Способ получения рекомбинантного полипептида

Представлены способ получения антитела, способ получения фармацевтического препарата, содержащего антитело, полученного указанным способом, молекула нуклеиновой кислоты, применение вектора, содержащего такую молекулу нуклеиновой кислоты, и применение клетки, в которую искусственно ввели указанные молекулу нуклеиновой кислоты или вектор в способе получения антитела. Представленный способ получения антитела предусматривает культивирование клетки, которая экспрессирует усиливающую продуцирование антитела последовательность (APES), которую искусственно вставляли в клетку и в которую была введена экзогенная ДНК, кодирующая желаемое антитело, с получением желаемого антитела, и где APES является молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, которая может связываться с ДНК или мРНК гена NfkBia, полученной из человека, мыши, крысы или хомячка спариванием оснований, и может супрессировать экспрессию гена NfkBia. Изобретения позволяют продуцировать антитело на высоком уровне с подавлением экспрессии NfkBia. 5 н. и 11 з.п. ф-лы, 29 ил., 8 пр.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ДАННОЕ ИЗОБРЕТЕНИЕ

[0001] Данное изобретение относится к способу получения рекомбинантного полипептида и, более конкретно, к способу получения рекомбинантного полипептида, эффективно использующему клетки животных, в которых была уменьшена экспрессия ингибитора α ядерного фактора κB (NfkBia).

ОБЛАСТЬ ТЕХНИКИ

[0002] При получении белков, применимых в качестве лекарственных средств, с использованием технологии рекомбинации генов, применение клеток животных делает возможными усложненные посттрансляционную модификацию и фолдинг (укладку), которые не могут выполнять прокариотические клетки. Таким образом, клетки животных часто используются в качестве клеток-хозяев для получения рекомбинантных белков.

[0003] В недавние годы было разработано большое количество биофармацевтических лекарственных средств, таких как антитела и физиологически активные белки. Способы, которые позволяют эффективно продуцировать рекомбинантные белки с использованием животных клеток, приводят к уменьшению стоимости биофармацевтических лекарственных средств и обещают их стабильную поставку для пациентов.

[0004] При этих обстоятельствах желаемым является способ получения белков с более высокой эффективностью получения.

[0005] NfkBia (IKBα, ингибитор α ядерного фактора κB),

который является аббревиатурой ингибитора альфа ядерного фактора энхансера гена полипептида легкой цепи каппа в В-клетках, участвует в активации NF-каппа B, фактора транскрипции, связанного с внутриклеточной передачей сигнала. NfkBia является одним из факторов, которые инактивируют NF-kappa B. Эта индуцируемая ядерная экспрессия новосинтезированного NfkBia отрицательно регулирует связывание ДНК и транскрипционные активности NF-kappa B (Непатентный документ 1). Далее, экспрессия некоторых генов, которые ингибируют пролиферацию клеток, таких как NfkBia, подавляется почти во всех опухолевых клетках мыши или человека. (Патентный Документ 2). NF-kappa B обычно существует в состоянии, в котором он связан с инактиватором, таким как NfkBia. При наличии различных стимуляторов NF-kappa B высвобождается из такого инактиватора, активируется и транслоцируется в ядро и связывается со специфической ДНК-последовательностью в районах промотор/энхансер различных генов-мишеней цитокина, факторов роста, адгезионных молекул, регуляторов гибели клеток и т.п. (5’-GGGACTTTCC-3’; эту последовательность ДНК называют NFκB-связывающей последовательностью, kB-мотивом, реагирующим на NFkB элементом или т.п. (SEQ ID NO: 35)), и таким образом NF-kappa B участвует в модуляции транскрипционных активностей (Непатентный Документ 3).

[0006] Между тем, совершенно не было известным, каким образом NfkBia связан с продуцирующей рекомбинантный белок способностью, а также не было известным поведение NfkBia в культивируемых клетках животных.

СПИСОК ЦИТИРУЕМЫХ МАТЕРИАЛОВ

НЕПАТЕНТНАЯ ЛИТЕРАТУРА

[0007] Непатентный Документ 1: Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates DNA-binding and transcriptional activities of NF-kappa B, Mol. Cell. Biol., May 1995, 2689-2696, Vol. 15, No. 5.

Непатентный Документ 2: From mice to humans: Identification of commonly deregulated genes in mammary cancer via comparative SAGE studies, Hu Y., Sun H., Drake J., Kittrell F., Abba M. C., Deng L., Gaddis S., Sahin A., Baggerly K., Medina D. and Aldaz C. M., Cancer Research 2004 64:21 (7748-7755).

Непатентный Документ 3: “New insights into the Role of Nuclear Factor-kappa B in Cell Growth Regulation”, American Journal of Pathology, 2001, Vol. 159, No. 2: 387-397.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

ТЕХНИЧЕСКАЯ ПРОБЛЕМА

[0008] Целью данного изобретения является обеспечение способа, способного продуцировать природный или рекомбинантный белок при высоком уровне.

РЕШЕНИЕ ПРОБЛЕМЫ

[0009] Авторы данного изобретения использовали культивируемые клеточные штаммы (штаммы клеток CHO), имеющие высокую способность продуцирования рекомбинантного антитела, для проведения исследований на генах, экспрессируемых явно в этих клеточных штаммах, в тщательных попытках достижения вышеуказанной цели. В результате, авторы этого изобретения идентифицировали один тип мРНК, не кодирующий РНК, которая узнается с использованием специфической последовательности мыши, в качестве зонда. Этот транскрипт соответствовал комплементарной цепи нетранслируемого района мРНК NfkBia. Далее, авторы данного изобретения обнаружили, что экспрессия в культивируемых рекомбинантных клетках молекулы нуклеиновой кислоты, состоящей из частичной последовательности этого транскрипта, явно увеличивает способность продуцирования этого рекомбинантного полипептида культивируемых клеток. Авторы данного изобретения обнаружили также, что экспрессия NfkBia подавлялась в высоко продуцирующих антитело клетках, в которых увеличивалась экспрессия этой не кодирующей РНК. Кроме того, авторы данного изобретения обнаружили, что эти культивируемые клетки, имеющие высокую способность продуцирования рекомбинантного антитела, подавляли экспрессию NfkBia в этих клетках. На основе этих открытий, авторы данного изобретения ожидали, что количество продукции желаемого полипептида может быть увеличено индукцией высокой экспрессии транскрипта, который регулирует экспрессию NfkBia в культивируемых клетках. Эти открытия привели к завершению данного изобретения.

[0010] Такие РНК или ДНК или их последовательность, которая имеют функцию увеличения способности продуцирования такого белка, как рекомбинантное антитело, увеличением их экспрессии в культивируемых клетках, совместно называются здесь как APES (Усиливающая Продуцирование Антитела Последовательность) (также называются PPES (Усиливающая Продуцирование Полипептида Последовательность) в некоторых случаях).

[0011] Авторы данного изобретения предположили, что APES (или PPES) могли бы регулировать экспрессию NfkBia в культивируемых клетках, усиливая посредством этого активность NF-kappa B и, следовательно, увеличивая продуцирующую рекомбинантный полипептид способность. Предполагается, что NF-kappa B, имеющий усиленную активность, мог бы транслоцироваться в ядро, увеличивать экспрессию генов, связанных с иммунитетом, воспалением и анти-апоптозом (например, Bcl-2, Bcl-xL, IAP (Ингибиторов Белков Апоптоза)) и способствовать росту этих клеток, поддержанию коэффициента выживаемости этих клеток и т.п.

[0012] Кроме того, множество NF-kappa B-связывающих последовательностей существуют в районах промотор/энхансер обычных плазмид для экспрессии гена, кодирующего рекомбинантный белок или пептид, такой как антитело. Таким образом, предполагается также, что NF-kappa B, который был транслоцирован в ядро, мог бы усиливать промоторную активность экспрессионных плазмид и способствовать более высокому продуцированию антител. Например, в случае промотора MCMV, такие NF-kappa B-связывающие последовательности существуют в восьми сайтах в полученной из цитомегаловируса мыши последовательности (DD434486) и в трех сайтах в полученной из цитомегаловируса человека последовательности (DI097553).

[0013] Данное изобретение суммируется следующим образом:

(1) Способ получения полипептида, предусматривающий культивирование клетки, которая экспрессирует APES и в которую была введена ДНК, кодирующая желаемый полипептид, с получением посредством этого желаемого полипептида.

(1-1) Способ по (1), где эта клетка является сильно экспрессирующей APES клеткой.

(2) Способ по (1), где эта APES является молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, которая может связываться с ДНК или мРНК гена NfkBia, полученной из человека, мыши, крысы или хомячка спариванием оснований, и посредством этого может подавлять экспрессию гена NfkBia.

(3) Способ по (2), где эта APES является малой РНК с длиной самое большее 30 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которые могут связываться с частью мРНК NfkBia спариванием оснований.

(4-1) Способ по (2), где эта APES является некодирующей РНК мРНК-типа с длиной самое большее 561 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований.

(4) Способ по (2), где эта APES является некодирующей РНК мРНК-типа с длиной самое большее 500 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований.

(5-1) Способ по (2), где эта APES является некодирующей РНК мРНК-типа с длиной 561-1579 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований.

(5) Способ по (2), где эта APES является некодирующей РНК мРНК-типа с длиной 500-1000 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований.

(6) Способ по любому из (3)-(5), где эта непрерывная последовательность с длиной 19-25 нуклеотидов является любой частичной последовательностью в последовательности нуклеотидов, представленной SEQ ID NO: 2.

(7-1) Способ по (6), где эта APES выбрана из молекул нуклеиновых кислот, каждая из которых содержит любую из следующих нуклеотидных последовательностей:

(a) ДНК, состоящей из нуклеотидной последовательности любой из SEQ ID NO: 1-16 и 29;

(b) ДНК, которая содержит вышеупомянутую последовательность (а) и является частичной последовательностью 3’-нетранслируемого района гена NfkBia;

(c) ДНК, состоящей из нуклеотидной последовательности, идентичной вышеупомянутым (a) или (b), за исключением одного или нескольких нуклеотидов;

(d) РНК, которая является транскриптом вышеупомянутых (a), (b) или (c); и

(e) ДНК или РНК, состоящей из последовательности, которая может связываться с вышеупомянутой последовательностью (a) спариванием оснований.

(7) Способ по (6), где эта APES выбрана из молекул нуклеиновых кислот, каждая из которых содержит любую из следующих нуклеотидных последовательностей:

(a) ДНК, состоящей из нуклеотидной последовательности любой из SEQ ID NO: 4-16;

(b) РНК, которая является вышеупомянутым транскриптом;

(c) ДНК, состоящей из нуклеотидной последовательности, идентичной вышеупомянутой последовательности (а), за исключением одного нуклеотида;

(d) РНК, которая является вышеупомянутым транскриптом (c); и

(e) ДНК или РНК, состоящих из последовательности, которая может связываться с вышеупомянутой последовательностью (a) спариванием оснований.

(8) Способ по (1), где экзогенная ДНК, кодирующая желаемый полипептид, была введена в эту клетку и APES была искусственно введена в эту клетку.

(9) Способ по (8), где клетка, в которую была искусственно введена APES, является клеткой, трансфицированной этой APES.

(10) Способ по (8), где клетка, в которую была введена APES, является клеткой, в которой была активирована транскрипция эндогенной APES.

(11) Способ по (8), где ДНК, кодирующую транспортер таурина, была дополнительно введена в эту клетку.

(12) Способ по (8), где ДНК, кодирующую декарбоксилазу цистеинсульфиновой кислоты, была дополнительно введена в эту клетку.

(13) Способ по (8), где ДНК, кодирующую аланинтрансферазу, была дополнительно введена в эту клетку.

(14) Способ по (1), где этот полипептид является антителом.

(15) Способ по (8), где эта клетка является клеткой яичника Китайского хомячка.

(16) Способ получения фармацевтического препарата, содержащего полипептид, полученный по любому из вышеупомянутых способов.

(17) Молекула нуклеиновой кислоты (APES или PPES), которая содержит любую из следующих нуклеотидных последовательностей и имеет активность APES, при условии, что исключена молекула нуклеиновой кислоты SEQ ID NO: 1:

(a) ДНК, состоящую из нуклеотидной последовательности любой из SEQ ID NO: 2-16 и 29;

(b) ДНК, которая содержит последовательность (а) и является частичной последовательностью 3’-нетранслируемого района гена NfkBia;

(c) ДНК, состоящую из нуклеотидной последовательности, идентичной последовательности любой из SEQ ID NO: 1-16 и 29 или последовательности (b), за исключением одного или нескольких нуклеотидов;

(d) РНК, которая является вышеупомянутым транскриптом (a), (b) или (c); или

(e) ДНК или РНК, состоящую из последовательности, которая может связываться с вышеупомянутой последовательностью (a) спариванием оснований.

(18) Вектор, содержащий молекулу нуклеиновой кислоты по вышеупомянутому (17).

(19) Клетка, в которую были искусственно введены молекула нуклеиновой кислоты по вышеупомянутому (17) или вектор по вышеупомянутому (18).

ПРЕИМУЩЕСТВЕННЫЕ ЭФФЕКТЫ ИЗОБРЕТЕНИЯ

[0014] Данное изобретение делает возможным эффективное получение рекомбинантных белков.

КРАТКОЕ ОПИСАНИЕ ФИГУР

[0015] Фигура 1 показывает последовательность идентифицированного транскрипта AI462015 и его местоположение на геноме мыши.

Фигура 2 показывает интенсивность экспрессии транскрипта AI462015 на 3-й день субкультуры антитело-продуцирующей клетки, полученной экспрессией Mab1 (анти-IL-6 рецептор-антитела) при высоком уровне в клетке CHO-DG44.

Фигура 3 показывает интенсивность экспрессии транскрипта AI462015 на 3-й день субкультуры антитело-продуцирующей клетки, полученной экспрессией Mab2 (антиглипикан 3-антитела) при высоком уровне в клетке CHO-DXB11s.

Фигура 4 показывает интенсивность экспрессии транскрипта AI462015 на 3-й день в культуре с подпиткой в 1-литровом сосуде Mab2 (антиглипикан 3-антитела)-продуцирующих клеток.

Фигура 5 показывает интенсивность экспрессии транскрипта AI462015 на 13-й день в последней стадии культуры с подпиткой в 1-литровом сосуде Mab2-продуцирующих клеток.

Фигура 6 показывает интенсивность экспрессии транскрипта AI462015 на 3-й день в культуре с подпиткой в 1-литровом сосуде клеток, которые имели низкий потенциал продуцирования Mab1 (анти-IL-6-рецептор-антитела).

Фигура 7 показывает экспрессионную плазмиду частичной последовательности 434 п.н. транскрипта AI462015 (437 п.н.).

Фигура 8 показывает экспрессионную плазмиду частичной последовательности 165 п.н. транскрипта AI462015 (437 п.н.).

Фигура 9 показывает плазмиду, в которой в качестве контроля экспрессировался только ген устойчивости к гигромицину.

Фигура 10 показывает, что количество продуцирования Mab1 увеличивается частичными последовательностями транскрипта (437 п.н.).

Фигура 11 показывает сильную экспрессию транскрипта AI462015 и супрессированную экспрессию NfkBia в высокопродуцирующих антитело клетках.

Фигура 12 показывает набор зондов, используемый для количественного измерения экспрессии NfkBia.

Фигура 13 показывает результат количественного измерения супрессированной экспрессии NfkBia в высокопродуцирующих антитело клетках.

Фигура 14 показывает восемь NfkB-связывающих сайтов промотора IE2 CMF (SEQ ID NO: 23) (эти сайты подчеркнуты).

Фигура 15 является схемой способа для анализа экспрессии микроРНК.

Фигура 16 показывает продукты ПЦР, полученные из микроРНК, которые были экспрессированы при высоких уровнях в высокопродуцирующих антитело клетках.

Фигура 17 показывает плазмиды pPur-APES165 и pPur-ALT1, которые использовали для коэкспрессии частичной последовательности 165bp транскрипта AI642048 (437 п.н.) и коэкспрессии ALT1, соответственно, в pHyg-TAUT-экспрессирующих клетках.

Фигура 18 показывает результат культуры с подпиткой в шейкере, который показывает высокий эффект роста клеток и высокий эффект продуцирования антитела, которые происходили из сильной экспрессии APES.

Фигура 19 показывает результат культуры с подпиткой в 1-литровом сосуде, который показывает высокий эффект роста клеток и высокий эффект продуцирования антитела, которые происходили из сильной экспрессии APES.

Фигура 20 показывает корреляцию между уровнем экспрессии APES сильно экспрессирующих APES165 кандидатных клеток-хозяев (девяти штаммов) и плотностью их жизнеспособных клеток.

Фигура 21 показывает, что количество продуцирования Mab1 увеличивается сильной экспрессией частичных последовательностей частичной последовательности APES165 транскрипта AI462015 (437 п.н.).

Фигура 22 показывает, что частичные последовательности APES165, которые, как было обнаружено, имеют эффект высокого продуцирования антител, как показано на Фигуре 21, содержат комплементарную Nfkbia последовательность.

Фигура 23 показывает, что AI462015 является комплементарной цепью мРНК Nfkbia мыши (Пример 8).

Фигура 24 показывает, что имеется гомологичная последовательность AI462015 на геноме клеток CHO-K1 (Example 8).

Фигура 25а показывает, что частичная последовательность (нуклеотиды 7-91 от 5’-конца) AI462015 является консервативной независимо от вида.

Фигура 25b показывает, что частичная последовательность (нуклеотиды 7-91 от 5’-конца) AI462015 является консервативной независимо от вида.

Фигура 25c показывает, что частичная последовательность (нуклеотиды 7-91 от 5’-конца) AI462015 является консервативной независимо от вида.

Фигура 25d показывает, что частичная последовательность (нуклеотиды 7-91 от 5’-конца) AI462015 является консервативной независимо от вида.

Фигура 25е показывает, что частичная последовательность (нуклеотиды 7-91 от 5’-конца) AI462015 является консервативной независимо от вида.

ОПИСАНИЕ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

[0016] Варианты осуществления данного изобретения описаны ниже более подробно.

[0017] (1) APES (Усиливающая Продуцирование Антитела Последовательность)

Данное изобретение обеспечивает способ получения полипептида, предусматривающий культивирование клетки, которая экспрессирует APES и в которую была введена ДНК, кодирующая желаемый полипептид, с получением посредством этого желаемого полипептида.

[0018] Как подробно описано в Примерах ниже, авторы данного изобретения обнаружили некодирующую РНК мРНК-типа с увеличенным уровнем экспрессии, коррелируемым с антитело-продуцирующей способностью в культивируемых СНО-клетках, и авторы этого изобретения идентифицировали некодирующую РНК мРНК-типа в виде транскрипта из 437 нуклеотидов в геноме мыши (Фигура 1; GenBank Accession ID: AI462015; SEQ ID NO: 1). Эта последовательность AI462015 и ее местоположение на геноме мыши показаны на Фигуре 1. Эта последовательность AI462015 существует на комплементарной цепи вблизи 3’-нетранслируемого района NfkBia (ингибитора α ядерного фактора κB) мРНК генома мыши (Примечание: Последующее обновление информации, выдаваемое GeneBank, выявило, что этот 437-нуклеотидный транскрипт AI462015 соответствует комплементарной цепи 3’-нетранслируемого района (513 нуклеотида) мРНК NfkBia мыши (Фигура 23)).

[0019] Кроме того, авторы этого изобретения обнаружили, что количество продуцирования желаемого полипептида может быть увеличено введением молекул нуклеиновых кислот, каждая из которых имеет произведенную из AI462015 частичную последовательность, в клетки-хозяева для возможности осуществления этой экспрессии.

[0020] Авторы этого изобретения предположили, что эти молекулы нуклеиновых кислот могут регулировать экспрессию NfkBia в культивируемых клетках, усиливая посредством этого активность Nf-kappa B и, следовательно, увеличивая продуцирующую рекомбинантный белок способность. Конкретно, авторы этого изобретения предположили, что NF-kappa B, имеющий усиленную активность, мог бы транслоцироваться в ядро, увеличивать экспрессию генов, связанных с иммунитетом, воспалением и анти-апоптозом (например, Bcl-2, Bcl-xL, IAP (Ингибиторов Белков Апоптоза)) и способствовать росту этих клеток, поддержанию коэффициента выживаемости этих клеток и т.п.

[0021] Авторы этого изобретения назвали совместно APES (Усиливающей Продуцирование Антитела Последовательность) (также называемой PPES (Усиливающей Продуцирование Полипептида Последовательностью) (в некоторых случаях) РНК или ДНК или их последовательность, которая имеет следующие функции, обеспечиваемые их собственной экспрессией или увеличенной экспрессией в культивируемых клетках: регуляцию экспрессии NfkBia в культивируемых клетках и посредством этого усиление активности Nf-kappa B и увеличение способности продуцировать желаемый рекомбинантный полипептид, такой как рекомбинантное антитело, и которая предпочтительно не кодирует белки.

[0022] Предыдущая произведенная из AI462015 последовательность или ее частичная последовательность является консервативной не только в грызунах, таких как мышь или хомячок, но также в человеке и, как считается, является также высококонсервативной последовательностью в других млекопитающих и животных, таких как рыба и насекомые. Таким образом, частичная последовательность 3’-нетранслируемого района мРНК NfkBia, полученной из различных клеток животных, или последовательность, комплементарная этой последовательности, (эта частичная последовательность и эта комплементарная последовательность соответствуют произведенной из AI462015 последовательности или ее частичной последовательности) также могут быть использованы в качестве APES-последовательностей данного изобретения.

[0023] В одном варианте осуществления, часть последовательности APES содержит комплементарную Nfkbia последовательность или является комплементарной Nfkbia последовательностью, и этот признак приводит к супрессии экспрессии Nfkbia в APES-экспрессирующих клетках. Эта супрессия стимулирует функцию продуцирования антитела и т.п. при высоких уровнях.

[0024] В одном варианте осуществления, APES является молекулой нуклеиновой кислоты, которая интерферирует с мРНК NfkBia (RNA-интерференция) и которая имеет сама функцию связывания с мРНК NfkBia в клетке для отрицательной регуляции экспрессии мРНК. Это увеличение внутриклеточного уровня экспрессии APES приводит к супрессированной экспрессии функции NfkBia и посредством этого увеличивает уровень экспрессии генов антител и дополнительно продуцирует рекомбинантный полипептид, такой как антитело, при высоких уровнях.

[0025] Таким образом, APES может быть следующей последовательностью, содержащей последовательность, которая может связываться с ДНК или мРНК гена NfkBia спариванием оснований: двухцепочечной РНК (dsRNA) или siRNA, которая является короткой dsRNA, или siRNA, диссоциированной на отдельные цепи, или shRNA, антисмысловой ДНК или РНК, микроРНК (miRNA) или некодирующей РНК типа мРНК.

[0026] Например, эта последовательность APES может быть олигонуклеотидом, состоящим из последовательности, содержащей частичную последовательность, комплементарную мРНК-мишени NfkBia. Такой олигонуклеотид является, например, miRNA, которая является последовательностью, соответствующей 19-25 нуклеотидам в комплементарной цепи мРНК NfkBia, или последовательностью, идентичной вышеуказанной последовательности, за исключением одного олигонуклеотида, и которая проявляет эффект супрессии экспрессии NfkBia. Альтернативно, APES может быть длинной цепью, некодирующей РНК типа мРНК, и может быть, например, такой РНК, которая состоит из последовательности с длиной 561 нуклеотидов (561-мер) или с длиной самое большее 500 нуклеотидов (500-мер), содержащей последовательность, способную связываться с ДНК или мРНК гена NfkBia спариванием оснований, и которая проявляет эффект супрессии экспрессии NfkBia. Альтернативно, APES может быть более длинной цепью (сотнями - сотнями тысяч нуклеотидов), некодирующей РНК мРНК-типа. Например, APES может быть молекулой нуклеиновой кислоты или последовательностью с длиной 200-100000 нуклеотидов или с длиной 300-300000 нуклеотидов.

[0027] Последовательность, которая может связываться спариванием оснований, не ограничивается последовательностью полного спаривания (т.е. 100% комплементарной последовательностью), и присутствие неспаривающихся нуклеотидов является также приемлемым, пока они не интерферируют с ее функциями (т.е. не мешают ее функциям). Предпочтительной является скорее частичная комплементация, зависящая от формы APES. Таким образом, например, последовательность, которая является по меньшей мере на 70%, более предпочтительно на 80%, еще более предпочтительно на 90%, наиболее предпочтительно на 95% гомологичной генетической ДНК или мРНК, содержащей нетранслируемый район NfkBia, или последовательность, комплементарная вышеуказанной последовательности, также включена в термин “последовательность, которая может связываться спариванием оснований”. Например, что касается некодирующей РНК мРНК-типа, 561-мера или 500-мера, по меньшей мере 90% гомологичная последовательность включает в себя мутантные последовательности, которые содержат 1-50 ошибочно спаренных нуклеотидов (или 1-56 ошибочно спаренных нуклеотидов в случае РНК 561-мера), происходящих из инсерции, делеции или точковой мутации нуклеотидов, и которые имеют функцию увеличения способности продуцирования рекомбинантного полипептида, такого как антитело, в ассоциации с экспрессией самих мутантных последовательностей в клетках-хозяевах, или функцию супрессии экспрессии NfkBia. Таким образом, предполагается, что последовательность, произведенная из ортолога NfkBia (ксеногенного гомологичного гена), которая имеет некоторую степень сходства последовательности (например, по меньшей мере 70% гомологию) и произведена из вида, отличающегося от клетки-хозяина, также может быть использована в качестве APES.

[0028] Альтернативно, эта последовательность, которая может связываться спариванием оснований, включает в себя последовательность, которая может связываться с мРНК NfkBia при таких условиях, как внутриклеточные условия. Такая последовательность включает в себя, например, последовательность, которая гибридизуется при условиях, известных квалифицированному в данной области специалисту как условия высокой строгости, и которая имеет желаемые функции. Одним примером условий высокой строгости является инкубирование полинуклеотида и другого полинуклеотида в гибридизационном буферном растворе, содержащем 6 × SSPE или SSC, 50% формамид, 5 × реагент Денхардта, 0,5% ДСН и 100 мкг/мл фрагментированной, денатурированной ДНК спермы лосося, при температуре гибридизации 42°C в течение 12-16 часов (один из этих полинуклеотидов может быть прикреплен к поверхности, такой как твердая поверхность, например, мембрана) и последующие промывки полученного материала промывочным буферным раствором, содержащим 1 × SSC и 0,5% ДСН при оптимальной температуре 42°C или более высокой. В отношении других конкретных условий, можно сослаться на многочисленные экспериментальные руководства, которые хорошо известны квалифицированному в данной области специалисту, такие как Sambrook et al., “Molecular Cloning: A Laboratory Manual (3rd Edition)”, Cold Spring Harbor Laboratory Pr; и Ausubel et al., “Current Protocols in Molecular Biology”, Maruzen Co., Ltd.

[0029] Новая молекула нуклеиновой кислоты, имеющая активность APES, или молекула нуклеиновой кислоты, имеющая комплементарность последовательности с этой молекулой, является важным признаком данного изобретения.

[0030] В одном варианте осуществления, APES является молекулой нуклеиновой кислоты, имеющей функцию супрессии экспрессии NfkBia или увеличения продуцирования рекомбинантного полипептида, и является РНК или ДНК, которые могут связываться с ДНК или мРНК гена NfkBia, произведенных из человека, мыши, крысы или хомячка, спариванием оснований. Предполагается, что такая молекула нуклеиновой кислоты содержит последовательность, гомологичную или комплементарную мРНК, кодирующей NfkBia, и может связываться с геном или мРНК NfkBia и ингибировать его экспрессию.

[0031] В одном варианте осуществления, APES является малой РНК с длиной 19-25 нуклеотидов, содержащей последовательность, комплементарную части мРНК NfkBia, или малой РНК, которая имеет последовательность, идентичную этой последовательности, за исключением одного нуклеотида, и имеет функцию супрессии экспрессии NfkBia или увеличения продуцирования рекомбинантных полипептидов. Эта малая РНК обозначает в данном контексте малую некодирующую РНК (snRNA), и snRNA включает в себя miRNA.

[0032] В одном варианте осуществления, APES является некодирующей РНК мРНК-типа с длиной самое большее 561 нуклеотид, которая содержит последовательность, комплементарную части мРНК NfkBia (например, эта последовательность является малой некодирующей РНК-последовательностью, описанной выше).

[0033] В одном варианте осуществления, APES является некодирующей РНК мРНК-типа с длиной 561-1579 нуклеотидов, которая содержит последовательность, комплементарную части мРНК NfkBia (например, эта последовательность является малой некодирующей РНК-последовательностью, описанной выше).

[0034] Один специфический пример APES, который был обнаружен в транскрипте в клетках CHO, имеет произведенную из AI462015 мыши частичную последовательность или такую частичную последовательность, в которой один или несколько нуклеотидов были заменены, делетированы или добавлены. В частности, включены ДНК-последовательность из 165 нуклеотидов, которая состоит из нуклеотидной последовательности между G в нуклеотиде 4 и С в нуклеотиде 168 от 5’-конца (SEQ ID NO: 2, APES165); комплементарной (антисмысловой) ДНК-последовательности из этой ДНК-последовательности; последовательности, содержащей РНК-последовательность, транскрибируемую из этих ДНК; или частичной последовательности любой длины в этой последовательности. Альтернативно, включена также ДНК-последовательность из 434 нуклеотидов, которая состоит из нуклеотидной последовательности между G в нуклеотиде 4 от 5’-конца и Т в 3’-конце (SEQ ID NO: 3, APES34); комплементарной (антисмысловой) ДНК-последовательности этой ДНК-последовательности; последовательности, содержащей РНК-последовательность, транскрибируемую из этих ДНК; или частичной последовательности любой длины, произведенной из этой последовательности. Включена также нуклеотидная последовательность, содержащая последовательность, полученную из млекопитающего, такого как человек, хомячок или крыса, которая соответствует последовательности AI462015 мыши; частичная последовательность, содержащая полученную из млекопитающего последовательность; или такая частичная последовательность, в которой один или несколько нуклеотидов были заменены, делетированы или добавлены.

[0035] В одном варианте осуществления, APES имеет нуклеотидную последовательность между нуклеотидами 4 и 133 от 5’-конца (SEQ ID NO: 4, APES130) в AI462015 или частичную последовательность, произведенную из этой последовательности. Например, включена ДНК-последовательность между нуклеотидами 4 и 68 от 5-конца (SEQ ID NO: 5, APES4-68) или ДНК-последовательность между нуклеотидами 69 и 133 от 5’-конца (SEQ ID NO: 6, APES69-133) или их комплементарная ДНК-последовательность или последовательность, транскрибируемая из этих ДНК.

[0036] В одном варианте осуществления, APES имеет последовательность из 52 нуклеотидов между нуклеотидами 40 и 91 от 5’-конца (SEQ ID NO: 7) в AI462015 или последовательность, произведенную из частичной последовательности, полученной отщеплением 52 нуклеотидов в любом местоположении. Например, включена ДНК-последовательность первой части (29 нуклеотидов APES40-68, 24 нуклеотида APES40-63 или 22 нуклеотида APES40-61) или последней части (23 нуклеотида APES69-91), или их комплементарная ДНК-последовательность (соответствующая SEQ ID NO: 8-11, соответственно), или последовательность, транскрибируемая из этих ДНК.

[0037] Эти 52 нуклеотида, описанные выше, являются последовательностью, идентичной последовательности комплементарной цепи 3’-нетранслируемого района гена NfkBia крысы, за исключением одного нуклеотида. 5’-24 нуклеотида (APES40-63, SEQ ID NO: 9) являются последовательностью, идентичной последовательности 3’-нетранслируемого района гена NfkBia человека. Эти 5’-22 нуклеотида (APES40-61, SEQ ID NO:10: AAGTACCAAAATAATTACCAAC) являются последовательностью, идентичной последовательности комплементарной цепи 3’-нетранслируемого района мРНК NfkBia независимо от вида, такого как крыса, макак резус, собаки и лошади. Ожидается что RNAi-эффект будет проявляться экспрессией в клетках-хозяевах частичной последовательности, комплементарной 3’-нетранслируемому району гена NfkBia. Например, возможно, что РНК, имеющая последовательность, комплементарную 19-25 нуклеотидам из вышеуказанных 52 нуклеотидов, будет действовать как микроРНК (miRNA) на нетранслируемом районе мРНК NfkBia, интерферируя посредством этого с процессом трансляции.

[0038] Альтернативно, APES имеет последовательность из 85 нуклеотидов между нуклеотидами 7 и 91 от 5’-конца (SEQ ID NO: 29) в AI462015 или последовательность, произведенную из частичной последовательности, полученной отщеплением 85 нуклеотидов в любом местоположении. Возможно, что РНК, имеющая последовательность, комплементарную 19-25 нуклеотидам из вышеуказанных 85 нуклеотидов, будет действовать как микроРНК (miRNA) на нетранслируемом районе мРНК NfkBia, интерферируя посредством этого с процессом трансляции.

[0039] В одном варианте осуществления, APES имеет последовательность, найденную в поиске на siRNA из 21 нуклеотидов. Примеры включают в себя miRNA-последовательности, содержащие последовательность, комплементарную ДНК-последовательности между нуклеотидами 84 и 104 (SEQ ID NO: 12, APES84-104) в AI462015, ДНК-последовательность между нуклеотидами 99 и 119 (SEQ ID NO: 13, APES99-119) или ДНК-последовательность между нуклеотидами 101 и 121 (SEQ ID NO: 14, APES101-121). Последовательность между нуклеотидами 71 и 112 (SEQ ID NO: 16) в вышеуказанной APES 69-133 является районом, который был определен количественно на GeneChip и действительно экспрессировался на высоком уровне. Таким образом, предполагается, что существует высокая вероятность того, что APES84-104 может функционировать как мРНК.

[0040] Кроме того, на основе структурного или функционального признака APES, новая молекула нуклеиновой кислоты, имеющая APES-активность, может быть синтезирована химически или выделена из биологических источников. Структурным признаком APES является то, что она является молекулой нуклеиновой кислоты, содержащей последовательность, комплементарную части мРНК NfkBia (мишени). Эта молекула нуклеиновой кислоты может находиться в любой форме, независимо от того, является ли она ДНК, ДНК-транскриптом, мРНК или кДНК, экзосомной РНК, химически синтезированной одноцепочечной РНК или химически синтезированной двухцепочечной РНК. Функциональным признаком является увеличение способности продуцировать рекомбинантный полипептид, такой как антитело, или супрессия экспрессии NfkBia, в ассоциации с экспрессией APES в клетках-хозяевах.

[0041] Если APES выделена из биологического источника, она может быть получена из любого живого организма без какого-либо конкретного ограничения. Конкретные примеры включают в себя APES, полученные из животных, включающих в себя приматов, таких как человек и шимпанзе; грызунов, таких как мышь, крыса и хомячок; скот, например, крупный рогатый скот, свинья и коза; птицы, такие как курица; рыба, такая как рыба-зебра; насекомых, таких как муха; нематоду; и т.п. APES предпочтительно получают из человека, грызуна или того же самого вида, к которому принадлежит клетка-хозяин. Например, когда сильно APES-экспрессирующей клеткой является клетка яичника Китайского хомячка (CHO-клетка), APES предпочтительно получают из человека, мыши или хомячка.

[0042] Такая молекула нуклеиновой кислоты может быть получена способом, известным квалифицированному в данной области специалисту. Например, эта молекула нуклеиновой кислоты может быть получена в соответствии со следующими процедурами: получением общей РНК из культивируемых клеток, которые продуцировали рекомбинантный полипептид, такой как антитело, на высоком уровне, синтезом олигонуклеотида на основе последовательности нуклеиновой кислоты этого изобретения (например, APES165 SEQ ID NO: 2), и проведением ПЦР с использованием этого олигонуклеотида в качестве праймера для амплификации кДНК, имеющей признаки APES. Далее, после получения малой РНК из культивируемых клеток, которые продуцировали рекомбинантный полипептид, такой как антитело, на высоком уровне, может быть получена кДНК-библиотека для получения малой РНК, содержащей частичную последовательность, комплементарную мРНК NfkBia на основе этой нуклеотидной последовательности клонированной кДНК. Эта кДНК-библиотека может быть также сконструирована способом, описанным, например, в Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989), после получения малой РНК, такой как микроРНК (miRNA).

[0043] Кроме того, APES-экспрессирующая геномная ДНК может быть выделена определением нуклеотидной последовательности полученной кДНК и скринингом библиотеки геномной ДНК с использованием этой кДНК в качестве зонда.

[0044] Конкретно, могут быть использованы следующие процедуры: сначала общую РНК выделяют из клеток, тканей или т.п., которые, вероятно, экспрессируют APES данного изобретения; для этого выделения мРНК используют известный способ, такой как способ ультрацентрифугирования с использованием гуанидина (Chirgwin, J. M. et al., Biochemistry (1979) 18, 5294-5299) или AGPC-способ (Chomczynski, P. and Sacchi, N., Anal. Biochem. (1987) 162, 156-159) для получения общей РНК и затем эту общую РНК дополнительно очищают с использованием мининабора RNeasy Mini Kit (QIAGEN) или т.п.

[0045] Из этой полученной общей РНК кДНК синтезируют с использованием обратной транскриптазы. кДНК может быть также синтезирована с использованием Обратной Транскриптазы SuperScriptТМ II (Invitrogen) или т.п. Можно также синтезировать и амплифицировать кДНК в соответствии со способом 5’-RACE (Frohman, M. A. et al., Proc. Natl. Acad. Sci. U.S.A. (1988) 85, 8998-9002; Belyavsky, A. et al., Nucleic Acids Res. (1989) 17, 2919-2932) с использованием набора 5’-Ampli FINDER RACE Kit (Clontech) и полимеразной цепной реакции (PCR) с праймером и т.п.

[0046] Представляющий интерес фрагмент ДНК получают из полученного ПЦР-продукта и лигируют с векторной ДНК для получения посредством этого рекомбинантного вектора. Этот вектор вводят в E. coli или т.п. и затем полученные колонии отбирают для получения желаемого рекомбинантного вектора. Нуклеотидная последовательность представляющей интерес ДНК может быть подтверждена известным способом, таким как способ терминации цепи с использованием дидезоксинуклеотида.

[0047] Полученная ДНК может быть модифицирована с использованием коммерчески доступного набора или известного способа. Такой модификацией является, например, введение полиморфизма единственного нуклеотида с использованием способа сайт-направленного мутагенеза, или т.п. Модифицированные таким образом последовательности также включены в объем данного изобретения, пока они имеют активность APES.

[0048] В данном контексте, фраза “имеют (имеющие) активность APES” относится к наличию действия супрессии экспрессии NfkBia в культивируемой клетке-хозяине для активации тем самым Nf-kappa B и увеличения посредством этого продуцирующей рекомбинантный полипептид способности. Эта фраза относится однозначно к наличию функции супрессии экспрессии NfkBia посредством экспрессии в клетке субъекта.

[0049] В некоторых случаях, молекула нуклеиновой кислоты, имеющая активность APES, называется здесь молекулой нуклеиновой кислоты данного изобретения.

[0050] (2) Экспрессия APES

В этом изобретении было обнаружено, что с использованием APES-экспрессирующих клеток, предпочтительно сильно экспрессирующих APES клеток, увеличивается количество полипептидов, продуцируемых этими клетками.

[0051] Сильно экспрессирующая APES клетка обозначает клетку, в которую была искусственно введена APES с использованием вектора или т.п., и сильнaя экспрессия APES означает, что уровень экспрессии APES был увеличен в сравнении с первоначальной клеткой, в которую еще не был введен ген антитела. Примеры первоначальных клеток включают в себя, но не ограничиваются конкретно ими, клетки для применения в качестве хозяев (например, клетки CHO) в получении рекомбинантных белков. Если это объясняется со ссылкой на описанные далее Примеры, конкретным примером является следующее: в эксперименте с GeneChip с использованием массива олигонуклеотидов, производимого AFFYMETRIX, Inc. (Affymetrix MOUSE430_2), величины сигнала AI462015 равны 2000 или менее в первоначальных клетках, в которые еще не был введен ген антитела. Увеличение уровня экспрессии APES в сравнении с этими величинами означает, что величина сигнала AI462015, например, является в два раза или более высокой, чем эти величины.

[0052] Сильно экспрессирующая APES клетка содержит эндогенную или экзогенную APES в клетке. Примеры сильно экспрессирующих APES клеток включают в себя клетки, в которые была искусственно введена APES.

[0053] Клетка, в которую была искусственно введена APES, может быть получена способом, известным квалифицированному в данной области специалисту. Например, эта клетка может быть получена включением APES-кодирующей ДНК-последовательности в вектор и трансформацией этого вектора в клетку.

[0054] Клетка, в которую была искусственно введена APES, как описано здесь, дополнительно включает в себя клетки, в которых эндогенная APES была активирована технологией активации генов (см., например, проспект Международной Публикации № WO 94/12650), которая показала результаты сильной экспрессии APES.

[0055] Типичным примером эндогенной APES является APES в виде ДНК-последовательности, кодируемой в геноме клетки-хозяина. В данном изобретении, могут быть также использованы клетки, в которых после введения гена антитела активировалась транскрипция этой эндогенной APES, так как некий фактор без использования какой-либо технологии активации гена, привел к сильной экспрессии.

[0056] Вектор, в который была инсертирована APES-кодирующая ДНК-последовательность, также находится в объеме этого изобретения. Этот вектор данного изобретения применим для удерживания молекулы нуклеиновой кислоты данного изобретения в клетке-хозяине или вне клетки-хозяина и экспрессии молекулы нуклеиновой кислоты данного изобретения. Вектор данного изобретения применим также для позволения клетке-хозяину сильно экспрессировать APES. Посредством позволения клетке-хозяину сильно экспрессировать APES, количество желаемого полипептида, продуцируемое этой клеткой-хозяином, может быть увеличено.

[0057] Например, при использовании E. coli в качестве клетки-хозяина предпочтительно, чтобы этот вектор имел сайт инициации репликации “ori” для амплификации в E. coli (например, JM109, DH5α, HB101, XL1Blue) для достижения амплификации и получения большого количества вектора в E. coli или т.п., а также имел ген для селекции (отбора) трансформированной E. coli (например, ген устойчивости к лекарственному средству, который делает возможной различение, с использованием какого-либо лекарственного средства (ампициллина, тетрациклина, канамицина, хлорамфеникола)). Примеры этого вектора включают в себя M13-векторы, pUC-векторы, pBR322, pBluescript, pCR-Script и т.п. Наряду с этими векторами, перечисляются pGEM-T, pDIRECT, pT7 и т.п., если эти векторы используются для субклонирования и эксцизии кДНК.

[0058] (3) Экспрессирующий вектор

В данном изобретении, при использовании вектора для сильной экспрессии APES и/или получения полипептида особенно полезным является экспрессирующий вектор. Примеры экспрессирующего вектора, который может быть использован в этом изобретении, включают в себя полученные из млекопитающих экспрессирующие векторы (например, pcDNA3 (Invitrogen), pEGF-BOS (Nucleic Acids. Res. 1990, 18(17), p5322), pEF, pCDM8), полученные из клеток насекомых экспрессирующие векторы (например, “Bac-to-BAC-бакуловирусная система экспрессии” (GIBCO BRL), pBacPAK8), полученные из растений экспрессирующие векторы (например, pMH1, pMH2), полученные из животных экспрессирующие векторы (например, pHSV, pMV, pAdexLcw), полученные из ретровируса экспрессирующие векторы (например, pZIpneo), полученные из дрожжей экспрессирующие векторы (например, “Набор для экспрессии Pichia” (Invitrogen), pNV11, SP-Q01), полученные из Bacillus subtilis экспрессирующие векторы (например, pPL608, pKTH50), и т.п.

[0059] Экспрессирующий вектор для экспрессии экзогенного полипептида содержит ДНК, кодирующую этот полипептид, и регулирующую экспрессию последовательность, способную стимулировать экспрессию этой ДНК. Подобным образом, экспрессирующий вектор для экспрессии экзогенного полипептида содержит ДНК, кодирующую APES, и регулирующую экспрессию последовательность, способную стимулировать экспрессию этой ДНК. Может быть сконструирован единый вектор для экспрессии как полипептида, так и APES. Например, если APES или ген полипептида, который является частью генома хозяина, активируют с использованием технологии активации генов, может быть введена регулирующая экспрессию последовательность, которая стимулирует экспрессию такой полученной из клетки-хозяина ДНК.

[0060] Примеры этой регулирующей экспрессию последовательности включают в себя подходящий промотор, энхансер, терминатор транскрипции, последовательность Козака, содержащую стартовый кодон (т.е. ATG) в кодирующем белок гене, сигнал сплайсинга для интрона, сайт полиаденилирования, стоп-кодон и т.п. Этот вектор может быть сконструирован подходящим образом квалифицированным в данной области специалистом.

[0061] Регулирующая экспрессию последовательность предпочтительно содержит район промотор/энхансер, способный увеличивать уровень транскрипции гена в используемой клетке животного. Район промотор/энхансер, включенный в экспрессию гена, кодирующего желаемый полипептид, может содержать NF-κB-связывающую последовательность.

[0062] Когда предполагается экспрессия в клетках млекопитающих, этот вектор предпочтительно имеет промотор, необходимый для экспрессии в этих клетках, такой как промотор SV40 (Mulligan et al., Nature (1979) 277, 108), промотор MMLV-LTR, промотор EF1α (Mizushima et al., Nucleic Acids Res. (1990) 18, 5322) или промотор CMV. Более предпочтительно, этот вектор также содержит ген для отбора трансформации в клетки (например, ген устойчивости к лекарственному средству, который позволяет различение, с использованием лекарственного средства (например, неомицин, G418)). Примеры вектора, имеющего такие характеристики, включают в себя pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV, pOP13 и т.п.

[0063] Далее, когда предполагается стабильная экспрессия гена и внутриклеточная амплификация числа копий этого гена, может быть использован способ, в котором, в клетки СНО, лишенные пути синтеза нуклеиновых кислот, вводят вектор, имеющий ген DHFR, который дополняет это отсутствие (например, (например, pCHOI), с последующей амплификацией с метотрексатом (MTX). Когда предполагается транзиторная экспрессия гена, может быть использован способ, в котором клетки COS, несущие SV40 T-антиген-экспрессирующий ген на хромосоме, трансформируют вектором, имеющим ориджин репликации (сайт инициации репликации) SV40 (например, pcD). В качестве сайта инициации репликации могут быть также использованы ориджин репликации, полученные из полиомавируса, аденовируса, бычьего папилломавируса (BPV) или т.п. Далее, для амплификации числа копий генов в системе клеток-хозяев этот экспрессирующий вектор может содержать маркер селекции, такой как ген аминогликозидтрансферазы (APH), ген тимидинкиназы (TK), ген E. coli ксантин-гуанин-фосфорибозилтрансферазы (Ecogpt) или ген дигидрофолатредуктазы (dhfr).

[0064] (4) Клетки-хозяева

Клетка, предназначенная для использования в данном изобретении, может быть либо природной клеткой, способной продуцировать желаемый полипептид, или клеткой, в которую была введена ДНК, кодирующая желаемый полипептид. Предпочтительно, используется трансформированная клетка, в которую была введена ДНК, кодирующая желаемый полипептид.

[0065] Одним примером трансформированной клетки, в которую была введена ДНК, кодирующая желаемый полипептид, является клетка-хозяин, которая была трансфицирована экспрессирующим вектором, содержащим по меньшей мере одну ДНК, кодирующую желаемый полипептид, и которая в сильной степени экспрессировала эндогенную или экзогенную APES.

[0066] Далее, в данном изобретении, клетка, в которую “была введена ДНК (или в которую был введен ген)” включает в себя клетки, трансфицированные экзогенной ДНК, а также клетки, в которых эндогенная ДНК была активирована с использованием технологии активации генов (можно сослаться, например, на проспект Международной публикации № WO 94/12650), которая приводила к экспрессии белка, соответствующего этой ДНК, или инициации или увеличения транскрипции ДНК.

[0067] При введении клетки, в которую была искусственно введена APES, для продуцирования желаемого полипептида, последовательность введения APES и гена, кодирующего этот желаемый полипептид, не являются конкретно ограниченными; APES может быть введена перед введением гена, кодирующего желаемый полипептид, или этот ген, кодирующий желаемый полипептид, может быть введен перед введением APES. Альтернативно, APES и ген, кодирующий желаемый полипептид, могут вводиться одновременно.

[0068] При использовании вектора, APES и ген, кодирующий желаемый полипептид, могут быть введены одновременно с использованием единого вектора, или они могут быть введены раздельно с использованием множества векторов.

[0069] Клетка, которая должна быть использована в данном изобретении, не ограничивается конкретно. Она может быть любой клеткой, такой как эукариотическая клетка (например, клетка животного, клетка растения, дрожжи), или прокариотическая клетка (например, E. coli и B. subtilis). Клетки животных, полученные из насекомых, рыбы, земноводных, пресмыкающихся и млекопитающих являются предпочтительными, и клетки млекопитающих являются особенно предпочтительными. Источниками клеток млекопитающих являются такие источники, как человек и шимпанзе, грызуны, такие как мышь, крыса и хомячок, и т.д., предпочтительно человек и грызуны. Далее, предпочтительным является то, что клетки этого изобретения являются культивируемыми клетками млекопитающих, которые обычно часто используются для экспрессии полипептидов, такие как клетки CHO, клетки COS, клетки 3T3, клетки миеломы, клетки BHK, клетки HeLa и клетки Vero. Для экспрессии большого количества желаемого полипептида, особенно предпочтительно используются клетки CHO. Для экспрессии большого количества желаемого полипептида особенно предпочтительно используются клетки СНО. В частности, dhfr-CHO (Proc. Natl. Acad. Sci. USA (1980) 77, 4216-4220), которые являются клетками CHO, лишенными гена DHFR, или CHO K-1 (Proc. Natl. Acad. Sci. USA (1968) 60, 1275) могут быть преимущественно использованы в качестве клеток CHO.

[0070] В частности, предпочтительными являются штамм DG44, штамм DXB-11, K-1 или CHO-S в качестве клеток CHO, и штамм DG44 или штамм DXB-11 является особенно предпочтительным.

[0071] Клетка-хозяин данного изобретения может быть использована, например, в качестве продукционной системы для получения или экспрессии желаемого полипептида. Если ДНК, кодирующую желаемый полипептид, вводят в сильно экспрессирующую APES клетку-хозяина, желаемый полипептид может продуцироваться на высоком уровне. В клетку-хозяина данного изобретения может быть дополнительно введена ДНК, кодирующая либо транспортер таурина (TauT), либо агент обмена аниона (AE1) (эта ДНК может быть включена в вектор). В клетку-хозяина этого изобретения, может быть дополнительно введена также ДНК, кодирующая либо декарбоксилазу цистеинсульфиновой кислоты (CSAD), либо аланинтрансферазу (ALT1). В отношении подробностей, см. WO 2007/119774, WO 2008/114673, WO 2009/020144 и WO 2009/054433.

[0072] Экзогенная ДНК (которая может быть включена в вектор) может быть введена в клетку-хозяина такими способами, как кальций-фосфатный способ, ДЭАЭ-декстрановый способ, способ, использующий катионную рибосому DOTAP (Boehringer Mannheim), электропорацию, способ нуклеофекции (amaxa) или липофекции.

[0073] (5) Предполагаемый полипептид

Полипептид, который должен быть продуцирован способом данного изобретения, не ограничивается особенно. Он может быть любым полипептидом, таким как антитело (например, анти-IL-6-рецептор-антитело, анти-IL-6-антитело, антиглипикан-3-антитело, анти-СD3-антитело, анти-CD-антитело, анти-GPIIb/IIIa-антитело, анти-TNF-антитело, анти-CD25-антитело, анти-EGFR-антитело, анти-Her2/neu-антитело, анти-RSV-антитело, анти-CD33-антитело, анти-CD52-антитело, анти-IgE-антитело, анти-CD11a-антитело, анти-VEGF-антитело, анти-VLA4-антитело) или физиологически активный белок (например, гранулоцитарный колониестимулирующий фактор (G-CSF), гранулоцитарный-макрофагальный колониестимулирующий фактор (GM-CSF), эритропоэтин, интерферон, интерлейкин (например, IL-1, IL-6), t-PA, урокиназа, сывороточный альбумин, фактор свертывания крови, PTH). Особенно предпочтительным является антитело, и оно может быть любым антителом, таким как природное антитело, низкомолекулярное антитело (например, Fab, scFv, sc(Fv)2), химерное антитело или гуманизированное антитело

[0074] (6) Получение полипептида

Представляющий интерес полипептид может быть получен культивированием клетки-хозяина, описанной выше, с получением желаемого полипептида и сбором этого полипептида.

[0075] Для культивирования этой клетки могут быть использованы среды, которые используют в обычных культурах клеток (предпочтительно клеток животных). Эти среды обычно содержат аминокислоты, витамины, липидные факторы, источники энергии, осмотические регуляторы, источники железа и рН-буферы. Обычно удобно, чтобы содержание этих компонентов находилось в следующих диапазонах: аминокислоты 0,05-1500 мг/л, витамины 0,001-10 мг/л, липидные факторы 0-200 мг/л, источники энергии 1-20 г/л, осмотические регуляторы 0,1-10000 мг/л, источники железа 0,1-500 мг/л, pH-буферы 1-10000 мг/л, металлические микроэлементы 0,00001-200 мг/л, поверхностно-активные вещества 0-5000 мг/л, кофакторы роста 0,05-10000 мкг/л и нуклеозиды 0,001-50 мг/л. Однако, эти содержания не ограничиваются этими диапазонами и могут быть должным образом определены в зависимости от типа подлежащей культивированию клетки, типа желаемого полипептида и т.д.

[0076] Кроме вышеописанных компонентов, могут быть также добавлены, например, металлические микроэлементы, поверхностно-активные вещества, кофакторы роста, нуклеозиды и т.п.

[0077] Конкретные примеры включают в себя аминокислоты, такие как L-аланин, L-аргинин, L-аспарагин, L-аспарагиновая кислота, L-цистеин, L-цистин, L-глутамин, L-глутаминовая кислота, глицин, L-гистидин, L-изолейцин, L-лейцин, L-лизин, L-метионин, L-орнитин, L-фенилаланин, L-пролин, L-серин, L-треонин, L-триптофан, L-тирозин и L-валин (предпочтительно, L-аланин, L-аргинин, L-аспарагин, L-аспарагиновая кислота, L-цистеин, L-цистин, L-глутамин, L-глутаминовая кислота, глицин, L-гистидин, L-изолейцин, L-лейцин, L-лизин, L-метионин, L-фенилаланин, L-пролин, L-серин, L-треонин, L-триптофан, L-тирозин и L-валин); витамины, такие как i-инозит, биотин, фолиевая кислота, липоевая кислота, никотинамид, никотиновая кислота, п-аминобензойная кислота, пантотенат кальция, гидрохлорид пиродоксаля, гидрохлорид пиридоксина, рибофлавин, гидрохлорид тиамина, витамин B12 и аскорбиновая кислота (предпочтительно, биотин, фолиевая кислота, липоевая кислота, никотинамид, пантотенат кальция, гидрохлорид пиридоксаля, рибофлавин, гидрохлорид тиамина, витамин B12 и аскорбиновая кислота); липидные факторы, такие как холин-хлорид, холин-тартрат, линолевая кислота, олеиновая кислота и холестерин (предпочтительно, холин-хлорид); источники энергии, такие как глюкоза, галактоза, манноза и фруктоза (предпочтительно, глюкоза); осмотические регуляторы, такие как хлорид натрия, хлорид калия и нитрат калия (предпочтительно, хлорид натрия); источники железа, такие как железо-ЭДТА, цитрат трехвалентного железа, хлорид двухвалентного железа, хлорид трехвалентного железа, сульфат двухвалентного железа, сульфат трехвалентного железа и нитрат трехвалентного железа (предпочтительно, хлорид трехвалентного железа, железо-ЭДТА и цитрат трехвалентного железа); и рН-буферы, такие как гидрокарбонат натрия, хлорид кальция, дигидрофосфат натрия, HEPES и MOPS (предпочтительно, гидрокарбонат натрия). В качестве примеров могут быть представлены среды любого одного (или нескольких) из этих компонентов.

[0078] Кроме вышеуказанных компонентов, могут быть, например, добавлены: металлические микроэлементы, такие как сульфат меди, сульфат марганца, сульфат цинка, сульфат магния, хлорид никеля, хлорид олова и субсиликат натрия (предпочтительно сульфат меди, сульфат цинка и сульфат магния); поверхностно-активные вещества, такие как Твин 80 и Плуроник F68; кофакторы роста, такие как рекомбинантный инсулин, рекомбинантный IGF-1, рекомбинантный EGF, рекомбинантный FGF, рекомбинантный PDGF, рекомбинантный TGF-α, гидрохлорид этаноламина, селенит натрия, ретиноевая кислота и гидрохлорид путресцина (предпочтительно, селенит натрия, гидрохлорид этаноламина, рекомбинантный IGF-1 и гидрохлорид путресцина); нуклеозиды, такие как дезоксиаденозин, дезоксицитидин, дезоксигуанозин, аденозин, цитидин, гуанозин и уридин; и т.п. Следует отметить, что в предпочтительных примерах вышеописанных сред может содержаться антибиотик, такой как стрептомицин, пенициллин G-калий или гентамицин или индикатор рН, такой как Феноловый Красный.

[0079] pH этой среды варьируется в зависимости от подлежащих культивированию клеток. Обычно подходящим является pH 6,8-7,6 и во многих случаях подходящим является pH 7,0-7,4.

[0080] Можно также использовать коммерчески доступную среду для культуры клеток животных, такую как D-MEM (модифицированная по способу Дульбекко среда Игла), смесь 1:1 D-MEM/F-12 (модифицированная Дульбекко среда Игла: смесь нутриентов F-12), RPMI1640, CHO-S-SFM II (Invitrogen), CHO-SF (Sigma-Aldrich), EX-CELL 301 (JRH Biosciences), CD-CHO (Invitrogen), IS CHO-V (Irvine Scientific) или PF-ACF-CHO (Sigma-Aldrich).

[0081] Эта среда может быть бессывороточной средой.

[0082] Когда клетки-хозяева являются клетками СНО, для культивирования этих клеток СНО может быть использован способ, известный квалифицированному в данной области специалисту. Например, клетки СНО могут обычно культивироваться в атмосфере газовой фазы при концентрации CO2 0-40%, предпочтительно 2-10%, при 30-39°C, предпочтительно приблизительно 37°C.

[0083] Подходящим периодом культивирования для получения желаемого полипептида обычно является период от 1 дня до 3 месяцев, предпочтительно от 1 дня до 2 месяцев, более предпочтительно от 1 дня до 1 месяца.

[0084] В качестве различных устройств для культивирования клеток животных могут быть использованы следующие устройства: например, устройства для культивирования в чане типа ферментера, устройства для культивирования air lift-типа, устройства для культуры типа вращающихся колб, устройства для культивирования типа микроносителей, устройства для культивирования типа псевдоожиженного слоя, устройства для культивирования типа полого волокна, устройства для культивирования типа роллерных флаконов и устройства для культивирования типа уплотненного слоя.

[0085] Культивирование может выполняться любым способом, таким как периодическая культура, культура с подпиткой или непрерывная культура. Среди них предпочтительной является культура с подпиткой или непрерывная культура и более предпочтительной является культура с подпиткой.

[0086] Полученный полипептид может быть выделен из внутреннего пространства клетки-хозяина или из наружной среды (например, питательной среды) и очищен с получением, по существу, чистого и гомогенного полипептида. Выделение и очистка этого полипептида могут выполняться с использованием обычного способа выделения и очистки, и они никоим образом не ограничиваются. Например, полипептиды могут быть выделены и очищены подходящим образом выбором и комбинированием хроматографических колонок, фильтров, ультрафильтрацией, высаливаниеи, осаждением растворителем, экстракцией растворителем, дистилляцией, иммунопреципитацией, диализом, перекристаллизацией и т.п.

[0087] Примеры хроматографии включают в себя аффинную хроматографию, ионообменную хроматографию, гидрофобную хроматографию, гель-фильтрацию, хроматографию с обращенной фазой, адсорбционную хроматографию и т.п. (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996). Эти хроматографии могут проводиться с использованием жидкостной хроматографии, такой как жидкостная хроматография высокого разрешения (высокоэффективная жидкостная хроматография) (ВЖХ) или жидкостной хроматографии быстрого разрешения (ЖХБР). Данное изобретение включает в себя также полипептиды, высокоочищенные этими способами очистки.

[0088] Следует отметить, что до и после очистки полипептидов можно также придавать необязательные модификации или удалять частичный пептид, давая подходящему ферменту модификации полипептида действовать на эти полипептиды. Примеры фермента модификации полипептидов включают в себя трипсин, химотрипсин, лизилэндопептидазу, протеинкиназу, глюкозидазу и т.п.

[0089] (7) Фармацевтические препараты

Когда полипептид, продуцируемый по способу этого изобретения, имеет биологическую активность, которая может быть использована в качестве лекарственного средства, этот полипептид может быть смешан с фармацевтически приемлемым носителем или добавкой и приготовлен для получения фармацевтического препарата.

[0090] Примеры фармацевтически приемлемого носителя или добавки включают в себя воду, фармацевтически приемлемые органические растворители, коллаген, поливиниловый спирт, поливинилпирролидон, карбоксивиниловые полимеры, натрий-карбоксиметилцеллюлозу, полиакрилат натрия, альгинат натрия, водорастворимый декстран, натрий-карбоксиметилкрахмал, пектин, метилцеллюлозу, этилцелюлозу, ксантановую камедь, аравийскую камедь, казеин, агар, полиэтиленгликоль, диглицерин, глицерин, пропиленгликоль, вазелин, парафин, стеариловый спирт, стеариновую кислоту, сывороточный альбумин человека (HSA), маннит, сорбит, лактозу, поверхностно-активные вещества, приемлемые в качестве фармацевтических добавок, и т.п.

[0091] Эта фактическая добавка выбрана из предшествующих добавок, либо отдельно, либо в подходящей комбинации, в соответствии с лекарственной формой терапевтического агента этого изобретения, но эта фактическая добавка не ограничивается только ими. Например, в случае использования в качестве препарата для инъекции, может быть использован материал, который получен растворением очищенного полипептида в растворителе, таком как физиологический солевой раствор, буферный раствор или раствор глюкозы, и затем добавлением к полученному раствору ингибитора адсорбции, такого как Твин 80, Твин 20, желатин или сывороточный альбумин человека. Альтернативно, лиофильно высушенный материал может быть использован для приготовления лекарственной формы, которая растворяется и воспроизводится перед использованием, и эксципиент, который может быть использован для лиофилизации, является, например, сахароспиртом или сахаром, таким как маннит или глюкоза.

[0092] Эффективное количество введения этого полипептида подходящим образом выбирают в соответствии с типом этого полипептида, типом заболеваний, подлежащих лечению или предотвращению, возрастом пациентов, серьезностью этих заболеваний, и т.п. Например, когда этим полипептидом является антиглипикан-антитело, эффективное количество введения выбирают из диапазона 0,001 мг - 1000 мг на кг массы тела на одно введение. Альтернативно, количество введения 0,01-100000 мг/тело может быть выбрано на пациента. Однако эффективное количество не ограничивается этими диапазонами.

[0093] Этот полипептид может вводиться перорально или парентерально, но предпочтительным является парентеральное введение. Конкретные примеры включают в себя инъекцию (например, системное или локальное введение внутривенной инъекцией, внутримышечной инъекций, внутрибрюшинной инъекцией, подкожной инъекцией или т.п.), трансназальное введение, чрезлегочное введение, чрескожное введение и т.п.

[0094] (8) Супрессия экспрессии NfkBia

Согласно данному изобретению, в способе получения желаемого полипептида культивированием клеток животного, в которые была введена ДНК, кодирующая этот полипептид, количество продукции желаемого полипептида может быть увеличено уменьшением уровня экспрессии ингибитора α ядерного фактора κB (NfkBia) в этих клетках-хозяевах. Ген NfkBia является незаменимым геном, и полная супрессия этого гена приводит к гибели клеток. Таким образом, возможно, что умеренная супрессия экспрессии гена NfkBia является важной в способе этого изобретения.

[0095] В силу этих причин, объем этого изобретения включает в себя способ получения желаемого полипептида культивированием клеток животных, в которые была введена ДНК, кодирующая этот полипептид, предусматривающий стадию уменьшения уровня экспрессии NfkBia в клетках до уровня, меньшего, чем уровень экспрессии в исходных клетках, в которые еще не был введен ген антитела.

[0096] В качестве способа уменьшения экспрессии NfkBia, эта экспрессия может быть ингибирована ингибированием транскрипции из гена NfkBia, деградацией мРНК, ингибированием трансляции из мРНК или ингибированием функции (связывания) продукта трансляции. В сравнении со случаями, в которых этот способ уменьшения экспрессии NfkBia не используется, уровень экспрессии

NfkBia контролируется до 70% или более низкого уровня, предпочтительно 60% или менее, более предпочтительно 50% или менее, что приводит к увеличению количества продуцирования желаемого полипептида. Другими словами, уровень экспрессии гена NfkBia, необходимый для избежания гибели клеток, равен, например, 20% или более, предпочтительно 30% или более.

[0097] Предполагается, что конкретным способом ингибирования экспрессии NfkBia является использование антисмыслового олигонуклеотида, рибозима или молекулы нуклеиновой кислоты, которая вызывает РНК-интерференцию (RNAi), такой как dsRNA, siRNA, shRNA или miRNA. Могут быть также использованы некодирующие РНК мРНК-типа, которые называют “большими межгенными (или промежуточными) длинными некодирующими РНК “(lincRNAs)”, другие некодирующие РНК мРНК-типа, олигонуклеотиды-“приманки” или аптамеры. Эти молекулы нуклеиновых кислот, каждая, содержат последовательность, гомологичную или комплементарную мРНК, кодирующей NfkBia, и могут связываться с геном или мРНК NfkBia и ингибировать их экспрессию. APES (или PPES) является такой молекулой нуклеиновой кислоты.

[0098] Молекула нуклеиновой кислоты, которая может быть использована для ингибирования экспрессии NfkBia, является, например, малой РНК с длиной 19-25 нуклеотидов, содержащей последовательность, комплементарную части мРНК NfkBia, или малой РНК, которая имеет последовательность, идентичную этой последовательности, за исключением одного нуклеотида, и имеет функцию ингибирования экспрессии NfkBia.

[0099] Посредством экспрессии в клетке-хозяине такой малой РНК, которая ингибирует экспрессию NfkBia, уровень экспрессии ингибитора α ядерного фактора κB (NfkBia) может быть уменьшен. Типичным способом для экспрессии в клетке-хозяине малой РНК, которая ингибирует экспрессию NfkBia, может быть введение вектора, содержащего ДНК, кодирующую такую малую РНК, в эту клетку.

[0100] Можно также ингибировать экспрессию NfkBia введением в эту клетку dsRNA, образованную связыванием смысловой РНК и антисмысловой РНК против мРНК NfkBia или ее частичной последовательности друг с другом.

[0101] Перед измерением уровня экспрессии NfkBia, должна быть определена мРНК-последовательность NfkBia, которая была экспрессирована в клетке-мишени и может быть количественно определена способом TaqMan. Например, частичные последовательности NfkBia (SEQ ID NO: 19 и 28) и набор зондов TaqMan (SEQ ID NO: 20-22), которые были использованы в этом исследовании, могут быть показаны Фигурой 12. Эти зонды TaqMan могут быть сконструированы с использованием программы Primer Express® (Applied Biosystems) или т.п. Эта вышеуказанная частичная последовательность NfkBia (SEQ ID NO: 28) может быть также подтверждена как последовательность, подобная последовательности ингибитора α NF-kappa-B в клетках CHO K1, и спарена с последовательностью изобретения авторов в ПЦР-клонировании. В этой последовательности, может быть определена количественно экспрессия района между нуклеотидами 64 слева от стоп-кодона и 132 нуклеотидами слева от стоп-кодона TGA (907-909).

[0102] Могут быть приобретены обычный измерительный инструмент, например, 7900HI Sequence Detection System, производимый Applied Biosystems (ABI), и все наборы и реагенты. Таким образом, это количественное определение может выполняться в соответствии с протоколом, рекомендуемым ABI.

ПРИМЕРЫ

[0103] Данное изобретение конкретно описано ниже со ссылкой на Примеры, представленные ниже. Следует отметить, что эти Примеры обеспечены для иллюстрации этого изобретения, но не для ограничения объема этого изобретения.

[0104] [Пример 1] GeneChip-эксперимент для анализа различных клеток СНО с введенным геном

GeneChip-эксперимент проводили в соответствии с обычной процедурой с использованием массива (упорядоченного ряда) олигонуклеотидов, производимого AFFYMETRIX, Inc. (Affymetrix MOUSE430_2), при условии, что, поскольку любой массив хомячка не мог быть коммерциализован, использовали Массив Генома Мыши 430 2.0 (Genome 430 2.0 Array). Оптимизация условий гибридизации приводила к детектированию присутствующих клеток в 8 из 16 генных зондов мыши на Массиве Теста 3, и стало возможным количественное определение экспрессии транскрипта в хомячках, когда гомология нуклеотидной последовательности с мышиными последовательностями была приблизительно 90% или более высокой.

[0105] Из клеток, проявляющих сильную экспрессию различных генов, получали общую РНК высокой чистоты и затем синтезировали кДНК с использованием этой общей РНК и олиго-dT-праймера, содержащего последовательность Т7-промотора (Т7-(Т)24). Затем, синтезировали биотин-меченую кРНК из этой кДНК посредством реакции транскрипции с использованием Bio-11 CTP, Bio-16 UTP и набора Megascript T7 (Ambion). После подвергания кРНК колоночной очистке, полученную кРНК высокого качества, молекулярную массу которой подтверждали электрофорезом в отношении соответствия с 18s-28s рРНК, фрагментировали для получения GeneChip-проб однородного размера. К этим пробам GeneChip перед использованием добавляли раствор гибридизационной пробы с последующей криоконсервацией при -80°C. Раствор этой пробы обрабатывали нагреванием перед использованием, центрифугировали и наносили на массив Генома мыши 430 2.0. Инкубирование выполняли при 45°C в течение 16 часов в печи для гибридизации с вращением этих массивов. Пробы извлекали и эти массивы промывали повторяющимся образом, окрашивали стрептавидин-R-фикоэритрином и затем сканировали.

[0106] Величины сигналов GeneChip этих транскриптов на массивах (приблизительно 45000) сравнивали и в результате была идентифицирована некодирующая мРНК мРНК-типа UG_GENE=AI462015 (Affymetrix MOUSE430_2, 1420088_AT) в качестве транскрипта, экспрессия которого была экспрессией высокой интенсивности и заметно увеличивалась на геноме мыши в субкультивированной клетке DG44, которая продуцировала по меньшей мере 900 мг/л of MAb1 (анти-IL-6R-антитела; тоцилицумаба, название продукта: Actemra) на 10-й день культуры с подпиткой в сосудах на 1 л и которая сильно экспрессировала MAb1 (анти-IL-6R-антитело), TAUT и CSAD (Фигура 1: последовательность транскрипта AI462015).

[0107] AI462015 является некодирующей мРНК мРНК-типа из 437 нуклеотидов, и ее последовательность существует на комплементарной цепи вблизи 3’-нетранслируемого района (56590831-56590397) мРНК NfkBia в мышином геноме 12. Имелись возможности, что этот транскрипт AI462015 мог бы действовать непосредственно на нетранслируемый район мРНК NfkBia и ингибировать трансляцию, или что часть последовательности из 437 нуклеотидов могла бы функционировать в качестве малой РНК и деградировать мРНК NfkBia.

[0108] Например, последовательность из 52 нуклеотидов, которая является последовательностью между А в нуклеотиде 40 и А в нуклеотиде 91 от 5’-конца (AAGTACCAAAATAATTACCAACAAAATACAACATATACAACATTTACAAGAA: SEQ ID NO: 7) в последовательности AI462015 совмещалась с комплентарной цепью 3’-нетранслируемого района мРНК NfkBia крысы (1478-1529, GENE ID: 25493 NfkBia), за исключением одного нуклеотида (А в нуклеотиде 61 от 5’-конца в AI462015). Далее, последовательность из 24 нуклеотидов, содержащая последовательность между А в нуклеотиде 40 и А в нуклеотиде 63 (AAGTACCAAAATAATTACCAACAA: SEQ ID NO: 9) в AI462015, является комплементарной цепью частичной последовательности 3’-нетранслируемого района мРНК NfkBia (TTGTTGGTAATTATTTTGGTACTT, 1490-1513: SEQ ID NO: 24). В свете этих точек зрения, было предсказано, что 19-25 нуклеотидов, которые являются частью из 52 нуклеотидов, могли бы действовать на мРНК NfkBia клеток CHO, служа в качестве микроРНК, или что частичные последовательности могли бы действовать на мРНК NfkBia mRNA клеток CHO, служа в качестве антисмысловых РНК.

[0109] Далее в соответствии с уточненной информацией (Пример 8), например, последовательность из 85 нуклеотидов, которая является последовательностью между Т в нуклеотиде 7 и А в нуклеотиде 91 от 5’-конца (эта подчеркнутая часть, показанная на Фигурах 23 и 24; SEQ ID NO: 29) (TGTAAAAATCTGTTTAATAAAT ATACATCTTAGAAGTACCAAAATAATTACCAACAAAATACAACATATACAACATTTACAAGAA) в последовательности AI462015 совмещалась с комплементарной нитью 3’-нетранслируемого района мРНК NfkBia (1478-1562, GENE ID: 25493 NfkBia, SEQ ID NO: 31), за исключением одного нуклеотида (А в нуклеотиде 70 от 5’-конца в AI462015) (Совместимость = 84/85, Фигура 25b). Подобным образом, было подтверждено, что эта последовательность была гомологичной последовательностям человека (Совместимость = 75/85, Фигура 25а, SEQ ID NO: 30), шимпанзе (Совместимость = 75/85, Фигура 25c, SEQ ID NO: 32), обезьяны резус (Совместимость = 74/85, Фигура 25d, SEQ ID NO: 33) и крупного рогатого скота (Совместимость = 76/85, Фигура 25e, SEQ ID NO: 34). Таким образом, предполагается, что нуклеотиды 19-25, которые являются частью из 85 нуклеотидов (Консервативных последовательностей 7-91), действуют на клетках животных или клетках млекопитающих независимо от вида, служа в качестве микроРНК, или что частичные последовательности действуют на клетках животных или клетках млекопитающих независимо от вида, служа в качестве антисмысловых РНК. Таким образом, было предсказано, что они будут также действовать на мРНК NfkBia культивируемых клеток животных, предпочтительно клеток млекопитающих, таких как клетки СНО.

[0110] [Пример 2] Идентификация транскрипта, экспрессируемого при увеличенном уровне в высокопродуцирующих антитело клетках

В Примере 1, уровень экспрессии транскрипта AI462015 был увеличенным в клетке DG44, продуцирующей MAb1 (анти-IL-6R-антитело; тоцилицумаб, Название продукта: Actemra) при высоком уровне (Фигура 2). Подобным образом, при получении другого антитела (MAb2: антиглипикан 3-антитела; GC33 (см. WO 2006/006693)) при высоком уровне в другой клетке-хозяине (CHO-DXB11s), наблюдали увеличенную экспрессию транскрипта AI462015 (Фигура 3).

[0111] Как показано на Фигуре 2, при сильной экспрессии транспортера таурина (TauT) сильно экспрессировался ген декарбоксилазы цистеинсульфиновой кислоты (CSAD) (данные не показаны), и TauT и CSAD сильно коэкспрессировались в клетке CHO-DG44, в каждом случае, уровни экспрессии транскрипта AI462015 были все сравнимыми. В отличие от этого, в клетке, в которой TauT и CSAD сильно коэкспрессировались и дополнительно сильно экспрессировалось Mab1 (анти-IL-6 рецептор-антитело), наблюдали аберрантное увеличение AI462015 (в 7 раз более высокое, чем в клетке-хозяине), и уровень экспрессии показан также аберрантно высокой величиной сигнала GeneChip (10000 или более высокой). С учетом того, что интенсивности экспрессии GAPDH в качестве контроля были сравнимы среди клеток, было обнаружено, что эта увеличенная экспрессия транскрипта AI462015 является специфической в клетке, продуцирующей антитело Mab1 при высоком уровне. То же самое относится к случаю, показанному на Фигуре 3; при сильной экспрессии гена MAb2 (антиглипикан 3-антитела) в клетке CHO-DXB11s было обнаружено, что увеличенная экспрессия последовательности AI462015 (в 13 раз более высокая, чем средняя величина среди клеток, которые сильно экспрессируют TauT, CSAD или AE1) является специфической в клетке, продуцирующей MAb2-антитело при высоком уровне.

[0112] Приведенные выше результаты показывают, что высокопродуцирующие антитело клетки, которые росли стабильно на 3-й день шейкерной субкультуры, экспрессировали последовательность AI462015 при аберрантно высоких уровнях.

[0113] В условиях продукционной культуры на 3-й день культивирования в 1-литровых сосудах, также наблюдали аберрантно увеличенную экспрессию последовательности AI462015. Как видно на Фигуре 4, два типа высокопродуцирующих антитело клеток, продуцирующих приблизительно 1200-1400 мг/л MAb1 (анти-IL-6R-антитела), на 10-й день культивирования с подпиткой в 1-литровых сосудах обнаруживали высокие величины сигналов GeneChip 5000 или более высокие. Вследствие различий в условиях культивирования, величины сигналов GeneChip, измеренные в день 3 культуры с подпиткой в 1-литровых сосудах, были равны приблизительно 50% величины в шейкерной культуре. Однако, на 13-й день в последней стадии культивирования с подпиткой в 1-литровых сосудах, было обнаружено, что интенсивность экспрессии последовательности AI462015 увеличивалась до уровня интенсивности шейкерной субкультуры, показывая аберрантно высокие величины сигналов (Фигура 5). С другой стороны, продуцирующая низкие количества антитела и сильно экспрессирующая MAb1 клетка DXB11s (300 мг/л или менее на 7-й день не содержащей гидролизата шейкерной культуры; 500 мг/л или менее даже в культуре с добавлением гидролизата) не обнаруживали увеличенной экспрессии последовательности AI462015 на третий день культуры в 1-литровых сосудах даже при условиях, в которых добавляли гидролизат, который способствует более высокому продуцированию (Hy-Fish или Procine-лизат) (Фигура 6).

[0114] Эти экспериментальные результаты показывают высокое количество антитела, продуцируемое в сильно экспрессирующих MAb1, TauT и CSAD клетках DG44, которые показали высокую величину сигналов на Фигуре 2 (эта величина была равна 640 мг/л на 7-й день не содержащей гидролизата шейкерной культуры), высокое количество антитела, продуцируемое в сильно экспрессирующих MAb2 клетках DXB11s, которые показывают высокую величину сигналов на Фигуре 3 (эта величина была равна 640 мг/л не содержащей гидролизата шейкерной культуры), и не наблюдали увеличения величины сигналов даже при добавлении гидролизата, который способствует более высокому продуцированию антител, как показано на фигуре 6. В свете этих экспериментальных результатов, предполагается, что “клетка, экспрессирующая высокий уровень последовательности AI462015, имеет высокий потенциал продуцирования антитела”.

[0115] [Пример 3] Пример высокого продуцирования, происходящего из сильной экспрессии APES в антитело-продуцирующих клетках

Для демонстрации того, что уровень экспрессии последовательности AI462015 коррелирует с уровнем антитело-продуцирующего потенциала, плазмиды, экспрессирующие часть последовательности AI462015, вводили, каждую, в клетки DXB11s, которые проявляют низкий антитело-продуцирующий потенциал и сильную экспрессию MAb1 на Фигуре 6, и затем индуцировали сильную экспрессию и сравнивали антитело-продуцирующие потенциалы.

[0116] Из последовательности полученного из генома мыши транскрипта AI462015 (Фигура 1; 437 нуклеотидов), частичные последовательности (содержащие последовательность зонда AI462015 Affymetrix GeneChip): последовательность между G в нуклеотиде 4 от 5’-конца и T в 3’-конце была названа APES434 и последовательность между G в нуклеотиде 4 и C в нуклеотиде 168 от 5’-конца была названа APES165. Таким образом получали два типа экспрессирующих единиц (APES является короткой для Усиливающей Продуцирование Антител Последовательности). Дополненные последовательностью Козака экспрессирующие единицы синтезировали для конструирования pHyg-APES434 (Фигура 7) и pHyg-APES165 (Фигура 8), каждая из которых экспрессировала при высоких уровнях CMV-промотор, и pHyg-null (Фигура 9).

[0117] Нуклеовектор, который является системой для введения гена, производимой Amaxa (в настоящее время, LONZA), использовали для введения этих экспрессирующих плазмид в сильно экспрессирующие MAb1 клетки DXB11s, которые были низкопродуцирующими антитела штаммами на Фигуре 6. После селекции (отбора) всех клеточных штаммов, которые росли в высокой степени на 96-луночном планшете в присутствии селектирующей среды, содержащей гигромицин (200 мкг/мл), их распространяли на 24-

луночный планшет и количества продуцирования антитела сравнивали. Количества селектированных штаммов были следующими: pHyg-APES434 (N=38), pHyg-APES165 (N=60) и pHyg-null (N=11), и из этих количеств штаммов можно было ожидать, что положительный эффект мог быть произведен введением сильно экспрессирующих APES плазмид. Поскольку не наблюдали роста клеток на 13-й день стационарной культуры в 24-луночном планшете, содержащим 1 мл среды субкультуры, измеряли количества продуцирования антитела и измеряли количества клеток. Средние величины количеств продуцированных антител были pHyg-APES434 (44,3 мг/л), pHyg-APES165 (41,2 мг/л) и pHyg-null (21,9 мг/л), и количества клеток (средние величины) были pHyg-APES434 (9,27×105 клеток/мл), pHyg-APES165 (11,39×105 клеток/мл) и pHyg-null (7,76×105 клеток/мл). Клетка с введением pHyg-APES434 и клетка с введением pHyg-APES165, обе, были статистически превосходящими pHyg-null в качестве контроля (t-критерий, P<0,001, Фигура 10).

[0118] Приведенные выше результаты показывают, что сильная экспрессия нуклеиновой кислоты, содержащей 5’-165 п.н. транскрипта AI462015 (например, APES165, который является ДНК-транскриптом SEQ ID NO: 2, или APES434, который является ДНК-транскриптом SEQ ID NO: 3), увеличивает антитело-продуцирующий потенциал этих клеток.

[0119] [Пример 4] Супрессия экспрессии NfkBia в высокопродуцирующих антитело клетках СНО

Как описано в Примере 1, последовательность AI462015 находится на комплементарной цепи вблизи 3’-нетранслируемого района (3’-78 п.н.) гена NfkBia в геноме 2 мыши; 22 нуклеотида

(AAGTACCAAAATAATTACCAAC; SEQ ID NO: 10), содержащиеся в этой последовательности AI462015, являются последовательностью, идентичной последовательности комплементарной цепи 3’-нетранслируемого района (1492-1513) гена NfkBia человека, и являются консервативными независимо от вида, такого как крыса, макак резус, собака и лошадь, и, следовательно, существует вероятность того, что эти 22 нуклеотида могли бы вызывать РНК-интерференцию и деградировать мРНК NfkBia, функционируя в качестве микроРНК; или 21 нуклеотид (CATATACAACATTTACAAGAA; SEQ ID NO: 15) от С в нуклеотиде 71 от 5’-конца, которая соответствует первой части района последовательности специфического зонда (42 п.н.) (CATATACAACATTTACAAGAAGGC GACACAGACCTTAGTTGG; SEQ ID NO: 16) на массиве олигонуклеотидов AFFYMETRIX (Affymetrix MOUSE430_2), который способен определять количественно экспрессию AI462015, являются последовательностью, комплементарной последовательности между нуклеотидами 1478 и 1498 мРНК NfkBia крысы. В свете предыдущего, имелась вероятность того, что эта произведенная из последовательности AI462015 молекула нуклеиновой кислоты могла бы интерферировать с мРНК NfkBia (РНК-интерференция), супрессировать ее экспрессию и тем самым поддерживать гомеостаз высокоэкспрессирующих антитело клеток СНО (Летальность мышей с нокаутом: постнатальная) (обратите внимание на то, что позднее было обнаружено, что транскрипт AI462015 соответствует комплементарной цепи из 513 нуклеотидов в 3’-нетранслируемом районе гена NfkBia мыши. См. Пример 8). Далее, было подтверждено, что последовательность между нуклеотидами 71 и 112 (SEQ ID NO: 16) AI462015, которая была количественно определена на GeneChip мыши, была транскриптом в клетках СНО).

[0120] В связи с этими материалами, авторы данного изобретения исследовали процедуру количественного определения уровня экспрессии мРНК NfkBia в высокоэкспрессирующих AI462015 клетках, которые имели высокий антителопродуцирующий потенциал, для подтверждения супрессии экспрессии мРНК NfkBia.

[0121] Поскольку последовательность мРНК NfkBia в клетках СНО является неизвестной, конструировали зонды (5’-ACTTGGTGACTTTGGGTGCT и 5’-GCCTCCAAACACACAGTCAT) (SEQ ID NO: 17 и 18, соответственно) с использованием последовательностей, консервативных в кодирующих аминокислоты районах мыши и крысы (для обоих районов, 942 нуклеотида: 314 аминокислот), для получения ПЦР-продуктов из 325 п.н. Предполагается, что эти 325 п.н., подвергнутые ПЦР-клонированию, являются частичной последовательностью произведенной из мРНК NfkBia, полученной из клеток СНО, в свете гомологии последовательностей (Фигура 11).

[0122] Экспрессия мРНК NfkBia не могла быть количественно определена с использованием массива Mouse Genome 430 2.0 Array (Пример 1), возможно. потому, что последовательность зонда соответствует видоспецифической последовательности клеток СНО. Между тем, сравнение ПЦР-продуктов 325 п.н. показало, что экспрессия мРНК NfkBia была супрессирована в высокопродуцирующих антитело клетках, которые обнаруживали увеличенную экспрессию последовательности AI462015 (Дорожки 3 и 4) в сравнении с сильно экспрессирующими гены клетками, которые не продуцируют антитело (Дорожки 1 и 2). Далее, был сконструирован набор зондов TaqMan, способный количественно определять частичную последовательность из 325 п.н. (Фигура 12), и определение количества выполняли с использованием RT-PCR. В результате, было обнаружено, что экспрессия мРНК NfkBia в высокопродуцирующих антитело клетках была супрессирована до приблизительно 50% этого уровня в клетках, которые не продуцировали антитело (Фигура 13).

[0123] В свете этих открытий, предполагается, что экспрессия мРНК NfkBia была супрессирована в высокопродуцирующих антитело клетках, и в результате увеличивался антитело-продуцирующий потенциал. В районах промотора/энхансера экспрессирующих плазмид, используемых авторами этого изобретения для экспрессии генов антитела, существуют в действительности множество NfkB-связывающих сайтов на промоторе (Фигура 14; NfkB-связывающие сайты на промоторе мыши СМV IE2). Эти энхансерные районы являются незаменимыми для высокой экспрессии генов антител. Таким образом, предполагается, что одним фактором высокого продуцирования антитела является то, что NfkB, активированный супрессией экспрессии NfkBia, является транслоцированным в ядро, с последующим усилением активности промотора.

[0124] [Пример 5] Анализ микроРНК, увеличенной в высокопродуцирующих антитело клетках СНО

Как иллюстрировано Фигурой 15, для анализа микроРНК использовали набор для синтеза первой цепи микроРНК Mir-XTM (Clontech). 3’-концы этих малых РНК, полученных из следующих клеток, были снабжены поли(А)-хвостами: высокопродуцирующая MAb1 (анти-IL-6R-антитело) клетка DXB11s и высокопродуцирующая и сильно экспрессирующая TAUT клетка DXB11s, обе из которых находились в субкультуре, и клетка-хозяин DXB11s, в которую еще не был введен ген антитела. После этого адаптор, имеющий олиго dT на 3’-концах и последовательность праймера для ПЦР (mRQ 3’-праймер) на 5’-концах, подвергали праймированию для синтеза первых цепей кДНК. qPCR (количественную полимеразную цепную реакцию) проводили с использованием полученных кДНК в качестве матриц, mRQ 3’-праймера и праймера, специфического для микроРНК, полученного из ожидаемой последовательности APES (APES 40-61 5’-праймера или APES 71-91 5’-праймера), и дополнительно, U6 snRNA 5’-праймера в качестве положительного контроля (30 циклов 95°C в течение 5 сек, 60°C в течение 20 с). Полученные жидкости реакции ПЦР очищали и затем подвергали электрофорезу на 3% агарозном геле. Как иллюстрируется Фигурой 16, полосы предполагаемого размера были детектированы при помощи этой ПЦР с использованием праймера APES 40-61 5’ и праймера U6 snRNA 5’. Как показано Дорожками 1, 2 и 3, 22 нуклеотида of APES 40-61 (AAGTACCAAAATAATTACCAAC; SEQ ID NO: 10) экспрессировались при высоких уровнях в высокопродуцирующих MAb1 (анти-IL-6R-антитело) клетках. Уровень экспрессии U6 snRNA (Дорожка 4) в качестве положительного контроля был сравнимым в любых клетках, и присутствие APES 71-91 (CATATACAACATTTACAAGAA; SEQ ID NO: 15) не подтверждалось (данные не показаны). На основании этих открытий, предполагается, что последовательность APES 40-61 (22 нуклеотидов), консервативная независимо от вида, могла бы способствовать в качестве микроРНК высокому продуцированию антитела.

[0125] [Пример 6] Пример более высокого роста, происходящего из сильной экспрессии APES в клетке-хозяине для продуцирования антитела

Из клетки-хозяина для продуцирования антитела DXB11/TAUT, была получена высокопродуцирующая антитело клетка (DXB11/TAUT/MAb1), которая продуцировала 3,9 г/л MAb1 (анти-IL-6R-антитела) на 14-й день культивирования с подпиткой в 1-литровом сосуде. Способность TAUT поддерживать выживаемость, помогала продуцированию 8,1 г/л в 31-й день культивирования, но необходимым было увеличение наивысшей плотности клеток (4,1×106 клеток/мл) для достижения высокого продуцирования в 14-й день культивирования, с учетом фактической продукции. Если супрессированная мРНК NfkBia экспрессия, происходящая из сильной экспрессии APES (Пример 4), стимулирует активацию Nfkb, экспрессия связанного с ростом гена могла бы увеличиваться и, следовательно, наивысшая плотность клеток могла бы, возможно, увеличиваться. Плазмиду для коэкспрессии APES и плазмиду для коэкспрессии ALT1, которые способствуют более высокому продуцированию антитела, как в случае с APES (pPur-APES165, pPur-ALT1, соответственно; Фигура 17), каждую, вводили в вышеописанные высокопродуцирующие антитело клетки DXB11/TAUT/MAb1 (родительский штамм). Отбирали три лучших штамма с наиболее высокой скоростью роста, каждых для этих двух типов, и подвергали шейкерному культивированию с подпиткой. В результате, средняя величина наивысшей плотности клеток была (11,5±1,7)×106 клеток/мл для сильно экспрессирующих APES165 клеток, показывая, что были получены более хорошо растущие клетки, чем сильно экспрессирующие ALT1 клетки ((8,9±1,8)×106 клеток/мл. Далее, средние величины количеств продуцирования антител в 14-й день этой шейкерной культуры с подпиткой были 4,4±0,6 г/л для сильно экспрессирующих APES клеток и 4,0±0,6 г/л для сильно экспрессирующих ALT1, которые были более высокими, чем 3,4 г/л для клеток DXB11/TAUT/MAb1, в которых еще не была введена плазмида. Этот результат показывает, что сильно экспрессирующее APES действие положительно продуцировалось независимо от сильно продуцирующего TAUT действия (Фигура 18). Это положительное действие, происходящее из сильной экспрессии APES, явно наблюдалось в культуре с подпиткой в 1-литровых сосудах. Сравнение клеток с высокой скоростью роста в шейкерной культуре с подпиткой выявило наивысшую скорость роста сильно экспрессирующего APES штамма, который показал его преимущество высокой продуцируемости в краткосрочной культуре, с величиной 5,3 г/л на 12-й день культивирования в сравнении с 3,2 г/л для родительского штамма и 4,4 г/л для сильно экспрессирующего ALT1 штамма (Фигура 19). На основании этих результатов, авторы данного изобретения решили модифицировать клетку-хозяина для получения антитела DXB11/TAUT в клетку-хозяина, которая проявляет более высокую скорость роста, и получили сильно экспрессирующие APES165 клетки-хозяева DXB11/TAUT/APES. Введение гена выполняли введением pPur-APES165 в хозяина DXB11/TAUT посредством электропорации. Для этих девяти кандидатных штаммов-хозяев, которые были хорошими как в выживаемости, так и в росте после селекции лекарственного средства, определяли количественно уровни экспрессии snRNA APES (малой некодирующей РНК) в субкультуре. Кандидатный штамм-хозяин DXB11/TAUT/APES, который экспрессировал APES при высоком уровне, имел высокую величину плотности жизнеспособных клеток во время культивирования и обнаруживал корреляцию (R2=0,70) (Фигура 20).

[0126] [Пример 7] Пример 2 более высокого продуцирования, происходящего из сильной экспрессии APES в продуцирующих антитело клетках

Как и в случае с Примером 3, плазмиды, экспрессирующие 5’-концевые частичные последовательности транскрипта AI462015, вводили в сильно экспрессирующие MAb1 клетки DXB11s и сравнивали их антитело-продуцирующие потенциалы.

[0127] Наряду с APES4-168 (APES165), экспрессионные единицы APES4-68 (SEQ ID NO: 5) и APES69-133 (SEQ ID NO: 6), каждая из которых состояла из частичной последовательности APES4-168, получали для исследования антитело-продуцирующих потенциалов этих клеток. В сравнении с сильной нуль-векторной экспрессией (нуль), APES4-68 и APES69-133 обнаруживали высокое продуцирование антитела со значимыми различиями p<0,05 и p<0,01 соответственно (t-критерий, P<0,001, Фигура 21).

[0128] Фигура 22 показывает, какие районы соответствующих частичных последовательностей, имеющих APES-активность, которые были идентифицированы в Примерах 3 и 7, соответствуют районам в транскрипте AI462015 мыши. Эти частичные последовательности, проявляющие APES-активность, содержат по меньшей мере 23 нуклеотида комплементарной Nfkbia последовательности.

[0129] [Пример 8] Анализ гена, относящегося к APES

На основании информации об этом гене в момент подачи этой заявки, в Примере 1 заявляется, что “AI462015 является некодирующей мРНК мРНК-типа из 437 нуклеотидов и его последовательность находится на комплементарной цепи вблизи 3’-нетранслируемого района (56590831-56590397) гена NfkBia в геноме мыши 12”. Однако последующее уточнение информации, даваемое GeneBank, выявило, что эти 437 нуклеотидов, которые являются транскриптом AI462015, соответствуют комплементарной цепи 3’-нетранслируемого района (513 нуклеотидов) гена NfkBia мыши (Фигура 23). Как показано на Фигуре 24, имеется гомологичная последовательность на последовательности генома клеток CHO-K1, которая была опубликована после подачи этой заявки (SEQ ID NO: 25: AI462015; SEQ ID NO: 26-27: геном CHO-K1). Далее, супрессию экспрессии NfkBia наблюдали в высокопродуцирующих антитело клетках СНО. (Пример 4). Таким образом, возможно, что гомологичная последовательность AI462015 экспрессируется при высоком уровне в клетках СРО и функционирует в них.

[0130] Д<анное изобретение может быть применено к любым клеткам, продуцирующим рекомбинантный полипептид, такой как антитело.

[0131] Все публикации, патенты и заявки на патент, цитируемые здесь, включены здесь посредством ссылки в их полном виде.

1. Способ получения антитела, предусматривающий культивирование клетки, которая экспрессирует усиливающую продуцирование антитела последовательность (APES), которую искусственно вставляли в клетку и в которую была введена экзогенная ДНК, кодирующая желаемое антитело, с получением посредством желаемого антитела; и где APES является молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, которая может связываться с ДНК или мРНК гена NfkBia, полученной из человека, мыши, крысы или хомячка спариванием оснований, и может супрессировать экспрессию гена NfkBia.

2. Способ по п. 1, где APES является малой РНК с длиной самое большее 30 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований, и где последовательность с длиной 19-25 нуклеотидов является любой частичной последовательностью в нуклеотидной последовательности, представленной SEQ ID NO: 2.

3. Способ по п. 1, где APES является некодирующей РНК мРНК-типа с длиной самое большее 561 нуклеотид, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований, и где последовательность с длиной 19-25 нуклеотидов является любой частичной последовательностью в нуклеотидной последовательности, представленной SEQ ID NO: 2.

4. Способ по п. 1, где APES является некодирующей РНК мРНК-типа с длиной 561-1579 нуклеотидов, содержащей последовательность с длиной 19-25 нуклеотидов, которая может связываться с частью мРНК NfkBia спариванием оснований, и где последовательность с длиной 19-25 нуклеотидов является любой частичной последовательностью в нуклеотидной последовательности, представленной SEQ ID NO: 2.

5. Способ по любому из пп. 1-4, где APES выбрана из молекул нуклеиновых кислот, каждая из которых содержит любую из следующих нуклеотидных последовательностей:

(а) ДНК, состоящей из нуклеотидной последовательности любой из SEQ ID NO: 1-16 и 29;

(b) ДНК, которая содержит вышеупомянутую последовательность (a) и является частичной последовательностью 3'-нетранслируемого района гена NfkBia;

(c) ДНК, состоящей из нуклеотидной последовательности, идентичной вышеупомянутой последовательности (а) или (b), за исключением одного или нескольких нуклеотидов;

(d) РНК, которая является вышеупомянутым транскриптом (а), (b) или (с); и

(e) ДНК или РНК, состоящей из последовательности, которая может связываться с вышеупомянутой последовательностью (а) спариванием оснований.

6. Способ по п. 1, где клетка является сильно экспрессирующей APES клеткой.

7. Способ по п. 1, где клетка, в которую была искусственно введена APES, является клеткой, трансфицированной APES.

8. Способ по п. 1, где клетка, в которую была введена APES, является клеткой, в которой была активирована транскрипция эндогенной APES.

9. Способ по п. 1, где ДНК, кодирующая транспортер таурина, была дополнительно введена в клетку.

10. Способ по п. 1, где ДНК, кодирующая декарбоксилазу цистеинсульфиновой кислоты, была дополнительно введена в клетку.

11. Способ по п. 1, где ДНК, кодирующая аланинтрансферазу, была дополнительно введена в клетку.

12. Способ по п. 1, где клетка является клеткой яичника китайского хомячка.

13. Способ получения фармацевтического препарата, содержащего антитело, включающий: получение антитела способом по любому из пп. 1-12 и формулирование указанного антитела в фармацевтическую композицию путем смешивания указанного антитела с фармацевтически приемлемым носителем или разбавителем.

14. Молекула нуклеиновой кислоты, которая состоит из любой из следующих последовательностей и обладает APES активностью:

(а) ДНК, состоящая из нуклеотидной последовательности, представленной любой из SEQ ID NO: 2, 4-16 и 2 9;

(b) ДНК, состоящей из нуклеотидной последовательности, идентичной последовательности, представленной любой из SEQ ID NO: 1-16 и 29, за исключением одного нуклеотида; или

(c) РНК, являющейся транскриптом указанных выше (а) или (b).

15. Применение вектора, включающего молекулу нуклеиновой кислоты по п. 14 или молекулы нуклеиновой кислоты, которая включает одну из следующих нуклеотидных последовательностей и обладает APES активностью:

(a) ДНК, состоящая из нуклеотидной последовательности, представленной любой из SEQ ID NO: 2-16 и 29;

(b) ДНК, которая состоит из последовательности, указанной выше в (а), и которая является частичной последовательностью 3'-нетранслируемого района гена NfkBia;

(c) ДНК, состоящая из нуклеотидной последовательности, идентичной последовательности, представленной любой из SEQ ID NO: 1-16 и 29, или последовательности (b), за исключением одного или нескольких нуклеотидов;

(d) РНК, являющаяся транскриптом указанных выше (а), (b) или (с); или

(e) ДНК или РНК, состоящая из последовательности, которая может связываться с последовательностью, указанной выше в (а), спариванием оснований в способе по любому из пп. 1-13.

16. Применение клетки, в которую искусственно ввели молекулу нуклеиновой кислоты по п. 14 или вектор по п. 15 в способе по любому из пп. 1-13.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения поверхностно-активных белков.

Изобретение относится к области биотехнологии, конкретно к мутеинам белка липокалина, а также к полученным на их основе специфично связывающимся терапевтическим или диагностическим белкам, направленным против гепсидина, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного белка TNFR1-Fc в клетках HEK293.

Изобретение относится к области генной инженерии, конкретно к рекомбинантному получению антиангиогенных пептидов, и может быть использовано в медицине. Способ получения рекомбинантного антиангиогенного пептида Тумастина - производного модифицированного фрагмента [L69K-95] тумстатина человека с присоединенными к N- и С-концам последовательностями Ser-Gly-Ala-Met-Gly и Pro-Gly-Pro соответственно, предусматривает культивирование штамма-продуцента Е.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного слитого белка, состоящего из опухоль-специфического пептида и противоопухолевого пептида RL2.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного слитого белка, состоящего из опухоль-специфического пептида и противоопухолевого пептида RL2.

Изобретение относится к области биотехнологии, а именно к рекомбинантному получению антимикробного пептида минибактенецина ChBac7.5Nα из лейкоцитов козы Capra hircus, который может найти применение в медицинской и ветеринарной практике в качестве антибиотика широкого спектра действия.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в Escherichia coli, и может быть использовано для получения рекомбинантного пищевого аллергена гороха посевного Pisum sativum.

Группа изобретений относится к биотехнологии и фармакологии и касается штаммов Lactobacillus brevis 47f, Lactobacillus rhamnosus 313, Lactobacillus rhamnosus 40f и Lactobacillus brevis 15f, способных синтезировать антиоксидант глутатион.

Изобретение относится к области биотехнологии, может быть использовано для получения альфа-фетопротеина (АФП) человека с использованием штаммов дрожжей Saccharomyces cerevisiae, содержащих рекомбинантный ген АФП.

Изобретение относится к области биохимии. Предложено выделенное антитело или его функциональная часть, способное специфически связывать респираторно-синцитиальный вирус (РСВ).

Изобретение относится к области биохимии. Предложено антитело к рецептору эпидермального фактора роста 2 (HER2) человека, а также включающие указанное антитело фармацевтические композиции, предназначенные для профилактики и лечения злокачественной опухоли и для индуцирования апоптоза.

Настоящая группа изобретений относится к биотехнологии и медицине. Предложены связывающая молекула, специфически связывающаяся с двумя различными эпитопами на HER2, и способ ее получения, а также кодирующая ее молекула нуклеиновой кислоты, экспрессирующий вектор, включающий эту молекулу нуклеиновой кислоты, клетка-хозяин для экспрессии связывающей молекулы, трансформированная экспрессирующим вектором, и фармацевтическая композиция для лечения рака, включающая связывающую молекулу, или молекулу нуклеиновой кислоты ее кодирующую, или экспрессирующий вектор.

Изобретение относится к области биохимии. Заявлено антитело, специфически связывающееся с PTK7 (протеинтирозинкиназа 7) человека, а также конъюгат указанного антитела с цитотоксическим агентом.

Изобретение относится к области биохимии. Заявлены связывающие белки, представляющие собой иммуноглобулины с двойными вариабельными доменами, которые связывают IL-1α и IL-1β.

Данное изобретение относится к иммунологии. Предложено антитело, связывающее кластерин, и его антигенсвязывающий фрагмент.

Группа изобретений относится к биотехнологии, а именно к получению иммуноглобулиновой композиции со сниженным уровнем тромбогенных агентов. Способы включают фракционирование плазмы крови по Кону и/или по Кистлеру-Ничманну с получением содержащего иммуноглобулин раствора.
Группа изобретений относится к области фармацевтики и медицины и касается гипотонических фармацевтических составов низкой вязкости, содержащих концентрированное PRO 140 моноклональное антитело в количестве от 100 до 200 мг/мл, регулятор тоничности в виде соли, выбранной из хлорида натрия, глюконата натрия или лактата натрия, в количестве от 90 до 95 мМ и буферный раствор.

Изобретение относится к области биохимии. Заявлено применение антитела, специфичного к CD19, в синергетической комбинации с бендамустином для лечения неходжкинской лимфомы, хронического лимфоцитарного лейкоза и/или острого лимфобластного лейкоза.

Изобретение относится к области биохимии. Описана группа изобретений, включающая антитело или его антигенсвязывающий фрагмент, которые связываются с PD-1; гуманизированное антитело или его антиген-связывающий фрагмент; фармацевтическая композиция для лечения заболевания, связанного со взаимодействием В7-Н1 с PD-1; способ лечения злокачественной опухоли у индивидуума, а также способ лечения инфекционного заболевания, связанного со взаимодействием В7-Н1 с PD-1, где вышеуказанные способы включают введение фармацевтической композиции; применение вышеуказанного антитела или антиген-связывающего фрагмента для получения лекарственного средства для лечения злокачественной опухоли, а также для получения лекарственного средства для лечения инфекционного заболевания, связанного со взаимодействием В7-Н1 с PD-1; способ обнаружения или диагностики заболевания, нарушения или инфекции, связанного (ой) со взаимодействием В7-Н1 с PD-1, способ контроля за прогрессированием заболевания, нарушения или инфекции, способ контроля ответа на лечение заболевания, нарушения или инфекции, способ лечения заболевания, отличающегося повышенной экспрессией PD-1, способ лечения заболевания, отличающегося повышенной экспрессией В7-Н1, где способы включают в себя использование вышеуказанного антитела или его антиген-связывающего фрагмента.

Изобретение относится к области биохимии. Изобретение представляет собой фрагмент ингибитора циклин-зависимой киназы p16INK4a, способный индуцировать иммунный ответ против p16INK4a , молекулу нуклеиновой кислоты, вектор, содержащий молекулу нуклеиновой кислоты, вирусный вектор, а также их применение.

Представлены способ получения антитела, способ получения фармацевтического препарата, содержащего антитело, полученного указанным способом, молекула нуклеиновой кислоты, применение вектора, содержащего такую молекулу нуклеиновой кислоты, и применение клетки, в которую искусственно ввели указанные молекулу нуклеиновой кислоты или вектор в способе получения антитела. Представленный способ получения антитела предусматривает культивирование клетки, которая экспрессирует усиливающую продуцирование антитела последовательность, которую искусственно вставляли в клетку и в которую была введена экзогенная ДНК, кодирующая желаемое антитело, с получением желаемого антитела, и где APES является молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, которая может связываться с ДНК или мРНК гена NfkBia, полученной из человека, мыши, крысы или хомячка спариванием оснований, и может супрессировать экспрессию гена NfkBia. Изобретения позволяют продуцировать антитело на высоком уровне с подавлением экспрессии NfkBia. 5 н. и 11 з.п. ф-лы, 29 ил., 8 пр.

Наверх