Антитело против csf-1r



Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r
Антитело против csf-1r

 


Владельцы патента RU 2547586:

ТРАНСЖЕНЕ С.А. (FR)

Настоящее изобретение относится к области иммунологии. Предложено антитело и его антигенсвязывающий фрагмент, специфически связывающие рецептор колониестимулирующего фактора-1 (CSF-1R) человека, охарактеризованные последовательностями гипервариабельных участков (CDR). Также рассмотрены нуклеиновая кислота, кодирующая антитело по изобретению или его антигенсвязывающий фрагмент, вектор, обеспечивающие экспрессию антитела или его антигенсвязывающего фрагмента, и фармацевтическая композиция для применения при лечении заболеваний, ассоциированных с воспалением или аутоиммунитетом, или рака. Данное изобретение может найти дальнейшее применение в диагностике и терапии заболеваний, ассоциированных с CSF-1. 4 н. и 19 з.п. ф-лы, 18 ил., 4 табл.

 

CSF-1 (колониестимулирующий фактор-1) представляет собой цитокин, который, в частности, экспрессируется различными типами клеток. Он является фактором дифференциации, роста и выживания для клеток ретикулогистиоцитарной генеалогии, которые экспрессируют рецептор для CSF-1 (CSF-1R) (SHERR. Рецептор колониестимулирующего фактора-1 Blood. 1990, том 75, №1, стр.1-12). CSF-1R представляет собой рецептор тирозинкиназы, который кодируется c-fms протонкогеном, содержащим внутриклеточный домен киназы и связывающий лиганд внеклеточный участок, организованный в виде пяти подобных иммуноглобулину субдоменов. Ответ на CSF-1 приводит к повышенному выживанию, росту, дифференциации и обратимым изменениям функции. c-fms ген, как таковой, представляет собой маркер дифференциации макрофагов. Степень экспрессии c-fms является более сильной, чем других специфических для макрофагов генов, включая лизоцим и специфический для макрофагов белок тирозинфосфатазу (HUME, и др. Регуляция экспрессии рецептора CSF-1. Molecular reproduction and development. 1997, том 46, №1, стр.46-52).

В дополнение к клеткам ретикулогистиоцитарной клеточной линии CSF-1R экспрессируется многими типами опухолей человека. При раке молочной железы экспрессия CSF-1R ассоциируется с большими размерами опухоли и сниженным выживанием (KLUGER, и др. Экспрессия рецептора колониестимулирующего фактора-1 макрофагов ассоциируется с неблагоприятным прогнозом рака молочной железы на основе микроанализа с использованием большой группы тканей. Clinical cancer research. 2004, том 10, №1, стр.173-7; SCHOLL и др. Окрашивание с помощью антитела к колониестимулирующему фактору-1 в первичных аденокарциномах молочной железы коррелирует с выделенными инфильтратами воспалительных клеток и прогнозом. Journal of the National Cancer Institute. 1994, том 86, №2, стр.120-6). При эпителиальном раке яичников большинство первичных опухолей и метастазов в высокой степени экспрессируют CSF-1R, а метастазы часто коэкспрессируют CSF-1 и CSF-1R. CSF-1R также экспрессируется инфильтрующими опухоль макрофагами (CHAMBERS, и др. Сверхэкспрессия эпителиального колониестимулирующего фактора макрофагов и CSF-1 рецептора: фактор неблагоприятного исхода при эпителиальном раке яичника контрастирует с протективным эффектом стромального CSF-1. Clinical Cancer Research. 1997, том 3, №6, стр.999-1007). При раке яичника и эндометрия, Нозерн-блоттинг анализ показывает, что подавляющее большинство опухолей коэкспрессирует CSF-1 и CSF-1R, в то время как экспрессия CSF-1R только слабо определяется в образцах нормальной ткани эндометрия (BAÏOCCHI, и др. Экспрессия колониестимулирующего фактора макрофагов и его рецептора при гинекологических злокачественных образованиях. Cancer. 1991, том 67, №4, стр.990-6). При цервикальной карциноме экспрессия CSF-1R подвергается понижающей регуляции как в опухолевой строме, так и в опухолевом эпителии по сравнению с нормальным эндометрием (KIRMA, и др. Повышенная экспрессия онкогена c-fms и его лиганда, колониестимулирующего фактора-1 макрофагов, при цервикальном раке и роль трансформирующего фактора роста бета 1 в индукции экспрессии с-fms. Cancer res. 2007, том 67, №5, стр.1918-26). При почечной карциноме инфильтрация ассоциированных с опухолью макрофагов, экспрессирующих высокие уровни CSF-1R, ассоциируется с развитием опухоли (HEMMERLEIN, и др. Экспрессия воспалительных антигенов острой и поздней стадии, c-fms, CSF-1 и человеческой моноцитарной серинэстеразы 1 в ассоциированных с опухолью макрофагах карциномы почечных клеток. Cancer immunology, immunotherapy. 2000, том 49, №9, стр.485-92). CSF-1R экспрессируется на уровне около 100% образцами простатической неоплазии или рака (IDE, и др. Экспрессия рецептора колониестимулирующего фактора 1 в процессе развития предстательной железы и развития рака предстательной железы. Proc.Natl. Acad. Sci. U.S.A. 2002, том 99, №22, стр.14404-9). Экспрессия CSF-1R также определяется при острых миелобластных лейкемиях и при В-клеточных хронических лимфоцитарных лейкемиях (RAMBALDI, и др. Экспрессия колониестимулирующего фактора макрофагов и c-fms генов в клетках острой миелобластной лейкемии человека. Journal of Clinical Investigation. 1988, том 81, №4, стр.1030-5).

Работа, проведенная с помощью иммуногистохимии и in situ гибидизации, продемонстрировала специфичность экспрессии CSF-1 в клетках инвазивного рака молочных желез, в то время как такой продукции не наблюдали в интраканальных или неинвазивных опухолевых клетках (SCHOLL, и др. Окрашивание с помощью антитела к колониестимулирующему фактору-1 в первичных аденокарциномах молочной железы коррелирует с выделенными инфильтратами воспалительных клеток и прогнозом. Journal of the National Cancer Institute. 1994, том 86, №2, стр.120-6; TANG, и др. Экспрессия M-CSF (колониестимулирующего фактора моноцитов) и M-CSF рецептора опухолевыми клетками молочной железы; опосредованный M-CSF рекрутинг инфильтрующих опухоль моноцитов. Journal of cellular biochemistry. 1992, том 50, №4, стр.350-6). Продукция CSF-1 инвазивными опухолевыми клетками коррелирует с повышением их концентрации в плазме крови пациентов, где эта концентрация может превышать 1000 пг/мл по сравнению с менее чем 300 пг/мл у нормальных индивидуумов. Высокая концентрация в сыворотке коррелирует с поздними стадиями заболевания и неблагоприятным краткосрочным прогнозом (SCHOLL, и др. Циркулирующие уровни колониестимулирующего фактора 1 в качестве прогностического индикатора у 82 пациентов с эпителиальным раком яичника. British journal of cancer. 1994, том 69, №2, стр.342-6; SCHOLL. Циркулирующие уровни колониестимулирующего фактора макрофагов CSF-1 у пациентов с первичным и метастатическим раком молочной железы. Пилотное исследование. Breast cancer research and treatment. 1996, том 39, №3, стр.275-83). Кроме того, было продемонстрировано, что CSF-1 стимулирует мобильность и инвазивность опухолевых клеток (DORSCH, и др. Перенос гена колониестимулирующего фактора макрофагов в опухоли индуцирует инфильтрацию макрофагами, но не супрессию опухоли. European journal of immunology. 1993, том 23, №1, стр.186-90; WANG, и др. Индукция миграции моноцитов с помощью рекомбинантного колониестимулирующего фактора макрофагов. Journal of immunology. 1988, том 141, №2, стр.575-9; FILDERMAN, и др. Колониестимулирующий фактор макрофагов (CSF-1) повышает инвазивность в позитивной по рецептору CSF-1 линии клеток карциномы. Cancer res. 1992. том 52, №13, стр.3661-6).

CSF-1 также обладает хемотаксическим влиянием на предшественников миелоидной линии, которые способствуют инфильтрации моноцитов в опухоли. Однако присутствие этих моноцитов не является достаточным для того, чтобы наблюдать разрушение опухоли иммунной системой (DORSCH, и др. Перенос гена колониестимулирующего фактора макрофагов в опухоли индуцирует инфильтрацию макрофагами, но не супрессию опухоли. European journal of immunology. 1993, том 23, №1, стр.186-90). Оказывается, что при высоких концентрациях в сыворотке, что обычно наблюдается у пациентов, страдающих от опухолей молочных желез, яичников или поджелудочной железы, CSF-1 ориентирует дифференциацию этих моноцитов в макрофаги, а не в дендритные клетки, способные к презентации опухолевых антигенов и, таким образом, инициируя эффективный цитотоксический иммунный ответ, направленный против опухолевых клеток (SCHOLL. Циркулирующие уровни колониестимулирующего фактора макрофагов CSF-1 у пациентов с первичным и метастатическим раком молочной железы. Пилотное исследование. Breast cancer research и treatment. 1996, том 39, №3, стр.275-83; BARON, и др. Модуляция транспорта МНС класса II и лизосомального распределения с помощью колониестимулирующего фактора макрофагов в дендритных клетках человека, имеющих происхождение от моноцитов. Journal of cell science. 2001, том 114, №pt5, стр.999-1010).

CSF-1 является также существенным для пролиферации и дифференциации остеокластов (CECCHINI, и др. Роль CSF-1 в развитии костей и костного мозга. Molecular reproduction and development. 1997, том 46, №1, стр.75-83). Остеокласты представляют собой многоядерные клетки, которые экспрессируют CSF-1R и имеют происхождение от гематопоэтических предшественников, которые, главным образом, являются ответственными за разрушение минерализованных костей в процессе развития костей, гомеостаза и репарации. При различных расстройствах скелета, таких, как остеопороз, злокачественная гиперкальцемия, ревматоидный артрит, опухолевые метастазы и рак соска молочной железы Педжета, резорбция кости остеокластами превалирует над образованием костной ткани остеобластами, что приводит к уменьшению костной массы, хрупкости скелета и переломам костей (BRUZZANITI, и др. Молекулярная регуляция активности остеокластов. Reviews in endocrine. 2006, том 7, №1-2, стр.123-39). Например, пациенты в поздней стадии рака молочной железы часто развивают метастазы в кости. Костные метастазы приводят к неустранимой боли и высокому риску переломов по причине задаваемой опухолью потери костной массы (остеолизис), который вызывается повышенной активностью остеокластов (CICEK, и др. Костные метастазы рака молочной железы и современные малые терапевтические молекулы. Cancer metastasis reviews. 2006, том 25, №4, стр.635-44). Было показано, что остеолизис является связанным с высоким уровнем циркулирующего CSF-1 (KITAURA, и др. Журнал клинического исследования. M-CSF опосредует индуцированный TNF воспалительный остеолизис. 2005, том 115, №12, стр.3418-27).

Путь CSF-1 является также вовлеченным в опосредование воспаление желудочно-кишечного тракта при заболеваниях, таких как воспалительное заболевание кишечника (MARSHALL, и др. Блокирование колониестимулирующего фактора-1 (CSF-I) приводит к ингибированию индуцированного DSS колита. Inflammatory bowel diseases. 2007, том 13, №2, стр.219-24), в опосредование пролиферация макрофагов при остром отторжении аллотрансплантата (JOSE, и др. Блокирование колониестимулирующего фактора макрофагов снижает пролиферацию макрофагов и их акумуляцию при отторжении почечного аллотрансплантата. American journal of transplantation. 2003, том 3, №3, стр.294-300) и при репликации ВИЧ-1 в инфицированных макрофагах (KUTZA, и др. Антагонист колониестимулирующего фактора макрофагов ингибирует репликацию ВИЧ-1 в человеческих макрофагах. Journal of immunology. 2000, №164, стр.4955-4960).

По этим причинам ингибирование CSF-1 активности различными соединениями было предложено для лечения рака и разрушения костей.

Предпосылки создания изобретения

WO 01/30381 относится к применению ингибиторов активности CSF-1 в производстве лекарственных средств для лечения опухолевых заболеваний. Два предложенных подхода для ингибирования активности CSF-1 представляют собой супрессию активности CSF-1 как таковой и супрессию активности CSF-1R. Нейтрализующие антитела против CSF-1 или его рецептора являются предпочтительными в качестве ингибиторов активности CSF-1.

WO 03/059395 описывает комбинационные продукты, включающие вещество, способное к ингибированию активности CSF-1, и вещество, обладающее цитотоксической активностью, для лечения рака.

WO 2005/068503 раскрывает способ для предотвращения и лечения остеолизиса, раковых метастазов и потери костной массы, ассоциированной с раковыми метастазами путем введения антитела против CSF-1 субъекту.

ЕР 1488792 А относится к применению моно- и/или бициклического арила или соединений гетероарилхинозолина, которые демонстрируют селективное ингибирование дифференциации, пролиферации или высвобождения медиатора путем эффективного ингибирования активности CSF-1R тирозинкиназы. Эта заявка также относится к применению таких соединений для производства лекарственного средства для ингибирования патологической клеточной пролиферации.

US 2005059113 относится к антителам и их связывающим антиген частям, которые специфически связываются с CSF-1. Изобретение также относится к человеческому анти-CSF-1 антителу и его связывающим антиген частям. Эта заявка на изобретение также обеспечивает способы генной терапии при использовании нуклеиновой кислоты молекул, кодирующих тяжелые и/или легкие молекулы иммуноглобулина, которые включают человеческие анти-CSF-1 антитела.

Раскрытие сущности изобретения

Настоящее изобретение относится к антителу, которое специфически связывается с CSF-1R.

Как используется в данной заявке, термин "любой" используется в том смысле, что он означает "по крайней мере, один", "по крайней мере, первый", "один или более" или "множество" упомянутых компонентов или этапов, если в контексте ясно не указано иное. Например, термин "любая клетка" включает множество клеток, включая их смеси.

Термин "и/или", используемый где-либо в данной заявке, включает значения "и", "или" и "все" или любую другую комбинацию элементов, связанных данных термином.

Термин "около" или "приблизительно", как используется в данной заявке, означает в пределах 20%, предпочтительно в пределах 10% и более предпочтительно в пределах 5% данного значения или интервала.

Как используется в данной заявке, термины "включающий" и "включает" предназначены для понимания наборов частей, продуктов, композиций и способов, включающих указанные компоненты или этапы, но не исключающих других. "Существенно состоящий из", когда используется для определения продуктов, композиций и способов, будет означать исключающий другие компоненты или этапы любой существенной значимости. Таким образом, композиция, существенно состоящая из указанных компонентов, не будет исключать следовых веществ и фармацевтически приемлемых носителей. "Состоящий из" будет означать большее исключение, чем следовых элементов, из других компонентов или этапов.

Как используется в данной заявке, термин "специфически связывается с" относится к реакции связывания, которая является определяющей присутствие гетерогенной популяции белков и других биологических компонентов. Таким образом, при названных условиях анализа антитело в соответствии с изобретением предпочтительно связывается с, по крайней мере, частью CSF-1R и не связывается в значительном количестве с другими компонентами, присутствующими в исследуемом образце. Специфическое связывание между антителом в соответствии с изобретением и CSF-1R мишенью означает, что связывающая аффинность составляет, по крайней мере, 103 М-1, и предпочтительно 105 М-1, 106 M-1, 107 М-1, 108 М-1, 109 М-1 или 1010 М-1.

Как используется в данной заявке, термин "CSF-1R" относится к человеческому рецептору CSF1. Человеческий рецептор CSF-1 был секвенирован, и его аминокислотная последовательность является представленной в SEQ ID NO:29.

Как используется в данной заявке, "антитело" или "Аb" используется в самом широком смысле. Таким образом, "антитело" или "Аb" может быть таким, которое существует в природе, или созданным человеком, таким как моноклональные антитела (mAb), полученные с помощью традиционной гибридомной технологии, рекомбинантной технологии, и/или его функциональным фрагментом. Антитела в соответствии с настоящим изобретением являются предназначенными для включения как молекул интактного иммуноглобулина, например, поликлонального антитела, моноклонального антитела (mAb), моноспецифического антитела, биспецифического антитела, полиспецифического антитела, антитела человека, антитела животного (например, антитела верблюда), химерного антитела, а также их частей, фрагментов, участков, пептидов и производных (которые обеспечиваются с помощью любой известной методики, такой как, но без ограничения, методики ферментативного расщепления, пептидного синтеза или рекомбинантные методики), таких как, например, иммуноглобулин, лишенный легких цепей (смотри, например, US 6,005,079), Fab, Fab′, F(ab′)2, Fv, scFv, фрагмент антитела, диатело, Fd, CDR участки, или любую часть или пептидную последовательность антитела, которая является способной к связыванию антигена или эпитопа. Антитело считается "способной к связыванию" молекулой, если оно является способным к специфической реакции с молекулой, посредством чего молекула связывается с антителом. Фрагменты или части антитела могут не содержать Fc фрагмента интактного антитела, которые более быстро выводятся из циркуляции и могут обладать меньшим неспецифическим связыванием с тканями, чем интактное антитело. Примеры антитела могут быть получены из интактного антитела при использовании способов, хорошо известных в области техники, например, путем протеолитического расщепления с помощью ферментов, таких как папаин (для получения Fab фрагментов) или пепсин (для получения F(ab′)2 фрагментов). Смотри, например, Wahl и др., 24 J. Nucl. Med. 316-25 (1983). Части антитела могут быть получены с помощью любого из описанных выше способов, или могут быть получены путем экспрессии части рекомбинантной молекулы. Например, CDR участок(участки) рекомбинантного антитела может(могут) быть изолирован(ы) и субклонирован(ы) в приемлемый экспрессионный вектор. Как используется в данной заявке, термин "вариабельный участок" относится к вариабельному участку или домену легкой цепи (VL) или тяжелой цепи (VH), который содержит детерминанты для связывания специфичности узнавания. Вариабельные домены являются вовлеченными в узнавание антигена и образуют сайт связывания антигена. Как используется в данной заявке, термин "каркасный участок" относится к частям легкой и тяжелой цепи вариабельных участков, которые являются, по крайней мере, на 85% гомологичными (то есть отличными от CDR) среди различных антител у одинаковых видов. Как используется в данной заявке, термин "гомологичный" относится к сравнению аминокислот двух полипептидов, которые при выравнивании с помощью алгоритма Смита-Вотермена (SMITH, и др. Идентификация общих молекулярных субпоследовательностей. Journal of Molecular Biology. 1981, №147 стр.195-7) имеют приблизительно означенный процент одинаковых аминокислот. Например, "на 85% гомологичный" относится к сравнению аминокислот двух полипептидов, которые при оптимальном выравнивании имеют 85% аминокислотной идентичности. Вариабельный участок как тяжелой, так и легкой цепи, делится на сегменты, включающие четыре каркасных субучастка (FR1, FR2, FR3, и FR4), которые прерываются тремя участками гипервариабельных последовательностей, или участками, определяющими комплементарность (CDR), как определяется в базе данных Кабат (Kabat и др., в цитируемой работе), с CDR1, который размещается между FR1 и FR2, CDR2 между FR2 и FR3, и CDR3 между FR3 и FR4. Без указания определенных субучастков как FR1, FR2, FR3 или FR4, каркасный участок, как упоминается другими, представляет собой объединенные FR в рамках вариабельного участка одиночной цепи существующего в природе иммуноглобулина. Как используется в данной заявке, один FR представляет собой один из четырех субучастков, а множество FR представляет собой два или более из четырех субучастков, которые составляют каркасный участок. Последовательности каркасных участков различных легкой или тяжелой цепей являются относительно консервативными в пределах видов. Каркасный участок антитела представляет собой объединенные каркасные участки составляющих его легкой и тяжелой цепей и служит для позиционирования и выравнивания CDR. CDR являются, главным образом, ответственными за формирование сайта связывания антитела, придающего связывающую специфичность и аффинность эпитопу антигена. В пределах вариабельных участков Н или L цепей, которые обеспечивают участки, связывающие антиген, существуют меньшие последовательности, которые называются "гипервариабельными" по причине своей крайней вариабельности между антителами различной специфичности. Такие гипервариабельные участки также называются "участками, определяющими комплементарность" или " участками. Эти CDR участки отвечают за основную специфичность антитела для определенной структуры антигенной детерминантны. CDR представляют собой несмежные участки аминокислот в рамках вариабельных участков, но независимо от видов позиционное расположение этих важных аминокислотных последовательностей в рамках вариабельного участка тяжелой и легкой цепи было продемонстрировано как такое, которое обладает подобным расположением в рамках аминокислотных последовательностей вариабельных цепей. Вариабельные участки тяжелых и легких цепей всех антител содержат 3 CDR участка, каждый из которых не сообщается с остальными (называются L1, L2, L3, Н1, Н2, Н3) для соответствующей легкой (L) и тяжелой (Н) цепей. Признанные CDR участки были описаны Kabat и др., 252 J. Biol. Chem. 6609-16 (1977), и CDR петли могут быть идентифицированы путем применения этих правил при исследовании линейной аминокислотной последовательности. Правила идентификации CDR-H3 петли могут изменяться, однако (смотри Глава 4, Конструирование антител: Методы и Прописи, (Lo, ред. Humana Press, Totowa, NJ, 2004)) и фактические границы некоторых CDR-H3 петель могут не быть идентифицированы без применения экспериментальных методик, таких как циркулярный дихроизм, ядерный магнитный резонанс или кристаллография в рентгеновских лучах. Во всех видах животных пептиды антитела содержат константный (то есть высококонсервативный) и вариабельный участки, в пределах последнего находятся CDR и так называемые "каркасные участки", состоящие из аминокислотных последовательностей в пределах вариабельного участка тяжелой или легкой цепи, но за пределами CDR. CDR участки могут также быть определены при использовании номенклатуры Chothia (CHOTHIA и LESK. Канонические структуры для гипервариабельных участков иммуноглобулинов (1987) J Mol Biol. 1987 Aug 20; 196 (4): 901-17). Таким образом, в некоторых воплощениях CDR представляют собой определенные по Kabat CDR, а в других воплощениях CDR представляют собой определенные по Chothia CDR. Что касается антигенной детерминанты, которая узнается CDR участками антитела, то ее также называют "эпитопом." Другими словами, эпитоп относится к той части любой молекулы, которая является способной к узнаванию и связыванию с антителом (соответствующий связывающий участок антитела может называться паратопом). В общем случае, эпитопы состоят их химически активных группировок молекул, например, боковых цепей аминокислот или сахара, и обладают специфическими пространственными структурными характеристиками, а также специфическими зарядными характеристиками.

Термин "моноклональное антитело" или "mAb", как используется в данной заявке, относится к антителу, которое имеет происхождение из одного клона. Моноклональные антитела могут быть получены при использовании гибридомных технологий, таких как те, что раскрыты у HARLOW. Антитела: Лабораторное руководство. 2-е изд. Cold Spring Harbor: Laboratory press, 1988. и HAMMERLING, и др. Моноклональные антитела и Т-клеточные гибридомы. New York: Elsevier, 1981, стр.563-681.

Как используется в данной заявке, термин "человеческое антитело" относится к антителу, имеющему вариабельный и константный участки, имеющие происхождение от или имеющих близкое соответствие с последовательностями зародышевого иммуноглобулина человека. Человеческое антитело в соответствии с изобретением может включать аминокислотные остатки, которые не кодируются последовательностями зародышевого иммуноглобулина человека (например, случайным образом введенные мутации или сайт-специфический мутагенез in vitro или путем соматической мутации in vivo). Таким образом, как используется в данной заявке, термин "человеческое антитело" относится к антителу, в котором существенно каждая часть белка является существенно подобной человеческому зародышевому антителу. "Существенно подобный" относится к антителу, имеющему последовательность нуклеиновой кислоты, которая является, по крайней мере, на 80, предпочтительно 85, более предпочтительно 90, и даже более предпочтительно 95% гомологичной последовательности нуклеиновой кислоты человеческого зародышевого антитела.

Как используется в данной заявке, термин "Fab" относится к участкам молекул антитела, которые включают вариабельный участок тяжелой цепи и легкой цепи и которые демонстрируют связывающую активность. "Fab" включает агрегаты одной тяжелой и одной легкой цепи (которые обычно являются известными как «Fab»), где любой из указанных выше является ковалентно или нековалентно агрегированным при условии, что такая агрегация является способной к селективной реакции с частным антигеном или антигенным семейством. «Fab» фрагмент представляет собой гетеродимер, включающий VL и второй полипептид, включающий VH и СН1 домены. В предпочтительном воплощении антитело представляет собой Fab′ фрагмент. Fab′ фрагменты отличаются от «Fab» фрагментов тем, что Fab′ фрагмент содержит несколько остатков на карбоксильном конце тяжелой цепи СН1 домена, включая один или более цистеинов из "шарнирного участка" антитела.

"F(ab′)2" относится к фрагменту антитела, полученному с помощью обработки пепсином антитела, или к эквивалентному белку, полученному с помощью других методик, таких как рекомбинантные технологии. F(ab′)2 фрагмент имеет два антигенобъединяющих сайта и все еще является способным к перекрестному связыванию с антигеном.

"Fv" представляет собой минимальный фрагмент антитела, который содержит полный сайт узнавания и связывания антигена. Этот участок состоит из димера одного вариабельного домена тяжелой и одного вариабельного домена легкой цепи в тесной нековалентной ассоциации. В этой конфигурации три CDR каждого вариабельного домена взаимодействуют для определения сайта связывания антигена на поверхности VH VL димера. Совместно шесть CDR придают антителу антигенсвязывающую специфичность. Однако даже единственный вариабельный домен (или половина Fv, включающая только три CDR, специфические для антигена) обладает способностью узнавать и связывать антиген, хотя при более низкой аффинности, чем цельный сайт связывания.

"Одноцепочечные Fv" или "scFv" включают VH и VL домены антитела, при этом эти домены являются присутствующими в одной полипептидной цепи. Предпочтительно, когда scFv дополнительно включает полипептидный линкер между VH и VL доменами, что позволяет scFv образовывать желаемую структуру для связывания антигена (LENNARD. Стандартные прописи для конструирования scFv библиотек. Methods in molecular biology. 2002, №178, стр.59-71).

Как используется в данной заявке, термин "фрагмент антитела" относится к одному или более фрагментам антитела, которые сохраняют способность специфически связываться с CSF-1R.

Термин "диатела" относится к малым фрагментам антитела с двумя сайтами связывания антигена, фрагменты которого включают вариабельный домен тяжелой цепи (VH), соединенный с вариабельным доменом легкой цепи (VL) в той же полипептидной цепи (VH VL). При использовании линкера, который является настолько коротким, чтобы позволить осуществлять спаривание между двумя доменами на той же цепи, домены принуждают к спариванию с комплементарными доменами другой цепи и создают два сайта связывания антигена. Диатела могут связываться с одним или более чем одним эпитопом. Диатела являются более подробно описанными у POLJAK. Получение и структура диател. Structure. 1994, том 2, №12, стр.1121-3. HUDSON, и др. Мультимеры scFv с высокой авидностью; диатела и триатела. Journal of immunological methods. 1999, том 231, №1-2, стр.177-89, и KIPRIYANOV. Получение биспецифических тандемных диател. Methods in molecular biology. 2002, №178, стр.317-31.

Были разработаны различные методики для получения фрагментов антитела. Традиционно, эти фрагменты получают путем протеолитического переваривания интактного антитела. Однако эти фрагменты сейчас могут быть получены непосредственно при использовании рекомбинантных хозяйских клеток. Fab, Fv и scFv фрагменты антитела могут все экспрессироваться и секретироваться из Е. соli, позволяя, таким образом, осуществлять продукцию больших количеств этих фрагментов. Методики для продукции фрагментов антитела будут понятными специалисту в данной области техники. В других воплощениях выбранное антитело представляет собой одиночные цепи Fv фрагмента (scFv).

Как используется в данной заявке, "домен антитела" (dAb) состоит из самых мелких функциональных связывающих единиц антител, соответствующих вариабельным участкам либо тяжелой (VH), либо легкой (VL) цепей антитела. Домен антитела имеет молекулярный вес приблизительно 13 кДа или менее чем одна десятая размера полного антитела.

Как используется в данной заявке, "Fd" относится к фрагменту антитела, который состоит из VH и СН1 доменов.

Термин "антитело" или "Ab" также относится к другим фрагментам антитела, хорошо известным специалисту в данной области техники, например, таким, как описано у HOLLIGER, и др. Сконструированные фрагменты антитела и добавление одиночных доменов. Nature biotechnology. 2005, том 23, №9, стр.1126-36, и HOOGENBOOM, и др. Природные и сконструированные сайты связывания, полученные с помощью технологии фагового дисплея. Immunology today. 2000, том 21, №8, стр.371-8.

В соответствии с одним воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) по крайней мере, один CDR, где указанный CDR включает, по крайней мере, пять последовательных аминокислот последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2, последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, или последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

или

(ii) по крайней мере, один CDR, где указанный CDR включает, по крайней мере, пять последовательных аминокислот последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4, последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4 или последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, где указанный CDR является независимо от другого, выбранным из группы CDR, включающих, по крайней мере, пять последовательных аминокислот:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4

или

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4 или 5 и даже более предпочтительно 6 CDR, где указанные CDR являются независимо друг от друга выбранными из группы CDR, включающей, по крайней мере, пять последовательных аминокислот:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4

- или последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(iii) 2 и даже более предпочтительно 3 CDR, где указанные CDR являются независимо друг от друга выбранными из группы CDR, включающей, по крайней мере, пять последовательных аминокислот:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

или

(iv) 2 и даже более предпочтительно 3 CDR, где указанные CDR являются независимо друг от друга выбранными из группы CDR, включающей, по крайней мере, пять последовательных аминокислот:

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4

или последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) по крайней мере, один CDR, выбранный, независимо от другого, из группы CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2 и

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

или

(ii) по крайней мере, один CDR, выбранный, независимо от другого, из группы CDR, как отражено в:

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4 и

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, выбранный, независимо от другого, из группы CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4 и

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4 или 5 и даже более предпочтительно 6 CDR, выбранных, независимо от другого, из группы CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4 и

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(iv) 2 и даже более предпочтительно 3 CDR, где указанные CDR являются независимо друг от друга выбранными из группы CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2,

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

или

(iv) 2 и даже более предпочтительно 3 CDR, где указанные CDR являются независимо друг от друга выбранными из группы CDR, как отражено в:

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4,

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с одним воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO 11, 12 или 13; или (ii) no крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:14, 15 или 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:11, 12, 13, 14, 15 или 16.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, включающих аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:11, 12, 13, 14, 15 или 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере один CDR, как отражено в какой-либо одной из SEQ ID NO:11, 12 или 13; или (ii) по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:14, 15 или 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:11, 12, 13, 14, 15 или 16.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, как отражено в какой-либо одной из SEQ ID NO:11, 12, 13, 14, 15 или 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:17, 18 или 19; или (ii) по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:20, 21 или 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:17, 18, 19, 20, 21 или 22.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, включающих аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:17, 18, 19, 20, 21 или 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере один CDR, как отражено в какой-либо одной из SEQ ID NO:17, 18 или 19; или (ii) по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:20, 21 или 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:17, 18, 19, 20, 21 или 22.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, как отражено в какой-либо одной из SEQ ID NO:17, 18, 19, 20, 21 или 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:23, 24 или 25; или (ii) по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:26, 27 или 28.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, включающий аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:23, 24, 25, 26, 27 или 28.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, включающих аминокислотную последовательность, как отражено в какой-либо одной из SEQ ID NO:23, 24, 25, 26, 27 или 28.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:23, 24 или 25; или (ii) по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:26, 27 или 28.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает, по крайней мере, один CDR, как отражено в какой-либо одной из SEQ ID NO:23, 24, 25, 26, 27 или 28.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает 2, 3, 4, 5 и даже более предпочтительно 6 CDR, как отражено в какой-либо одной из SEQ ID NO:23, 24, 25, 26, 27 или 28.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает CDR, как отражено в:

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, как отражено в SEQ ID NO:11, 12 и 13.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, представленных в SEQ ID NO:17, 18 и 19.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, как отражено в SEQ ID NO:20, 21 и 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, как отражено в SEQ ID NO:23, 24 и 25.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где указанный вариабельный участок включает три CDR, как отражено в SEQ ID NO:26, 27 и 28.

В предпочтительных воплощениях указанный вариабельный участок дополнительно включает один, более предпочтительно два, даже более предпочтительно три и особенно предпочтительно четыре каркасных участка, и более предпочтительно человеческие FR. Как используется в данной заявке, "человеческий FR" представляет собой каркасный участок, который является, по крайней мере, на 75% гомологичным каркасному участку существующего в природе человеческого антитела.

В соответствии с одним предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где вариабельный участок включает аминокислотную последовательность, как отражено в SEQ ID NO:6.

В более предпочтительном воплощении антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где вариабельный участок является таким, как отражено в SEQ ID NO:6.

В другом предпочтительном воплощении антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где вариабельный участок включает аминокислотную последовательность, как отражено в SEQ ID NO:9.

В другом более предпочтительном воплощении антитело в соответствии с изобретением специфически связывается с CSF-1R и включает вариабельный участок, где вариабельный участок является таким, как отражено в SEQ ID NO:9.

В другом воплощении антитело в соответствии с изобретением специфически связывается с CSF-1R и включает два вариабельных участка, где вариабельные участки являются независимо друг от друга выбранными из группы

(i) вариабельных участков, включающий CDR, как отражено в:

- последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

(ii) вариабельных участков, включающий CDR, как отражено в:

- последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4;

(ii) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:11, 12 и 13;

(iii) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:14, 15 и 16;

(iv) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:17, 18 и 19;

(v) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:20, 21 и 22;

(vi) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:23, 24 и 25, и

(vii) вариабельных участков, включающих три CDR, представленных в SEQ ID NO:26, 27 и 28.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) первый вариабельный участок, где указанный вариабельный участок включает:

- CDR, как отражено в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- CDR, как отражено в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

и

(ii) второй вариабельный участок, где указанный вариабельный участок включает:

- CDR, как отражено в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- CDR, как отражено в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:11, 12 и 13, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:17, 18 и 19, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:20, 21 и 22.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:23, 24 и 25, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:26, 27 и 28.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) вариабельный участок, как отражено в SEQ ID NO:6, и

(ii) вариабельный участок, как отражено в SEQ ID NO:9.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает:

(i) вариабельный участок тяжелой цепи, включающий:

- CDR, как отражено в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- CDR, как отражено в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

и

(ii) вариабельный участок легкой цепи, включающий:

- CDR, как отражено в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- CDR, как отражено в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i)

вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:11, 12 и 13, и (ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:17, 18 и 19, и (ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:20, 21 и 22.

В соответствии с другим воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:23, 24 и 25, и (ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO: 26, 27 и 28.

В соответствии с предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает (i) вариабельный участок тяжелой цепи, как отражено в SEQ ID NO:6, и (ii) вариабельный участок легкой цепи, как отражено в SEQ ID NO:9.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельные участки, включающие:

- CDR, представленный в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- CDR, представленный в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

и

(ii) вариабельный участок, включающий:

- CDR, представленный в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- CDR, представленный в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:11, 12 и 13, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:17, 18 и 19, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:20, 21 и 22,

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок, включающий три CDR, как отражено в SEQ ID NOs: 23, 24 и 25, и

(ii) вариабельный участок, включающий три CDR, как отражено в SEQ ID NO:26, 27 и 28.

В соответствии с более предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок, как отражено в SEQ ID NO:6, и

(ii) вариабельный участок, как отражено в SEQ ID NO:9.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок тяжелой цепи, включающий:

- CDR, представленный в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- CDR, представленный в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2,

и

(ii) вариабельный участок легкой цепи, включающий:

- CDR, представленный в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- CDR, представленный в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:11, 12 и 13, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:17, 18 и 19, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:20, 21 и 22.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:23, 24 и 25, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:26, 27 и 28.

В соответствии с более предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и представляет собой scFv, где указанный scFv включает:

(i) вариабельный участок тяжелой цепи, как отражено в SEQ ID NO:6,

и

(ii) вариабельный участок легкой цепи, как отражено в SEQ ID NO:9.

Даже в более предпочтительном воплощении обеспечивается scFv, в котором, по крайней мере, одна аминокислота является замещенной (в соответствии с Таблицей 1 и Таблицей 2) в пределах аминокислотной последовательности, как отражено в SEQ ID NO 6 и 9. В особенно предпочтительном воплощении обеспечивается человеческое антитело, в котором все аминокислоты, показанные в Таблице 1 и Таблице 2, являются замещенными (в соответствии с Таблицей 1 и Таблицей 2) в пределах аминокислотной последовательности, как отражено в SEQ ID NO 6 и 9.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает тяжелую цепь, как отражено в SEQ ID NO:2.

В соответствии с другим предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает легкую цепь, как отражено в SEQ ID NO:4.

В соответствии с более предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает тяжелую цепь, как отражено в SEQ ID NO:2, и легкую цепь, как отражено в SEQ ID NO:4.

В соответствии с даже более предпочтительным воплощением антитело в соответствии с изобретением специфически связывается с CSF-1R и включает две тяжелые цепи, как отражено в SEQ ID NO:2, и две легкие цепи, как отражено в SEQ ID NO:4. Это частное антитело будет называться CXIIG6 в данной заявке.

В соответствии с другим предпочтительным воплощением настоящее изобретение относится к человеческому антителу, которое специфически связывается с CSF-1R и включает:

(i) вариабельный участок тяжелой цепи, включающий:

- CDR, как отражено в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2, и

- CDR, как отражено в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2;

и

(ii) вариабельный участок легкой цепи, включающий:

- CDR, как отражено в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4,

- CDR, как отражено в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и

- CDR, как отражено в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

В соответствии с другим воплощением настоящее изобретение относится к человеческому антителу, которое специфически связывается с CSF-1R и включает:

(i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:11, 12 и 13, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:14, 15 и 16.

В соответствии с другим воплощением настоящее изобретение относится к человеческому антителу, которое специфически связывается с CSF-1R и включает:

(ii) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:17, 18 и 19, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:20, 21 и 22.

В соответствии с другим воплощением настоящее изобретение относится к человеческому антителу, которое специфически связывается с CSF-1R и включает:

(i) вариабельный участок тяжелой цепи, включающий три CDR, как отражено в SEQ ID NO:23, 24 и 25, и

(ii) вариабельный участок легкой цепи, включающий три CDR, как отражено в SEQ ID NO:26, 27 и 28.

В соответствии с предпочтительным воплощением настоящее изобретение относится к человеческому антителу, которое специфически связывается с CSF-1R и включает:

(i) вариабельный участок тяжелой цепи, представленный в SEQ ID NO:6, и

(ii) вариабельный участок легкой цепи, представленный в SEQ ID NO:9.

В более предпочтительном воплощении обеспечивается человеческое антитело, в котором, одна аминокислота является замещенной (в соответствии с Таблицей 1 и Таблицей 2) в пределах аминокислотной последовательности, как отражено в SEQ ID NO 6 и 9. В особенно предпочтительном воплощении обеспечивается человеческое антитело, в котором все аминокислоты, показанные в Таблице 1 и Таблице 2, являются замещенными (в соответствии с Таблицей 1 и Таблицей 2) в пределах аминокислотной последовательности, как отражено в SEQ ID NO 6 и 9.

Таблица 1
SEQ ID NO:6 Положение Предпочтительное замещение
К 3 Q
E 5 V
M 18 L
К 19 R
W 33 Y
S 40 A
E 42 G
M 43 К
A 49 G
E 50 R
I 51 Т
A 59 Т
F 61 E
E 64 A
S 79 N
V 81 L
R 89 К
P 90 Т, А
G 94 A
I 95 V
Т 99 A
N 107 Y, V
Т 113 L
L 114 V
Таблица 2
SEQ ID NO:9 Положение Предпочтительное замещение
A 9 S
V 13 A
E 17 D
Т 18 R
E 27 Q
N 28 G
Q 40 P, D
S 43 A
Q 45 К
V 48 L
H 49 Y
N 53 R
A 55 E
SEQ ID NO:9 Положение Предпочтительное замещение
D 56 S
Q 70 D
Y 71 F
S 72 Т
К 74 Т
N 76 S
S 80 P
G 84 A
S 85 Т
H 90 Q
G 100 Q

Антитело, в частности человеческое антитело, в соответствии с изобретением, может быть таковым различных изотипов, таких как IgG, IgA, IgM или IgE. В предпочтительном воплощении антитело, в частности человеческое антитело, в соответствии с изобретением, представляет собой IgG.

В близком воплощении человеческое антитело включает модифицированный или немодифицированный константный участок человеческого IgG1, IgG2, IgG3 или IgG4. В предпочтительном воплощении константный участок представляет собой человеческий IgG1 или IgG4, который может быть необязательно модифицирован для повышения или снижения определенных свойств.

В случае IgG1 модификации константного участка, в частности шарнирного участка или СН2 участка, могут повышать или снижать эффекторную функцию, включая ADCC и/или CDC активности. В других воплощениях IgG2 константный участок модифицируют для снижения образования агрегатов антитело-антиген. В случае IgG4 модификации константного участка, в частности шарнирного участка, могут снижать образование половинных антител.

Желаемая связывающая аффинность может сохраняться даже, несмотря на то что одна или более аминокислот в антителе являются мутированными. Такие варианты имеют, по крайней мере, одну аминокислоту в антителе, замещенную отличным остатком. В соответствии с другим воплощением настоящее изобретение обеспечивает антитело, которое специфически связывается с CSF1, как описано выше, в котором, по крайней мере, одна аминокислота, содержащаяся в CDR, является консервативно замещенной. Консервативные замещения показаны в Таблице 3.

Таблица 3
Исходная аминокислота Предпочтительное консервативное замещение Более предпочтительное консервативное замещение
А V, L, I V
R K, Q, N К
N Q, Н, D, К, R Q
D E, N Е
С S, A S
Q N, E N
Е D, Q D
G A А
Н N, Q, K, R R
I L, V, М, A, F L
L I, V, М, A, F I
К R, Q, N R
М L, F, I L
F W, L, V, I, A, Y Y
Р A А
S Т Т
Т V, S S
W Y, F Y
Y W, F, T, S F
V L, М, F, A L

Настоящее изобретение также относится к способу модификации антитела в соответствии с изобретением с помощью созревания аффинности.

Как используется в данной заявке, "созревание аффинности" относится к замещению одной или более аминокислот, входящих в состав одного или более CDR, при этом указанное замещение приводит к улучшению аффинности антитела по отношению к CSF-1R, по сравнению с исходным антителом, которое не обладает таким(и) замещением(ями). Процессы созревания аффинности являются известными в области техники. Смотри, например, способы, раскрытые в MARKS, и др. Обходная иммунизация: получение высокоаффинных антител человека с помощью перестановки цепей. Biotechnology. 1992, том 10, №7, стр.779-83; BARBAS, и др. In vitro изменение человеческого нейтрализующего антитела к вирусу иммунодефицита человека типа 1 для усовершенствования аффинности и более широкой штаммовой перекрестной реактивности. Proceedings of the National Academy of Sciences of the United States of America. 1994, том 91, №9, стр.3809-13; SCHIER. Идентификация функциональных и структурных аминокислотных остатков с помощью экономного мутагенеза. Gene. 1996, том 169, №2, стр.147-55; YELTON. Аффинное созревание BR96 противокарциномного антитела с помощью мутагенеза на основе кодонов. J. immunol. 1995, том 155, №4, стр.1994-2004; JACKSON, и др. In vitro созревание антитела. Усовершенствование высокой аффинности, нейтрализующее антитело против IL-1 бета. J. immunol. 1995, том 154, №7, стр.3310-9, и HAWKINS, и др. Селекция фаговых антител на связывающую аффинность. Имитация аффинного созревания. Journal of molecular biology. 1992, том 226, №3, стр.889-96.

Настоящее изобретение также относится к антителу, которое специфически связывается с CSF-1R, полученному с помощью аффинного созревания, как было описано ранее.

В другом воплощении настоящее изобретение обеспечивает варианты описанного ранее антитела, обладающие аминокислотной последовательностью, которая является, по крайней мере, на 80%, предпочтительно, по крайней мере, на 85%, более предпочтительно, по крайней мере, на 90%, и даже более предпочтительно, по крайней мере, на 98% гомологичной аминокислотной последовательности описанного ранее антитела.

В другом воплощении антитело в соответствии с изобретением специфически связывается более чем с одним эпитопом. Например, антитело в соответствии с изобретением может связываться с двумя различными эпитопами CSF-1R. Альтернативно, антитело в соответствии с изобретением может быть способным связываться с CSF-1R и с другой молекулой. Как используется в данной заявке, антитела, которые специфически связываются более чем с одним эпитопом, могут быть перекрестно связанными антителами. Например, антитело может быть слито с авидином, отличным от биотина. Перекрестно связанные антитела могут быть получены при использовании любого из приемлемых способов перекрестного связывания, хорошо известных в области техники. Методики для получения биспецифических антител из фрагментов антитела также были описаны, смотри например BRENNAN, и др. Получение биспецифических антител с помощью химической рекомбинации фрагментов моноклинального иммуноглобулина G1. Science. 1985, том 229, №4708, стр.81-3, и SHALABY, и др. Усовершенствование гуманизированных биспецифических антител, реактивных по отношению к цитотоксическим лимфоцитам и опухолевым клеткам, экспрессирующим HER2 протоонкоген. 777е Journal of experimental medicine. 1992, том 175, №1, стр.217-25, KOSTELNY, и др. Создание биспецифического антитела при использовании лейциновых застежек. J. Immunol. 1992, том 148, №5, стр.1547-33.

В соответствии с предпочтительным воплощением антитело, которое специфически связывается с более чем одним эпитопом в соответствии с изобретением, представляет собой диатело.

В соответствии с другим предпочтительным воплощением антитело, которое специфически связывается с более чем с одним эпитопом в соответствии с изобретением, представляет собой линейное антитело, как описано у ZAPATA, и др. Инжиниринг F(ab′)2 фрагментов для эффективной продукции в Escherichia coli и улучшенной антипролиферативной активности. Protein engineering. 1995, том 8, №10, стр.1057-62.

Антитело в соответствии с изобретением может гликозилированным или негликозилированным.

Как используется в данной заявке, термин "гликозилирование" относится к присутствию углеводных единиц, которые являются ковалентно присоединенными к антителу.

В другом воплощении антитело в соответствии с изобретением является конъюгированным с радиосенсибилизирующим агентом, рецепторным и/или цитотоксическим агентом.

Как используется в данной заявке, термин "радиосенсибилизатор" относится к молекуле, которая делает клетки более чувствительными к радиационной терапии. Радиосенсибилизатор включает, но без ограничения, метронидазол, мизонидазол, десметилмисонидазол, пимонидазол, этанидазол, ниморазол, митомицин С, RSU 1069, SR 4233, Е09, RB 6145, никотинамид, 5-бромодезоксиуридин (BUdR), 5-йоддезокриуридин (IUdR), бромодезоксицитидин, фтордезоксиуридин (FUdR), гидроксимочевину и цисплатин.

Как используется в данной заявке, термин "рецептор" относится к соединению, способному к специфическому связыванию с лигандом. В соответствии с предпочтительным воплощением изобретения рецептор представляет собой биотин.

Как используется в данной заявке, термин "цитотоксический агент" относится к соединению, которое непосредственно является токсическим для клеток, предотвращая их размножение или рост. В соответствии с предпочтительным воплощением цитотоксический агент, используемый в контексте настоящего изобретения, является выбранным из группы, включающей противораковый терапевтический агент, токсин (например, ферментативно активный токсин бактериального, грибкового, растительного или животного происхождения или его фрагменты) или радиоактивный изотоп.

В другом воплощении антитело в соответствии с изобретением представляет собой антитело, конъюгированное с маркирующим агентом.

Как используется в данной заявке, "маркирующий агент" относится к соединению, способному к обнаружению. Маркирующий агент может быть способным к определению как таковой (например, радиоизотопные метки или флуоресцентные метки) или, в случае ферментативной метки, может катализировать химическую модификацию субстратного соединения, которое является способным к определению.

Как используется в данной заявке, термин "конъюгированный" означает, что антитело в соответствии с изобретением и маркирующий агент являются ковалентно или нековалентно связанными.

"Ковалентная связь" относится к слиянию с помощью реактивных функциональных групп, необязательно, с промежуточным применением перекрестного линкера или другого активирующего агента (смотри, например, HERMANSON. Методики создания биоконъюгатов. Academic press, 1996). Антитело в соответствии с изобретением и/или конъюгированный агент могут быть модифицированы для того, чтобы позволить осуществить их слияние посредством, например, замещения активированной карбонильной группы (включая те, что активированы in situ) или на имидоэстере, посредством добавления на ненасыщенной карбонильной группе, путем восстановительного аминирования, нуклеофильного замещения на насыщенном атоме углерода или на гетероатоме, с помощью реакции ароматических циклов. В частности, слияние может осуществляться при использовании гомобифункциональных или гетеробифункциональных реагентов для перекрестного связывания. Гомобифункциональные перекрестные линкеры, включающие глутаральдегид, янтарную кислоту и бис-имидоэстер, подобный ДИС (диметил суберимидат), могут использоваться для слияния аминных групп, которые могут присутствовать на различных остатках. Многочисленные примеры приведены в HERMANSON. Методики создания биоконъюгатов. Academic press, 1996, стр.118-228, которые являются известными тем, кто работает в данной области. Гетеробифункциональные перекрестные линкеры включают те, которые содержат как аминореактивную, так и сульфгидрилреактивную группы, карбонилреактивную и сульфгидрилреактивную группы, и сульфгидрилдреактивные группы и фотореактивные линкеры. Приемлемые гетеробифункциональные перекрестные линкеры представляют собой, например, те, что описаны у HERMANSON. Методики создания биоконъюгатов. Academic press, 1996, стр.229-285. Примеры представляют собой, например, SPDP (N-сукцинимидил 3-(2-пиридилтио)пропионат), SMBP (сукцинимидил-4-(п-малеимидофенил)бутират), SMPT (сукцинимидилоксикарбонил-метил-(-2-пиридилтио)толуол), MBS (м-малеимидобезоил-N-гидроксисукцинимидный эстер), SIAB (N-сукцинимидил (4-йодацетил)аминобензоат), GMBS (γ-малеимидобутирилокси) сукцинимидный эстер), SIAX (сукцинимидил-6-йодацетил амино гексаноат, SIAC (сукцинимидил-4-йодацетил амино метил), NPIA (п-нитрофенил йодацетат). Другие примеры представляют собой полезные для слияния молекулы, содержащие углевод (например, env гликопротеины, антитела), с сульфгидрилреактивными группами. Примеры включают МРВН (4-(4-N малеимидофенил)масляная кислота гидразид) и PDPH (4-(N-малеимидометил)циклогексан-1-карбоксилгидразид (М2С2Н и 3-2(2-пиридилтио)пропионил гидразид).

В соответствии с другим воплощением настоящее изобретение относится к последовательности нуклеиновой кислоты, кодирующей антитело в соответствии с изобретением.

Термин "последовательность нуклеиновой кислоты" относится к линейной последовательности нуклеотидов. Нуклеотиды представляют собой либо линейную последовательность полирибонуклеотидов, либо полидезоксирибонуклеотидов, либо их смесь. Примеры полинуклеотидов в контексте настоящего изобретения включают одно- и двухцепочечные ДНК, одно- и двухцепочечные РНК, и гибридные молекулы, которые содержат смеси одно- и двухцепочечных ДНК и РНК. Кроме того, полинуклеотиды настоящего изобретения могут иметь один или более модифицированных нуклеотидов.

В соответствии с предпочтительным воплощением изобретения последовательность нуклеиновой кислоты в соответствии с изобретением включается в вектор.

Вектор может иметь происхождение от плазмиды и вируса и может, если это является приемлемым, объединяться с одним или более веществами, которые улучшают трансфекционную эффективность и/или стабильность вектора. Эти вещества являются широко описанными в литературе, которая является доступной квалифицированному специалисту в данной области техники (смотри, например, FELGNER, и др. Трансфекция, опосредованная катионными липосомами. Proceedings of the Western Pharmacology Society. 1989, том 32, стр.115-21; HODGSON, и др. Виросомы: катионные липосомы улучшают вирусную трансдукцию. Nature biotechnology. 1996, том 14, №3, стр.339-42; REMY, и др. Перенос генов с помощью серий липофильных молекул, связывающих ДНК. Bioconjugate chemistry. 1994, том 5, №6, стр.647-54). В качестве неограничивающей иллюстрации, вещества могут представлять собой полимеры, липиды, в частности, катионные липиды, липосомы, ядерные белки или нейтральные липиды. Эти вещества могут использоваться самостоятельно или в комбинации. Комбинация, которая может быть предусмотрена, представляет собой таковую рекомбинантного плазмидного вектора, который объединяют с катионными липидами (DOGS, DC-CHOL, спермин-хол, спермидин-хол и др.), лизофосфолипидами (например, гексадецилфосфохолин) и нейтральными липидами (DOPE).

В соответствии с предпочтительным воплощением катионные липиды, которые могут использоваться в настоящем изобретении, представляют собой катионные липиды, описанные в ЕР 901463 В, и более предпочтительно, pcTG90.

Выбор плазмид, которые могут использоваться в контексте настоящего изобретения, является огромным. Это могут быть клонирующие векторы и/или экспрессионные векторы. В общем случае они являются известными специалисту в данной области техники, в то время как ряд из них является доступным коммерчески, является также возможным конструировать или модифицировать их при использовании методик генной инженерии. Примеры, которые могут быть упомянуты, представляют собой плазмиды, которые имеют происхождение от pBR322 (Gibco BRL), pUC (Gibco BRL), pBluescript (Stratagene), pREP4, pCEP4 (Invitrogene) или р Poly (LATHE, и др. Плазмиды и векторы на основе бактериофагов для вырезания интактных вставок. Gene. 1987, том 57, №2-3, стр.193-201). Предпочтительно, плазмида, которая используется в контексте настоящего изобретения, содержит источник репликации, который обеспечивает инициацию репликации в клетке-продуценте и/или хозяйской клетке (например, СоIЕ1 источник будет выбран для плазмиды, которая является предназначенной для того, чтобы продуцироваться в Е. coli, a oriP/EBNA1 система будет выбрана, если является желательным, чтобы плазмида реплицировалась в хозяйской клетке млекопитающего, LUPTON, и др. Картирование генетических элементов вируса Эпштейна-Барра, которое способствует экстрасомальной персистенции плазмид, имеющих происхождение от вируса Эпштейна-Барра, в человеческих клетках. Molecular and cellular biology. 1985, том 5, №10, стр.2533-42; YATES, и др. Стабильная репликация плазмид, имеющих происхождение от вируса Эпштейна-Барра, в различных клетках млекопитающих. Nature. 1985, том 313, №6005, стр.812-5). Плазмида может дополнительно включать селективный ген, который позволяет отбирать или идентифицировать трансфицированные клетки (комплементация ауксотрофной мутации, ген, кодирующий резистентность к антибиотикам, и т.д.). Естественно, плазмида может содержать дополнительные элементы, которые улучшают ее поддержание и/или стабильность в данной клетке (cer последовательность, которая способствует поддержанию плазмиды в мономерной форме (SUMMERS, и др. Мультимеризация большого количества копий плазмид вызывает нестабильность: СоIЕ1 кодирует детерминанту, существенную для мономеризации плазмид и стабильности. Cell. 1984, том 36, №4, стр.1097-103, последовательности для интеграции в клеточный геном).

В отношении вирусного вектора является возможным предусмотреть вектор, который имеет происхождение из вируса оспы (вирус осповакцины, в частности MVA, вирус оспы канареек и т.д.), из аденовируса, из ретровируса, из вируса герпеса, из альфавируса, из вируса пенистости или из аденоассоциированного вируса. Является возможным использоваться компетентные в отношении репликации или дефектные в отношении репликации вирусные векторы. Предпочтение отдается применению вектора, который не интегрирует. В этой связи аденовирусные векторы и векторы, имеющие происхождение от вируса оспы, и, более предпочтительно, от вируса осповакцины и MVA, являются особенно приемлемыми для применения настоящего изобретения.

В соответствии с предпочтительным воплощением вирусный вектор в соответствии с изобретением имеет происхождение от модифицированного вируса осповакцины Анкара (MVA). MVA векторы и способы получения таких векторов являются полностью описанными в европейских патентах ЕР 83286 А и ЕР 206920 А, а также у SUTTER, и др. Нереплицирующийся вирус осповакцины эффективно экспрессирует рекомбинантные гены. Proc. Natl. Acad. Sci. U.S.A. 1992, том 89, №22, стр.10847-51. В соответствии с более предпочтительным воплощением последовательность нуклеиновой кислоты в соответствии с изобретением может быть встроена в делецию I, II, III, IV, V и VI MVA вектора и даже более предпочтительно в делецию III (MEYER, и др. Картирование геномных делеций в геноме высокоаттенуированного вируса осповакцины MVA и их влияние на вирулентность. The Journal of general virology. 1991, том 72, №Pt5, стр.1031-8; SUTTER, и др. Рекомбинантный вектор, имеющий происхождение от хозяев ограниченного круга, и высоко аттенуированный штамм MVA вируса осповакцины стимулирует протективный иммунитету мышей к вирусу гриппа. Vaccine. 1994, том 12, №11, стр.1032-40).

Ретровирусы в большинстве случаев обладают способностью инфицировать делящиеся клетки путем интеграции, в этой связи они являются особенно приемлемыми для использования в связи с раком. Рекомбинантный ретровирус в соответствии с изобретением в общем случае содержит LTR последовательности, участок капсидирования и нуклеотидную последовательность в соответствии с изобретением, которую помещают под контролем промотора ретровирусного LTR или внутреннего промотора, такого, как те, что описаны выше. Рекомбинантный ретровирус может быть получен из ретровируса любого происхождения (мышей, приматов, кошек, человека, и т.д.) и, в частности, из MoMuLV (вирус мышиного лейкоза Молони), MVS (вирус саркомы мышей) или мышиный ретровирус Френда (Fb29). Он размножается в капсидированной линии клеток, которая является способной к трансобеспечению вирусных полипептидов gag, pol и/или env, которые являются необходимыми для составления вирусной частицы. Такие клеточные линии являются описанными в литературе (РА317, Psi CRIP GP + Am-12 и т.д.). Ретровирусный вектор в соответствии с изобретением может содержать модификации, в частности, в LTR (замена промоторного участка промотором эукариотической клетки) или в участке капсидирования (замена гетерологичным участком капсидирования, например, VL30 типа) (смотри US 5747323).

Предпочтение будет также отдаваться применению аденовирусного вектора, в котором отсутствует весь или часть, по крайней мере, одного участка, который является существенным для репликации и выбран из Е1, Е2, Е4 и L1-L5 участков для того, чтобы устранить размножение вектора в хозяйском организме или в окружающей среде. Делеция Е1 участка является предпочтительной. Однако она может сочетаться с другой(другими) модификацией(ями)/делецией(ями), затрагивающей(ими), в частности, все или часть участков Е2, Е4 и/или L1-L5, при условии, что дефектные существенные функции дополняются при использовании транскомплементирующей клеточной линии и/или хелперного вируса. В этой связи является возможным использовать векторы второго поколения уровня техники (смотри, например, международные заявки WO 94/28152 и WO 97/04119). В качестве иллюстрации, делеция основной части Е1 участка и Е4 транскрипционной единицы является весьма предпочтительной. С целью повышения клонирующей способности в аденовирусном векторе может дополнительно отсутствовать весь или часть несущественного участка Е3. В соответствии с другой альтернативой является возможным применять минимальный аденовирусный вектор, который сохраняет последовательности, которые являются существенными для капсидирования, в частности 5′ и 3′ ITR (инвертированный концевой повтор), и участок капсидирования. Различные аденовирусные векторы и методики для их получения являются известными (смотри, например, GRAHAM, и др. Способы в молекулярной биологии, под ред. MURREY. The human press inc, 1991, стр.109-128).

Кроме того, происхождение аденовирусного вектора в соответствии с изобретением может варьировать как с точки зрения видов, так и с точки зрения серотипа. Вектор может иметь происхождение из генома аденовируса человека или животного (собака, птица, корова, мышь, овца, свинья, обезьяна, и т.д.) или может быть получен из гибрида, который включает фрагменты аденовирусного генома, по крайней мере, из двух различных источников. В частности, следует упомянуть CAV-I или CAV-2 аденовирусы, которые происходят от собаки, DAV аденовирус, полученный от птиц, или аденовирус Bad типа 3, полученный от коровы (ZAKHARCHUK, и др. Физическое картирование и исследование гомологии аденовирусной ДНК синдрома падения несучести (EDS-76). Archives of virology. 1993, том 128, №1-2, стр.171-6; SPIBEY, и др. Молекулярное картирование и картирование и использование рестрикционной эндонуклеазы двух штаммов собачьего аденовируса типа 2. The Journal of general virology. 1989, том 70, №Pt 1, стр.165-72; JOUVENNE, и др. Клонирование, физическое картирование и перекрестная гибридизация геномов собачьего аденовируса типов 1 и 2. Gene. 1987, том 60, №1, стр.21-8; MITTAL, и др. Разработка экспрессионного вектора на основе коровьего аденовируса типа 3. The Journal of general virology. 1995, том 76, №Pt 1, стр.93-102). Однако предпочтение будет отдаваться аденовирусным векторам, имеющим происхождение от человека, которые являются полученными из серотипа С аденовируса, в частности, типа 2 или 5 серотипа С аденовируса.

Термин "репликативно компетентный", как используется в данной заявке, относится к вирусному вектору, способному к репликации в хозяйской клетке при отсутствии какой-либо транскомплементации.

В соответствии с предпочтительным воплощением в соответствии с изобретением репликативно компетентный вектор представляет собой репликативно компетентный аденовирусный вектор. Такие репликативно компетентные аденовирусные векторы являются хорошо известными квалифицированному специалисту в данной области техники. Среди них, аденовирусные векторы, имеющие делецию в Е1b участке, кодирующем 55 кДа Р53 ингибитор, как в ONYX-015 вирусе (BISCHOFF, и др. Аденовирусный мутант, который селективно реплицируется в дефектных по р53 опухолевых клетках человека. Science. 1996, том 274, №5286, стр.373-6; Не HEISE, и др. Аденовирусный Е1А мутант, который демонстрирует мощную селективную и системную противоопухолевую эффективность. Nature Medicine. 2000, том 6, №10, стр.1134-9; WO 94/18992) являются особенно предпочтительными. Соответственно, этот вирус может использоваться для селективного инфицирования и уничтожения дефектных по р53 неопластических клеток. Специалист в данной области техники может также подвергать мутации и разрушать ген р53 ингибитора в аденовирусе 5 или других вирусах в соответствии с принятыми методиками. Аденовирусные векторы, имеющие делецию в Е1А Rb связывающем участке, могут также использоваться в настоящем изобретении. Например, Delta24 вирус, который представляет собой мутант аденовируса, несущий делецию 24 пар основ в Е1А участке (FUEYO, и др. Мутантный онколитический онковирус, нацеливающий Rb путь, вызывает антиглиомный эффект in vivo. Oncogene. 2000, том 19, №1, стр.2-12). Delta24 имеет делецию в Rb связывающем участке и не связывается с Rb. Таким образом, репликация мутантного вируса ингибируется с помощью Rb в нормальной клетке. Однако если Rb инактивируется и клетки становятся неопластическими, то Delta24 уже не является ингибированным. Вместо этого мутантный вирус эффективно реплицируется и лизирует дефектные по Rb клетки.

Аденовирусный вектор в соответствии с настоящим изобретением может размножаться in vitro в Escherichia coli (E.coli) путем лигирования или гомологичной рекомбинации (смотри, например, международную заявку WO 96/17070), или также путем рекомбинации в комплементирующей клеточной линии.

В соответствии с предпочтительным воплощением изобретения вектор дополнительно включает элементы, необходимые для экспрессии антитела в соответствии с изобретением.

Элементы, необходимые для экспрессии, включают все элементы, которые позволяют последовательности нуклеиновой кислоты транскрибироваться в РНК и мРНК транслироваться в полипептид. Такие элементы включают, в частности, промотор, который может быть регулируемым или конститутивным. Естественно, промотор является приемлемым для выбранного вектора и выбранной хозяйской клетки. Примеры, которые могут быть упомянуты, представляют собой эукариотические промоторы PGK (фосфоглицераткиназа), МТ (металлотионеин; MCIVOR. Пурин нуклеозидаза человека и аденозиндезаминаза: перенос генов в культивируемые клетки и мышиные гематопоэтические стволовые клетки при использовании рекомбинантных амфотропных ретровирусов. Molecular and cellular biology. 1987, том 7, №2, стр.838-46), α-1 антитрипсин, CFTR, поверхностно-активное вещество, иммуноглобулин, актин (TABIN, и др. Адаптация ретровируса в качестве эукариотического вектора, переносящего ген тимидинкиназы вируса простого герпеса. Molecular and cellular biology. 1982, том 2, №4, стр.426-36) и SRα (TAKEBE, и др. SR альфа промотор: эффективная и универсальная экспрессионная система кДНК млекопитающих, состоящая из раннего промотора обезьяньего вируса 40 и R-U5 сегмента длинного терминального повтора вируса Т-клеточной лейкемии типа 1. Molecular and cellular biology. 1988, том 8, №1, стр.466-72) гены, ранний промотор SV40 вируса (вирус обезьян), LTR RSV (вирус саркомы Рауса), ТК промотор HSV-I, ранний промотор CMV вируса (цитомегаловирус), р7.5К pH5R, pK1L, p28 и р11 промоторы вируса осповакцины, химерные промоторы, такие как р11К7.5 и Е1А, и MLP аденовирусные промоторы. Промотор также может представлять собой промотор, который стимулирует экспрессию в опухолевой или раковой клетке. Особо следует упомянуть промоторы MUC-I гена, которые сверхэкпрессируются при раке молочной железы и предстательной железы, (CHEN, и др. Селективная экспрессия гена рака молочной железы и терапия, опосредованная рекомбинантными аденовирусами, содержащими DF3/MUC1 промотор. The Journal of clinical investigation. 1995, том 96, №6, стр.2775-82), СЕА (замещающий зародышевый антиген карциномы) ген, который сверхэкпрессируется при раке толстого кишечника (SCHREWE, и др. Клонирование полного гена канцероэмбрионального антигена: анализ его промотора указывает участок, обеспечивающий типоспецифическую экспрессию. Molecular and cellular biology. 1990, том 10, №6, стр.2738-48), ген тирозиназы, который сверхэкпессируется при меланомах (VILE, и др. Применение тканеспецифической экспрессии гена тимидинкиназы вируса простого герпеса для ингибирования роста традиционных мышиных меланом после прямой внутриопухолевой инъекции ДНК. Cancer res. 1993, том 53, №17, стр.3860-4), ERBB-2 ген, который сверхэкпессируется в молочной железе и поджелудочной железе (HARRIS, и др. Генная терапия рака при использовании специфической для опухоли активации лекарственного средства. Gene therapy. 1994, том 1, №3, стр.170-5), и ген а-фетопротеина, который сверхэкпессируется при различных формах рака печени (KANAI, и др. In vivo генная терапия гепатоцеллюлярной карциномы, вырабатывающей альфа-фетопротеин, с помощью опосредованного аденовирусами переноса гена цитозиндезаминазы. Cancer res. 1997, том 57, №3, стр.461-5). Ранний промотор цитомегаловируса (CMV) является весьма предпочтительным.

Однако, когда используется вектор, имеющий происхождение от вируса осповакцины (как, например, MVA вектор), то промотор гена тимидинкиназы 7.5К и pH5R промотор являются особенно предпочтительными.

Необходимые элементы могут также включать дополнительные элементы, которые улучшают экспрессию последовательности нуклеиновой кислоты в соответствии с изобретением или ее поддержание в хозяйской клетке. Могут быть, в частности, упомянуты интронные последовательности, последовательности сигнала секреции, последовательности ядерной локализации, внутренние сайты для реинициации трансляции IRES типа, терминации транскрипции поли А последовательности, трехчленные лидерные последовательности и источники репликации. Эти элементы являются известными квалифицированному специалисту в данной области техники. Среди них сигнальная последовательность секреции, последовательности, кодирующие полипептиды, как отражено в SEQ ID NO 5 и/или 8, являются особенно предпочтительными.

Рекомбинантный вектор в соответствии с изобретением может также включать один или более дополнительных генов, представляющих интерес, при этом является возможным для этих генов размещаться под контролем тех же регуляторных элементов (полицистронная кассета) или независимых элементов. Гены, которые могут быть, в частности, упомянуты, представляют собой гены, кодирующие интерлейкины IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18, хемокины, такие, как СС1-19, CCL20, CCL21, CXCL-14, интерфероны, фактор некроза опухоли (TNF) и факторы, воздействующие на врожденный иммунитет и ангиогенез (например, РАI-1, означающий ингибитор активатора плазминогена). В одном частном воплощении рекомбинантный вектор в соответствии с изобретением включает представляющий интерес ген, кодирующий IL-2.

Настоящее изобретение также относится к клетке, включающей последовательность нуклеиновой кислоты в соответствии с изобретением. В предпочтительном воплощении клетка в соответствии с изобретением представляет собой эукариотическую клетку и, более предпочтительно, клетку млекопитающего. Клетки млекопитающего, которые являются доступными в качестве хозяев для экспрессии, хорошо известны в области техники и включают множество иммортализованных клеточных линий, таких как, но без ограничения, клетки яичника китайского хомячка (СНО), клетки почки детеныша хомячка (ВНК) и многие другие приемлемые дополнительные эукариотические клетки включают дрожжи и другие грибы.

Настоящее изобретение также относится к способу получения антитела в соответствии с изобретением, включающему культивирование клетки в соответствии с изобретением при условиях, позволяющих осуществлять экспрессию антитела и очистку антитела из клетки или среды, которая окружает клетку.

В другом воплощении настоящее изобретение относится к фармацевтической композиции, включающей любое антитело, последовательность нуклеиновой кислоты или вектор в соответствии с изобретением и фармацевтически приемлемый носитель. В предпочтительном воплощении фармацевтическая композиция дополнительно включает соединение, представляющее интерес.

Фармацевтически приемлемый носитель предпочтительно является изотоническим, гипотоническим или слабогипертоническим и обладает относительно низкой ионной силой, таким, как, например, раствор сахарозы. Кроме того, такой носитель может содержать любой растворитель, или водные или частично водные жидкости, такие, как непирогенная стерильная вода. Значение рН фармацевтической композиции дополнительно доводится или буферируется для того, чтобы соответствовать требованиям применения in vivo. Фармацевтическая композиция может также включать фармацевтически приемлемый разбавитель, адъювант или наполнитель, а также солюбилизирующие, стабилизирующие и консервирующие агенты. Для введения путем инъекции композиция в водном, неводном или изотоническом растворе является предпочтительной. Она может обеспечиваться в виде однодозовой или мультидозовой жидкой или сухой (порошок, лиофилизат и тому подобное) формы, которая может быть восстановлена во время применения при использовании приемлемого разбавителя.

Настоящее изобретение также относится к комплекту частей, включающему (i) фармацевтическую композицию, антитело, последовательность нуклеиновой кислоты или вектор в соответствии с изобретением и (ii) соединение, представляющее интерес.

Как используется в данной заявке, термин "соединение, представляющее интерес" относится к терапевтическому соединению, и предпочтительно к противораковому терапевтическому агенту или соединению, полезному для лечения снижения костной массы.

В соответствии с предпочтительным воплощением противораковый терапевтический агент является выбранным из группы, включающей Абраксан (стабилизированная алюминием композиция Паклитаксела, в форме наночастиц), Адриамицин (Доксорубицин гидрохлорид), Адруцил (фторурацил), Альдара (Имиквимод), Алемтузумаб, Алимта (Пеметрексед динатрий), Аминолевулиновую кислоту, Анастрозол, Апрепитант, Аримидекс (Анастрозол), Аромазин (Эксеместан), Арранон (Неларабин), трехокись мышьяка, Авастин (Бевацизумаб), Азацидин, Бевацизумаб, Бексаротен, Бортезомиб, Кампат (Алемтузумаб), Камптосар (Иринотекан гидрохлорид), Капецитабин, Карбоплатин, Цетуксимаб, Цисплатин, Клафен (Циклофосфамид), Клофарабин, Клофарекс (Клофарабин), Клолар (Клофарабин), Циклофосфамид, Цитарабин, Цитосар-U (Цитарабин), Цитоксан (Циклофосфамид), Дакоген (Децитабин), Дазатиниб, Децитабин, ДепоЦит (липосомальный Цитарабин), ДепоФом (липосомальный Цитарабин), Дексразоксан гидрохлорид, Доцетаксел, Доксил (Доксорубицин гидрохлорид липосомный), Доксорубицин гидрохлорид, Доксорубицин гидрохлорид липосомный, Докс-SL (Доксорубицин гидрохлорид липосомный), Эфудекс (фторурацил), Элленс (Эпирубицин гидрохлорид), Элоксатин (Оксалиплатин), Эменд (Аперпитант), Эпирубицин гидрохлорид, Эрбитукс (Цетуксимаб), Эрлотиниб гидрохлорид, Эвацет (Доксорубицин гидрохлорид липосомный), Эвиста (Ралоксифен гидрохлорид), Экземестан, Фазлодекс (Фулвестрант), Фемара (Летрозол), Флуороплекс (Фторурацил), Фторурацил, Фулвестрант, Гефитиниб, Гемцитабин гидрохлорид, Гемтузумаб Озогамицин, Гемзар (Гемцитабин гидрохлорид), Гливек (Иматиниб мезилат), Герцептин (Трастузумаб), Хикамтин (Топотекан гидрохлорид), Иматиниб мезилат, Имиквимод, Иресса (Гефитиниб), Иринотекан гидрохлорид, Иксабепилон, Иксемпра (Иксабепилон), Кеоксифен (Ралоксифен гидрохлорид), Кепиванс (Палифермин), Лапатиниб дитозилат, Леналидомид, Летрозол, Левулан (аминолевулиновая кислота), ЛипоДокс (Доксорубицин гидрохлорид липосомный), липосомальный Цитарабин, Метазоластон (Темозоломид), Метотрексат, Милосар (Азатицидин), Милотарг (Гемтузумаб Озогамицин), наночастицы Паклитаксела (стабилизированная алюминием композиция Паклитаксела, в форме наночастиц), Неларабин, Неосар (Циклофосфамид), Нексавар (Софарениб тозилат), Нилотиниб, Нолвадекс (Тамоксифен цитрат), Онкоспар (Пегаспаргаза), Оксалиплатин, Паклитаксел, стабилизированная алюминием композиция Паклитаксела, в форме наночастиц, Палефермин, Панитумумаб, Параплат (Карбоплатин), Параплатин (Карбоплатин), Пегаспаргаза, Пеметрексед динатрий, Платинол-AQ (Цисплатин), Платинол (Цисплатин), Ралоксифен гидрохлорид, Ревлимид (Леналидомид), Ритуксан (Ритуксимаб), Ритуксимаб, Склерозола интраплевральный аэрозоль (Тальк), Сорафениб тозилат, Сприцел (Дазатиниб), стерильный порошок Талька (Тальк), Стеритальк (Тальк), Сунитиниб малат, Сутент (Сунитиниб малат), Синовир (Талидомид), Тальк, Тамоксифен цитрат, Тарабин PFS (Цитарабин), Тарцева (Эрлотиниб гидрохлорид), Таргретин (Бексаротен), Тасигна (Нилотиниб), Таксол (Паклитаксел), Таксотер (Доцетаксел), Темодар (Темозоломид), Темозоломид, Темсиролимус, Таломид (Талидомид), Талидомид, Тотект (Дексразоксан гидрохлорид), Топотекан гидрохлорид, Торисел (Темсиролимус), Трастузумаб, Тризенокс (трехокись мышьяка), Тикерб (Лапатиниб дитозилат), Вектибикс (Панитумумаб), Велкад (Бортезомиб), Видаза (Азацитидин), Вориностат, Кселода (Капецитабин), Зинекард (Дексразоксан гидрохлорид), Золендроновую кислоту, Золинза (Вориностат) и Зомета (Золендроновую кислоту).

В соответствии с предпочтительным воплощением в соответствии с изобретением соединение, полезное для лечения снижения костной массы, представляет собой бифосфонат, модуляторы селективного рецептора эстрогена (SERM), гормон паращитовидной железы (РТН) (например, терипаратид (Фортео)), ранелат стронция, денозумаб или кальтонин, или их комбинацию. В соответствии с более предпочтительным воплощением бифосфонат является выбранным из группы, включающей Алендронат (Фозамакс, Фозамакс Плюс D), Этидронат (Дидронел), Ибандронат (Бонива), Памидронат (Аредия), Ризедронат (Актонель, Актонель W/кальций), Тилудронат (Скелид) изолендроновой кислоты (Рекласт, Зомета). В соответствии с более предпочтительным воплощением SERM являются выбранными из группы, включающей Ралоксифен (Эвиста), Базедоксифен/Премарин (Апрелал) и Тамоксифен.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением для лечения заболеваний, ассоциированных с повышенной активностью остеокластов. Такие заболевания включают, но без ограничения, эндокринные заболевания (гиперфункция надпочечников, гипогонадизм, первичный или вторичный гиперпаратиреоидизм гипертироидизм), гиперкальцемию, дефицитные состояния (рахит/остеомаляция, цинга, истощение), хронические заболевания (синдром малабсорбции, хроническая почечная недостаточность (почечная остеодистрофия)), хроническое печеночное заболевание (печеночная остеодистрофия), заболевания, индуцированные лекарственными средствами (глкокортикоиды (индуцированный глюкокортикоидами остеопороз), антиандрогенная терапия, терапия на основе ингибитора ароматазы, гепарина, спирта), и наследственные заболевания (остеопсатироз, гомоцистинурия), остеопороз, остеопетроз, воспаление костей, ассоциированное с артритом и ревматоидным артритом, заболеванием периодонта, фиброзной дисплазией и/или болезнью Педжета.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением для лечения заболеваний, ассоциированных с воспалением или аутоиммунитетом. Такие заболевания включают, но без ограничения, серонегативную спондилоартропатию (псориатический артрит, анкилозирующий спондилоартрит, болезнь Рейтера, спондилоартропатию, ассоциированную с воспалительным заболеванием кишечника), расшатывание суставного протеза, заболевания соединительных тканей (юношеский ревматоидный артрит, ревматоидный артрит, системная эритематозная волчанка (SLE) и волчаночный нефрит, склеродерма, синдром Шегрена, смешанное заболевание соединительной ткани, полимиозит, дерматомиозит), воспалительное заболевание кишечника (например, болезнь Крона; язвенный колит), синдром Уипла, артрит, ассоциированный с грануломатозным энтероколитом, воспалительные состояния кожи (аутоиммунный буллезный пемфигоид, аутоиммунная обыкновенная пузырчатка, экзема, дерматит), воспалительное легочное заболевание (альвеолит, легочный фиброз, саркоидоз, астма, бронхит, облитерирующий бронхиолит), воспалительное почечное заболевание (гломерулонефрит, отторжение почечного аллотрансплантата, воспаление почечных канальцев), атеросклероз, системный васкулит (височный артериит/гигантоклеточный артериит, артериит Такаясу, нодозный полиартериит, болезнь Кавасаки, грануломатоз Вегенера, синдром Черджа-Строса, микроскопическая полиангиопатия, некротизирующий гломерулонефрит, болезнь Шенлейн-Геноха, эссенциальный криоглобулинемический васкулит и другие васкулиты малых сосудов (болезнь Бехчета), заболевания, связанные с активацией макрофагов (синдром активации макрофагов (MAS), приобретенная болезнь Стилла, гемофагоцитарный синдром), ревматическая полимиалгия, первичный биллиарный склероз, склеродирующий холангит, аутоиммунный гепатит, сахарный диабет типа 1, тироидит Хашимото, болезнь Граве, рассеянный склероз (MS), синдром Гийена-Барре, болезнь Аддисона и/или феномен Рейно, синдром Гудпасчера.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением для лечения рака.

Как используется в данной заявке, термин "рак" относится, но без ограничения к аденокарциноме, ацинарной аденокарциноме, карциномам коры надпочечников, карциноме альвеолярных клеток, анаплазированному раку, базалоидной карциноме, базально-клеточной эпителиоме, аденоматозу легких, бронхогенной карциноме, renaladinol карциноме, эмбриональному раку, анометроидной карциноме, фиброламеллярной карциноме печеночных клеток, фолликулярному раку, гигантоклеточным карциномам, гепатоцеллюлярному раку, внутриэпидермальной карциноме, внутриэпителиальной карциноме, карциноме мозговых оболочек, медуллярной карциноме, меланотической карциноме, менингиальной карциноме, мезометонефрической карциноме, овсяноклеточному раку, чешуйчатоклеточной карциноме, карциноме потовых желез, переходно-клеточной карциноме, тубулярной карциноме, амелобластической саркоме, ацервуломе, эмбриональной рабдомиосаркоме, эндометриальной стромальной саркоме, опухоле Юинга, веретеноклеточной саркоме, гигантоклеточной саркоме, гранулоцитарной саркоме, иммунобластной саркоме, субкардиальной остеогенной саркоме, coppices саркоме, лейкозу (лейкемии), лимфобластоме (лимфосаркоме), медуллярной саркоме, миелоидной саркоме (гранулоцитарной саркоме), austiogenci саркоме, периостальной саркоме, ретикулосаркоме (гистиоцитарной лимфоме), круглоклеточной саркоме, веретеноклеточной саркоме, синовиальной саркоме, остеогенной аудиогенной саркоме с сосудистым компонентом, лимфоме Беркита, NPDL, NML, NH и диффузным лимфомам. В соответствии с предпочтительным воплощением способ в соответствии с изобретением является направленным на лечение метастатического рака костей, где метастатический рак представляет собой злокачественные образования молочных желез, легких, почек, множественную миелому, злокачественные образования щитовидной железы, предстательной железы, аденокарциному, злокачественные перерождения клеток крови, включая лейкемию или лимфому; виды рака головы и шеи; виды рака желудочно-кишечного тракта, включая рак пищевода, рак желудка, рак толстого кишечника, рак тонкого кишечника, рак ободочной и прямой кишки, рак прямой кишки, рак поджелудочной железы, рак печени, рак желчного протока или желчного пузыря; злокачественные образования женского полового тракта, включая карциному яичников, виды рака матки/эндометрия, рак влагалища и рак шейки матки; рак мочевого пузыря; рак мозга, включая нейробластому; саркому, остеосаркому; и рак кожи, включая злокачественную меланому или чешуйчато-клеточный рак.

Настоящее изобретение дополнительно касается способа улучшения лечения ракового пациента, которого подвергают химиотерапевтическому лечению с помощью противоракового терапевтического агента, включающего дополнительное сочетанное лечение указанного пациента наряду со способом, как раскрыто выше.

Настоящее изобретение дополнительно касается способа улучшения цитотоксической эффективности цитотоксических лекарственных средств или лучевой терапии, включающего дополнительное сочетанное лечение пациента, который нуждается в таком лечении, наряду со способом, как раскрыто выше.

Настоящее изобретение дополнительно касается способа улучшения лечения пациента с заболеванием, ассоциированным с повышенной остеокластной активностью, которого подвергают лечению с помощью бифосфоната, селективных модуляторов рецептора эстрогена (SERM), гормона паращитовидной железы (РТН) (например, терипаратида (Фортео)), ранелата стронция, деносумаба или кальцитонина, или их комбинации, включающего дополнительное сочетанное лечение указанного пациента наряду со способом, как раскрыто выше.

В другом воплощении применение антитела в соответствии с изобретением предполагается использовать для производства лекарственного средства для предотвращения или лечения метастатического рака в кости у пациента, страдающего метастатическим раком. В связанных с данным воплощениях метастатический рак представляет собой злокачественные образования молочных желез, легких, почек, множественную миелому, злокачественные образования щитовидной железы, предстательной железы, аденокарциному, злокачественные перерождения клеток крови, включая лейкемию или лимфому; виды рака головы и шеи; виды рака желудочно-кишечного тракта, включая рак пищевода, рак желудка, рак толстого кишечника, рак тонкого кишечника, рак ободочной и прямой кишки, рак прямой кишки, рак поджелудочной железы, рак печени, рак желчного протока или желчного пузыря; злокачественные образования женского полового тракта, включая карциному яичников, виды рака матки/эндометрия, рак влагалища и рак шейки матки; рак мочевого пузыря; рак мозга, включая нейробластому; саркому, остеосаркому; и рак кожи, включая злокачественную меланому или чешуйчато-клеточный рак.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением в производстве лекарственного средства.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением в производстве лекарственного средства для лечения пациента, имеющего рак.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением в производстве лекарственного средства для лечения пациента, имеющего заболевание, ассоциированное с повышенной активностью остеокластов.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением в производстве лекарственного средства для лечения пациента, имеющего воспалительное заболевание, в частности воспалительное заболевание кишечника.

В соответствии с другим воплощением настоящее изобретение относится к применению антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением в производстве лекарственного средства для лечения пациента, страдающего ревматоидным артритом.

Введение антитела, последовательности нуклеиновой кислоты, вектора, фармацевтической композиции или комплекта частей в соответствии с изобретением может осуществляться с помощью любых средств, известных квалифицированному специалисту в данной области техники. Предпочтительные способы введения включают, но без ограничения, интрадермальный, подкожный, пероральный, парентеральный, внутримышечный, интраназальный, сублингвальный, интратрахеальный, ингаляционный, окулярный, вагинальный и ректальный. В соответствии с предпочтительным воплощением антитело, последовательность нуклеиновой кислоты, вектор, фармацевтическая композиция или комплект частей в соответствии с изобретением доставляются системно.

Введение может осуществляться в единичной дозе или в повторяемой дозе один или несколько раз после определенного интервала времени. Является желательным, когда антитело, последовательность нуклеиновой кислоты, вектор, фармацевтическая композиция или комплект частей в соответствии с изобретением вводятся 1-10 раз с недельным интервалом.

Для общего руководства приемлемые дозировки для антитела составляют приблизительно от 2 мг/кг до 30 мг/кг, от 0,1 мг/кг до 30 мг/кг или от 0,1 мг/кг до 10 мг/кг веса тела. Приемлемые дозировки для вектора в соответствии с изобретением варьируют приблизительно от 104 до 1010 БОЕ (бляшкообразующих единиц), желательно приблизительно от 105 до 108 БОЕ для MVA вектора, в то время как они варьируют от приблизительно 105 до 1013 ИЕ (инфекционных единиц), желательно от приблизительно 107 до 1012 ИЕ, для вектора на основе аденовируса. Композиция на основе векторной плазмиды может вводиться в дозах от 10 мкг до 20 мг, предпочтительно от 100 мкг до 2 мг.

Когда применение или способ в соответствии с изобретением предназначен для лечения рака, то способ или применение в соответствии с изобретением могут осуществляться в сочетании с одним или более из традиционных терапевтических приемов (например, с лучевой терапией, химиотерапией и/или хирургией). Применение многочисленных терапевтических подходов обеспечивает пациента более широким вмешательством. В одном воплощении способ в соответствии с изобретением может предшествовать или следовать за хирургическим вмешательством. В другом воплощении он может предшествовать или следовать за лучевой терапии (например, гамма облучением). Специалисты в данной области техники могут легко составить прописи для приемлемой лучевой терапии и параметры, которые могут использоваться (смотри, например, PEREZ. Принципы и практика радиационной онкологии. 2-ое изд. LIPPINCOTT, 1992).

Краткое описание фигур на рисунках

Фигура 1 отражает специфическое окрашивание трансфицированных CSF-1R NIH/3T3 клеток с помощью mAb CXIIG6.

Фигура 2 показывает ингибирование связывания CSF-1 с CSF-1R на поверхности клеток в присутствии mAb CXIIG6.

Фигура 3 показывает специфическое блокирование растворимого человеческого CSF-1R с помощью mAb CXIIG6 (`Ctrl` означает контроль; `neg SN` означает негативный контроль гибридомного супернатанта).

Фигура 4 показывает ингибирование дифференциации человеческих остеокластов и секреции матриксной металлопротеазы-9 (ММР-9) в присутствии mAb CXIIG6 (`Ctrl` означает контроль; `CXIIG6 SN` означает CXIIG6 гибридомный супернатант, 'neg SN' означает негативный контроль гибридомного супернатанта).

Фигура 5 показывает неперекрестные реактивности mAb CXIIG6 с другими рецепторами тирозинкиназы, обладающими гомологией с CSF-1R (`SN` означает гибридомный супернатант).

Фигура 6 показывает последовательность нуклеиновой кислоты (SEQ ID NO:1) и дедуцированную аминокислотную последовательность (SEQ ID NO:2) тяжелой цепи CXIIG6. Последовательности праймера, включающие рестрикционные сайты для клонирования, которые прибавляли к нуклеотидной последовательности, подчеркнуты. Рестрикционные сайты являются выделенными курсивом. Аминокислотные последовательности V-доменов выделены жирным шрифтом.

Фигура 7 показывает последовательность нуклеиновой кислоты (SEQ ID NO:3) и дедуцированную аминокислотную последовательность (SEQ ID NO:4) легкой цепи CXIIG6. Последовательности праймера, включающие рестрикционные сайты для клонирования, которые прибавляли к нуклеотидной последовательности, подчеркнуты. Рестрикционные сайты являются выделенными курсивом. Аминокислотные последовательности V-доменов выделены жирным шрифтом.

Фигура 8 показывает плазмидную конструкцию pTG17753.

Фигура 9 показывает плазмидную конструкцию pTG17727.

Фигура 10 показывает плазмидную конструкцию pOptiVEC™.

Фигура 11 показывает плазмидную конструкцию pTG17895.

Фигура 12 показывает плазмидную конструкцию pTG17812.

Фигура 13 показывает плазмидную конструкцию pTG 17868.

Фигура 14 показывает плазмидную конструкцию pTG17869.

Фигура 15 показывает гуманизированные варианты CXIIG6 легкой цепи.

Фигура 16 показывает гуманизированные варианты CXIIG6 IgGI тяжелой цепи.

Фигура 17 показывает специфическое блокирование растворимого человеческого CSF-1R с помощью рекомбинантного CXIIG6 и химерного CXIIG6 IgGI.

Фигура 18 показывает ингибирование дифференциации человеческих остеокластов и секреции матриксной металлопротеазы-9 (ММР-9) в присутствии рекомбинантного мышиного CXIIG6 и химерного CXIIG6 IgGI.

Способ(ы) осуществления изобретения

Специфическое окрашивание трансфицированных CSF-1R клеток NIH/3T3 с помощью mAb CXIIG6

Клеточную линия В4-800-5 получали путем приемлемой транфекции NIH/3T3 клеток экспрессионной плазмидой, кодирующей полноразмерный CSF-1R человека. Экспрессию поверхностного CSF-1R на В4-800-5 клетках проверяли с помощью опосредованного иммуноокрашивания при использовании античеловеческих CSF-1R mAb 61701 (мышиный IgG1, R&D Systems) или 2-4А5-4 (крысиный IgG1,k, GeneTex), по сравнению с контролями изотипа (Фигура 1, верхняя и средняя панели). Супернатанты культур из гибридомы CXIIG6 или из негативного контроля гибридомы использовали для иммуноокрашивания В4-800-5 клеток или исходных NIH/3T3 клеток (Фигура 1, нижние панели).

Анализ на основе проточной цитометрии показал, что супернатант культуры из гибридомы CXIIG6 селективно окрашивал В4-800-5 клетки, демонстрируя специфичность mAb для CSF-1R на поверхности клеток.

Ингибирование связывания CSF-1 CSF-1R на поверхности клеток 3×105 ТНР-1 клеток (человеческая позитивная по CSF-1R клеточная линия моноцитарного лейкоза) инкубировали в течение 30 минут при 4°С в присутствии либо супернатантов культуры гибридомы, сыворотки из неиммунизированных или иммунизированных с помощью антител к CSF-1R мышей (разведение 1:1000), mAb анти-CSF-lR 2-4А5-4 (GeneTex) или контрольного крысиного IgG1 (10 мкг/мл), или при отсутствии реагента. После двух промываний с помощью холодного PBS клетки инкубировали с 1 мкг/мл биотинилированного рекомбинантного человеческого CSF-1 в течение 30 минут. Клетки дважды промывали и дополнительно инкубировали в течение 30 минут при 4°С с 10 мкг/мл стрептавидин-Alexa Fluor 488 (Invitrogen). После промывания с помощью PBS и фиксации при использовании 4% параформальдегида окрашивание клеток анализировали с помощью проточной цитометрии.

Сниженные по сравнению с контрольными образцами интенсивности флуоресценции отражали ингибирование связывания CSF-1 с CSF-1R на поверхности клеток. Сыворотка от иммунизированных CSF-1R мышей блокировала связывание CSF-1 с ТНР-1 клетками (Фигура 2). В то время как негативный контроль супернатантов гибридомы или несоответствующее mAb не продемонстрировали никакого эффекта, супернатант культуры из гибридомы CXIIG6 ингибировал связывание CSF-1 с ТНР-1 клетками (Фигура 2, нижняя правая панель), как и mAb 2-4А5-4 (нижняя левая панель).

Локализация сайта связывания mAb CXIIG6.

Для идентификации сайта связывания mAb CXIIG6 на CSF-1R осуществляли Вестерн-блоттинг при использовании растворимых форм человеческого CSF-1R, включающего либо пять внеклеточных, подобных иммуноглобулину доменов (Met 1 - Glu 512, R&D Systems) или только три N-терминальных, подобных иммуноглобулину домена внеклеточного участка CSF-1R (Met 1 - Ser 290), оба сливали на их С-терминальных концах с Fc участком человеческого IgG1. Растворимую форму EGFR, слитую с человеческим IgG1 Fc (R&D Systems), использовали в качестве негативного контроля.

Сто нанограмм каждого растворимого рецептора подвергали электрофорезу в естественных условиях перед перенесением на нитроцеллюлозные пластинки и исследовали либо с гибридомными супернатантами, либо с кроличьим pAb c-fms/CSF-1R Н300 (Santa Cruz Biotechnology), либо мышиным mAb 61701 (R&D Systems), либо с сывороткой, полученной от неиммунизированных или иммунизированных с помощью CSF-1R мышей.

Обе растворимые формы CSF-1R определяли в широких полосах при исследовании с помощью pAb c-fms/CSF-1R Н300, mAb 61701 или сыворотки от иммунизированных мышей. Никаких способных к определению сигналов не наблюдали при использовании сыворотки от неиммунизированных мышей или негативного контроля гибридомного супернатанта. CXIIG6 гибридомный супернатант узнавал CSF-1R1-290:Fc также, как и CSF-1R1-512:Fc, но не EGFR:Fc, что свидетельствовало о том, что CXIIG6 специфически связывается с эпитопом, лежащим в пределах М-терминальных, подобных иммуноглобулину доменов (между остатками от 1 до 290) человеческого CSF-1R.

Специфическое блокирование растворимого человеческого CSF-1R с помощью mAb CXIIG6

CSF-1-зависимую линию клеток мышиного миелиоидного лейкоза M-NFS-60 (# CRL-1838, АТСС) использовали для оценки блокирования активности CXIIG6 супернатанта гибридомы на человеческом и мышином CSF-1R. Пять нанограмм растворимого человеческого CSF-1R (CSF-1R1-512: Fc от R&D Systems) предварительно инкубировали в белых микропланшетах на 96 ячеек с серийными разведениями либо супернатантов гибридомы, либо mAb 61701 (R&D Systems), либо мышиного контроля изотипа mAb. 10E4 M-NFS-60 клетки, которые культивировали в течение ночи при отсутствии CSF-1, потом прибавляли к ячейкам с культурой вместе с 0,1 нг человеческого CSF-1 в заключительном аналитическом объеме 100 мкл. Культуры инкубировали в течение 48 часов при 37°С, количественно оценивали пролиферацию с помощью встраивания BrdU при использовании ELISA для исследования пролиферации клеток (Roche).

Растворимый человеческий CSF-1R полностью ингибировал пролиферацию M-NFS-60 клеток, опосредованную человеческим CSF-1, как было показано в присутствии негативного контроля супернатанта гибридомы, содержащего или не содержащего контрольный IgG1 (Фигура 3; среднее значение +/- стандартная ошибка среднего для трех ячеек). В противовес этому, CXIIG6 супернатант гибридомы и позитивный контроль mAb 61701 были оба способными восстанавливать клеточную пролиферацию зависимым от дозы образом, демонстрируя то, что они являются способными нейтрализовать растворимый человеческий CSF-1R.

В этом анализе активная клеточная пролиферация M-NFS-60 в присутствии низких разведений CXIIG6 супернатанта гибридомы показала, что mAb CXIIG6 был неспособным блокировать мышиный CSF-1R, который экспрессируется M-NFS-60 клетками. Кроме того, в анализе пролиферации на M-NFS-60 клетках, поддерживаемых мышиным CSF-1, который осуществляли при отсутствии растворимого CSF-1R, обработка при использование mAb AFS98 антимышиного CSF-1R (eBioscience) приводила к сильному зависимому от концентрации снижению роста клеток (данные не представлены). CXIIG6 супернатант гибридомы, подобно негативному контролю антитела и негативному супернатанту гибридомы, не вызывал снижения клеточной пролиферации. Эти результаты демонстрируют, что mAb CXIIG6 специфически нацеливает человеческий CSF-1R.

Ингибирование дифференциации человеческих остеокластов и секреции матриксной металлопротеазы-9 (ММР-9)

Остеокласты получали из моноцитов человека, полученных путем элютриации РВМС от здорового донора крови. Кратко, моноциты высевали при концентрации 2×10Е4 клеток на ячейку в планшеты на 96 ячеек и обрабатывали в течение 45 минут либо супернатантами культуры гибридомы, либо античеловеческими mAb к CSF-1R 61701 (R&D Systems), либо 2-4А5-4 (GeneTex), либо античеловеческими mAb к CSF-1 26730 (R&D Systems), либо мышиными и крысиными контролями изотипа, либо сывороткой от неиммунизированных и иммунизированных CSF-1R мышей, разведенной в культуральной среде гибридомы. Прибавляли полную а-МЕМ среду к ячейкам, содержащим культуру, при наличии или при отсутствии человеческого CSF-1 и RANKL (РергоТесП, 25 и 40 нг/мл, соответственно). Супернатанты гибридомы, mAb и/или среду с цитокинами или без них добавляли каждые 3 дня в течение 9 дней. Кондиционные супернатанты культуры собирали на 9 день и оценивали на общее содержание человеческой ММР-9 при использовании анализа ELISA (R&D Systems). Образование остеокластов оценивали путем окрашивания с помощью резистентной к тартрату кислой фосфатазы (TRAP) при использовании набора лейкоцитарной кислой фосфатазы от Sigma-Aldrich.

CSF-1+RANKL индуцированные моноциты для дифференциации в остеокласты определяли как большие многоядерные TRAP-позитивные клетки, в то время как никаких TRAP-позитивных остеокластов не получали при отсутствии цитокинов. Прибавление 0,5 мкг/мл анти-CSF-l mAb 26730 полностью устраняло дифференциацию остеокластов, как было продемонстрировано при отсутствии секреции ММР-9. Анти-CSF-1R mAb 61701 или 2-4А5-4 при одинаковой концентрации и сыворотка иммунизированных мышей (разведение 1:1000) ингибировали образование остеокластов только частично (Фигура 4; с (+) или без (-) цитокинов; среднее значение +/- стандартная ошибка среднего для 3 ячеек; *: среднее значение для 2 ячеек). Обработка с помощью CXIIG6 супернатанта культуры гибридомы, разведенного 1:20 или 1:100, значительно снижала уровень продукции ММР-9, по сравнению с двумя супернатантами негативного контроля гибридомы (А, В). Эти результаты демонстрируют, что mAb CXIIG6 ингибирует дифференциации остеокластов из человеческих моноцитов путем блокирования функции CSF-1R, находящего на поверхности клеток.

Ингибирование зависимого от CSF-1 фосфорилирования CSF-1R В4-800-5 линию клеток, полученную путем приемлемой трансфекции NIH/3T3 клеток с помощью плазмиды, экспрессирующей человеческое CSF-1R, использовали для оценки влияния CXIIG6 супернатанта гибридомы на зависимое от CSF-1 фосфорилирование CSF-1R. Клетки высевали при концентрации 2×10Е5 клеток на чашку Петри размером 60 мм и культивировали в течение 48-72 часов. После истощения сыворотки в течение 1 часа при 37°С клетки обрабатывали в течение 1 часа при 37°С культуральной средой, содержащей либо CXIIG6 супернатант гибридомы, либо mAb 2-4A5-4 (NeoMarkers), либо контролем изотипа mAb (разведенные в негативном супернатанте гибридомы) и потом стимулировали с помощью 100 нг/мл hCSF-1 или оставляли без стимуляции в течение 5 минут при 37°С. Слои клеток потом лизировали и экстрагировали общий белок. Десять мкг белков подвергали анализу путем исследования Вестерн-блоттов либо с помощью кроличьего рАb c-fms/CSF-1R Н300, либо кроличьего рАb p-c-fms/CSF-1R (Tyr708)-R (Santa Cruz Biotechnology), после чего обрабатывали козьими анти-кроличьими иммуноглобулинамиHRP.

При отсутствии CSF-1, ни CXIIG6 супернатант гибридомы, ни mAb 2-4A5-4 не индуцировали фосфорилирования рецептора, как можно наблюдать с антителом, специфическим для CSF-1R, фосфорилированным в положении 708, что свидетельствует о том, что mAb CXIIG6 самостоятельно не вызывает агонистического эффекта. При стимуляции с помощью CSF-1 количество CSF-1R снижалось в клетках, обработанных контролем изотипа, по сравнению с нестимулированными клетками, а CSF-1R подвергался фосфорилированию в Tyr708 (данные не представлены). Предварительная обработка с помощью CXIIG6 супернатанта гибридомы или с помощью mAb 2-4A5-4 не повышала исчезновения CSF-1R. Фосфорилирование CSF-1R снижалось после обработки с помощью CXIIG6 супернатанта гибридомы или с помощью mAb 2-4A5-4. Эти результаты показывают, что mAb CXIIG6 является способным блокировать зависимое от CSF-1 фосфорилирование CSF-1R.

Перекрестная реактивность mAb CXIIG6

Перекрестную реактивность mAb CXIIG6 анализировали с помощью ELISA на сериях очищенных растворимых рецепторов, принадлежащих к типу III подсемейства рецепторов тирозинкиназы и демонстрирующих гомологию с CSF-1R в своих внеклеточных доменах, подобных Ig: растворимые VEGFR-1, VEGFR-2, Flt-3 и PDGFRb (все четыре экспрессируются в виде Fc слитых белков), а также PDGFRa и SCFR (с-набор) получали от R&D Systems и использовали для покрытия ELISA планшета. Растворимый EGFR (R&D Systems) EGFR подсемейства рецепторов тирозинкиназы использовали в качестве негативного контроля.

Культуральные супернатанты либо из гибридомы CXIIG6 (CXIIG6 SN), либо из негативного контроля гибридомы, либо анти-CSF-1R мышиный IgG1 61701 (R&D Systems) инкубировали на покрытом ELISA планшете при концентрациях антитела 500 нг/мл. После промывания планшета ELISA связанные антитела выявляли при использовании конъюгированного с пероксидазой козьего антимышиного Ig (Sigma) и измеряли значение OD(450-540 nm). Результаты, представленные на Фигуре 5, показывают, что подобно mAb 61701, CXIIG6 сильно связывает CSF-1R, в то время как никакого специфического сигнала не определяли на каком-либо другом рецепторе тирозинкиназы. Это показывает, что среди различных исследованных рецепторов тирозинкиназы типа III CXIIG6 является специфическим для CSF-1R.

Конструирование экспрессионных векторов для mAb CXIIG6

Набор для экспрессии антитела OptiCHO™ (Invitrogen, катал. №12762-019) использовали для клонирования генов, кодирующих тяжелые и легкие цепи CXIIG6 для того, чтобы получить mAb CXIIG6 в линии клеток млекопитающих DG44. Набор для экспрессии антитела OptiCHO™ включает: (1) pOptiVEC™ вектор, бицистронную плазмиду, которая позволяет осуществлять клонирование гена, представляющего интерес, ниже от CMV промотора. Транскрипция гена, представляющего интерес, отделяется от ауксотрофного селективного маркера дигидрофолатредуктазы (DHFR) с помощью участка внутренней посадки рибосомы (IRES), что позволяет осуществлять транскрипцию гена, представляющего интерес, и селективного маркера в одной и той же мРНК; (2) pcDNA™3.3 вектор, который позволяет клонировать ген, представляющий интерес, ниже от CMV промотора. pcDNA™3.3 содержит ген устойчивости к неомицину, что позволяет осуществлять селекцию при использовании Geneticin®. pOptiVEC™ и pcDNA™3.3 векторы содержат ТК поли-А последовательность, которая направляет собственный процессинг 3′ конца мРНК гена, представляющего интерес.

Специфические праймеры (смотри Таблицу 4) синтезировали и использовали для ПЦР амплификации и клонирования генов тяжелой цепи и легкой цепи цельного CXIIG6 (соответственно, SEQ ID NO:1 и SEQ ID NO:3; смотри, соответственно, Фигуру 6 и Фигуру 7). Обратные праймеры включали консенсусную последовательность Козака для эффективной эукариотической трансляции (KOZAK М. Анализ 5′-некодирующих последовательностей из 699 мРНК позвоночных. Nucleic Acids Res. 1987, 15 (20): 8125-8148).

Таблица 4
Праймер Последовательность
OTG18929 GCCGCCACCATGTACTTGGGACTGAACTATGTATTC
(SEQ ID NO:30)
OTG18930 GGAGATCTTCATTTACCCGGAGTCCGGGA
(SEQ ID NO:31)
OTG18931 GCCGCCACCATGAGTGTGCCCACTCAGGTCCTG
(SEQ ID NO:32)
OTG18932 GCCCGGGCTAACACTCATTCCTGTTGAAGCTC
(SEQ ID NO:33)

Тяжелые цепи CXIIG6 амплифицировали с помощью ПЦР при использовании OTG18929 и OTG18930 с плазмидами pTG17753 (Фигура 8) в качестве матрицы и клонировали в вектор pOptiVEC™-TOPO® (набор pOptiVEC™-TOPO® ТА Cloning®, Invitrogen, катал. №12744-017-01) и pcDNA™3.3-TOPO® векторы (набор рсДНК™3.3-ТОРО® ТА Cloning®, Invitrogen, катал. №К8300-01)для получения, соответственно, pTG17786 и pTG17789.

Легкие цепи CXIIG6 амплифицировали с помощью ПЦР при использовании OTG18931 и OTG18932 с плазмидами pTG17727 (Фигура 9) в качестве матрицы и клонировали в вектор pOptiVEC™-TOPO® (набор pOptiVEC™-ТОРО® ТА Cloning®, Invitrogen, катал. №12744-017-01) и pcDNA™3.3-TOPO® векторы (набор рсДНК™3.3-ТОРО® ТА Cloning®, Invitrogen, катал. №К8300-01) для получения, соответственно, pTG17788 и pTG17787.

Нуклеотидную последовательность полной экспрессионной кассеты, включающей CMV промотор и ТК полиА сигнал pTG17786, pTG17787, pTG17788 и pTG17789 подвергали секвенированию и выявляли, что она соответствует теоретическим последовательностям.

Получение химерных антител из mAb CXIIG6

Вариабельные домены mAb CXIIG6 объединяли с константными участками человека.

Для получения химерной легкой цепи (которую называли химерной CXIIG6 1gk цепью) теоретическую последовательность конструировали путем соединения последовательности, кодирующей CXIIG6 VK домен (из SEQ ID NO:3), с последовательностью, кодирующей IGKC участок человека (GenBank депозитный номер: J00241). Этот Xbal NotI фрагмент ДНК сохранял ту же нетранслируемую последовательность на 5′ конце, включая последовательность Козака, что и тот, который используется в мышином варианте (как в pTG17787 и pTG17788, описанных выше). Химерную CXIIG6 последовательность легкой цепи оптимизировали по кодонам для экспрессии в СНО, соединяли с синтетическими олигонуклеотидами и субклонировали в pOptiVEC™ (Фигура 10) с помощью Xbal NotI от GeneArtAG. Полученная оптимизированная по кодонам последовательность нуклеиновой кислоты химерной CXIIG6 легкой цепи (вариабельный и константный участки) является представленной в SEQ ID NO:34. Полученная плазмида получила название pTG 17895 (Фигура 11).

Для получения химерных тяжелых IgG1 и IgG4 цепей (соответственно, называются химерной CXIIG6 IgG1 и химерной CXIIG6 IgG4 цепями) теоретические последовательности конструировали путем соединения последовательности, кодирующей CXIIG6 VH домен (из SEQ ID NO:1), с последовательностями, кодирующими либо человеческий IGHG1C участок (GenBank депозитн. номер: J00228), либо человеческий IGHG4C участок (GenBank депозитн. номер: К01316). Эти Xbal NotI фрагменты ДНК сохраняли ту же нетранслируемую последовательность на 5′ конце, включая последовательность Козака, что и тот, который использовался в мышином варианте (как в pTG17786 и pTG17789, описанных выше). Потом химерные CXIIG6 тяжелые цепи подвергали оптимизации по кодонам для экспрессии в СНО, синтезировали и клонировали в pTG17812 (Фигура 12) с помощью Xbal Noil от GeneArt AG. Полученная оптимизированная по кодонам последовательность нуклеиновой кислоты CXIIG6 IgG1 тяжелых цепей (вариабельный и константный участки) является такой, как отражено в SEQ ID NO:35, а полученная плазмида получала название pTG17868 (Фигура 13). Полученная оптимизированная по кодонам последовательность нуклеиновой кислоты CXIIG6 IgG4 тяжелой цепи (вариабельный и константный участки) является такой, как отражено в SEQ ID NO:36, а полученная плазмида получала название pTG 17869 (Фигура 14).

Получение человеческих антител из mAb CXIIG6

Для получения гуманизированных вариантов легкой цепи осуществляли аминокислотные замены в соответствии с Таблицей 2 в пределах вариабельного участка легкой цепи, как отражено в SEQ ID NO:9.

ДНК последовательности конструировали путем соединения модифицированной последовательности, несущей замены CXIIG6 VK домена (из SEQ ID NO:3), с последовательностью, кодирующей человеческий IGKC участок (GenBank депозитный номер: J00241). Этот Хbal NotI фрагмент ДНК сохранял ту же нетранслируемую последовательность на 5' конце, включая последовательность Козака, что и тот, который использовался в мышином варианте (как в pTG17787 и pTG17788, описанных выше). Последовательности гуманизированной CXIIG6 легкой цепи потом оптимизировали по кодонам для экспрессии в СНО, соединяли с синтетическими олигонуклеотидами и клонировали в pOptiVEC™ (Фигура 10) с помощью Xbal NotI от GeneArt AG. Полученные гуманизированные варианты CXIIG6 легкой цепи и плазмиды приведены на Фигуре 15.

Для получения гуманизированных вариантов тяжелой цепи осуществляли аминокислотные замены в соответствии с Таблицей 1 в пределах вариабельного участка тяжелой цепи, как отражено в SEQ ID NO:6.

ДНК последовательности конструировали путем соединения модифицированных последовательностей, несущих замены CXIIG6 VH домена (из SEQ ID NO:1), с последовательностью, кодирующей человеческий IGHG1C участок (GenBank депозитный номер: J00228). Эти Xbal NotI фрагменты ДНК сохраняли ту же нетранслируемую последовательность на 5′ конце, включая последовательность Козака, что и тот, который используется в мышином варианте (как в pTG 17786 и pTG 17789, как описано выше). Потом ДНК последовательности подвергали оптимизации по кодонам для экспрессии в СНО, синтезировали и клонировали в pTG17812 (Фигура 12) с помощью Xbal NotI от GeneArt AG. Полученные гуманизированные варианты CXIIG6 IgG1 тяжелой цепи и плазмиды приведены на Фигуре 16.

In vitro ингибиторные активности рекомбинантного мышиного CXIIG6 и химерного CXIIG6 IgG1

Для определения, является ли очищенный рекомбинантный мышиный CXIIG6 (как описано ранее) и его химерный IgG1 вариант (химерный CXIIG6 IgG1, как описано ранее) способными блокировать растворимый человеческий CSF-1R, осуществляли исследования доза-ответ в моделях пролиферации М-NFS-60 клеток и дифференциации остеокластов (как описано ранее). Очищенный поликлональный IgG2a от Rockland (Rockland, 010-0141) и химерный IgG1, полученный заявителем, подвергали параллельному анализу в качестве контрольных антител. Блокирующий эффект оценивали, подвергая клетки воздействию интервалов концентрации активного анти-CSF-IR антитела, как измеряется с помощью связывания антигена в биосенсорном SPR анализе. Сравнение между mAb CXIIG6 и их соответствующим контролем mAb осуществляли путем загрузки равных количеств общего антитела (SPR биосенсорный анализ на Fc связывание).

M-NFS-60 биоанализ: в M-NFS-60 биоанализе клетки обрабатывали с помощью 0,23 нг/мл - 0.5 мкг/мл активных mAb CXIIG6 (рекомбинантный мышиный CXIIG6; химерный CXIIG6 IgG1) или соответствующими концентрациями контрольных mAb в присутствии 50 нг/мл человеческого растворимого CSF-1R и 1 нг/мл человеческого CSF-1 в течение 48 часов. Результаты, представленные на Фигуре 17, показывают, что рост M-NFS-60 клеток увеличивается в ответ на повышающиеся концентрации обоих mAb CXIIG6 (рекомбинантное мышиное CXIIG6; химерный CXIIG6 IgG1), демонстрируя тот факт, что они антагонизируют связывание растворимого CSF-1R с CSF-1 (среднее значение +/- стандартная ошибка среднего для трех ячеек). Химерный CXIIG6 IgG1 был таким же эффективным, как и рекомбинантный мышиный CXIIG6 в отношении востановления клеточной пролиферации. Контрольный мышиный IgG2a и химерный IgG1 не оказывали никакого влияния на нейтрализацию CSF-1 растворимым CSF-1R в пределах их соответствующего интервала концентраций.

Остеокластный биоанализ: в остеокластном биоанализе декантированные человеческие моноциты инкубировали в течение 8 дней с 0,85 нг/мл - 0,62 мкг/мл активных mAb CXIIG6 (рекомбинантное мышиное CXIIG6; химерный CXIIG6 IgG1) в присутствии 25 нг/мл CSF-1 (ImmunoTools) и 40 нг/мл RANKL. Среду и все прибавляемые агенты добавляли в дни 4 и 6, и общий ММР-9 измеряли в культуральной среде, стандартизованной в период от 6 до 8 дня. Результаты, представленные на Фигуре 18, показывают, что по сравнению с контрольными антителами рекомбинантное мышиное антитело CXIIG6 и его химерный вариант (химерный CXIIG6 IgG1) каждый значительно снижали продукцию ММР-9, которая соответствовала дифференциации остеокластов, свидетельствуя о том, что происходило замедление роста (Фигура 18); (среднее значение +/- стандартная ошибка среднего для трех ячеек).

Взятые вместе эти результаты демонстрируют, что очищенный рекомбинантный CXIIG6 и химерный CXIIG6 IlgG1 ингибируют человеческий CSF-1R как тот, что находится на поверхности клеток, так и растворимый.

Ссылки

- WO 01/30381

- WO 03/059395

- WO 2005/068503

- EP 1488792 A

- US 2005059113

- EP 901463 В

- EP 83286 A

- EP 206920 A

- US 5747323

- WO 94/28152

- WO 97/04119

- WO 94/18992

- WO 96/17070

- SHERR. Colony-stimulating factor-1 receptor. blood. 1990, vol.75, no.1, p.1-12.

- HUME, et al. Regulation of CSF-1 receptor expression. Molecular reproduction and development. 1997, vol.46, no.1, p.46-52.

- KLUGER, et al. Macrophage colony-stimulating factor-1 receptor expression is associated with poor outcome in breast cancer by large cohort tissue microarray analysis. Clinical cancer research. 2004, vol.10, no.1, p.173-7.

- SCHOLL, et al. Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis. Journal of the National Cancer Institute. 1994, vol.86, no.2, p.120-6.

- CHAMBERS, et al. Overexpression of epithelial macrophage colony-stimulating factor (CSF-1) and CSF-1 receptor: a poor prognostic factor in epithelial ovarian cancer, contrasted with a protective effect of stromal CSF-1. Clinical Cancer Research. 1997, vol.3, no.6, p.999-1007.

- BAÏOCCHI, et al. Expression of the macrophage colony-stimulating factor and its receptor in gynecologic malignancies. Cancer. 1991, vol.67, no.4, p.990-6.

- KIRMA, et al. Elevated expression of the oncogene c-fms and its ligand, the macrophage colony-stimulating factor-1, in cervical cancer and the role of transforming growth factor-beta1 in inducing c-fms expression. Cancer res. 2007, vol.67, no.5, p.1918-26.

- HEMMERLEIN, et al. Expression of acute and late-stage inflammatory antigens, c-fms, CSF-1, and human monocytic serine esterase 1, in tumor-associated macrophages of renal cell carcinomas. Cancer immunology, immunotherapy. 2000, vol.49, no.9, p.485-92.

- IDE, et al. Expression of colony-stimulating factor 1 receptor during prostate development and prostate cancer progression. Proc. Natl. Acad. Sci. U.S.A. 2002, vol.99, no.22, p.14404-9.

- RAMBALDI, et al. Expression of the macrophage colony-stimulating factor and c-fms genes in human acute myeloblastic leukemia cells. Journal of Clinical Investigation. 1988, vol.81, no.4, p.1030-5.

- SCHOLL, et al. Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis. Journal of the National Cancer Institute. 1994, vol.86, no.2, p.120-6.

- TANG, et al. M-CSF (monocyte colony stimulating factor) and M-CSF receptor expression by breast tumour cells: M-CSF mediated recruitment of tumour infiltrating monocytes? Journal of cellular biochemistry. 1992, vol.50, no.4, p.350-6.

- SCHOLL, et al. Circulating levels of colony-stimulating factor 1 as a prognostic indicator in 82 patients with epithelial ovarian cancer. British journal of cancer. 1994, vol.69, no.2, p.342-6. - SCHOLL. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study. Breast cancer research and treatment. 1996, vol.39, no.3, p.275-83.

- DORSCH, et al. Macrophage colony-stimulating factor gene transfer into tumor cells induces macrophage infiltration but not tumor suppression. European journal of immunology. 1993, vol.23, no.1, p.186-90.

- WANG, et al. Induction of monocyte migration by recombinant macrophage colony-stimulating factor. Journal of immunology. 1988, vol.141, no.2, p.575-9.

- FILDERMAN, et al. Macrophage colony-stimulating factor (CSF-1) enhances invasiveness in CSF-1 receptor-positive carcinoma cell lines. Cancer res. 1992, vol.52, no.13, p.3661-6.

- DORSCH, et al. Macrophage colony-stimulating factor gene transfer into tumor cells induces macrophage infiltration but not tumor suppression. European journal of immunology. 1993, vol.23, no.1, p.186-90.

- SCHOLL. Circulating levels of the macrophage colony stimulating factor CSF-1 in primary and metastatic breast cancer patients. A pilot study. Breast cancer research and treatment. 1996, vol.39, no.3, p.275-83.

- BARON, et al. Modulation of MHC class II transport and lysosome distribution by macrophage-colony stimulating factor in human dendritic cells derived from monocytes. Journal of cell science. 2001, vol.114, no.pt5, p.999-1010.

- CECCHINI, et al. Role of CSF-1 in bone and bone marrow development. Molecular reproduction and development. 1997, vol.46, no.1, p.75-83.

- BRUZZANITI, et al. Molecular regulation of osteoclast activity. Reviews in endocrine. 2006, vol.7, no.1-2, p.123-39.

- CICEK, et al. Breast cancer bone metastasis and current small therapeutics. Cancer metastasis reviews. 2006, vol.25, no.4, p.635-44.

- KITAURA, et al. The journal of clinical investigation. M-CSF mediates TNF-induced inflammatory osteolysis. 2005, vol.115, no.12, p.3418-27.

- MARSHALL, et al. Blockade of colony stimulating factor-1 (CSF-I) leads to inhibition of DSS-induced colitis. Inflammatory bowel diseases. 2007, vol.13, no.2, p.219-24.

- JOSE, et al. Blockade of macrophage colony-stimulating factor reduces macrophage proliferation and accumulation in renal allograft rejection. American journal of transplantation. 2003, vol.3, no.3, p.294-300.

- KUTZA, et al. Macrophage colony-stimulating factor antagonists inhibit replication of HIV-1 in human macrophages. Journal of immunology. 2000, no.164, p.4955-4960.

- SMITH, et al. Identification of common molecular subsequences. Journal of Molecular Biology. 1981, no.147, p.195-7.

- HARLOW. Antibodies: A Laboratory manual. 2nd edition. Cold Spring Harbor; Laboratory press, 1988.

- HAMMERLING, et al. Monoclonal Antibodies and Т Cell Hybridomas. New York: Elsevier, 1981. p.563-681.

- SMITH, et al. Identification of common molecular subsequences. Journal of Molecular Biology. 1981, no.147, p.195-7.

- LENNARD. Standard protocols for the construction of scFv libraries. Methods in molecular biology. 2002, no.178, p.59-71.

- POLJAK. Production and structure of diabodies. Structure. 1994, vol.2, no.12, p.1121-3.

- HUDSON, et al. High avidity scFv multimers; diabodies and triabodies. Journal of immunological methods. 1999, vol.231, no.1-2, p.177-89.

- KIPRIYANOV. Generation of bispecific and tandem diabodies. Methods in molecular biology. 2002, no.178, p.317-31.

- HOLLIGER, et al. Engineered antibody fragments and the rise of single domains. Nature biotechnology. 2005, vol.23, no.9, p.1126-36.

- HOOGENBOOM, et al. Natural and designer binding sites made by phage display technology. Immunology today. 2000, vol.21, no.8, p.371-8.

- MARKS, et al. By-passing immunization: building high affinity human antibodies by chain shuffling. Biotechnology. 1992, vol.10, no.7, p.779-83.

- BARBAS, et al. In vitro evolution of a neutralizing human antibody to human immunodeficiency virus type 1 to enhance affinity and broaden strain cross-reactivity. Proceedings of the National Academy of Sciences of the United States of America. 1994, vol.91, no.9, p.3809-13.

- SCHIER. Identification of functional and structural amino-acid residues by parsimonious mutagenesis. Gene. 1996, vol.169, no.2, p.147-55.

- YELTON. Affinity maturation of the BR96 anti-carcinoma antibody by codon-based mutagenesis. J. immunol. 1995, vol.155, no.4, p.1994-2004.

- JACKSON, et al. In vitro antibody maturation. Improvement of a high affinity, neutralizing antibody against IL-1 beta. J. immunol. 1995, vol.154, no.7, p.3310-9.

- HAWKINS, et al. Selection of phage antibodies by binding affinity. Mimicking affinity maturation. Journal of molecular biology. 1992, vol.226, no.3, p.889-96.

- SMITH, et al. Identification of common molecular subsequences. Journal of Molecular Biology. 1981, no.147, p.195-7.

- BRENNAN, et al. Preparation of bispecific antibodies by chemical recombination of monoclonal immunoglobulin G1 fragments. Science. 1985, vol.229, no.4708, p.81-3.

- SHALABY, et al. Development of humanized bispecific antibodies reactive with cytotoxic lymphocytes and tumor cells overexpressing the HER2 protooncogene. The Journal of experimental medicine. 1992, vol.175, no.1, p.217-25.

- KOSTELNY, et al. Formation of a bispecific antibody by the use of leucine zippers. J. immunol. 1992, vol.148, no.5, p.1547-33.

- ZAPATA, et al. Engineering linear F(ab′)2 fragments for efficient production in Escherichia coli and enhanced antiproliferative activity. Protein engineering. 1995, vol.8, no.10, p.1057-62.

- HERMANSON. Bioconjugate techniques. Academic press, 1996.

- HERMANSON. Bioconjugate techniques. Academic press, 1996. p.118-228.

- HERMANSON. Bioconjugate techniques. Academic press, 1996. p.229-285.

- FELGNER, et al. Cationic liposome mediated transfection. Proceedings of the Western Pharmacology Society. 1989, vol.32, p.115-21.

- HODGSON, et al. Virosomes: cationic liposomes enhance retroviral transduction. Nature biotechnology. 1996, vol.14, no.3, p.339-42.

- REMY, et al. Gene transfer with a series of lipophilic DNA-binding molecules. Bioconjugate chemistry. 1994, vol.5, no.6, p.647-54.

- LATHE, et al. Plasmid and bacteriophage vectors for excision of intact inserts. Gene. 1987, vol.57, no.2-3, p.193-201.

- LUPTON, et al. Mapping genetic elements of Epstein-Barr virus that facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Molecular and cellular biology. 1985, vol.5, no.10, p.2533-42.

- YATES, et al. Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature. 1985, vol.313, no.6005, p.812-5.

- SUMMERS, et al. Multimerization of high copy number plasmids causes instability: ColE1 encodes a determinant essential for plasmid monomerization and stability. Cell. 1984, vol.36, no.4, p.1097-103.

- SUTTER, et al. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc. Natl. Acad. Sci. U.S.A. 1992, vol.89, no.22, p.10847-51.

- MEYER, et al. Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. The Journal of general virology. 1991, vol.72, no.Pt5, p.1031-8.

- SUTTER, et al. A recombinant vector derived from the host range-restricted and highly attenuated MVA strain of vaccinia virus stimulates protective immunity in mice to influenza virus. Vaccine. 1994, vol.12, no.11, p.1032-40.

- GRAHAM, et al. Methods in molecular biology. Edited by MURREY. The human press inc, 1991. p.109-128.

- ZAKHARCHUK, et al. Physical mapping and homology studies of egg drop syndrome (EDS-76) adenovirus DNA. Archives of virology. 1993, vol.128, no.1-2, p.171-6.

- SPIBEY, et al. Molecular cloning and restriction endonuclease mapping of two strains of canine adenovirus type 2. The Journal of general virology. 1989, vol.70, no.Pt 1, p.165-72.

- JOUVENNE, et al. Cloning, physical mapping and cross-hybridization of the canine adenovirus types 1 and 2 genomes. Gene. 1987, vol.60, no.1, p.21-8.

- MITTAL, et al. Development of a bovine adenovirus type 3-based expression vector. The Journal of general virology. 1995, vol.76, no.Pt 1, p.93-102.

- BISCHOFF, et al. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science. 1996, vol.274, no.5286, p.373-6.

- HEISE, et al. An adenovirus E1A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nature Medicine. 2000, vol.6, no.10, p.1134-9.

- FUEYO, et al. A mutant oncolytic adenovirus targeting the Rb pathway produces anti-glioma effect in vivo. Oncogene. 2000, vol.19, no.1, p.2-12.

- MCIVOR. Human purine nucleoside phosphorylase and adenosine deaminase: gene transfer into cultured cells and murine hematopoietic stem cells by using recombinant amphotropic retroviruses. Molecular and cellular biology. 1987, vol.7, no.2, p.838-46.

- TABIN, et al. Adaptation of a retrovirus as a eucaryotic vector transmitting the herpes simplex virus thymidine kinase gene. Molecular and cellular biology. 1982, vol.2, no.4, p.426-36.

- TAKEBE, et al. SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and cellular biology. 1988, vol.8, no.1, p.466-72.

- CHEN, et al. Breast cancer selective gene expression and therapy mediated by recombinant adenoviruses containing the DF3/MUC1 promoter. The Journal of clinical investigation. 1995, vol.96, no.6, p.2775-82.

- SCHREWE, et al. Cloning of the complete gene for carcinoembryonic antigen: analysis of its promoter indicates a region conveying cell type-specific expression. Molecular and cellular biology. 1990, vol.10, no.6, p.2738-48.

- VILE, et al. Use of tissue-specific expression of the herpes simplex virus thymidine kinase gene to inhibit growth of established murine melanomas following direct intratumoral injection of DNA. Cancer res. 1993, vol.53, no.17, p.3860-4.

- HARRIS, et al. Gene therapy for cancer using tumour-specific prodrug activation. Gene therapy. 1994, vol.1, no.3, p.170-5.

- KANAI, et al. In vivo gene therapy for alpha-fetoprotein-producing hepatocellular carcinoma by adenovirus-mediated transfer of cytosine deaminase gene. Cancer res.. 1997, vol.57, no.3, p.461-5.

- PEREZ. Principles and practice of radiation oncology. 2nd edition. LIPPINCOTT, 1992.

- KOZAK M. An analysis of 5′-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 1987,15(20): 8125-8148.

- CHOTHIA and LESK. Canonical structures for the hypervariable regions of immunoglobulins (1987) J Mol Biol. 1987 Aug 20; 196(4):901-17.

1. Антитело или его антигенсвязывающий фрагмент, которое(ый) специфически связывает человеческий CSF-1R и содержит тяжелую цепь, включающую 3 CDRs, причем указанные CDRs содержат последовательности, представленные в SEQ ID NO: 11, 12 и 13, соответственно; и легкую цепь, включающую 3 CDRs, причем указанные CDRs содержат последовательности, представленные в SEQ ID NO: 14, 15 и 16, соответственно.

2. Антитело или его антигенсвязывающий фрагмент по п.1, причем указанная вариабельная область легкой цепи может содержать по меньшей мере одну аминокислотную замену A9S.

3. Антитело или его антигенсвязывающий фрагмент по п.1, в котором вариабельная область включает один, более предпочтительно два, даже более предпочтительно три и особенно предпочтительно четыре человеческих FR.

4. Антитело или его антигенсвязывающий фрагмент по п.1, в котором вариабельная область включает аминокислотную последовательность, представленную в SEQ ID NO:6.

5. Антитело или его антигенсвязывающий фрагмент по п.4, в котором вариабельная область является такой, как представлено в SEQ ID NO:6.

6. Антитело или его антигенсвязывающий фрагмент по п.1, в котором вариабельная область включает аминокислотную последовательность, представленную в SEQ ID NO:9.

7. Антитело или его антигенсвязывающий фрагмент по п.6, в котором вариабельная область является такой, как представлено в SEQ ID NO:9.

8. Антитело или его антигенсвязывающий фрагмент по п.1, которое включает: (i) первую вариабельную область, содержащую CDR, представленный в последовательности, начинающейся в положении 45 и заканчивающейся в положении 54 SEQ ID NO:2; CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 87 SEQ ID NO:2 и CDR, представленный в последовательности, начинающейся в положении 117 и заканчивающейся в положении 126 SEQ ID NO:2, и
(ii) вторую вариабельную область, содержащую CDR, представленный в последовательности, начинающейся в положении 44 и заканчивающейся в положении 56 SEQ ID NO:4, CDR, представленный в последовательности, начинающейся в положении 66 и заканчивающейся в положении 76 SEQ ID NO:4, и CDR, представленный в последовательности, начинающейся в положении 109 и заканчивающейся в положении 117 SEQ ID NO:4.

9. Антитело или его антигенсвязывающий фрагмент по п.1, включающее вариабельную область, представленную в SEQ ID NO:6, и вариабельную область, как отражено в SEQ ID NO:9.

10. Антитело или его антигенсвязывающий фрагмент по п.1, которое является гуманизированным антителом и включает (i) вариабельную область тяжелой цепи, представленную в SEQ ID NO:6, и (ii) вариабельную область легкой цепи, представленную в SEQ ID NO:9.

11. Антитело или его антигенсвязывающий фрагмент по п.10, где указанная вариабельная область тяжелой цепи включает следующие аминокислотные замены K3Q, E5V, M18L и Р90Т.

12. Антитело или его антигенсвязывающий фрагмент по п.10, где указанная вариабельная область тяжелой цепи включает следующие аминокислотные замены K3Q, E5V, M18L, K19R, S40A, E42G, М43К, R89K, Р90Т, I95V, T113L и L114V.

13. Антитело или его антигенсвязывающий фрагмент по п.1, 11 или 12, где указанное антитело или его антигенсвязывающий фрагмент выбирается из группы, включающей моноклональное антитело, Fab, F(ab')2, Fv, scFv и диатело.

14. Антитело или его антигенсвязывающий фрагмент по п.13, где указанное антитело является моноклональным антителом.

15. Нуклеиновая кислота, кодирующая антитело или его антигенсвязывающий фрагмент по любому из пп.1-14.

16. Вектор, обеспечивающий экспрессию антитела или его антигенсвязывающего фрагмента по пп.1-14, включающий нуклеиновую кислоту по п.15.

17. Фармацевтическая композиция для применения при лечении заболеваний, ассоциированных с воспалением или аутоиимунитетом, или рака, включающая терапевтически эффективное количество антитела или его антигенсвязывающего фрагмента по любому из пп.1-14, и фармацевтически приемлемый носитель.

18. Фармацевтическая композиция по п.17, где указанная композиция дополнительно включает соединение, которое представляет собой терапевтическое соединение и предпочтительно противораковый терапевтический агент или соединение, полезное для лечения уменьшения костной массы.

19. Антитело или его антигенсвязывающий фрагмент по п.1 для применения при лечении заболеваний, ассоциированных с повышенной активностью остеокластов.

20. Антитело или его антигенсвязывающий фрагмент по п.1, 13 или 14 для применения при лечении рака.

21. Антитело или его антигенсвязывающий фрагмент по п.1, 13 или 14 для применения для предотвращения или лечения метастатического рака кости у пациента, страдающего от метастатического рака.

22. Антитело или его антигенсвязывающий фрагмент по п.1, 13 или 14 для применения при лечении пациента, имеющего воспалительное заболевание кишечника.

23. Антитело или его антигенсвязывающий фрагмент по п.1, 13 или 14 для применения при лечении пациента, страдающего от ревматоидного артрита.



 

Похожие патенты:

Группа изобретений относится к биотехнологии, в частности к биосинтезу гидролазы пептидогликана, и представляет собой белок с активностью гидролазы пептидогликана, плазмиду, содержащую фрагмент, кодирующий гидролазу пептидогликана, бактерию-продуцент, способ микробиологического синтеза гидролазы пептидогликана, а также фармацевтическую композицию, содержащую полученную гидролазу пептидогликана, для терапии заболеваний, вызванных грамотрицательной микрофлорой.

Изобретение относится к области биохимии, в частности к композициям для интенсивной продукции целевого белка в эукариотических клетках, включающим ДНК-вектор со вставкой гена целевого белка и агонист клеточных рецепторов.

Изобретения относятся к химерным белкам, нуклеиновой кислоте, кодирующей такой белок, экспрессирующей кассете, обеспечивающей экспрессию нуклеиновой кислоты, вектора, включающего экспрессирующую кассету, способу диагностики и набора для диагностики.

Изобретение относится к области биотехнологии и иммунологии. Предложены антитела, направленные на интегрин α2β1, включая гуманизированные антитела к интегрину альфа-2 (α2), а также способы лечения антителами к интегрину α2.

Изобретение относится к области биотехнологии и иммунологии. Представлена клетка-хозяин Bordetella pertussis, Bordetella bronchiseptica или Bordetella parapertussis, которая используется в качестве адъюванта или для профилактики или лечения коклюша, имеющая сниженную активность эндогенной гликозилтрансферазы с по меньшей мере 98% идентичностью с аминокислотной последовательностью SEQ ID NO: 2 по сравнению с активностью гликозилтрансферазы соответствующего родительского штамма, где сниженная активность достигается применением инактивирующего вектора, который вызывает инактивацию экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, или приводит к сниженному уровню экспрессии последовательности эндогенной нуклеиновой кислоты, кодирующей гликозилтрансферазу, слиянием последовательности нуклеиновой кислоты, кодирующей гликозилтрансферазу, со слабым или индуцибельным промотором.

Изобретение относится к биотехнологии. Предложены варианты антиген-связывающего полипептида, специфичного к полипептиду LIGHT, характеризующиеся наличием вариабельной области тяжелой и легкой цепей, а также варианты конъюгатов на их основе для лечения заболевания или состояния.

Изобретение относится к области биотехнологии и иммунологии. Описаны биспецифические антитела против фактора роста сосудистого эндотелия человека VEGF и ангиопоэтина-2 человека ANG-2, способы их получения, фармацевтические композиции, содержащие указанные антитела, и их применения.

Изобретения относятся к области биотехнологии и касаются вектора, клетки-хозяина, содержащего вектор, генетически модифицированного микроорганизма Clostridium thermocellum, способа получения такого микроорганизма и способа преобразования лигноцеллюлозной биомассы в этанол.

Представленные изобретения касаются выделенного полинуклеотида, кодирующего полипептид, вовлеченный в биосинтез пирипиропена А, вектора и клетки-хозяина, включающих такой полипептид, и способов получения предшественников пирипиропена А, включающих культивирование клетки-хозяина.

Изобретение относится к области биотехнологии и иммунологии. Описано антитело и его функциональный фрагмент, специфически узнающее Siglec-15 человека и обладающее активностью ингибирования образования остеокластов.

Изобретение относится к биотехнологии. Предложены варианты антиген-связывающего полипептида, специфичного к полипептиду LIGHT, характеризующиеся наличием вариабельной области тяжелой и легкой цепей, а также варианты конъюгатов на их основе для лечения заболевания или состояния.

Настоящее изобретение относится к области биотехнологии. Предложен способ улучшения функциональных свойств антитела или его антигенсвязывающего фрагмента, у которых тяжелая цепь принадлежит семейству VH1b человека, предусматривающий проведение мутагенеза в каркасных остовах с заменой аминокислоты в положении 78 тяжелой цепи по системе нумерации AHo (в положении 67 по системе нумерации Кабата) на лейцин или изолейцин.

Изобретение относится к области биотехнологии и иммунологии. Описаны антитела и их функциональные эквиваленты, способные специфически связываться с RSV.

Изобретение относится к области иммунологии и биотехнологии. Описаны гуманизированное антитело и его антигенсвязывающий фрагмент (Fab), которые селективно связывают человеческий ИФН-γ и содержат вариабельный участок тяжелой цепи (VH) и вариабельный участок легкой цепи (VL), где VH и VL имеют последовательности аминокислот соответственно SEQ ID NO:1 и 2, представленные в описании.

Настоящее изобретение относится к области биотехнологии, конкретно к антагонистам гранулоцитарно-макрофагального колониестимулирующего фактора (GM-CSF), и может быть использовано в медицине.

Настоящее изобретение относится к области иммунологии. Предложены: антитело, связывающееся с интерлейкином-17 (ИЛ-17), характеризующееся 6 CDR из лёгкой и тяжёлой цепи, а также кодирующая нуклеиновая кислота и вектор для экспрессии указанного антитела.

Группа изобретений относится к медицине, а именно к офтальмологии, и может быть использована для лечения глазной болезни, ассоциированной со связанными с амилоидом-бета патологическими аномалиями/изменениями в тканях зрительной системы.

Настоящее изобретение относится к области иммунологии. Предложен полипептид, содержащий два связывающих фрагмента, представленных антителами, причем первый из них связывается с эпитопом СD3ε(эпсилон)-цепи человека и примата, не являющегося шимпанзе, в частности Callithrix jacchus, Saguinus oedipus и Saimirí sciureus, а второй - с EGFR, Her2/neu или IgE человека и/или примата, не являющегося шимпанзе, причем упомянутый эпитоп СD3ε включает аминокислотную последовательность Gln-Asp-Gly-Asn-Glu.

Настоящее изобретение относится к области биохимии. Предложено биспецифическое антитело, которое связывается как с фактором свертывания крови IX/активированным фактором свертывания крови IX, так и с фактором свертывания крови X, и функционально заменяет функцию фактора свертывания крови VIII.

Настоящее изобретение относится к области биохимии. Предложено биспецифическое антитело, которое связывается как с фактором свертывания крови IX/активированным фактором свертывания крови IX, так и с фактором свертывания крови X и функционально заменяет функцию фактора свертывания крови VIII.

Изобретение относится к области биотехнологии, конкретно к моноклональному антителу (mAb), и может быть использовано в медицине. Указанное антитело связывается с рецептором 2 IIIb фактора роста фибробластов (FGFR2IIIb) и содержит три CDR легкой и три CDR тяжелой цепи, представленные на фиг.13А и 13В, соответственно.
Наверх