 0,053 0,029* 0,33 0,267* 0,110*
Эффективность (% максимального ингибирования)
родительские HN5 Клон#7 Клон #8 Клон #11 Клон #14
Эрбитукс 88,1% 60,9% 42,5% 35,7% 32,0%
Вектибикс 88,3% 61,1% 51,3% 28,6% 33,7%
Sym004 88,2% 70,3% 57,5% 38,9% 43,5%
*Значения IC50 не могут сравниваться из-за различия в максимальном уровне ингибирования

Пример 25: In vivo-обработка устойчивых к эрбитуксу клеток HN5 с использованием эрбитукса и композиции антител с антителами 992+1024

Метод

5*106 устойчивых к эрбитуксу клеток HN5 клона #7 были подкожно инъецированы в правый бок 6-8 недельных самок мыши без волосяного покрова, без вилочковой железы. Опухоли измерялись дважды в неделю микрометрами, и объем опухоли в мм3 рассчитывался по следующей формуле: V=(ширина)2×(длина)×0,5. Обработка начиналась последовательно, когда опухоли достигали среднего размера ~650 мм3. Мыши обрабатывались 50 мг/кг Sym004 или эрбитуксом посредством внутрибрюшинных инъекций дважды в неделю в течение трех недель. После трех недель обработки проводилось изучение мышей в течение пяти недель.

Результаты

После трех недель терапии Sym004, обе опухоли в группе Sym004 были полностью устранены (Фиг. 47). Две из трех подвергавшихся лечению в группе эрбитукса мышей имели только частичный ответ на лечение. Это указывает на то, что опухоли, являющиеся частично устойчивыми/не имеющими ответа на эрбитукс, могут эффективно лечиться Sym004. Таким образом, приобретенный механизм устойчивости против эрбитукса не влияет на эффективность Sym004.

1. Композиция антител для применения в способе лечения злокачественного новообразования у субъекта, который проходил предшествующий курс лечения с применением антитела против EGFR человека, или злокачественного новообразования, являющегося устойчивым или частично устойчивым к лечению по меньшей мере одним другим антителом против EGFR человека, выбранным из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба, и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, при этом указанная композиция антител содержит по меньшей мере первую молекулу антитела против EGFR человека и вторую молекулу антитела против EGFR человека,
а) где первая молекула антитела против EGFR человека выбрана из группы, состоящей из
(i) антитела, легкая цепь которого содержит аминокислоты 3-216 из SEQ ID NO:72, и тяжелая цепь которого имеет вариабельную область (VH), содержащую аминокислоты 3-124 из SEQ ID NO:40, и константную область, содержащую аминокислотную последовательность SEQ ID NO:91;
(ii) антитела, вариабельная область легкой цепи (VL) которого содержит аминокислоты 3-109 из SEQ ID NO:72, и VH которого содержит аминокислоты 3-124 из SEQ ID NO:40; и
(iii) антитела, имеющего CDR1, CDR2 и CDR3 легкой цепи из SEQ ID NO:72 и CDR1, CDR2 и CDR3 тяжелой цепи из SEQ ID NO:40; и
b) где вторая молекула антитела против EGFR человека выбрана из группы, состоящей из
(i) антитела, легкая цепь которого содержит аминокислоты 3-221 из SEQ ID NO:73 и тяжелая цепь которого имеет вариабельную область (VH), содержащую аминокислоты 3-120 из SEQ ID NO:41, и константную область, содержащую аминокислотную последовательность SEQ ID NO:91;
(ii) антитела, VL которого содержит аминокислоты 3-114 из SEQ ID NO:73 и VH которого содержит аминокислоты 3-120 из SEQ ID NO:41; и
(iii) антитела, имеющего CDR1, CDR2 и CDR3 легкой цепи в SEQ ID NO:73 и CDR1, CDR2 и CDR3 тяжелой цепи в SEQ ID NO:41.

2. Композиция по п.1, где указанный предшествующий курс лечения включал применение антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител.

3. Композиция по п.2, где указанное антитело против EGFR человека представляет собой залутумумаб или антитело, способное связывать тот же эпитоп, что и залутумумаб.

4. Композиция по п.2, где указанное антитело против EGFR человека представляет собой панитумумаб или антитело, способное связывать тот же эпитоп, что и панитумумаб.

5. Композиция по п.2, где указанное антитело против EGFR человека представляет собой цетуксимаб или антитело, способное связывать тот же эпитоп, что и цетуксимаб.

6. Композиция по п.1, где указанное злокачественное новообразование выбрано из группы, состоящей из рака головы и шеи, рака толстой кишки, рака груди, рака почки, рака легких, рака яичников, рака простаты, глиомы, рака поджелудочной железы, рака мочевого пузыря, немелкоклеточной карциномы легких (NSCLC), рака желудка, рака шейки матки, гепатоцеллюлярного рака, желудочно-пищеводного рака, колоректального рака, рака прямой кишки, эпителиоидной карциномы, RCC, плоскоклеточной карциномы головы и шеи (SCCHN), рака пищевода, мультиформной глиобластомы, плоскоклеточной карциномы, рака почек, саркомы и меланомы.

7. Композиция по п.1, где композицию антител применяют для вспомогательной терапии, следующей за хирургическим вмешательством и/или радиационной терапией.

8. Композиция по п.1, где композицию антител используют для комбинационной терапии, совместно с: (а) химиотерапией, (b) по меньшей мере одним ингибитором тирозинкиназы, (с) по меньшей мере одним ингибитором ангиогенеза, (d) по меньшей мере одним гормоном, (е) по меньшей мере одним индуцирующим дифференциацию агентом или (f) любой комбинацией (а)-(е).

9. Композиция по п.1, где указанный предшествующий курс лечения являлся терапией первой линии.

10. Композиция по п.1, где указанный предшествующий курс лечения являлся терапией второй линии.

11. Композиция по п.9, где терапия первой линии содержала курс лечения (а) химиотерапией, (b) по меньшей мере одним ингибитором тирозинкиназы, (с) по меньшей мере одним ингибитором ангиогенеза, (d) по меньшей мере одним гормоном, (е) по меньшей мере одним индуцирующим дифференциацию агентом, или (f) любой комбинацией (а)-(е).

12. Композиция по п.8 или 11, где ингибитором ангиогенеза является бевацизумаб.

13. Композиция по п.8 или 11, где химиотерапия включает в себя введение препарата выбранного из группы, включающей адриамицин, цисплатин, таксол, доксорубицин, топотекан, фторпиримидин, оксалиплатин и иринотекан.

14. Композиция по п.1, где злокачественное новообразование указанного субъекта прогрессировало во время или после предшествующего курса лечения.

15. Композиция по п.1, где злокачественное новообразование указанного субъекта прогрессировало после вышеупомянутого предшествующего курса лечения.

16. Композиция по любому из пп.1-15, где указанное злокачественное новообразование являлось устойчивым или частично устойчивым к предшествующему курсу лечения.

17. Композиция по п.1, в которой первая молекула антитела против EGFR человека и вторая молекула антитела против EGFR человека представляют собой гуманизированные антитела.

18. Композиция антител для применения в лечении злокачественного новообразования у субъекта, который проходил предшествующий курс лечения с применением антитела против EGFR человека, или злокачественного новообразования, являющегося устойчивым или частично устойчивым к лечению по меньшей мере одним другим антителом против EGFR человека, выбранным из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, при этом указанная композиция антител содержит первую молекулу антитела против EGFR человека и вторую молекулу антитела против EGFR человека,
a) где первая молекула антитела против EGFR человека имеет легкую цепь, содержащую аминокислоты 3-216 из SEQ ID NO:72, и тяжелую цепь, которая содержит VH, содержащую аминокислоты 3-124 из SEQ ID NO: 40, и константную область, содержащую аминокислотную последовательность SEQ ID NO:91;
и
b) где вторая молекула антитела против EGFR имеет легкую цепь, содержащую аминокислоты 3-221 из SEQ ID NO:73, и тяжелую цепь, содержащую VH, содержащую аминокислоты 3-120 из SEQ ID NO:41, и константную область, содержащую аминокислотную последовательность SEQ ID NO:91, где композиция не содержит дополнительных молекул антител в дополнение к первой и второй молекуле антитела.

19. Композиция по п.1, где первая и вторая молекула антитела против EGFR из указанной композиции не ингибируют связывание друг друга с EGFR человека.

20. Композиция по п.1, где по меньшей мере одна из молекул антител указанной композиции способна повышать максимальную связывающую способность молекулы другого антитела в отношении EGFR человека.

21. Композиция по п.1, где количество первой молекулы антитела и молекулы второго антитела в композиции составляет от 5% до 95%, от 10% до 90%, от 20% до 80%, от 30% до 70%, от 40% до 60% или составляет около 50%.

22. Композиция по п.1, где соотношение первой молекулы антитела ко второй молекуле антитела составляет 1:1.

23. Композиция по п.1, в которой первая и вторая молекула антитела композиции принадлежат к подтипу изотипа IgG1 или IgG2.

24. Композиция по п.1, где композиция не содержит других молекул антител против EGFR в дополнение к указанным первой и второй молекулам антител.

25. Композиция по п.1, где композиция дополнительно содержит третью молекулу антитела против EGFR, при этом молекула указанного третьего антитела против EGFR выбрана из группы, состоящей из:
(i) антитела, легкая цепь которого содержит аминокислоты 3-220 из SEQ ID NO:74 и тяжелая цепь которого имеет VH, содержащую аминокислоты 3-120 из SEQ ID NO:42, и константную область, содержащую аминокислотную последовательность SEQ ID NO:91;
(ii) антитела, VL которого содержит аминокислоты 3-114 из SEQ ID NO:74 и VH которого содержит аминокислоты 3-120 из SEQ ID NO:42;
(iii) антитела, имеющего CDR1, CDR2 и CDR3 легкой цепи из SEQ ID NO:74 и CDR1, CDR2 и CDR3 тяжелой цепи из SEQ ID NO:42;
(iv) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями K27Q, Y36F и Q44L, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S9*01 и IGHJ4*01 с соматическими мутациями K14R, M39L, T55S, S58G, G59V, Y62T, T63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO:112;
(v) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F и Q44L, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S12*01 и IGHJ4*01 с соматическими мутациями M39L, T55S, I56T, S58G, G59V, Y62T, T63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO: 112;
(vi) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F и Q44L, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S9*01 и IGHJ4*01 с соматическими мутациями M39L, T55S, S58G, G59V, Y62T, T63Y, Y66-, Y67F, D69G, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO: 112;
(vii) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F, Q44L и Q48R, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S12*01 и IGHJ4*01 с соматическими мутациями M39L, T55S, S58G, G59V, Y62T, Т63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO:112;
(viii) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F, Q44L и H92Y, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S9*01 и IGHJ4*01 с соматическими мутациями M39L, T55S, S58G, G59V, Y62T, T63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO:112;
(ix) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F и Q44L, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S9*01 и IGHJ4*01 с соматическими мутациями M39L, T55S, S58G, G59V, Y62T, T63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO:112; и
(х) антитела, легкая цепь которого кодируется генами IGKV3-12*01 и IGKJ2*01 с соматическими мутациями Y36F и Q44L, L-CDR3 которого представляет собой SEQ ID NO:119, тяжелая цепь которого кодируется генами IGHV5S9*01 и IGHJ4*01 с соматическими мутациями S32N, M39L, T55S, S58G, G59V, Y62T, T63Y, Y66-, Y67F, I78M, K84R и T86I, и H-CDR3 которого представляет собой SEQ ID NO: 112.

26. Композиция по п.25, в которой указанная третья молекула антитела приводит к улучшенному связыванию с EGFR человека вышеупомянутых первой и/или второй молекулы антитела.

27. Композиция по п.25, где композиция не содержит дополнительных молекул антител против EGFR в дополнение к вышеупомянутым первой, второй и третьей молекулам антител.

28. Композиция по п.1, где молекулы антитела композиции подготовлены для одновременного, последовательного или отдельного введения.

29. Композиция по п.1, где композиция приводит к интернализации рецепторов.

30. Композиция по п.1 для применения в индуцировании регрессии опухоли у субъекта.

31. Композиция по п.1, где композиция способна индуцировать конечную дифференцировку клеток А431 NS in vivo.

32. Композиция по п.1, где композиция способна повышать регуляцию экспрессии инволюкрина опухоли in vivo.

33. Композиция по п.1, в которой первая и вторая молекулы антитела против EGFR формируют части биспецифичной связывающей молекулы.

34. Композиция по п.33, в которой биспецифичная связывающая молекула содержит первую антигенсвязывающую область, содержащую CDR1, CDR2 и CDR3 легкой цепи в SEQ ID NO:72 и CDR1, CDR2 и CDR3 тяжелой цепи из SEQ ID NO:40; и вторую антигенсвязывающую область, содержащую CDR1, CDR2 и CDR3 легкой цепи в SEQ ID NO:73 и CDR1, CDR2 и CDR3 тяжелой цепи из SEQ ID NO:41.

35. Композиция по п.33, в которой биспецифичная связывающая молекула представляет собой антитело с двумя вариабельными доменами.

36. Композиция по п.33, в которой биспецифичная связывающая молекула представляет собой биспецифичный Fab-фрагмент или биспецифичное scFV.

37. Композиция по п.1, где указанная композиция применяется для терапии первой линии.

38. Композиция по п.1, где указанная композиция применяется для терапии второй линии после курса лечения (а) химиотерапией, (b) по меньшей мере одним ингибитором тирозинкиназы, (с) по меньшей мере одним ингибитором ангиогенеза, (d) по меньшей мере одним гормоном, (е) по меньшей мере одним индуцирующим дифференциацию агентом или (f) любой комбинацией (а)-(е).

39. Композиция по п.1, где указанная композиция применяется для терапии третьей линии.

40. Композиция по п.38, где ингибитором ангиогенеза является бевацизумаб.

41. Композиция по п.16, где устойчивость или частичную устойчивость определяли посредством анализа образца раковых клеток, выделенного из указанного субъекта.

42. Способ снижения передачи сигналов EGPR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего снижается передача сигналов EGFR.

43. Способ уничтожения клеток, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего экспрессирующие EGFR клетки уничтожаются.

44. Способ индуцирования апоптоза в клетках, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется апоптоз.

45. Способ подавления пролиферации клеток, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего подавляется пролиферация.

46. Способ индуцирования дифференциации клеток опухоли in vivo, включающий введение композиции антител к экспрессирующим EGFR опухолевым клеткам, при этом указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется дифференциация клеток опухоли.

47. Способ по п.46, где указанная дифференциация является конечной.

48. Способ по п.46, где указанная дифференциация сопровождается повышением экспрессии инволюкрина.

49. Способ индуцирования интернализации EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки ранее подвергались воздействию антитела против EGFR человека, выбранного из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется интернализация EGFR.

50. Способ снижения передачи сигналов EGFR, включающий введение композиции антител в экспрессирующие EGFR клети, где указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего снижается передача сигналов EGFR.

51. Способ уничтожения клеток, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mАb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего экспрессирующие EGFR клетки уничтожаются.

52. Способ индуцирования апоптоза в клетках, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется апоптоз.

53. Способ подавления пролиферации клеток, экспрессирующих EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего подавляется пролиферация.

54. Способ индуцирования дифференциации клеток опухоли in vivo, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки опухоли являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется дифференциация клеток опухоли.

55. Способ по п.54, где указанная дифференциация является конечной.

56. Способ по п.54, где указанная дифференциация сопровождается повышением экспрессии инволюкрина.

57. Способ индуцирования интернализации EGFR, включающий введение композиции антител в экспрессирующие EGFR клетки, где указанные клетки являются устойчивыми или частично устойчивыми к антителу против EGFR человека, выбранному из группы, состоящей из цетуксимаба, панитумумаба, залутумумаба, нимотузумаба, ICR62, mAb806, матузумаба и антител, способных связывать тот же эпитоп, что и любое из перечисленных антител, и где указанная композиция антител представляет собой композицию по любому из пп.1-41, посредством чего индуцируется интернализация EGFR.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой способы лечения аутоиммунного заболевания, включающие введение субъекту фармацевтической композиции, содержащей фармацевтически приемлемый носитель и гуманизированное анти-CD4-антитело, способное активировать регуляторные T-клетки CD4+CD25+, где указанное антитело содержит V-домен H-цепи, содержащий последовательности DCRMY, VISVKSENYGANYAESVRG и SYYRYDVGAWFAY, и V-домен L-цепи, содержащий последовательности RASKSVSTSGYSYIY, LASILES и QHSRELPWT, при этом указанную композицию вводят субъекту с частотой от еженедельного приема до введения через каждый 31 день и с дозой гуманизированного анти-CD4-антитела от 20 до 200 мг, либо от 8 до 60 мг/м2 площади поверхности тела субъекта, либо от 0,2 до 2 мг/кг.

Изобретение относится к биотехнологии и представляет собой способы лечения аутоиммунного заболевания, включающие введение субъекту фармацевтической композиции, содержащей фармацевтически приемлемый носитель и гуманизированное анти-CD4-антитело, способное активировать регуляторные T-клетки CD4+CD25+, где указанное антитело содержит V-домен H-цепи, содержащий последовательности DCRMY, VISVKSENYGANYAESVRG и SYYRYDVGAWFAY, и V-домен L-цепи, содержащий последовательности RASKSVSTSGYSYIY, LASILES и QHSRELPWT, при этом указанную композицию вводят субъекту подкожно в дозе гуманизированного анти-CD4-антитела от 20 до 200 мг либо от 8 до 60 мг/м2 площади поверхности тела субъекта, либо от 0,2 до 2 мг/кг.

Изобретение относится к области биохимии, в частности к одиночному вариабельному домену, направленному против IL-6R, к полипептиду и конструкции, направленным против IL-6R, содержащим указанный одиночный вариабельный домен, а также к способам их получения.

Изобретение относится к области биотехнологии и иммунологии. Описано выделенное антитело человека или его антигенсвязывающий фрагмент.

Изобретение относится к области биотехнологии и медицины. Описаны способы лечения аутоиммунного заболевания.

Настоящее изобретение относится к области иммунологии. Предложено применение блинатумомаба (MT103) для получения фармацевтической композиции для лечения, уменьшения интенсивности или устранения острого лимфобластного лейкоза (ALL), где блинатумомаб (MT103) переводит MRD (минимальное остаточное заболевание) - позитивный острый лимфобластный лейкоз ALL в MRD-негативное состояние ALL.

Настоящее изобретение относится к области иммунологии. Предложено применение блинатумомаба для получения фармацевтической композиции для лечения, уменьшения интенсивности или устранения острого лимфобластного лейкоза (ALL) у детей, где блинатумомаб переводит MRD (минимальное остаточное заболевание) - позитивный острый лимфобластный лейкоз ALL в MRD-негативное состояние ALL.

Настоящее изобретение относится к области иммунологии. Предложен полипептид, содержащий два связывающих фрагмента, представленных антителами, причем первый из них связывается с эпитопом СD3ε(эпсилон)-цепи человека и примата, не являющегося шимпанзе, в частности Callithrix jacchus, Saguinus oedipus и Saimirí sciureus, а второй - с EGFR, Her2/neu или IgE человека и/или примата, не являющегося шимпанзе, причем упомянутый эпитоп СD3ε включает аминокислотную последовательность Gln-Asp-Gly-Asn-Glu.

Изобретение относится к области иммунологии и биотехнологии. Предложены варианты антагонистических антител, которые связываются с рецептором интерлейкина-7 (IL-7R).

Изобретение относится к области биотехнологии и иммунологии. Представлена молекула, специфически связывающаяся с CD37, содержащая от N-конца до С-конца: (a) CD37-специфическую scFV, содержащую от N-конца до С-конца: (i) гуманизированную вариабельную область тяжелой цепи, содержащую CDR1 GYNMN, CDR2 NIDPYYGGTTYNRKFKG и CDR3 SVGPFDS, (ii) линкер, имеющий от 5 до 30 аминокислот, включительно, и (iii) гуманизированную вариабельную область легкой цепи, содержащую CDR1 RASENVYSYLA, CDR2 FAKTLAE и CDR3 QHHSDNPWT; (b) шарнирную область; и (c) иммуноглобулиновые области CH2 и СН3.

Настоящее изобретение относится к области биотехнологии. Предложена композиция антител, обладающих способностью к связыванию с IGF-IR, которую получают при культивировании клеточной линии CHO DSM ACC 2795, причем количество остатков фукозы в сахарной цепи антител составляет по меньшей мере 99%. Также рассмотрена фармацевтическая композиция для ингибирования роста опухоли и способ получения такой фармацевтической композиция путем смешивания композиции антител по изобретению с фармацевтически приемлемым носителем. Композиция антител обладает пониженной антителозависимой клеточно-опосредованной цитотоксичностью (ADCC) и может найти применение в терапии заболевания, ассоциированных с IGF-IR. 3 н. и 2 з.п. ф-лы, 1 ил., 4 табл., 15 пр.

Изобретение относится к области иммунологии. Представлено профилактическое или терапевтическое средство против зуда, вызванного IL-31, которое содержит эффективное количество анти-NR10 антитела, обладающего нейтрализующей активностью против NR10 (другое название IL-31RA) в качестве активного ингредиента, и фармацевтически приемлемые добавки, где анти-NR10 антитело представляет собой антитело, которое включает аминокислотную последовательность тяжелой цепи SEQ ID NO: 17 и аминокислотную последовательность легкой цепи SEQ ID NO: 18, или его гуманизированное антитело. Предложено применение антитела против NR10, содержащего аминокислотные последовательности SEQ ID NO: 17 и SEQ ID NO: 18 тяжелой и легкой цепей соответственно, или его гуманизированного антитела для изготовления профилактического или терапевтического средства против зуда, вызванного IL-31. Описан способ профилактики или лечения зуда, вызванного IL-31, который включает стадию введения анти-NR10 антитела, содержащего аминокислотную последовательность тяжелой цепи SEQ ID NO: 17 и аминокислотную последовательность легкой цепи SEQ ID NO: 18, или его гуманизированного антитела. Изобретение позволяет супрессировать зуд, вызванный сверхэкспрессией IL-31. 3 н.п. ф-лы, 5 ил., 2 пр.

Изобретение относится к биотехнологии. Предложены варианты антиген-связывающего полипептида, специфичного к полипептиду LIGHT, характеризующиеся наличием вариабельной области тяжелой и легкой цепей, а также варианты конъюгатов на их основе для лечения заболевания или состояния. Описана фармацевтическая композиция для ингибирования апоптоза, индуцированного LIGHT человека, на основе терапевтически эффективного количества полипептида. Раскрыты: способ лечения или диагностики заболевания или состояния на основе композиции. Описаны варианты выделенного полинуклеотида и клетка, трансформированная полинуклеотидом, для получения антиген-связывающего полипептида, а также способ получения антиген-связывающего полипептида на основе клетки. Использование изобретения обеспечивает антитела, которые блокируют взаимодействие LIGHT человека или макаки с рецепторами LIGHT, что может найти применение в лечении различных заболеваний, связанных с повышенной активностью Т-клеток. 11 н. и 12 з.п. ф-лы, 11 ил., 8 табл., 3 пр.

Изобретение относится к области биотехнологии и иммунологии. Предложены антитела, направленные на интегрин α2β1, включая гуманизированные антитела к интегрину альфа-2 (α2), а также способы лечения антителами к интегрину α2. Гуманизированные антитела к интегрину α2 содержат вариабельную область тяжелой цепи, вариабельную область легкой цепи, константную область легкой цепи человека и вариантную константную область тяжелой цепи IgG1 человека, которые проявляют измененную эффекторную функцию. В вариантной константной области тяжелой цепи IgG1 человека присутствует замена S324N. Антитела проявляют улучшенную комплементзависимую цитотоксичность, улучшенную антителозависимую клеточноопосредованную цитотоксичность или улучшенные CDC и ADCC. Изобретение может быть использовано в медицине. 12 н. и 21 з.п. ф-лы, 3 ил., 1 табл., 2 пр.

Изобретение относится к области биотехнологии, конкретно к моноклональному антителу (mAb), и может быть использовано в медицине. Указанное антитело связывается с рецептором 2 IIIb фактора роста фибробластов (FGFR2IIIb) и содержит три CDR легкой и три CDR тяжелой цепи, представленные на фиг.13А и 13В, соответственно. Сконструированное антитело или его гуманизированный аналог используется в составе фармацевтической композиции для лечения злокачественного заболевания. Изобретение позволяет получить антитело против FGFR2IIIb, наиболее эффективно и полно ингибирующее рост ксенотрансплантата опухоли человека у мышей. 6 н. и 6 з.п. ф-лы, 16 ил., 6 пр.

Настоящее изобретение относится к области иммунологии. Предложено антитело и его антигенсвязывающий фрагмент, специфически связывающие рецептор колониестимулирующего фактора-1 (CSF-1R) человека, охарактеризованные последовательностями гипервариабельных участков (CDR). Также рассмотрены нуклеиновая кислота, кодирующая антитело по изобретению или его антигенсвязывающий фрагмент, вектор, обеспечивающие экспрессию антитела или его антигенсвязывающего фрагмента, и фармацевтическая композиция для применения при лечении заболеваний, ассоциированных с воспалением или аутоиммунитетом, или рака. Данное изобретение может найти дальнейшее применение в диагностике и терапии заболеваний, ассоциированных с CSF-1. 4 н. и 19 з.п. ф-лы, 18 ил., 4 табл.

Настоящее изобретение относится к антителам, включая человеческие антитела и их антигенсвязывающие части, которые специфически связываются с CCR2, в частности с человеческим CCR2, и могут действовать как ингибиторы CCR2. Анти-CCR2 антителами являются антитела, которые связываются с первой и/или второй внеклеточными петлями CCR2. Настоящее изобретение также относится к человеческим анти-CCR2 антителам и к их антигенсвязывающим частям. Настоящее изобретение относится к выделенным тяжелой и легкой цепям иммуноглобулина, происходящим от человеческих анти-CCR2 антител, и к молекулам нуклеиновой кислоты, кодирующим такие иммуноглобулины. Настоящее изобретение также относится к способам получения человеческих анти-CCR2 антител или их антигенсвязывающих частей, к композициям, содержащим такие антитела или их антигенсвязывающие части, и к способам применения антител и их антигенсвязывающих частей и композиций для диагностики и лечения. Настоящее изобретение также относится к способам генотерапии с применением молекул нуклеиновой кислоты, кодирующих молекулы тяжелой и/или легкой цепи иммуноглобулина, где указанные молекулы включают человеческие анти-CCR2 антитела или их антигенсвязывающие части. 10 н. и 15 з.п. ф-лы, 24 ил., 8 табл., 17 пр.

Изобретение относится к области биотехнологии, конкретно к биспецифическим антителам, и может быть использовано в медицине. Конструируют антитело, содержащее одну из следующих групп из шести последовательностей гипервариабельной области (HVR): (a) HVR-L1, включающую последовательность NIAKTISGY; (b) HVR-L2, содержащую последовательность WGSFLY; (c) HVR-L3, содержащую последовательность HYSSPP; (d) HVR-H1, содержащую последовательность NIKDTY; (e) HVR-H2, содержащую последовательность RIYPTNGYTR; и (f) HVR-Н3, содержащую последовательность WGGDGFYAMD; или (a) HVR-L1, включающую последовательность NIAKTISGY; (b) HVR-L2, содержащую последовательность WGSFLY; (c) HVR-L3, содержащую последовательность HYSSPP; (d) HVR-H1, содержащую последовательность NISGTY; (e) HVR-H2, содержащую последовательность RIYPSEGYTR; и (f) HVR-Н3, содержащую последовательность WVGVGFYAMD. Полученное антитело специфически связывает рецептор человеческого эпидермального фактора роста 2 (HER2) и сосудистый эндотелиальный фактор роста (VEGF). Изобретение относится также к выделенному фрагменту Fab указанного антитела, полинуклеотиду, его кодирующему, вектору экспрессии, клетке-хозяину, способу его получения, а также к его применению для лечения HER2-опосредованных заболеваний. Настоящее изобретение позволяет получить биспецифичное антитело, способное связывать одновременно VEGF и HER2 с улучшенной аффинностью. 9 н. и 5 з.п. ф-лы, 65 ил., 16 табл., 8 пр.

Настоящее изобретение относится к области иммунологии. Предложена молекула биспецифического одноцепочечного антитела, содержащая первый связывающий домен, способный связываться с эпитопом CD3-эпсилон-цепи человека и Callithrix jacchus (игрунка), Saguinus oedipus (эдипов тамарин) и Saimiri sciureus (беличья обезьяна), и второй связывающий домен, способный связываться с антигеном, выбранным из группы, состоящей из: PSCA, CD19, С-МЕТ, эндосиалина, EGF-подобного домена 1 ЕрСАМ, кодируемого экзоном 2, FAP-альфа или IGF-IR (или IGF-1R) человека и/или примата. Эпитоп СD3ε включает аминокислотную последовательность, раскрытую в описании. Раскрыта нуклеиновая кислота, кодирующая указанную молекулу биспецифического одноцепочечного антитела, экспрессирующий вектор, клетка-хозяин и способ получения антитела, а также полученное способом антитело. Описывается фармацевтическая композиция, содержащая молекулу биспецифического одноцепочечного антитела и способ предупреждения, лечения или ослабления рака или аутоиммунного заболевания на её основе. Предложено применение указанной молекулы биспецифического одноцепочечного антитела для изготовления фармацевтической композиции для предупреждения, лечения или ослабления рака или аутоиммунного заболевания. Использование изобретения обеспечивает клиническое улучшение в отношении перераспределения Т-клеток, уменьшая его, и улучшенный профиль безопасности. 9 н. и 14 з.п. ф-лы, 74 ил., 17 табл., 33 пр.

Изобретение относится к области иммунологии. Предложены варианты модифицированного антитела к CD20 или его антигенсвязывающего фрагмента. Каждый из вариантов характеризуется тем, что содержит вариабельную область лёгкой и тяжёлой цепи, и индуцирует более высокий уровень апоптоза, в сравнении с химерным B-Ly1 антителом. Предложены: смесь антител, в которой по меньшей мере 20% олигосахаридов в Fc области имеют разветвленную цепь и не фукозилированы, а также фармацевтическая композиция для производства лекарственного средства для лечения злокачественного гематологического или аутоиммунного заболевания на основе антител или смеси антител. Описаны: вектор экспрессии, клетка-хозяин на его основе, варианты кодирующих полинуклеотидов, а также способ получения антитела в клетке. Использование изобретений обеспечивает новые антитела с улучшенными терапевтическими свойствами, в том числе с повышенным связыванием рецептора Fc и с повышенной эффекторной функцией, что может найти применение для лечения злокачественного гематологического или аутоиммунного заболевания. 13 н. и 19 з.п. ф-лы, 3 пр., 9 табл., 26 ил.
Наверх