Олигонуклеотидные праймеры и флуоресцентно-меченый зонд, способ и тест-система пцр в режиме реального времени для выявления генома каприпоксвирусов

Изобретение относится к ветеринарной вирусологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена Р32 каприпоксвирусов:

Предложен также способ выявления генома каприпоксвирусов с использованием праймеров и зонда и тест-система ПЦР в режиме реального времени. Для проведения ПЦР-РВ используют амплификацию фрагмента гена белка Р32. Разработан высокочувствительный набор, состоящий из готовой ПЦР смеси, Taq-ДНК-полимеразы, положительного контроля и отрицательного контроля, позволяющий в кратчайшие сроки специфично выявить геном каприпоксвирусов. Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК каприпоксвирусов в пробах широкого спектра патологического и биоматериала. 3 н.п. ф-лы, 3 пр., 1 ил.

 

Изобретение относится к ветеринарной вирусологии, к средствам молекулярной диагностики, а именно к выявлению генома каприпоксвирусов в реакции полимеразной цепной реакции в режиме реального времени (ПЦР-РВ).

Заболевания, вызываемые возбудителями, относящимися к роду Capripoxvirus (оспа овец, оспа коз, заразный узелковый дерматит крупного рогатого скота), в соответствии с классификацией МЭБ относятся к категории особо опасных инфекционных болезней, подлежащих обязательной нотификации, способны вызывать эпизоотии и наносить огромный экономический ущерб животноводству, слагающийся из гибели и вынужденного убоя больных животных, снижения продуктивности, абортов, затрат на проведение ветеринарно-санитарных и охранно-карантинных мероприятий [1, 2].

В настоящее время данные заболевания регистрируются на всех континентах, за исключением Австралии и Океании. Напряженная ситуация остается в странах СНГ Среднеазиатского и Кавказского регионов (Казахстан, Таджикистан, Киргизия, Азербайджан, Грузия), которые представляют наибольшую угрозу для Российской Федерации в отношении заноса возбудителей болезней, так как со многими из них имеется общая граница и тесные экономические связи. В РФ оспа мелких жвачных животных периодически возникает на Дальнем Востоке, а в 2015 году была зарегистрирована вспышка заболевания в Северно-Кавказском регионе РФ [3]. Кроме того, в 2015 году в Российскую Федерацию было занесено новое заболевание - нодулярный дерматит крупного рогатого скота, и наблюдаются тенденции к его распространению [4]. Массовое распространение каприпоксвирусов на территории РФ в 2015-2016 гг. [5] требует разработки высокочувствительных методов диагностики данных заболеваний, позволяющих проводить мониторинг среди латентно-инфицированных восприимчивых животных и в кратчайшие сроки выявлять вирусоносительство с целью применения мер для предотвращения и борьбы с каприпоксвирусами.

Известен способ диагностики каприпоксвирусов вирусологическим методом, основанном на культивировании возбудителя на чувствительных клеточных культурах, в результате роста которого в культуре клеток проявляется цитопатический эффект от вируса [6]. Недостатками данного метода являются: длительность постановки, трудоемкость и необходимость использования биологических моделей, таких как культуры клеток.

Известен способ детекции антигена поксвирусов с помощью иммунодиффузии в геле. Недостатком данного метода является кросс-реактивность с антителами к другим поксвирусам, невозможность отличить каприпоксвирусы от вируса эктимы овец [6].

Известен способ выявления каприпоксвирусов с помощью электронной микроскопии. Недостатком данного метода является невозможность морфологически отличить вирионы каприпоксвиурсов от ортопоксвирусов [7].

Известен способ выявления вирусных частиц каприпоксвирусов с помощью иммуногистохимиии. Недостатком данного способа является высокая трудоемкость и необходимость получения моноклональных антител [8].

Известен способ выявления генома каприпоксвирусов с помощью классической ПЦР на основе поверхностного белка прикрепления [9]. Недостатком метода является то, что существует риск перекрестной контаминации ввиду необходимости проведения электрофореза для анализа продуктов реакции.

Наиболее близким к заявленному изобретению является тест-система «Lumpy Skin Disease, Sheeppox virus, Goatpox virus Real Time PCR Kit» (Liveriver, Китай) [10]. Однако согласно инструкции производителя для данной тест-системы для исследования пригодны только соскобы с нодул, содержимое нодул, лимфоузлы и тканевые поражения. К тому же реакцию можно проводить на ограниченном перечне амплификаторов.

Таким образом, технической проблемой является разработка надежного, с возможностью исследования широкого спектра биологического материала, чувствительного и специфичного количественного способа обнаружения генома каприпоксвирусов методом полимеразной цепной реакции в режиме реального времени путем конструирования набора, содержащего специфичные олигонуклеотидные праймеры и ДНК-зонд, а также подбора условий для проведения ПЦР, обеспечивающего минимальный риск контаминации при исследовании и исключающего субъективность при оценке результатов.

Изобретение касается тест-системы, состоящей из олигонуклеотидных праймеров и флуоресцентно-меченого зонда для специфичной экспресс-идентификации генома каприпоксвирусов методом ПЦР-РВ. Представленный метод включает последовательности олигонуклеотидов, родоспецифичные для каприпоксвирусов и имеющие следующую нуклеотидную последовательность:

В качестве источника флуоресценции на 5'-конце зонда применяют краситель FAM, а для тушения флуоресценции на 3'-конце - BHQ1. Флуоресценцию измеряют по каналу FAM. Пересечение кривой флуоресценции линии threshold свидетельствует о наличии в образце генома каприпоксвируса, причем чем меньше показатель «Ct», тем выше количество генома каприпоксвируса в исследуемом образце. Отсутствие пересечения кривой флуоресценции линии threshold свидетельствует об отсутствии генома каприпоксвируса в исследуемом материале.

Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК каприпоксвирусов в пробах патологического и биоматериала.

Техническим результатом изобретения является: расширенный спектр биологического материала (внутренние органы, нодулы, сыворотка крови, цельная кровь, культура клеток), пригодного для проведения исследований без возможности получения ложноположительных результатов; возможность использования широкого спектра амплификаторов, отвечающих минимальным требованиям для постановки ПЦР; сокращение времени для проведения массовых исследований проб на наличие генома каприпоксвирусов.

Сущность изобретения состоит в том, что при помощи указанных праймеров (CaPV_f_new, CaPV_R_new) и зонда (CaPV_probe) проводят ПЦР-РВ для выявления генома каприпоксвирусов. В качестве мишени выбран фрагмент гена, кодирующий поверхностный белок Р32, который консервативен для всех каприпоксвирусов. Высокая степень консервативности гена подтверждена сравнением опубликованных в настоящее время последовательностей каприпоксвирусов с аналогичными нуклеотидными последовательностями других каприпоксвирусов (база данных GenBank), а также с помощью лабораторных исследований.

Сущность изобретения пояснена на графическом изображении, на котором представлена линейность результатов ПЦР-РВ при тестировании 10-кратных разведений выделенной ДНК вируса заразного узелкового дерматита, оспы овец или оспы коз.

Детекция продуктов амплификации осуществляется методом регистрации флуоресценции, генерируемой в результате разрушения гибридизационного зонда, с красителем FAM на 5'-конце и гасителем BHQ1 на 3'-конце. В отсутствии мишени краситель и гаситель сближены, и наблюдается лишь незначительная флуоресценция, так как гаситель поглощает испускаемое красителем излучение. При накоплении в ходе ПЦР специфических продуктов зонд гибридизируется на ампликон, что ведет к его разрушению за счет 5'-экзонуклеазной активности Taq-полимеразы. В результате флуорофор отделяется от гасителя, и его излучение может быть детектировано. Таким образом, увеличение флуоресценции прямо пропорционально количеству синтезированного ПЦР-продукта.

Праймеры и зонды комплементарны консервативной области гена, кодирующего поверхностный белок Р32, и не комплементарны каким-либо участкам генома других поксвирусов.

Для разработки праймеров из базы данных GenBank были получены полногеномные последовательности каприпоксвирусов. Последовательности выравнивали с помощью программы Bioedit, затем визуально оценивали консервативные участки, на основе которых были получены ряд праймеров. В результате тестирования при различных параметрах была получена оптимальная пара праймеров и зонда, которая используется в тест-системе.

Набор для выявления генома каприпоксвирусов в ПЦР-РВ состоит из следующих компонентов:

№1 - готовая ПЦР-смесь, объем 550 мкл - 2 пробирки;

№2 - фермент Taq-ДНК-полимераза, объем 12,5 мл - 1 пробирка;

№3 - положительный контрольный образец, объем 100 мкл - 1 пробирка;

№4 - отрицательный контрольный образец, объем 100 мкл - 1 пробирка.

ПЦР-РВ проводится в одну стадию с использованием готовой ПЦР-смеси (№1), включающей на одну реакцию буфер 5х для ПЦР-РВ (5 мкл), 25 мМ хлорид магния (3,5 мкл), дезоксирибонуклеотидтрифосфаты (0,5 мкл 10 пмоль), олигонуклеотидные праймеры (1,5 мкл каждого праймера 10 пмоль), зонд (0,8 мкл 5 пмоль) и фермент Taq-ДНК-полимеразу в программируемом амплификаторе. Перед началом постановки реакции необходимо разморозить все необходимые компоненты реакции, встряхнуть на шейкере, затем центрифугировать несколько секунд на низкоскоростной центрифуге.

Реакционную смесь для проведения ПЦР-РВ готовят в пробирке в расчете на одну реакцию (V=25 мкл) следующим образом:

- готовая ПЦР-смесь №1 - 20 мкл,

- фермент Taq-ДНК-полимераза №2 - 0,25 мкл,

- выделенная ДНК (отриц. контроль №3 или полож. контроль №4) - 5 мкл.

Приготовленную в отдельных 1,5 мл пробирках реакционную ПЦР-смесь переносят в 0,2 мл пробирки по 20 мкл и вносят 5 мкл суммарной ДНК. В соответствующие пробы вносят также выделенные образцы ДНК, отрицательного и положительного контролей. Общий объем смеси - 25 мкл.

Устанавливают пробирки в амплификатор для постановки ПЦР-РВ, отмечают в программе расположение и характеристику проб, выбирают рабочий краситель (FAM), устанавливают в программе температурно-временной профиль реакции.

После первоначальной денатурации при 95°C в течение 10 мин ПЦР-РВ проводят в следующих условиях: 95°C - 15 с, 60°C - 60 с - 45 циклов.

Результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, что соответствует наличию или отсутствию значения порогового цикла «Ct» в соответствующей графе в таблице результатов реакции, выведенной в результате машинного анализа.

Результат считается достоверным только в случае прохождения положительного (Ct<35) и отрицательного (Ct не определен) контролей амплификации.

Образец считается положительным на наличие ДНК каприпоксвируса, если значение Ct не более 35. Однако в случае, если значение Ct для проб находится в пределах от 30 до 35, необходимо повторить реакцию с целью подтвердить или опровергнуть наличие ДНК вируса в исследуемой пробе.

Образец считается отрицательным на наличие ДНК вируса, если для него значение Ct отсутствует или более 37.

Результаты не подлежат учету (считаются недействительными):

- в случае отсутствия регистрации роста флуоресценции в пробе с положительным контролем, что может свидетельствовать об ошибках, допущенных на этапе постановки ПЦР-РВ;

- в случае регистрации значения Ct в таблице результатов на экране компьютера для отрицательного контрольного образца, что указывает на наличие контаминации.

В любом из этих случаев необходимо повторить анализ всех проб, а при повторном выявлении контаминации отрицательного контроля - принять меры по выявлению и ликвидации источника контаминации.

Сущность предлагаемого изобретения пояснена примерами его использования, которые не ограничивают объем изобретения.

Пример 1. Оценка специфичности тест-системы

Для оценки специфичности тест-системы использовались следующие образцы гетерологичных вирусов, депонированных в коллекции штаммов микроорганизмов ФГБУ «ВНИИЗЖ»: ДНК вируса заразного узелкового дерматита штамма ВНД КРС/Дагестан/2015 (диагностический), ДНК вируса заразного узелкового дерматита штамма НД КРС Э-95, ДНК вакцинного штамма Neethling, ДНК вируса оспы овец штамма «Афганский», ДНК вируса оспы овец вакцинного штамма «ВНИИЗЖ», ДНК вируса оспы коз штамма «Приморский 2003», ДНК вируса оспы коз штамма «ВНИИЗЖ 2003», ДНК вируса чумы мелких жвачных штамма «ВНИИЗЖ», ДНК вируса везикулярного стоматита штамма «ВНИИЗЖ», ДНК вируса оспы коров штамма «ВНИИЗЖ».

Работу с ДНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности [11].

Процедуру выделения ДНК из исследуемого материала проводили с использованием набора реагентов на основе мембранных колонок.

ПЦР-РВ проводили в реакционной смеси следующего состава (на 1 исследование):

- готовая ПЦР-смесь №1 -20 мкл,

- фермент Taq-ДНК-полимераза №2 - 0,25 мкл,

- выделенная ДНК (отриц. контроль №3 или полож. контроль №4) - 5 мкл.

ПЦР-РВ и регистрацию результатов проводили в амплификаторе согласно термическому профилю, описанному выше.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линии, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случаи, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию.

При тестировании специфичности тест-системы с использованием ДНК гомологичных и гетерологичных вирусов ложноположительных результатов с вирусами, не входящими в род Capripoxvirus, не выявлено.

Пример 2. Оценка чувствительности и эффективности тест-системы

Для оценки чувствительности использовали ДНК вируса заразного узелкового дерматита штамма ВНД КРС/Дагестан/2015 (диагностический) с титром 6,17. Метод ПЦР-РВ выявлял ДНК с чувствительностью 0,17 lg/мл. Для оценки эффективности амплификации было проведено 3 повторных эксперимента и получены значения Ct, которые использовались для вычисления эффективности. С помощью средних значений Ct была получена линейная регрессия со значением эффективности амплификации (Е) 90,2%. Полученные данные приведены на графическом изображении.

Пример 3. Оценка воспроизводимости тест-системы

Воспроизводимость определяли с помощью величины стандартного отклонения (SD) для каждой серии разведений, используя полученные значения Ct. Стандартное отклонение SD варьировало от 0,12 до 0,32 на протяжении 6 10-кратных разведений.

Таким образом, изобретение может быть использовано в ветеринарной практике для выявления генетического материала каприпоксвирусов в биологических и культуральных образцах для постановки и уточнения диагноза, для решения научно-исследовательских задач по мониторингу распространения каприпоксвирусов среди восприимчивых и латентно-инфицированных животных. Использование специфических праймеров и зонда позволяет выявить генетический материал каприпоксвирусов в исследуемых образцах методом полимеразной цепной реакции (ПЦР) в режиме реального времени (РВ).

Источники информации, принятые во внимание при составлении описания изобретения к заявке на выдачу патента РФ на изобретение «Олигонуклеотидные праймеры и флуоресцентно-меченый зонд, способ и тест-система ПЦР в режиме реального времени для выявления генома каприпоксвирусов»

1. Beard, P.M. Lumpy skin disease: a direct threat to Europe // Vet Rec., 2016, v. 28, p. 557-558.

2. Tuppurainen ES, Venter EH, Shisler JL, Gari G, Mekonnen GA, Juleff N, Lyons NA, De Clercq K, Upton C, Bowden TR, Babiuk S, Babiuk LA. Capripoxvirus Diseases: Current Status and Opportunities for Control // Transbound Emerg Dis., 2015.

3. http://www.fsvps.ru/fsvps/print/news/15919.html.

4. Бирюченкова M.В., Тимина A.M., Зиняков H.Г., Щербаков A.B. Результаты генодиагностики нодулярного дерматита в Дагестане и Чеченской Республике - первое официальное подтверждение болезни на территории Российской Федерации // Ветеринария сегодня. - 2015. - №4. - С. 43-45.

5. Кононов А.В., Кононова С.В., Шумилова И.Н. [и др.] Культурально-биологические свойства возбудителя нодулярного дерматита крупного рогатого скота, выделенного на территории Российской Федерации в 2015 году: научное издание // Ветеринария сегодня. - 2016. - №3. - С. 8-18.

6. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.4.13 // Lumpy skin disease. 2017.

7. Kitching RP, Smale C. Comparison of the external dimensions of capripoxvirus isolates // Res Vet Sci. – 1986. - 41(3) - Р. 425-427.

8. Babiuk S1, Parkyn G, Copps J, Larence JE, Sabara MI, Bowden TR, Boyle DB, Kitching RP. Evaluation of an ovine testis cell line (OA3.Ts) for propagation of capripoxvirus isolates and development of an immunostaining technique for viral plaque visualization // J Vet Diagn Invest. 2007. - 19(5). - p. 486-491.

9. Ireland DC1, Binepal YS. Improved detection of capripoxvirus in biopsy samples by PCR // J Virol Methods. 1998. V. 74(1). P. 1-7.

10. http://www.biosb.com/wp-content/uploads/AD-0111-02-Lumpy-Skin-Disease-Virus-Sheeppox-Virus-and-Goatpox-virus-Real-Time-PCR-Kit.pdf.

11. МУ 1.3.2569-09 Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности.

1. Олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена Р32 каприпоксвирусов:

CaPV_f_new-5' ATGAAACCAATGGATGGGATA 3',

CaPV_R_new-5' CGAAATGAAAAACGGTATATGGA 3',

CaPV_probe-5' ATGAGCCATCCATTTTCCAA 3'.

2. Способ выявления генома каприпоксвирусов с использованием олигонуклеотидных праймеров и зонда по п. 1 в реакции ПЦР-РВ, состоящей из следующих этапов: первоначальная денатурация при 95°C в течение 10 мин и термическое циклирование при 95°C - 15 с, 60°C - 60 с - 45 циклов.

3. Тест-система для выявления генома каприпоксвирусов в реакции ПЦР-РВ, включающая готовую ПЦР смесь, фермент Taq-ДНК-полимеразу, положительный контрольный образец, отрицательный контрольный образец, содержащие олигонуклеотидные праймеры и зонд по п. 1.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к ДНК-маркеру для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, путем проведения массового анализа методом ПЦР в режиме реального времени по технологии TaqMan.

Изобретение относится к биохимии. Описан способ ПЦР диагностики смешанных хронических рецидивирующих инфекций глаз.

Изобретение относится к области медицины и предназначено для прогнозирования наличия хромосомных аномалий в эмбрионах удовлетворительного и плохого качества в программе экстракорпорального оплодотворения (ЭКО).

Предложенная группа изобретений относится к области медицины. Предложен способ диагностики и/или определения у субъекта предрасположенности к развитию острого повреждения почек, включающий определение уровня экспрессии по меньшей мере miR-26b и сравнение указанного уровня экспрессии с контрольным значением, где снижение экспрессии является показателем острого повреждения почек или предрасположенности к развитию острого повреждения почек.

Изобретение относится к области биохимии, в частности к способу диагностики и мониторирования течения церебральных глиом, включающему определение уровней экспрессии генов микроРНК.

Изобретение относится к биотехнологии. Описан способ оценки риска сердечно-сосудистых событий у субъекта, включающий стадии определения в образце, выделенном от указанного субъекта, страдающего хроническим заболеванием почек, присутствия полиморфизмов в положении 27 в последовательностях нуклеиновой кислоты из SEQ ID NO:1-8, или в последовательности, находящейся в сильном неравновесном сцеплении с последовательностью из любой из SEQ ID NO:1-8, где присутствие в положении 27 С в SEQ ID NO:1, С в SEQ ID NO:2, T в SEQ ID NO:3, С в SEQ ID NO:4, С в SEQ ID NO:5, A в SEQ ID N0:6, T в SEQ ID NO:7 и G в SEQ ID NO:8, что соответствует номеру доступа в db SNP rs17465637, rs6725887, rs9818870, rs12526453, rs1333049, rs501120, rs9982601, rs10455872, соответственно, или присутствие полиморфизма в последовательности любого другого rs, который находится в сильном неравновесном сцеплении с любым из этих упомянутых rs, является показателем риска наличия сердечно-сосудистого события.

Изобретение относится к области медицины, в частности к медицинской генетике, и предназначено для ранней генетической диагностики риска развития сахарного диабета (СД) 2 типа.

Изобретение относится к молекулярной биологии. Предложен способ разделения молекул ДНК, предусматривающий негативную селекцию целевых молекул ДНК в растворе от нецелевых молекул ДНК, предусматривающий взаимодействие нецелевых молекул ДНК, содержащих сайт узнавания рекомбиназы Cre бактериофага P1 LoxP, с рекомбиназой Cre бактериофага Р1, дефектной по способности ковалентно модифицировать ДНК, которое обеспечивает перевод нецелевых молекул ДНК из раствора на твердую фазу.

Группа изобретений относится к области биохимии. Предложена система и способ для сбора нуклеиновой кислоты из образца текучей среды организма, а также стерильная съемная крышка для приемника для сбора отходов.

Изобретение относится к области биохимии, в частности к способу предсказания исхода рака молочной железы в положительной по рецептору эстрогена и отрицательной по HER2 опухоли у пациента с раком молочной железы, предусматривающему определение в образце опухоли от указанного пациента величины уровня экспрессии РНК генов UBE2C, BIRC5, DHCR7, STC2, AZGP1, RBBP8, IL6ST и MGP или генов UBE2C, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST и MGP, математическое комбинирование величин уровней экспрессии, где более высокий комбинированный показатель указывает на более худший прогноз у указанного пациента по сравнению с более низким комбинированным показателем.

Изобретение относится к области биохимии, в частности к мутантному растению сорго, содержащему в своем геноме по меньшей мере один полинуклеотид, где указанный полинуклеотид кодирует полипептид, имеющий замену аланина на треонин в положении 93 большой субъединицы белка AHAS сорго, причем указанное растение имеет повышенную устойчивость к одному или более имидазолиноновым гербицидам, к его семени, а также к способу его получения и способу его идентификации. Также раскрыт полинуклеотид, обладающий активностью устойчивости к гербицидам AHAS, и экспрессионная кассета, клетка, вектор экспрессии, его содержащие. Изобретение также относится к способу борьбы с сорняками в непосредственной близости от вышеуказанного растения сорго. Изобретение позволяет эффективно получать растение сорго с повышенной устойчивостью к одному или более имидазолиноновым гербицидам. 10 н. и 10 з.п. ф-лы, 5 ил., 5 табл., 6 пр.

Изобретение относится к ветеринарной вирусологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена Р32 каприпоксвирусов: Предложен также способ выявления генома каприпоксвирусов с использованием праймеров и зонда и тест-система ПЦР в режиме реального времени. Для проведения ПЦР-РВ используют амплификацию фрагмента гена белка Р32. Разработан высокочувствительный набор, состоящий из готовой ПЦР смеси, Taq-ДНК-полимеразы, положительного контроля и отрицательного контроля, позволяющий в кратчайшие сроки специфично выявить геном каприпоксвирусов. Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК каприпоксвирусов в пробах широкого спектра патологического и биоматериала. 3 н.п. ф-лы, 3 пр., 1 ил.

Наверх