Генетический тест накопления меди в печени у собак



Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак
Генетический тест накопления меди в печени у собак

Владельцы патента RU 2662660:

МАРС, ИНКОРПОРЕЙТЕД (US)

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора. Представленные способы или применения включают (i) генотипирование образца ДНК от собаки по одному или более полиморфизмам, выбранным из Chr22_3167534 (представленного положением 101 в SEQ ID NO: 144), наличие аллеля А указывает на предрасположенность к накоплению меди в печени, Chr22_3135144 (представленного положением 101 в SEQ ID NO: 145), наличие аллеля G указывает на предрасположенность к накоплению меди в печени, и повтора CGCCCC в хромосомном положении 22:3135287, наличие по меньшей мере одного дополнительного повтора указывает на предрасположенность к накоплению меди в печени с использованием специфического связывающего средства, которое выбирают из зонда или комбинации праймеров и которое способно обнаруживать или способствовать обнаружению выбранного полиморфизма, и (ii) определение по результатам стадии генотипирования, является ли собака предрасположенной к накоплению меди в печени. Изобретения обеспечивают возможность идентификации собак с риском развития или не защищенных от таких заболеваний или патологических состояний печени, как хронический гепатит, цирроз печени или печеночная недостаточность. 6 н. и 11 з.п. ф-лы, 10 ил., 21 табл., 6 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Изобретение относится к способу определения предрасположенности собаки к накоплению меди в печени и ассоциированному с медью заболеванию печени или вероятности защищенности собаки от них.

УРОВЕНЬ ТЕХНИКИ, ПРЕДШЕСТВУЮЩИЙ ИЗОБРЕТЕНИЮ

Медь представляет собой важный микроэлемент для ряда метаболических процессов в организме и, по существу, является неотъемлемой частью пищевого рациона. После всасывания в кишечнике медь в основном запасается в печени, хотя ее также можно найти в других тканях, таких как костный мозг, мышцы и селезенка. Кроме запасания меди, печень играет центральную роль в координации транспорта и выведении меди посредством церулоплазмина и солей желчных кислот, соответственно. Как правило, дефицит меди является более частой проблемой, чем токсичность. Однако токсичность встречается и может иметь серьезные последствия для пораженного животного.

Хотя заболевания печени у собак являются нечастыми, одной из их наиболее частых форм является хронический гепатит (CH). CH представляет собой гистологический диагноз, характеризуемый присутствием фиброза, воспаления и печеночно-клеточного апоптоза и некроза. В качестве конечной стадии заболевания может образовываться цирроз. Одной из причин CH является накопление меди в печени.

Накопление меди в печени может являться результатом увеличенного захвата меди, первичного метаболического дефекта в метаболизме меди в печени или измененного выведения меди через желчные пути. В последнем случае токсичность меди является вторичным относительно воспаления печени, фиброза печени и холестаза, хотя неясно насколько это может происходить у собаки. При вторичной болезни накопления меди накопление меди в основном ограничено перипортальной паренхимой, и концентрации меди в печени являются более низкими, чем при наследственных болезнях накопления. Хотя природа инициирующего фактора(ов) и сенсибилизирующего антигена неизвестна, одновременно с иммуноопосредованным механизмом образуются иммунологические аномалии и морфологические особенности, наблюдаемые при первичном биллиарном циррозе.

Тонкий кишечник у млекопитающих общепризнан в качестве основного участка всасывания поступающей с пищей меди. Перенос из просвета кишечника в слизистую кишечника представляет собой опосредованный носителем процесс, включающий компонент насыщаемого переноса. После попадания в клетки слизистой приблизительно 80% вновь всасываемой меди находится в цитозоле, в основном связанной с металлотионеинами (MT). Они представляют собой низкомолекулярные индуцибельные белки со множеством функций, включая гомеостаз, накопление, перенос и нейтрализацию металлов. После прохождения через энтероциты медь попадает в кровоток в системе воротной вены, где она связана с пептидами и аминокислотами белков-носителей, и происходит ее перенос в печень с меньшими количествами, попадающими в почки. У большинства млекопитающих медь легко выделяется и основным путем ее выделения является желчь.

Собак с избыточным накоплением меди в печени, как правило, лечат D-пеницилламином, мощным хелатором меди. Однако, в конечном счете, наиболее успешным лечением, доступным для собак с CH, является трансплантация печени.

Генетическая основа накопления меди в печени неизвестна. Ее сложно установить вследствие того факта, что медь вовлечена во множество различных биологических путей, каждый из которых является очень сложным и включает большое количество генов.

В WO 2009/044152 A2 описан способ определения предрасположенности собаки к накоплению меди в печени, включающий детекцию наличия или отсутствия (a) полиморфизма в генах GOLGA5, ATP7a или UBL5 собаки, что является показателем предрасположенности к накоплению меди в печени, и/или (b) полиморфизма в неравновесном сцеплении с указанным полиморфизмом (a), и таким образом определение предрасположенности собаки к накоплению меди в печени.

В WO 2010/038032 A1 и WO 2010/116137 A1 описаны дополнительные полиморфизмы для применения в способе определения предрасположенности собаки к накоплению меди в печени. Также в них описаны полиморфизмы для применения в способе определения вероятности того, что собака защищена от накопления меди в печени.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Авторы изобретения выявили в геноме собаки ряд полиморфизмов, которые ассоциированы с предрасположенностью к накоплению меди в печени. Также они выявили в геноме собаки полиморфизмы, которые ассоциированы с защитой от накопления меди в печени. Выявление этих полиморфизмов обеспечивает основу теста для прогноза предрасположенности собаки к накоплению или вероятности защиты собаки от накопления меди в печени посредством скрининга полиморфизмов. Прогностическую силу теста можно увеличить с использованием моделей, которые включают комбинирование результатов детекции одного или более из определенных полиморфизмов. Генетический тест, в котором комбинированы результаты детекции одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, с результатами детекции одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени у собак, может быть особенно информативным в отношении вероятности того, что у собаки существует риск накопления меди в печени.

Накопление меди в печени собаки может приводить к одному или более заболеваниям или патологическим состояниям печени, которые обусловлены высоким содержанием меди в печени. Например, высокое содержание меди в печени может приводить к хроническому гепатиту, циррозу печени и в конечном итоге к печеночной недостаточности. Таким образом, изобретение обеспечивает идентификацию собак с риском развития или не защищенных от таких заболеваний или патологических состояний печени, которые ассоциированы с высоким содержанием меди. После идентификации предрасположенности собаки к накоплению меди в печени или после идентификации собаки как не несущей одной или более мутаций, являющихся показателем защиты от накопления меди в печени, для этой собаки можно определять подходящие профилактические меры с целью поддержания уровня меди в печени на низком или нормальном уровне, например, посредством кормления кормом с низким содержанием меди (например, корм, описанный в WO 2009/044152 A2). Кроме того, собаки, которых идентифицировали как не несущих мутаций, ассоциированных с предрасположенностью к накоплению меди в печени, или которых идентифицировали как несущих мутации, ассоциированные с защитой от накопления меди в печени, являются идеальными для применения в селекционных программах с целью получения собак, у которых снижена вероятность возникновения заболевания печени или других патологических состояний, ассоциированных с высоким содержанием меди.

Таким образом, изобретение относится к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a); и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158),

Изобретение также относится к

- базе данных, содержащей информацию об одном или более полиморфизмах, как определено в настоящем документе, и их ассоциации с предрасположенностью собаки к накоплению меди в печени;

- способу определения предрасположенности собаки к накоплению меди в печени, включающему:

(a) введение в компьютерную систему данных о присутствии или отсутствии в геноме собаки одного или более полиморфизмов, как определено в настоящем документе;

(b) сравнение данных с компьютерной базой данных, которая содержит информацию об одном или более полиморфизмах, как определено в настоящем документе, и их ассоциации с предрасположенностью собаки к накоплению меди в печени; и

(c) определение на основе сравнения предрасположенности собаки к накоплению меди в печени;

- компьютерной программе, содержащей средства программного, которые при исполнении на компьютерной системе дают команду компьютерной системе на исполнение способа по изобретению;

- компьютерному носителю данных, содержащему компьютерную программу по изобретению и базу данных по изобретению;

- компьютерной системе, настроенной на исполнение способа по изобретению, содержащей:

(a) средства для введения данных о присутствии или отсутствии в геноме собаки полиморфизма, как определено в настоящем документе;

(b) базу данных, содержащую информацию об одном или более полиморфизмах, как определено в настоящем документе, и их ассоциации с предрасположенностью собаки к накоплению меди в печени;

(c) модуль для сравнения данных с базой данных; и

(d) средства для определения на основании указанного сравнения предрасположенности собаки к накоплению меди в печени;

- способу определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из полиморфизмов, как определено в настоящем документе;

- использованию одного или более полиморфизмов, выбранных из полиморфизмов, как определено в настоящем документе, для определения предрасположенности собаки к накоплению меди в печени; и

- способу отбора собаки для получения потомства с высокой вероятностью защиты от накопления меди в печени, включающему:

- определение способом по изобретению содержания в геноме первой собаки-кандидата одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, и таким образом определение того, что первая собака-кандидат является подходящей для получения потомства с высокой вероятностью защиты от накопления меди в печени;

- необязательно, определение способом по изобретению содержания в геноме второй собаки противоположного первой собаке пола одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени; и

- необязательно, спаривание первой собаки со второй собакой для получения потомства с высокой вероятностью защиты от накопления меди в печени.

Авторы изобретения выявили полиморфизмы, ассоциированные с защитой собаки от накопления меди в печени. Таким образом, изобретение относится к способу тестирования собаки для определения вероятности того, что собака защищена от накопления меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) Chr22_3135144 (SEQ ID NO: 145) и (b) одного или более полиморфизмов в неравновесном сцеплении с (a).

Изобретение также относится к

- базе данных, содержащей информацию об одном или более полиморфизмах, как определено в настоящем документе, и их ассоциации с защитой собаки от накопления меди в печени или предрасположенностью собаки к накоплению меди в печени;

- способу определения вероятности того, что собака защищена от накопления меди в печени, где способ включает:

(a) введение в компьютерную систему данных о присутствии или отсутствии в геноме собаки одного или более полиморфизмов, как определено в настоящем документе;

(b) сравнение данных с компьютерной базой данных, которая содержит информацию об одном или более полиморфизмах, как определено в настоящем документе, и их ассоциации с защитой собаки от накопления меди в печени или предрасположенностью собаки к накоплению меди в печени; и

(c) определение на основе сравнения вероятности защиты собаки от накопления меди в печени;

- компьютерной программе, содержащей средства программного, которые при исполнении на компьютерной системе дают команду компьютерной системе на исполнение способа по изобретению;

- компьютерному носителю данных, содержащему компьютерную программу по изобретению и базу данных по изобретению;

- компьютерной системе, настроенной на исполнение способа по изобретению, содержащей:

(a) средства для введения данных о присутствии или отсутствии в геноме собаки одного или более полиморфизмов, как определено в настоящем документе;

(b) базу данных, содержащую информацию об указанных полиморфизмах и их ассоциации с защитой собаки от накопления меди в печени или предрасположенностью собаки к накоплению меди в печени;

(c) модуль для сравнения данных с базой данных; и

(d) средства для определения на основании указанного сравнения вероятности защиты собаки от накопления меди в печени;

- способу определения вероятности того, что собака защищена от накопления меди в печени, включающему определение присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) Chr22_3135144 (SEQ ID NO: 145) и (b) одного или более полиморфизмов в неравновесном сцеплении с (a);

- использование полиморфизма, как определено в настоящем документе, для определения вероятности защиты собаки от накопления меди в печени; и

- способу отбора собаки для получения потомства с высокой вероятностью защиты от накопления меди в печени, включающему:

- определение способом по изобретению содержания в геноме первой собаки-кандидата одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, и таким образом определение того, что первая собака-кандидат является подходящей для получения потомства с высокой вероятностью защиты от накопления меди в печени;

- необязательно, определение способом по изобретению содержания в геноме второй собаки противоположного первой собаке пола одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени; и

- необязательно, спаривание первой собаки со второй собакой для получения потомства с высокой вероятностью защиты от накопления меди в печени.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг. 1 приведены средние уровни содержания меди по полу и генотипу ATP7A у лабрадоров-ретриверов (данные из таблицы 9), Ось y представляет собой содержание меди в массе сухого вещества печени (мг/кг). Ось x представляет собой генотип ATP7A: слева направо, первые три столбца представляют данные для самок собак в исследовании, а последние два столбца представляют данные для самцов собак в исследовании, Величины ошибок представляют собой стандартную ошибку.

Фиг. 2 представляет собой диаграмму размаха гистологических оценок содержания меди по полу и генотипу ATP7A у лабрадоров-ретриверов (данные из таблицы 9). Ось y представляет собой значения гистологических оценок содержания меди. Ось x представляет собой генотип ATP7A: слева направо, первые три столбца представляют данные для самок собак в исследовании, а последние два столбца представляют данные для самцов собак в исследовании. Значение p по Крускалу-Уоллису составляет 0,000396.

На фиг. 3 представлен кодирующий повтор переменной длины в ATP7B. Верх: Основания и соответствующие им аминокислоты (AA). Хромосомное положение заключенного в рамку C представляет собой 3135287, Низ: в Ensembl, NCBI и при секвенировании бигля и группы лабрадоров выявлено различное количество повторов CGCCCC. Как следствие, заключенные в рамку аминокислоты аланин (A) и пролин (P) представлены в большем или меньшем количестве. SEQ ID NO: 236, 237 и 238 представляют собой полинуклеотидные последовательности, содержащие два, три и четыре повтора соответственно.

На фиг. 4 представлено положение повтора CGCCCC в ATP7B между ассоциированными с тяжелыми металлами доменами 3 и 4.

На фиг. 5 представлен SNP ATP7B 4145G>A (Chr22_3167534). Вертикальная черта с правого края указывает примерное положение мутации. Замена G>A приводит к замене на аминокислоту глутамин (AA).

На фиг. 6 представлена структура LD первых 15 м.п.н. хромосомы 22. Стрелки наверху треугольника указывают положение кодирующих мутаций. Линия, указанная стрелками, представляет высокое LD кодирующих мутаций с несколькими SNP в области.

На фиг. 7 представлено действие количества аллелей риска на количественный уровень меди в печени. Ось x представляет собой количество аллелей риска, а ось y представляет собой количество меди в печени в мг/кг, Горизонтальная линия указывает нормальный уровень меди в печени 400 мг/кг.

На фиг. 8 представлено пошаговое моделирование гистологической оценки меди, X1-X17 представляют собой факторы из таблицы 21.

На фиг. 9 представлен пошаговое моделирование логарифмического количественного оценки меди, X1-X17 представляют собой факторы из таблицы 21.

На фиг. 10 схематически представлены варианты осуществления функциональных компонентов, настроенных на осуществление настоящего изобретения.

КРАТКОЕ ОПИСАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO: 1-5 представляют полинуклеотидные последовательности, содержащие SNP, используемые в трехобластной модели в примере 2, а также находящиеся в таблице 4.

SEQ ID NO: 6-141 представляют полинуклеотидные последовательности, содержащие дополнительные SNP, которые можно использовать для определения предрасположенности собаки к накоплению меди в печени. Эти последовательности также представлены в таблицах 5 и 6.

SEQ ID NO: 142 представляет собой полинуклеотидную последовательность SNP кодирующей области ATP7A, который ассоциирован с защитой собаки от накопления меди в печени (ChrX_63338063). Эта последовательность также представлена в таблице 8.

SEQ ID NO: 143 представляет собой полинуклеотидную последовательность SNP (ChrX_63397393 ATP7a_Reg16_F_42), находящегося в неравновесном сцеплении с SNP ChrX_63338063. Эта последовательность также представлена в таблице 8.

SEQ ID NO: 144-158 представляют полинуклеотидные последовательности, содержащие SNP по изобретению. Эти последовательности также представлены в таблице 18.

SEQ ID NO: 159-226 представляют полинуклеотидные последовательности, содержащие SNP, находящиеся в неравновесном сцеплении с SNP в таблице 18. Эти последовательности также представлены в таблице 20.

SEQ ID NO: 227-235 представляют собой последовательности праймеров.

SEQ ID NO: 236, 237 и 238 представляют собой полинуклеотиды, содержащие два, три или четыре повтора CGCCCC соответственно для последовательности повторов в положении 22:3135287 в геноме. Эти последовательности также представлены в таблице 12.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Идентификация предрасположенности к накоплению или защиты от накопления меди в печени

Накопление меди в печени приводит к заболеванию печени у ряда пород собак, включая лабрадоров-ретриверов, доберманов-пинчеров, немецких овчарок, кейсхондов, коккер-спаниелей, белых высокогорных терьеров, бедлингтон-терьеров и скайтерьеров. Средняя концентрация меди в печени нормальных собак любой породы составляет от 200 до 400 мг/кг массы сухого вещества, хотя у новорожденных, как правило, содержатся более высокие концентрации меди в печени. Количество меди в печени собаки можно измерять посредством биопсии.

У собаки, предрасположенной к накоплению меди в печени, существует тенденция к накоплению меди так, что концентрация меди в ее печени достигает уровня выше 400 мг/кг массы сухого вещества. Определение предрасположенности собаки к накоплению меди в печени по изобретению включает определение риска или вероятности того, что медь в печени собаки будет накапливаться до уровня выше 400 мг/кг, например выше 600 мг/кг, выше 800 мг/кг, выше 1000 мг/кг, выше 1500 мг/кг, выше 2000 мг/кг, выше 5000 мг/кг или выше 10000 мг/кг.

У собаки, защищенной от накопления меди в печени, существует низкие риск или вероятность накопления меди в печени так, что концентрация меди в ее печени с меньшей вероятностью достигает уровня выше 400 мг/кг массы сухого вещества. Концентрация меди в печени собаки, защищенной от накопления меди в печени, составляет ниже 600 мг/кг, например ниже 500 мг/кг, ниже 400 мг/кг или ниже 300 мг/кг. Определение вероятности защиты собаки от накопления меди в печени по изобретению включает определение вероятности того, что медь в печени собаки будет накапливаться до уровня ниже 600 мг/кг, например ниже 500 мг/кг, ниже 400 мг/кг или ниже 300 мг/кг.

Накопление меди в печени можно оценивать гистохимически. Например, концентрацию меди в печени можно полуколичественно гистохимически оценивать с использованием способа окрашивания рубеановым водородом для оценки распределения меди, как описано ранее (Van den Ingh et al., (1988) Vet Q 10: 84-89). Концентрацию можно ранжировать по шкале от 0 до 5 следующим образом: 0 = медь отсутствует; 1 = единичные клетки печени и/или ретикулогистиоцитарные (RHS) клетки, содержащие незначительное количество содержащих медь гранул; 2 = небольшие группы клеток печени и/или RHS клеток, содержащих от небольших до умеренных количеств содержащих медь гранул; 3 = более крупные группы или области клеток печени и/или RHS клеток, содержащих умеренные количества содержащих медь гранул; 4 = большие области клеток печени и/или RHS клеток с множеством содержащих медь гранул и 5 = наличие диффузных клеток печени и/или RHS клеток со множеством содержащих медь гранул. По этой системе градации оценки содержания меди выше 2 являются аномальными.

Таким образом, определение вероятности защиты собаки от накопления меди в печени по изобретению может включать определение вероятности того, что у собаки с использованием системы градации, описанной в Van den Ingh et al., можно получить оценку менее или равную 3, например менее чем или равную 2,5, 2, 1,5, или менее или равную 1. Определение предрасположенности собаки к накоплению меди в печени по изобретению может включать определение риска или вероятности того, что у собаки с использованием системы градации, описанной в Van den Ingh et al. можно получить оценку большую или равную 2, например большую или равную 2,5, 3, 3,5, или большую или равную 4.

Вероятность защиты или предрасположенности можно выражать, например, в виде фактора риска, процентного содержания или вероятности. Можно определять происходит или нет у собаки накопление меди до описанных выше уровней. Например, способ определения предрасположенности собаки к накоплению или вероятности защиты собаки от накопления меди в печени может включать определение накопления или отсутствия накопления у собаки меди до уровня выше 400 мг/кг.

Накопление меди в печени до уровня выше 400 мг/кг ассоциировано с заболеванием печени и в конечном итоге может приводить к печеночной недостаточности. Таким образом, определение наличия в геноме собаки одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, означает, что у собаки с меньшей вероятностью разовьется заболевание или патологическое состояние, обусловленное накоплением меди в печени, такое как хронический гепатит, цирроз и печеночная недостаточность. И наоборот, определение содержания в геноме собаки одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, означает предрасположенность собаки к такому заболеванию или патологическому состоянию. Таким образом, изобретение относится к способу тестирования предрасположенности собаки к заболеванию, ассоциированному с накоплением меди в печени, такому как хронический гепатит, цирроз и печеночная недостаточность, или вероятности защиты собаки от него.

Полиморфизмы и показатель предрасположенности к накоплению или защиты от накопления меди

Авторы изобретения выявили в геноме собаки ряд полиморфизмов, ассоциированных с предрасположенностью к накоплению меди в печени. Таким образом, настоящее изобретение относится к способу определения предрасположенности собаки к накоплению меди в печени с использованием одного или более полиморфных маркеров в этих положениях в геноме.

Таким образом, настоящее изобретение относится к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a); и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158),

Также авторы изобретения выявили в геноме собаки полиморфизмы, которые ассоциированы с защитой от накопления меди в печени. Таким образом, настоящее изобретение относится к способу определения вероятности того, что собака защищена от накопления меди в печени с использованием одного или более полиморфных маркеров в этих положениях в геноме.

Таким образом, изобретение также относится к способу тестирования собаки для определения вероятности того, что собака защищена от накопления меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) Chr22_3135144 (SEQ ID NO: 145) и (b) одного или более полиморфизмов в неравновесном сцеплении с (a).

Как правило, фраза "детекция присутствия или отсутствия полиморфизма" означает определение присутствия полиморфизма в геноме собаки. Полиморфизмы включают однонуклеотидные полиморфизмы (SNP), микросателлиты или полиморфизмы повторов, инсерционные полиморфизмы и делеционные полиморфизмы.

Предпочтительно полиморфизм представляет собой SNP. Детекция присутствия или отсутствия SNP означает генотипирование SNP или типирование нуклеотида(ов), присутствующих в геноме собаки, на SNP. Как правило, необходимо определять нуклеотид, находящийся в одном и том же положении на обеих гомологичных хромосомах. Другими словами, генотипируют один или оба аллеля и на основе генотипирования определяют состав одного или обоих аллелей. Собаку можно определять как гомозиготную по первому аллелю, гетерозиготную или гомозиготную по второму аллелю SNP. Когда полиморфизм представляет собой микросателлит или последовательность повторов, как правило, способ включает определение количества повторов.

Определение фенотипа индивидуума, такого как предрасположенность индивидуума к заболеванию или патологическому состоянию или защита индивидуума от заболевания или патологического состояния, не ограничено детекцией полиморфизма, являющегося причиной заболевания или патологического состояния. В исследованиях генетического картирования в выборке индивидуумов на ассоциацию с данным фенотипом тестируют генетическую изменчивость в наборе маркерных локусов. Если такую ассоциацию между конкретным маркерным локусом и фенотипом находят, это позволяют предположить, что или изменчивость в данном маркерном локусе воздействует на представляющий интерес фенотип, или что изменчивость в данном маркерном локусе находится в неравновесном сцеплении с реально связанным с фенотипом локусом, который не был генотипирован. В случае группы полиморфизмов, которые находятся в неравновесном сцеплении друг с другом, знание о наличии всех таких полиморфизмов у конкретного индивидуума, как правило, обеспечивает избыточную информацию. Таким образом, при определении содержания в геноме собаки одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди, или к ассоциированному с медью заболеванию печени, или защиты от накопления меди в печени, или ассоциированного с медью заболевания печени, из такой группы полиморфизмов необходимо детектировать только один полиморфизм.

В результате неравновесного сцепления полиморфизм, который не является функциональным/протективным полиморфизмом предрасположенности, но находится в неравновесном сцеплении с функциональным полиморфизмом, может действовать в качестве маркера, являющегося показателем присутствия функционального полиморфизма. Полиморфизм, который находится в неравновесном сцеплении с полиморфизмом по изобретению, является показателем предрасположенности к накоплению или защиты от накопления меди в печени.

Таким образом, любое из полиморфных положений, как определено в настоящем документе, можно типировать непосредственно, другими словами, определяя нуклеотид, находящийся в этом положении, или опосредованно, например, определяя нуклеотид, находящийся в другом полиморфном положении, которое находится в неравновесном сцеплении с указанным полиморфным положением.

Неравновесное сцепление представляет собой неслучайную гаметическую ассоциацию аллелей в различных локусах в популяции. В неравновесном сцеплении находятся полиморфизмы с тенденцией к совместному наследованию вместо независимого наследования посредством случайного распределения. Случайное распределение или независимое наследование полиморфизмов друг от друга происходят, если частота совместного присутствия двух полиморфизмов является произведением частот присутствия двух полиморфизмов по-отдельности. Например, если два полиморфизма в различных полиморфных участках присутствуют в 50% хромосом в популяции, тогда можно сказать, что они подвержены случайному распределению, если два аллеля совместно присутствуют на 25% хромосом в популяции. Более высокое процентное содержание может означать, что два аллели являются сцепленными. Отсюда следует, что первый полиморфизм находится в неравновесном сцеплении со вторым полиморфизмом, если частота совместного присутствия двух полиморфизмов является большей, чем произведение частот присутствия двух полиморфизмов в популяции по отдельности. Предпочтительно, первый полиморфизм находится в неравновесном сцеплении со вторым полиморфизмом, если частота совместного присутствия двух полиморфизмов более чем на 10% больше, например более чем на 30%, более чем на 50%, или более чем на 70% больше, чем произведение частот присутствия полиморфизмов по отдельности.

Исследования показали, что неравновесное сцепление у собак широко распространено (Extensive and breed-specific linkage disequilibrium in Canis familiaris, Sutter et al., Genome Research 14: 2388-2396). Полиморфизмы, находящиеся в неравновесном сцеплении, часто находятся в непосредственной физической близости, что является причиной их совместного наследования. Полиморфизмы, находящиеся в неравновесном сцеплении с полиморфизмами, указанными в настоящем документе, расположены на той же хромосоме. Полиморфизмы, находящиеся в неравновесном сцеплении у собак, как правило, расположены в пределах 5 м.п.н., предпочтительно в пределах 2 м.п.н., в пределах 1 м.п.н., в пределах 700 т.п.н., в пределах 600 т.п.н., в пределах 500 т.п.н., в пределах 400 т.п.н., в пределах 200 т.п.н., в пределах 100 т.п.н., в пределах 50 т.п.н., в пределах 10 т.п.н., в пределах 5 т.п.н., в пределах 1 т.п.н., в пределах 500 п. н., в пределах 100 п. н., в пределах 50 п. н. или в пределах 10 п. н. от указанного полиморфизма.

Специалист стандартными способами может идентифицировать полиморфизмы, которые находятся в неравновесном сцеплении с любым из полиморфных положений, как определено в настоящем документе. После выбора потенциального полиморфизма специалист легко может определить значимость корреляции этого полиморфизма, и какой версии или аллеля полиморфизма с любым из полиморфизмов, определенных в настоящем документе.

Более подробно, для определения нахождения полиморфизма в неравновесном сцеплении с любым из полиморфизмов, определенным в настоящем документе, специалист должен генотипировать полиморфизм-кандидат и один или более полиморфизмов, определенных в настоящем документе в выборке собак. Размер выборки должен быть достаточным для достижения статистически значимого результата. Как правило, следует генотипировать образцы, полученные по меньшей мере у 100, предпочтительно по меньшей мере у 150 или по меньшей мере у 200 различных собак. Собаки в выборке могут быть любой порода, но, как правило, имеют одинаковую или сходную генетическую основу породы. После генотипирования полиморфизмов в выборке собак неравновесное сцепление в одной или более парах полиморфизмов можно измерять с использованием любого из ряда легкодоступных пакетов программ обработки статистических данных. Примером пакета свободного программного обеспечения является Haploview (Haploview: analysis and visualisation of LD and haplotype maps, Barrett et al. 2005, Bioinformatics, 21(2): 263-265), доступный для загрузки на http://www.broadinstitute.org/haploview/haploview. Другим примером программного обеспечения, которое можно использовать, является PLINK (http://pngu.mgh.harvard.edu/purcell/plink/).

Мерой неравновесного сцепления является D’. Показателем того, что пара полиморфизмов находится в неравновесном сцеплении, является диапазон D’ от 0,5 до 1, где 1 указывает на наиболее значительное неравновесное сцепление. Таким образом, если для полиморфизма-кандидата и конкретного полиморфизма, определенного в настоящем документе, выявлено, что D’ составляет от 0,5 до 1, предпочтительно от 0,6 до 1, от 0,7 до 1, от 0,8 до 1, от 0,85 до 1, от 0,9 до 1, от 0,95 до 1 или наиболее предпочтительно 1, можно сказать, что полиморфизм-кандидат является прогностическим для полиморфизма, определенного в настоящем документе, и таким образом является показателем предрасположенности к накоплению или защиты от накопления меди в печени. В предпочтительном способе по изобретению, полиморфизм, который находится в неравновесном сцеплении с полиморфизмом, определенным в настоящем документе, расположен в пределах 680 т.п.н. от полиморфизма, определенного в настоящем документе, и на той же хромосоме, и рассчитанная мера неравновесного сцепления пары полиморфизмов, D’, является большей или равной 0,9.

Другой мерой неравновесного сцепления является R-квадрат, где R представляет собой коэффициент корреляции, R-квадрат, который также известен как "коэффициент детерминации", представляет собой долю дисперсии генотипов первого полиморфизма, вычисляемую в генотипах второго полиморфизма. Таким образом, R-квадрат в размере 0,5 для полиморфизма-кандидат и конкретного полиморфизма, определенного в настоящем документе, может означать, что полиморфизм-кандидат обуславливает 50% дисперсии конкретного полиморфизма. R-квадрат можно получать с использованием стандартных пакетов программ обработки статистических данных, таких как Haploview. Как правило, сильной корреляцией считают R-квадрат в размере 0,25 или более (R>0,5 или <-0,5). Таким образом, если выявлено, что R-квадрат для полиморфизма-кандидата и конкретного полиморфизма, определенного в настоящем документе, составляет 0,5 или более, предпочтительно 0,75 или более, 0,8 или более, 0,85 или более, 0,9 или более, или 0,95 или более, можно сказать, что полиморфизм-кандидат является прогностическим для полиморфизма, определенного в настоящем документе, и таким образом является показателем предрасположенности к накоплению или защиты от накопления меди в печени. В предпочтительном способе по изобретению, полиморфизм, который находится в неравновесном сцеплении с полиморфизмом, определенным в настоящем документе, расположен в пределах 680 т.п.н. от полиморфизма, определенного в настоящем документе, и на той же хромосоме, и рассчитанная мера неравновесного сцепления пары полиморфизмов, R-квадрат, является большей или равной 0,5.

Также с использованием полиморфизмов по изобретению можно строить гаплотип из полиморфизмов в LD. Даже если один или более полиморфизмов индивидуально находятся только в слабом LD с полиморфизмами по изобретению, они могут находиться в сильном LD, если их используют в комбинации. Например, у любого полиморфизма значение R-квадрат может составлять ниже 0,25. Однако у двух или более мутаций, у которых значение R-квадрат индивидуально составляет ниже 0,25, в комбинации значение R-квадрат может составлять более 0,5. Таким образом, эти полиморфизмы можно использовать в комбинации для определения предрасположенности собаки к накоплению или вероятности защиты собаки от накопления меди в печени.

Таким образом, способ по изобретению может включать детекцию присутствия или отсутствия двух или более полиморфизмов в неравновесном сцеплении с полиморфизмом, определенным в настоящем документе, где R-квадрат для каждого из указанных двух или более полиморфизмов индивидуально может составлять меньше или равно 0,25, но R-квадрат для комбинации указанных двух или более полиморфизмов составляет больше или равно 0,5.

После того, как идентифицировано, что полиморфизм находится в неравновесном сцеплении и таким образом коррелирован с полиморфизмом, определенным в настоящем документе, специалист может легко определить, какая версия полиморфизма, т.е. какой аллель ассоциирован с предрасположенностью к накоплению или с защитой от накопления меди в печени. Это можно осуществлять посредством фенотипирования выборки собак по накоплению меди в печени и классификации собак по уровню накопления меди в печени. Затем выборку собак генотипируют по представляющему интерес полиморфизму. Затем проводят корреляцию генотипов с уровнем меди в печени для определения ассоциации генотипов с уровнем меди в печени и таким образом определения того, какой аллель ассоциирован с предрасположенностью к накоплению или защите от накопления меди в печени.

Полиморфизмы по изобретению, для которых выявлено, что они являются показателями предрасположенности собаки к накоплению меди в печени, приведены в таблицах 17 и 18.

Конкретно, они представляют собой: Chr22_3167534 (SEQ ID NO: 144), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr32_38904515 (SEQ ID NO: 156), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr8_4892743 (SEQ ID NO: 157), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr8_4880518 (SEQ ID NO: 158), Chr10_65209946 (SEQ ID NO: 155) и Chr22_3135144 (SEQ ID NO: 145).

Кроме того, выявлено, что с предрасположенностью к накоплению меди в печени ассоциирован микросателлитный повтор в гене ATP7B. Он представляет собой повтор CGCCCC на хромосоме 22, начиная с положение 3135287 в геноме (22:3135287). Последовательность повторов проиллюстрирована на фиг. 3 (SEQ ID NO: 236-238). Может присутствовать два (SEQ ID NO: 236), три (SEQ ID NO: 237), четыре (SEQ ID NO: 238) и, потенциально, больше повторов. Таким образом, способ по изобретению может включать определение количества повторов CGCCCC в геноме собаки.

Способ определения предрасположенности собаки к накоплению меди в печени включает детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a); и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Для осуществления изобретения можно детектировать любое количество и любую комбинацию полиморфизмов. Предпочтительно, детектируют по меньшей мере 2 полиморфизма. Предпочтительно детектируют от 2 до 5, от 3 до 8, от 5 до 10 или от 8 до 15 полиморфизмов.

ДНК собаки можно типировать в положениях, соответствующих:

(i) одному или более полиморфизмам (a);

(ii) одному или более полиморфизмам (b);

(iii) одному или более полиморфизмам (c);

(iv) одному или более полиморфизмам (a) и одному или более полиморфизмам (b);

(v) одному или более полиморфизмам (a) и одному или более полиморфизмам (c) или

(vi) одному или более полиморфизмам (b) и одному или более полиморфизмам (c).

Предпочтительно способ определения предрасположенности собаки к накоплению меди в печени включает детекцию в образце присутствия или отсутствия в геноме собаки:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), Chr19_6078084 (SEQ ID NO: 148), Chr3_86838677 (SEQ ID NO: 152), Chr10_65209946 (SEQ ID NO: 155) и ChrX_63338063 (SEQ ID NO: 142); или

(b) ChrX_120879711 (SEQ ID NO: 147), Chr15_62625262 (SEQ ID NO: 149), Chr22_3167534 (SEQ ID NO: 144), Chr8_4892743 (SEQ ID NO: 157), Chr24_4011833 (SEQ ID NO: 153) и Chr18_60812198 (SEQ ID NO: 154).

Аллели мутаций, ассоциированных с высоким содержанием меди, приведены в таблице 18. Таким образом, способ определения предрасположенности собаки к накоплению меди в печени по изобретению может включать определение присутствия или отсутствия аллеля A в Chr22_3167534 (SEQ ID NO: 144), аллеля A в Chr20_55461150 (SEQ ID NO: 146), аллеля C в ChrX_120879711 (SEQ ID NO: 147), аллеля C в Chr32_38904515 (SEQ ID NO: 156), аллеля T в Chr19_6078084 (SEQ ID NO:148, аллеля A в Chr15_62625262 (SEQ ID NO: 149), аллеля G в Chr14_39437543 (SEQ ID NO: 150), аллеля A в Chr15_62625024 (SEQ ID NO: 151), аллеля C в Chr3_86838677 (SEQ ID NO: 152), аллеля T в Chr8_4892743 (SEQ ID NO: 157), аллеля G в Chr24_4011833 (SEQ ID NO: 153), аллеля A в Chr18_60812198 (SEQ ID NO: 154), аллеля A в Chr8_4880518 (SEQ ID NO: 158), аллеля T в Chr10_65209946 (SEQ ID NO: 155) и/или аллеля G в Chr22_3135144 (SEQ ID NO: 145) и таким образом определение наличия в геноме полиморфизма, являющегося показателем предрасположенности к накоплению меди.

Выявлено, что каждая дополнительная копия повтора CGCCCC в хромосомном положении 22:3135287 увеличивает риск накопления меди. Таким образом, способ определения предрасположенности собаки к накоплению меди в печени может включать определение количества повторов CGCCCC в хромосомном положении 22:3135287. Присутствие двух или более повторов, например трех или четырех повторов, является показателем предрасположенности к накоплению меди в печени.

В предпочтительном способе по изобретению полиморфизм в неравновесном сцеплении с полиморфизм (a) представляет собой SNP. В результате нахождения в неравновесном сцеплении полиморфизм является показателем предрасположенности к накоплению меди в печени. Примеры SNP в неравновесном сцеплении с полиморфизмами (a) приведены в таблице 19, а последовательности, окружающие SNP, приведены в таблице 20. Эти SNP для определения предрасположенности собаки к накоплению меди в печени можно использовать самостоятельно или в комбинации с одним или более полиморфизмами (a) и/или (c). Таким образом, способ по изобретению может включать детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из полиморфизмов в таблицах 19 и 20.

Авторы изобретения ранее выявили в гене ATP7A полиморфизмы, которые являются показателем защиты от накопления меди в печени, например (ChrX_63338063; SNP ATP7a_Reg3_F_6; SEQ ID NO: 142). Таким образом, способ определения предрасположенности собаки к накоплению меди в печени может дополнительно включать детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из:

(d) ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142); и/или

(e) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (d).

Аллель A Chr22_3135144 и аллель T ChrX_63338063 ассоциированы с низким содержанием меди или с защитой от накопления меди в печени. Наоборот, аллель G Chr22_3135144 и аллель C ChrX_63338063 ассоциированы с высоким содержанием меди или с предрасположенностью к накоплению меди в печени. Таким образом, способ определения предрасположенности собаки к накоплению меди в печени может включать определение присутствия или отсутствия аллелей A или G Chr22_3135144 и/или аллелей T или C ChrX_63338063. Присутствие аллеля A Chr22_3135144 и/или аллеля T ChrX_63338063 является показателем того, что собака с высокой вероятностью защищена от накопления меди в печени, а присутствие аллеля G Chr22_3135144 и/или аллеля C ChrX_63338063 означает, что собака с высокой вероятностью подвержена накоплению меди в печени.

В способе определения вероятности того, что собака защищена от накопления меди в печени, можно использовать полиморфизмы, для которых выявлено, что они ассоциированы с защитой от накопления меди в печени. Таким образом, изобретение относится к способу тестирования собаки для определения вероятности того, что собака защищена от накопления меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) Chr22_3135144 (SEQ ID NO: 145) и (b) одного или более полиморфизмов в неравновесном сцеплении с (a).

Для осуществления изобретения можно детектировать любое количество и любую комбинацию полиморфизмов. Предпочтительно детектируют по меньшей мере два полиморфизма. Предпочтительно детектируют от 2 до 5, от 3 до 8, от 5 до 10 или от 8 до 15 полиморфизмов.

Таким образом, ДНК собаки можно типировать в положениях, соответствующих:

(i) полиморфизму (a); и/или

(ii) одному или более полиморфизмам (b).

Способ определения вероятности того, что собака защищена от накопления меди в печени, дополнительно может включать детекцию в образце присутствия или отсутствия в геноме собаки (c) ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142) и/или (d) одного или более полиморфизмов в неравновесном сцеплении с (c). Примером полиморфизма, который находится в неравновесном сцеплении с ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142), является ChrX_63397393 (SNP ATP7a_Reg16_F_42; SEQ ID NO: 143). Дополнительные примеры приведены в таблицах 19 и 20. Таким образом, способ определения вероятности того, что собака защищена от накопления меди в печени, дополнительно может включать детекцию в образце присутствия или отсутствия в геноме собаки (c) ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142) и/или (d) ChrX_63397393 (SNP ATP7a_Reg16_F_42; SEQ ID NO: 143).

Предпочтительно способ определения вероятности того, что собака защищена от накопления меди в печени, включает детекцию в образце присутствия или отсутствия в геноме собаки:

Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), Chr19_6078084 (SEQ ID NO: 148), Chr3_86838677 (SEQ ID NO: 152), Chr10_65209946 (SEQ ID NO: 155) и ChrX_63338063 SEQ ID NO: 142.

Как указано выше, аллель A Chr22_3135144 и аллель T ChrX_63338063 ассоциированы с низким содержанием меди или с защитой от накопления меди в печени. Наоборот, аллель G Chr22_3135144 и аллель C ChrX_63338063 ассоциированы с высоким содержанием меди или с предрасположенностью к накоплению меди в печени. Таким образом, способ определения вероятности того, что собака защищена от накопления меди в печени, может включать определение присутствия или отсутствия аллелей A или G Chr22_3135144 и/или аллелей T или C ChrX_63338063. Присутствие аллеля A Chr22_3135144 и/или аллеля T ChrX_63338063 является показателем того, что собака с высокой вероятностью защищена от накопления меди в печени, а присутствие аллеля G Chr22_3135144 и аллеля C ChrX_63338063 является показателем того, что собака с низкой вероятностью защищена от накопления меди в печени.

В способе определения вероятности того, что собака защищена от накопления меди в печени, также можно использовать описываемые в настоящем документе полиморфизмы, для которых выявлено, что они ассоциированы с высоким содержанием меди в печени или с предрасположенностью к накоплению меди в печени. Определение отсутствия аллеля, который ассоциирован с высоким содержанием меди в печени, может помочь определению вероятности того, что собака защищена от накопления меди в печени. Таким образом, способ определения вероятности того, что собака защищена от накопления меди в печени может включать детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из:

(e) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(f) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (e); и/или

(g) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Авторы изобретения ранее выявили, что полиморфизмы в генах или в областях генов собак GOLGA5, ATP7A и UBL5 являются показателем предрасположенности к накоплению меди в печени у собак (примеры 1 и 2). Таким образом, эти полиморфизмы можно использовать в комбинации с полиморфизмами по изобретению для предоставления улучшенного генетического теста для определения риска или вероятности того, что собака подвержена накоплению или защищена от накопления меди в печени. Таким образом, способ определения предрасположенности собаки к накоплению или защиты собаки от накопления меди в печени по изобретению может дополнительно включать детекцию присутствия или отсутствия (I) полиморфизма в генах GOLGA5, ATP7A или UBL5 собаки, который является показателем предрасположенности к накоплению меди в печени и/или (II) полиморфизма в неравновесном сцеплении с указанным полиморфизмом (I). В дополнение к полиморфизмам по изобретению можно детектировать любое количество и любую комбинацию этих полиморфизмов. Предпочтительно детектируют по меньшей мере 2 из этих дополнительных полиморфизмов. Предпочтительно дополнительно детектируют от 2 до 5, от 3 до 8 или от 5 до 10 полиморфизмов.

Таким образом, ДНК собаки можно типировать в положениях, соответствующих (i) полиморфизму (I) и/или (ii) одному или более полиморфизмам (II). Дополнительно, ДНК собаки можно типировать в положениях, соответствующих:

(i) двум или более полиморфизмам (I);

(ii) двум или более полиморфизмам (II); или

(iii) одному или более полиморфизмам (I) и одному или более полиморфизмам (II).

Когда используют два полиморфизма (I), каждый полиморфизм может находиться в отдельном гене из генов GOLGA5, ATP7A и UBL5 или только в одном из этих генов. Когда используют три или более полиморфизма (I), например от 3 до 10 таких полиморфизмов, полиморфизмы могут находиться в одном и том же гене, в двух из этих генов или во всех трех этих генах.

Подобным образом, когда используют два полиморфизма (II), каждый полиморфизм может находиться в неравновесном сцеплении с полиморфизмом в отдельном гене из генов GOLGA5, ATP7A и UBL5 или в только одном из этих генов. Когда используют три или более полиморфизмов (II), например, от 3 до 10, такие полиморфизмы могут находиться в неравновесном сцеплении с полиморфизмом в том же гене, в двух из этих генов или во всех трех этих генах.

Предпочтительный способ по изобретению дополнительно включает детекцию присутствия или отсутствия в генах собаки GOLGA5, ATP7A или UBL5 по меньшей мере одного полиморфизма (I), который является показателем предрасположенности к накоплению меди в печени, и по меньшей мере одного полиморфизма (II) в неравновесном сцеплении с указанным полиморфизмом (I).

В предпочтительном способе по изобретению, полиморфизм (I) и/или (II) представляет собой SNP, SNP может представлять собой любой SNP в генах или областях генов GOLGA5, ATP7A или UBL5 собаки, который является показателем предрасположенности к накоплению меди в печени, и/или SNP, который находится в неравновесном сцеплении с ним.

Таким образом, способ по изобретению может дополнительно включать определение содержания в геноме собаки одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, выбранных из SNP, указанных в таблице 4, таблице 5 и таблице 6. В таблицах 4 и 5 каждый SNP в последовательности в положении 61. Для каждого SNP в этом положении приведены первый и второй аллели ([первый/второй]). В таблице 6 также указаны первый и второй аллели для каждого SNP. Можно использовать любое количество SNP из таблиц 4, 5 и 6 и в любой комбинации, SNP можно комбинировать с полиморфизмом другого типа.

Предпочтительно, способ определения предрасположенности собаки к накоплению меди или вероятности защиты собаки от накопления меди в печени дополнительно включает детекцию присутствия или отсутствия одного или более SNP, выбранных из SNP из таблицы 4 и таблицы 6, и/или одного или более SNP в неравновесном сцеплении с ними. Таким образом, предпочтительно, один или более SNP выбраны из BICF2P506595 (положение 61 SEQ ID NO:1), BICF2P772765 (положение 61 SEQ ID NO:2), BICF2S2333187 (положение 61 SEQ ID NO:3), BICF2P1324008 (положение 61 SEQ ID NO:4), BICF2P591872 (положение 61 SEQ ID NO:5), ATP7a_Reg4_F_9 (положение 164 SEQ ID NO: 131), UBL5_Reg1F_16 (положение 97 SEQ ID NO: 132), golga5_Reg1_24 (положение 70 SEQ ID NO: 133), golga5_26 (положение 88 SEQ ID NO: 134), golga5_27 (положение 104 SEQ ID NO: 135), golga5_28 (положение 139 SEQ ID NO: 136), golga5_29 (положение 128 SEQ ID NO: 137), golga5_30 (положение 95 SEQ ID NO: 138), golga5_31 (положение 106 SEQ ID NO: 139), atp7areg17_32 (положение 95 SEQ ID NO: 140), atp7areg17_33 (положение 90 SEQ ID NO: 141) и одного или более SNP в неравновесном сцеплении с ними. Таким образом, можно типировать любые из этих 16 SNP или любые SNP, которые находятся в неравновесном сцеплении с любыми из этих 16 SNP. Предпочтительно типируют по меньшей мере 2 из этих 16 SNP или SNP в неравновесном сцеплении с ними.

Более предпочтительно, способ по изобретению дополнительно включает детекцию присутствия или отсутствия одного или более SNP, выбранных из SNP из таблицы 4. Таким образом, типировать можно любые из этих 5 SNP или любые SNP, которые находятся в неравновесном сцеплении с любыми из этих 5 SNP. Предпочтительно типируют по меньшей мере 2 из этих 5 SNP или SNP в неравновесном сцеплении с ними. Более предпочтительно типируют все 5 положений. Таким образом, предпочтительно, нуклеотид(ы), которые подвергают типированию, выбраны из положения, эквивалентного:

- положению 61 SEQ ID NO: 1 (BICF2P506595, SNP 1);

- положению 61 SEQ ID NO: 2 (BICF2P772765, SNP 2);

- положению 61 SEQ ID NO: 3 (BICF2S2333187, SNP 3);

- положению 61 SEQ ID NO: 4 (BICF2P1324008, SNP 4);

- положению 61 SEQ ID NO: 5 (BICF2P591872, SNP 5);

или любым положениям, находящимся в неравновесном сцеплении с любым из этих положений. Предпочтительно, способ включает детекцию присутствия или отсутствия SNP BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4) и BICF2P591872 (SEQ ID NO:5).

SNP 1 расположен в интроне гена GOLGA5, SNP 2, 3 и 4 расположены в области гена UBL5, SNP 5 расположен в области гена ATP7A. Таким образом, способ детекции по изобретению относится к любому SNP, расположенному в одном или более из этих генов или в областях одного или более из этих генов (в кодирующих областях или в других областях), или к любому другому SNP, который находится в неравновесном сцеплении.

Пример 2 демонстрирует использование SNP 1-5 для обоснования булевой модели предрасположенности к накоплению меди. В таблице 3 представлены бинарные состояния аллелей в трех положениях в геноме. Бинарные значения означают собаку с аллелями, которые являются показателем предрасположенности к накоплению меди ("плохие" аллели). Например, 000 представляет собой отсутствие любого из трех плохих аллелей, 111 представляет собой наличие всех трех плохих аллелей.

Авторы изобретения определили, что аллель A SNP BICF2P506595 (SNP 1), аллель G SNP BICF2P772765 (SNP 2), аллель C SNP BICF2S2333187 (SNP 3), аллель G SNP BICF2P1324008 (SNP 4) и аллель A SNP BICF2P591872 (SNP 5) являются показателями предрасположенности к накоплению меди в печени. Собаки, которые являются гомозиготами по этим аллелям, подвержены накоплению меди в печени. Таким образом, предпочтительный способ по изобретению дополнительно включает определение присутствия или отсутствия аллеля A SNP BICF2P506595, аллеля G SNP BICF2P772765 (SNP 2), аллеля C SNP BICF2S2333187 (SNP 3), аллеля G SNP BICF2P1324008 (SNP 4) и/или аллеля A SNP BICF2P591872 (SNP 5) и, таким образом, определение содержания в геноме собаки полиморфизма, являющегося показателем предрасположенности к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа AA для SNP BICF2P506595, генотипа GG для SNP BICF2P772765, генотипа CC для SNP BICF2S2333187, генотипа GG для SNP BICF2P1324008 и/или генотипов AA или AG для SNP BICF2P591872.

Таким образом, предпочтительный способ определения предрасположенности собаки к накоплению или вероятности защищенности собаки от накопления меди в печени дополнительно включает детекцию присутствия или отсутствия

(i) генотипа AA для SNP BICF2P506595 (SNP 1);

(ii) генотипа GG для SNP BICF2P772765 (SNP 2);

(iii) генотипа CC для SNP BICF2S2333187 (SNP 3);

(iv) генотипа GG для SNP BICF2P1324008 (SNP 4); и/или

(v) генотипов AA или AG для SNP BICF2P591872 (SNP 5);

и таким образом определения содержания в геноме собаки одного или более полиморфизмов, являющихся показателем защиты от накопления и/или предрасположенности к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа (i); генотипов (ii), (iii) и (iv); или генотипа (v), Еще более предпочтительный способ включает детекцию присутствия или отсутствия всех 5 генотипов (i)-(v).

Типирование нуклеотида(ов), присутствующего в геноме собаки в положении, указанном в любой из таблиц 4, 5, 6, 8, 18 и 20, может означать, что типируют нуклеотид, присутствующий в этом положении в последовательности, точно соответствующей последовательности, указанной в таблицах 4, 5, 6, 8, 18 и 20. Однако следует понимать, что у тестируемой собаки не обязательно должны присутствовать точные последовательности, представленные в SEQ ID NO: 1-5, приведенных в таблице 4, SEQ ID NO: 6-130 из таблицы 5, SEQ ID NO: 131-141 из таблицы 6, SEQ ID NO: 142 и SEQ ID NO: 143 из таблицы 8, SEQ ID NO: 144-158 из таблицы 18 и SEQ ID NO: 159-226 из таблицы 20. Таким образом, типирование присутствующего нуклеотида можно проводить в положении, указанном в таблицах 4, 5, 6, 8, 18 и 20, или в эквивалентном или соответствующем положении в последовательности. Таким образом, как используют в настоящем документе, термин эквивалентное означает в положении, указанном в таблицах 4, 5, 6, 8, 18 и 20, или в положении, соответствующем ему. Например, последовательность и таким образом положение SNP может варьировать вследствие делеций или добавлений нуклеотидов в геноме собаки. Специалисты в данной области могут определить положение, которое соответствует или является эквивалентным соответствующему положению в каждой из SEQ ID NO: 1-226, например, с использованием компьютерной программы, такой как GAP, BESTFIT, COMPARE, ALIGN, PILEUP или BLAST. Программы, включая GAP, BESTFIT, COMPARE, ALIGN и PILEUP, которые можно использовать для расчета гомологии или выравнивания последовательностей (например, используемые с их установками по умолчанию), предоставлены в пакете UWGCG Package. Также для сравнения или выравнивания двух последовательностей можно использовать алгоритм BLAST, как правило, с его установками по умолчанию. Программное обеспечение для проведения сравнения BLAST двух последовательностей является общедоступным в National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Этот алгоритм дополнительно описан ниже. Подобные общедоступные средства для выравнивания и сравнения последовательностей можно найти на веб-сайте института European Bioinformatics Institute (http://www.ebi.ac.uk), например, программы ALIGN и CLUSTALW.

Существует ряд различных способов, которые можно использовать для определения того, является ли полиморфизм показателем предрасположенности к накоплению или защиты от накопления меди в печени. Как правило, полиморфизм-кандидат сравнивают с базой данных полиморфизмов и с их ассоциацией с предрасположенностью к накоплению или защитой от накопления меди в печени. Такая база данных получают посредством фенотипирования выборки собак по накоплению меди в печени, например, посредством биопсии печени, и классификации собак по уровню накопления меди. Собак в выборке также генотипируют по выборке полиморфизмов. Затем возможно определять ассоциацию каждого генотипа с уровнем меди в печени. Таким образом, определение того, является ли полиморфизм показателем предрасположенности к накоплению или защиты от накопления меди в печени, осуществляют, локализуя полиморфизм в базе данных.

Если представляющий интерес полиморфизм не находится в базе данных, как описано выше, определить является ли полиморфизм показателем предрасположенности к накоплению или защиты от накопления меди в печени, все еще возможно. Это можно осуществлять посредством фенотипирования выборки собак на накопление меди в печени и классификации собак по уровню накопления меди в печени. Затем выборку собак генотипируют по представляющему интерес полиморфизму. Затем для определения ассоциации генотипов c уровнем меди в печени определяют корреляцию генотипов с уровнем меди в печени.

После детекции присутствия или отсутствия одного или более полиморфизмов по изобретению в геноме собаки определяют, защищена ли собака от накопления или подвержена ли она накоплению меди в печени. Генотип каждого полиморфизма отдельно или в комбинации с другими полиморфизмами является показателем защиты собаки от накопления или предрасположенности собаки к накоплению меди в печени.

Для определения предрасположенности собаки к накоплению или вероятности того, что собака защищена от накопления меди в печени, можно генотипировать один или более полиморфизмов, определенных в настоящем документе. Присутствие одного или более аллелей, которые ассоциированы с высоким содержанием меди, является показателем того, что собака подвержена накоплению меди в печени. И наоборот, присутствие одного или более аллелей, ассоциированных с низким содержанием меди, является показателем того, что собака с высокой вероятностью защищена от накопления меди в печени. Например, для определения защищенности собаки от накопления меди в печени в геноме собаки с использованием образца ДНК собаки можно генотипировать SNP в Chr22_3135144., Эта функциональная мутация расположена в ATP7B (на хромосоме X), и аллель A является протективным. После определения генотипа SNP можно определять защищенность собаки от накопления меди в печени. Присутствие аллеля A является показателем защиты от накопления меди в печени. Собака, гомозиготная по аллелю (AA), с наибольшей вероятностью защищена от накопления меди в печени. Таким образом, предпочтительный способ по изобретению включает определение в геноме собаки присутствия или отсутствия аллеля A SNP в ATP7B. Способ может включать определение гомозиготности или гетерозиготности собаки по аллелю A SNP в ATP7B.

Если способ включает тестирование присутствия или отсутствия нескольких полиморфизмов, являющихся показателем предрасположенности к накоплению меди или защиты от накопления меди в печени, можно использовать модель, в которой результаты скомбинированы для получения общей оценки риска или вероятности того, что собака подвержена накоплению или защищена от накопления меди в печени. В примере 6 объяснено как можно получать модель с использованием нескольких полиморфизмов. Предпочтительно используют способ пошагового моделирования. Упрощенный пример получения модели описан в примере 2. В таблице 3 приведены различные возможные генотипы комбинации 5 SNP в областях генов GOLGA5, UBL5 и ATP7A и процентное содержание собак с этими генотипами с высоким содержанием меди (уровни в печени выше 600 мг/кг). В этом примере для определения предрасположенности собаки к накоплению меди в печени можно генотипировать 5 SNP в геноме собаки с использованием образца ДНК собаки. После определения генотипов SNP их можно преобразовывать в бинарные значения на основе ключа, приведенного в примере 2, т.е. на основе степени ассоциации генотипа с высоким содержанием меди. Затем для преобразования бинарных значений в фактор риска на основе процентного содержания собак с этим генотипическим профилем и высоким содержанием меди используют таблицу 3.

Собаку можно тестировать способом по изобретению в любом возрасте, например в возрасте от 0 до 12 лет, от 0 до 6 лет, от 0 до 5 лет, от 0 до 4 лет, от 0 до 3 лет, от 0 до 2 лет или от 0 до 1 года. Предпочтительно собаку тестируют настолько в молодом возрасте насколько возможно, например в течение первого года, первых 6 месяцев или первых 3 месяцев ее жизни. Собаку предпочтительно тестируют до начала накопления меди. Анамнез собаки может быть известен или нет. Например, собака может являться щенком известных родителей и анамнез родителей в отношении накопления меди может быть известен. Альтернативно, собака может представлять собой бездомную или спасенную собаку с неизвестными родословной и анамнезом.

Собака для тестирования любым способом по настоящему изобретению может быть любой породы. Изобретение относится к способу определения того, что геном собаки смешанной породы, или гибридной собаки, или дворняги, или беспородной собаки содержит один или более полиморфизмов, являющихся показателем защиты от накопления или предрасположенности к накоплению меди в печени.

В способе по изобретению собака может представлять собой собаку, у которой предполагают наличие предрасположенности к накоплению меди в печени. Альтернативно, могут предполагать, что собака защищена от накопления меди в печени.

Как правило, собака обладает генетической наследственностью породы, выбранной из лабрадора-ретривера, добермана-пинчера, немецкой овчарки, кейсхонда, коккер-спаниеля, белого высокогорного терьера, бедлингтон-терьера и скайтерьера. Собака может быть собакой смешанной породы, или гибридной собакой, или дворнягой, или беспородной собакой. У собаки по меньшей мере 25%, по меньшей мере 50% или по меньшей мере 100% ее генома может быть унаследовано от любой чистой породы или, более предпочтительно, от любой из пород, описываемых в настоящем документе. Собака может быть чистопородной. В одном из вариантов осуществления изобретения один или оба родителя собаки для тестирования являются или были чистопородными собаками. В другом варианте осуществления чистопородными собаками являются или были один или более прародителей. Чистопородными собаками могут быть или могли быть один, два, три или все четыре из прародителей тестируемой собаки.

Предпочтительно, собака обладает генетической наследственностью породы лабрадора-ретривера. Собака может представлять собой чистопородного лабрадора-ретривера. Альтернативно собака может представлять собой собаку смешанной породы, или гибридную собаку, или беспородную собаку (дворнягу). Один или оба родителя собаки могут представлять собой чистопородных собак породы лабрадор-ретривер. Один, два, три или четыре прародителя собаки могут представлять собой чистопородных собак породы лабрадор-ретривер. В генетической основе собаки может содержаться по меньшей мере 50% или по меньшей мере 75% породы лабрадора-ретривера. Таким образом, по меньшей мере 50% или по меньшей мере 75% генома собаки могут быть получены от породы лабрадор-ретривер.

Генетическую основу породы собаки можно определять, анализируя аллельные частоты генетических маркеров, например SNP или микросателлитов. Комбинации аллельных частот различных SNP или микросателлитов у собаки обеспечивают сигнатуру, позволяющую определить породу собаки или породы, которые составляют смешанную породу собаки. Такой генетический тест может представлять собой коммерчески доступный тест. Альтернативно, тестирования собаки на генетическое наследование ей конкретной породы может не требоваться вследствие предположения наличия наследования конкретной породы владельцем собаки или ветеринаром. Это можно сделать, например, на основе знания родословной собаки или на основе ее внешнего вида.

Прогностический тест по изобретению можно проводить в сочетании с одним или более другими прогностическими или диагностическими тестами, такими как определение генетической основы/наследования породы собаки или предрасположенность к одному или более другим заболеваниям.

Детекция полиморфизмов

Детекция полиморфизмов по изобретению может включать приведение полинуклеотида или белка в образце, полученном у собаки, со специфичным связывающим средством для полиморфизма и определение связывания средства с полинуклеотидом или белком, где связывание средства является показателем присутствия полиморфизма, а отсутствие связывания средства является показателем отсутствия полиморфизма.

Как правило, способ проводят in vitro на образце, полученном у собаки, где образец содержит ДНК собаки. Как правило, образец содержит биологическую жидкость и/или клетки собаки, и ее можно получать, например, с использованием мазка, такого как мазок из ротовой полости. Образец может представлять собой образец крови, мочи, слюны, кожи, щечных клеток или корней волос. Как правило, перед проведением способа образец обрабатывают, например можно проводить выделение ДНК. Полинуклеотид или белок в образце можно физически или химически расщеплять, например, с использованием подходящего фермента. В одном из вариантов осуществления часть полинуклеотида в образце до детекции полиморфизма копируют или амплифицируют, например, посредством клонирования или способом на основе ПЦР.

В настоящем изобретении любой один или более способов могут включать определение присутствия или отсутствия у собаки одного или более полиморфизмов. Как правило, полиморфизм детектируют посредством прямого определения присутствия полиморфной последовательности в полинуклеотиде или белке собаки. Как правило, такой полинуклеотид представляет собой геномную ДНК, мРНК или кДНК, Полиморфизм можно детектировать любым подходящим способом, таким как способы, указанные ниже.

Специфическое связывающее средство представляет собой средство, которое с селективной или высокой аффинностью связывается с белком или полипептидом, несущими полиморфизм, но не связывается или связывается только с низкой аффинностью с другими полипептидами или белками. Специфическое связывающее средство может представлять собой зонд или праймер. Зонд может представлять собой белок (такой как антитело) или олигонуклеотид. Зонд может быть меченым или может обладать способностью к непрямому мечению. Связывание зонда с полинуклеотидом или белком можно использовать для иммобилизации зонда или полинуклеотида или белка.

Как правило, в способе полиморфизм можно детектировать посредством определения связывания средства с полиморфным полинуклеотидом или белком собаки. Однако в одном из вариантов осуществления средство также способно связываться с соответствующей последовательностью дикого типа, например, связываясь с нуклеотидами или аминокислоты, фланкирующими вариабельное положение, хотя способ связывания с последовательностью дикого типа должен на уровне детекции отличаться от связывания с полинуклеотидом или белком, содержащими полиморфизм.

Способ может основываться на анализе лигирования олигонуклеотидов, в котором используют два олигонуклеотидных зонда. Эти зонды связываются со смежными областями на полинуклеотиде, содержащем полиморфизм, что позволяет соответствующему ферменту лигазе лигировать два зонда после связывания. Однако присутствие одного несоответствия в одном из зондов может нарушать связывание и лигирование. Таким образом, лигированные зонды образуются только при наличии полинуклеотида, содержащего полиморфизм, и таким образом, детекцию лигированного продукта можно использовать для определения присутствия полиморфизма.

В одном из вариантов осуществления зонд используют в системе на основе анализа гетеродуплексов. В такой системе, когда зонд связывается с полинуклеотидной последовательностью, содержащей полиморфизм, он в участке нахождения полиморфизма формирует гетеродуплекс и, таким образом, не формирует структуру двойной цепи. Такую гетеродуплексную структуру можно детектировать, используя фермент, специфичный для одной или двойной цепи. Как правило, зонд представляет собой зонд из РНК, гетеродуплексную область расщепляют с использованием РНКазы H и полиморфизм детектируют посредством детекции продуктов расщепления.

Способ может быть основан на флуоресцентном анализе химического расщепления несоответствий, который описан, например, в PCR Methods and Applications 3, 268-71 (1994) и Proc, Natl, Acad, Sci, 85, 4397-4401 (1998).

В одном из вариантов осуществления используют праймер для ПЦР, который инициирует реакцию ПЦР только если он связывается с полинуклеотидом, содержащим полиморфизм, например сайт-специфическая система ПЦР, а присутствие полиморфизма можно определять, детектируя продукт ПЦР. Предпочтительно область праймера, которая комплементарна полиморфизму, находится на 3’-конце праймера или рядом с ним. Присутствие полиморфизма можно определять с использованием анализа на основе ПУР с флуоресцентным красителем и гасящим средством, такого как система детекции ПЦР Taqman.

Специфическое связывающее средство может быть способным к специфическому связыванию с аминокислотной последовательности, кодируемой полиморфной последовательностью. Например, средство может представлять собой антитело или фрагмент антитела. Способ детекции может быть основан на системе ELISA. Способ может представлять собой систему на основе ПДРФ. Его можно использовать, если присутствие полиморфизма в полинуклеотиде создает или разрушает участок рестрикции, распознаваемый рестрикционным ферментом.

Присутствие полиморфизма можно определять на основе изменения подвижности полинуклеотида или белка при электрофорезе в геле, которое обеспечивает присутствие полиморфизма. В случае полинуклеотида, можно использовать анализ одноцепочечного конформационного полиморфизма (SSCP) или денатурирующего градиентного гель-электрофореза (DGGE). В другом способе детекции полиморфизма для определения присутствия полиморфизма секвенируют полинуклеотид, содержащий полиморфную область, в пределах области, содержащей полиморфизм.

Присутствие полиморфизма можно детектировать способом резонансного переноса энергии флуоресценции (FRET). В частности, полиморфизм можно детектировать посредством системы с двумя гибридизационными зондами. Этот способ включает использование двух олигонуклеотидных зондов, расположенных рядом друг с другом и комплементарных всему участку, представляющему интерес полинуклеотида-мишени, где каждый из двух зондов метят флуорофором. В качестве флуорофора можно использовать любую подходящую флуоресцентную метку или краситель так, чтобы длина волны испускания флуорофора на одном зонде (доноре) перекрывала длину волны возбуждения флуорофора на втором зонде (акцепторе). Типичным донорным флуорофором является флуоресцеин (FAM), а типичные акцепторные флуорофоры включают техасский красный, родамин, LC-640, LC-705 и цианин 5 (Cy5).

Для прохождения резонансного переноса энергии флуоресценции два флуорофора при гибридизации обоих зондов с мишенью должны прийти в непосредственную близость. Когда соответствующая длина волны света возбуждает донорный флуорофор, энергия спектра испускания переносится на флуорофор на акцепторном зонде, что приводит к его флуоресценции. Таким образом, детекция этой длины волны света, при возбуждении на длине волны, соответствующей донорному флуорофору, является показателем гибридизации и близкой ассоциации флуорофоров на двух зондах. Каждый зонд можно метить флуорофором флуорофор на одном конце так, чтобы зонд, расположенный выше (со стороны 5’), был мечен на 3’-конец, а зонд, расположенный ниже (со стороны 3’) был мечен на 5’-конце. Расстояние между двумя зондами при связывании с последовательностью-мишенью может составлять от 1 до 20 нуклеотидов, предпочтительно - от 1 до 17 нуклеотидов, более предпочтительно - от 1 до 10 нуклеотидов, например, пропуск 1, 2, 4, 6, 8 или 10 нуклеотидов.

Первый из двух зондов можно сконструировать так, чтобы он связывался с консервативной генной последовательностью рядом с полиморфизмом, а второй зонд можно сконструировать так, чтобы он связывался с областью, содержащей один или более полиморфизмов. Полиморфизмы в генной последовательности, к которой направлен второй зонд, можно детектировать, измеряя изменение температуры плавления, вызываемое образующимися несоответствиями оснований., Степень изменения температуры плавления зависит от количества и типов оснований, вовлеченных в нуклеотидные полиморфизмы.

Типирование полиморфизмов также можно проводить с использованием способа достройки праймера. В этом способе копируют или амплифицируют область-мишень, окружающую полиморфный участок, например, с использованием ПЦР. Затем проводят реакцию секвенирования одного основания с использованием праймера, отжигающегося на одно основание до полиморфного участка (встраивание аллелеспецифического нуклеотида). Затем детектируют продукт достройки праймера с определением нуклеотида, присутствующего в полиморфном участке. Существует несколько способов, которыми можно детектировать продукт достройки. Например, в одном из способов детекции для остановки реакции достройки в полиморфном участке используют флуоресцентно меченные дидезоксинуклеотидные терминаторы. Альтернативно, используют дидезоксинуклеотидные терминаторы с модифицированной массой и продукты достройки праймеров детектируют с использованием масс-спектрометрии. Посредством специфического мечения одного или более терминаторов, можно вычислить последовательность достроенного праймера и таким образом нуклеотид, присутствующий в полиморфном участке. Если специфически метить более одного терминатора, в одной реакции можно анализировать более одного продукта реакции и таким образом можно определять нуклеотид, присутствующий на обеих гомологичных хромосомах.

Изобретение дополнительно относится к праймерам или зондам, которые можно использовать при детекции любых полиморфизмов, определенных в настоящем документе для применения в прогнозе предрасположенности к накоплению или защиты от накопления меди в печени. Полинуклеотиды по изобретению также можно использовать в качестве праймеров для реакций достройки праймера для детекции SNP, определенных в настоящем документе.

Длина таких праймеров, зондов и других полинуклеотидных фрагментов предпочтительно составляет по меньшей мере 10 предпочтительно по меньшей мере 15 или по меньшей мере 20, например, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 40 нуклеотидов. Как правило, их длина составляет до 40, 50, 60, 70, 100 или 150 нуклеотидов. Длина зондов и фрагментов может составлять более 150 нуклеотидов, например до 200, 300, 400, 500, 600, 700 нуклеотидов или даже не достигая нескольких нуклеотидов, например, пяти или десяти нуклеотидов, полноразмерной полинуклеотидной последовательности по изобретению.

Праймеры и зонды для генотипирования полиморфизмов по изобретению можно конструировать с использованием любого подходящего программного обеспечения для конструирования, известного в данной области, с использованием последовательностей в таблицах 4, 5, 6, 8, 18 и 20. Гомологи этих полинуклеотидных последовательностей также являются подходящими для конструирования праймеров и зондов. Как правило, такие гомологи гомологичны по меньшей мере на 70%, предпочтительно по меньшей мере на 80, 90%, 95%, 97% или 99%, например, на области по меньшей мере из 15, 20, 30, 100 или более смежных нуклеотидов. Гомологию можно рассчитывать на основании идентичности нуклеотидов (иногда, обозначаемой как "сильная гомология").

Например, в пакете UWGCG Package предоставлена программа BESTFIT, которую можно использовать для расчета гомологии (например, используя ее значения по умолчанию) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). Алгоритмы PILEUP и BLAST можно использовать для расчета гомологии или выравнивания последовательностей (например, для идентификации эквивалентных или соответствующих последовательностей (как правило, с установками по умолчанию), например, как описано в Altschul S, F, (1993) J, Mol, Evol, 36:290-300; Altschul, S, F et al (1990) J, Mol, Biol, 215:403-10.

Программное обеспечение для проведения анализов BLAST является общедоступным в National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Этот алгоритм включает первичную идентификацию в базе данных последовательностей высокооцениваемых пар последовательностей (HSP) посредством идентификации в искомой последовательности коротких слов длины W, которые или совпадают или удовлетворяют некоторому положительному пороговому показателю T при выравнивании со словом той же длины T, рассматривают как порог оценки близких слов (Altschul et al. выше). Эти исходные соответствующие близкие слова действуют в качестве затравки для начала поиска для нахождения содержащих их HSP. Соответствующие слова продлевают в обоих направлениях в каждой последовательности до тех пор, пока может увеличиваться суммарный показатель выравнивания. Продление соответствующих слов в каждом направлении останавливают, когда суммарный показатель выравнивания снижается на величину X от его максимально достигаемого значения; суммарный показатель достигает нуля или ниже вследствие накопления одного или более отрицательно оцениваемых выравниваний остатков; или достигается конец любой последовательности. Параметры алгоритма BLAST W, T и X определяют чувствительность и скорость выравнивания. В программе BLAST используют длину слова по умолчанию (W) 11, выравнивания оценочной матрицы BLOSUM62 (см. Henikoff and Henikoff (1992) Proc, Natl, Acad, Sci, USA 89: 10915-10919) (B) 50, ожидание (E) 10, M=5, N=4 и сравнение обеих цепей.

В алгоритме BLAST проводят статистический анализ сходства двух последовательностей; см., например, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. Одной из мер сходства, предоставляемой алгоритмом BLAST, является наименьшая суммарная вероятность (P(N)), дающая указание на вероятность, с которой совпадение двух полинуклеотидных последовательностей может произойти случайным образом. Например, последовательность считают сходной с другой последовательностью, если наименьшая суммарная вероятность при сравнении первой последовательности со второй последовательностью составляет менее чем приблизительно 1, предпочтительно менее чем приблизительно 0,1, более предпочтительно менее чем приблизительно 0,01, а наиболее предпочтительно менее чем приблизительно 0,001.

Как правило, гомологичная последовательность отличается по меньшей мере на 1, 2, 5, 10, 20 или более мутаций, которые могут представлять собой замены, делеции или вставки нуклеотидов.

Полинуклеотиды по изобретению, такие как праймеры или зонды, можно предоставлять в выделенной или в значительной степени очищенной форме. Их можно смешивать с носителями или разбавителями, которые не препятствуют их планируемому применению, и рассматривать, по существу, как выделенные. Также они могут находиться в значительной степени очищенной форме, в случае чего они, как правило, составляют по меньшей мере 90%, например, по меньшей мере 95%, 98% или 99%, от полинуклеотидов в препарате.

Детекторные антитела

Детекторное антитело представляет собой антитело, специфичное для одного полиморфизма, но не связывающееся ни с каким другим полиморфизмом, как описано в настоящем документе. Детекторные антитела пригодны, например, в способах очистки, выделения или скрининга, включающих способы иммунопреципитации.

Антитела можно индуцировать против конкретных эпитопов полипептидов по изобретению. Антитело или другое соединение "специфически связывается" с полипептидом, когда оно с селективной или высокой аффинностью связывается с белком, в отношении которого оно специфично, но по существу, не связывается или связывается только с низкой аффинностью с другими полипептидами. В данной области хорошо известен ряд протоколов конкурентного связывания или радиоиммунных анализов для определения способности антитела к специфическому связыванию (см., например, Maddox et al. J. Exp. Med. 158, 1211-1226, 1993). Как правило, такие иммунологические анализы включают формирование комплексов между конкретным белком и антителом к нему и определение формирования комплекса.

Для целей настоящего изобретения термин "антитело", если не указано обратного, включает фрагменты, которые связывают полипептид по изобретению. Такие фрагменты включают фрагменты Fv, F(ab’) и F(ab’)2, а также одноцепочечные антитела. Кроме того, антитела и их фрагменты могут представлять собой химерные антитела, антитела с привитыми CDR или гуманизированные антитела.

Антитела можно использовать в способе детекции полипептидов по изобретению в биологическом образце (таком, как любой такой образец, указанный в настоящем документе), где способ включает:

I получение антитела по изобретению;

II инкубацию биологического образца с указанным антителом в условиях, которые позволяют формирование комплекса антитело-антиген; и

III определение формирования комплекса антитело-антиген, содержащего указанное антитело.

Антитела по изобретению можно получать любым подходящим способом. Способы получения и характеристики антител хорошо известны в данной области, см. например, Harlow and Lane (1988) "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Например, антитело можно получать, индуцируя антитело у животного-хозяина к целому полипептиду или его фрагменту, например к его антигенному эпитопу, далее в настоящем документе "иммуногену". Фрагмент может представлять собой любой из фрагментов, указанных в настоящем документе (как правило, длиной по меньшей мере 10 или по меньшей мере 15 аминокислот).

Способ получения поликлонального антитела включает иммунизацию подходящего животного-хозяина, например экспериментального животного, иммуногеном и выделение иммуноглобулинов из сыворотки животного. Таким образом, животному можно инокулировать иммуноген, затем у животного получать кровь и очищать фракцию IgG. Способ получения моноклонального антитела включает иммортализацию клеток, которые продуцируют желаемое антитело. Гибридомные клетки можно получать посредством слияния клеток селезенки экспериментального животного, которому проведена инокуляция, с опухолевыми клетками (Kohler and Milstein (1975) Nature 256, 495-497).

Иммортализованную клетку, продуцирующую желаемое антитело, можно выбирать общепринятым способом. Гибридомы можно выращивать в культуре или инъецировать интраперитонеально с получением асцитной жидкости или в кровоток аллогенного хозяина или хозяина с иммунной недостаточностью. Антитело человека можно получать посредством иммунизации лимфоцитов человека in vitro с последующей трансформацией лимфоцитов вирусом Эпштейна-Барр.

Подходящим экспериментальным животным для получения моноклональных и поликлональных антител является коза, кролик, крыса, мышь, морская свинка, курица, овца или лошадь. При желании, иммуноген можно вводить в виде конъюгата, в котором иммуноген связан, например, посредством боковой цепи одного из аминокислотных остатков, с подходящим носителем. Как правило, молекула носителя представляет собой физиологически приемлемый носитель. Полученное антитело можно выделять и, при желании, очищать.

Набор для детекции

Изобретение также относится к набору, содержащему средства для типирования одного или более полиморфизмов, определенных в настоящем документе. В частности, такие средства могут включать специфическое связывающее средство, зонд, праймер, пару или комбинацию праймеров или антитело, включая фрагмент антитела, как определено в настоящем документе, которые способны к детекции или содействию детекции полиморфизмов, определенных в настоящем документе. Праймер или пара или комбинация праймеров могут представлять собой сайт-специфические праймеры, которые обеспечивают амплификацию в ПЦР только полинуклеотидной последовательности, содержащей полиморфизм, подлежащий детекции, как описано в настоящем документе. Альтернативно праймер или пара праймеров могут не быть специфичными к полиморфному нуклеотиду, но могут быть специфичными к области выше (к 5’-концу) и/или ниже (к 3’-концу). Эти праймеры позволяют копировать область, содержащую полиморфный нуклеотид, Набор, пригодный для использования в способе достройки праймера, может конкретно содержать меченые дидезоксинуклеотидтрифосфаты (ddNTP). Например, они могут быть флуоресцентно меченые или обладать измененной массой для обеспечения детекции продукта достройки и таким образом определения нуклеотида, присутствующего в полиморфном положении.

Набор также может содержать специфическое связывающее средство, зонд, праймер, пару или комбинацию праймеров или антитело, которые способны к детекции отсутствия полиморфизма. Набор может дополнительно содержать буферы или водные растворы.

Набор может дополнительно содержать один или более других реагентов или инструментов, которые обеспечивают проведение любых вариантов осуществления способа, указанного выше. Такие реагенты или инструменты могут включать одно или более из следующего: средства для детекции связывания средства с полиморфизмом, детектируемая метка, такая как флуоресцентная метка, фермент, способный действовать на полинуклеотид, как правило, полимераза, рестрикционный фермент, лигаза, РНКаза H или фермент, который присоединяет метку к полинуклеотиду, подходящий буфер(ы) или водные растворы для ферментных реагентов, праймеры для ПЦР, которые связываются с областью, фланкирующей полиморфизм, как указано в настоящем документе, положительный и/или отрицательный контроль, устройство для электрофореза в геле, средства для выделения ДНК из образца, средства получения образца у индивидуума, такие как мазок или инструмент, содержащий иглу, или подложка, содержащая лунки, в которых можно проводить реакции детекции. Набор может представлять собой или содержать панель, такую как панель полинуклеотидов, содержащую специфическое связывающее средство, предпочтительно, зонд по изобретению, Как правило, набор содержит набор инструкций для использования набора.

Биоинформатика

Последовательности полиморфизмов можно хранить в электронном формате, например в компьютерной базе данных. Таким образом, изобретение относится к базе данных, содержащей информацию об одном или более полиморфизмах, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a); и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158);

и их ассоциации с предрасположенностью собаки к накоплению меди в печени. База данных также может содержать информацию о любых других полиморфизмах, описываемых в настоящем документе. База данных может содержать дополнительную информацию о полиморфизме, например о степени ассоциации полиморфизма с предрасположенностью собаки к накоплению меди в печени.

Изобретение также относится к базе данных, содержащей информацию об одном или более полиморфизмах, выбранных из:

(a) Chr22_3135144 (SEQ ID NO: 145); и

(b) одного или более полиморфизмов в неравновесном сцеплении с (a);

и их ассоциации с защитой собаки от накопления меди в печени.

База данных также может содержать информацию о любых других полиморфизмах, описываемых в настоящем документе. База данных может содержать дополнительную информацию о полиморфизме, например о степени ассоциации полиморфизма с защитой собаки от накопления меди в печени.

Базу данных, как описано в настоящем документе, можно использовать для определения содержания в геноме собаки одного или более полиморфизмов, являющихся показателем защиты от накопления или предрасположенности к накоплению меди в печени. Такое определение можно проводить электронными способами, например, с использованием компьютерной системы (такой как PC).

Как правило, определение содержания в геноме собаки одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению или защиты от накопления меди в печени, проводят посредством введения в компьютерную систему генетических данных собаки; сравнения генетических данных с базой данных, как определено в настоящем документе; и определения на основании этого сравнения содержания в геноме собаки одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди или защиты от накопления меди в печени. Затем эту информацию можно использовать для направления регулирования уровня меди в печени собаки или можно использовать с целью информированной селекции.

Изобретение также относится к компьютерной программе, содержащей средства программного кода для проведения всех этапов способа по изобретению, когда указанную программу запускают на компьютере. Также предоставлен компьютерный программный продукт, содержащий средства программного кода, хранимые на читаемом компьютером носителе для проведения способа по изобретению, когда указанную программу запускают на компьютере. Дополнительно предоставлен компьютерный программный продукт, содержащий средства программного кода на носителе, которые при исполнении на компьютерной системе, дают команду компьютерной системе на исполнение способа по изобретению.

Как проиллюстрировано на фиг. 10, изобретение также относится к устройству, настроенному на исполнение способа по изобретению. Как правило, устройство содержит компьютерную систему, такую как PC. В одном из вариантов осуществления компьютерная система содержит средства 20 для получения генетических данных у собаки; модуль 30 для сравнения данных с базой данных 10, содержащей информацию о полиморфизмах; и средства 40 для определения на основе указанного сравнения содержания в геноме собаки одного или более полиморфизмов, являющихся показателем защиты собаки от накопления меди в печени или предрасположенности собаки к накоплению меди в печени.

Средство селекции

Племенную ценность определяют как ценность индивидуума в качестве родителя и широко используют для улучшения желаемых признаков домашнего скота в сельском хозяйстве. Для улучшения общей способности метаболизма меди у собак и для снижения частоты ассоциированных с медью заболеваний, таких как хронический гепатит, предпочтительным для селекции является выбор собак, которые защищены от накопления или не подвержены накоплению меди в печени. Эту проблему решают посредством использования полиморфизмов, которые можно использовать для определения защиты собаки или отсутствия предрасположенности собаки к накоплению меди в печени для информированной селекции.

Например, на способность к метаболизму меди у потомства двух собак можно влиять посредством генотипа родителей в локусе ATP7B. Перенос конкретного варианта в этом локусе может быть благоприятен для потомства. При определении генотипа в этом локусе можно оценить племенную ценность возможного родителя и таким образом принять решение о целесообразности данной племенной пары.

Таким образом, изобретение относится к способу отбора собаки для получения потомства, защищенного от накопления меди в печени, включающему определение способом по изобретению содержания в геноме собаки одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, у первой собаки-кандидата, и, таким образом, определение того, является ли первая собака-кандидат подходящей для получения потомства, защищенного от накопления меди в печени. Дополнительно способ может включать определение способом по изобретению содержания в геноме собаки одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, у второй собаки противоположного первой собаке пола. Если результаты являются такими, что первая и/или вторая собака несут генотип, являющийся показателем защиты от накопления меди в печени, тогда для получения потомства, защищенного от накопления меди в печени, первую собаку можно вязать со второй собакой.

Например, способ может включать определение присутствия или отсутствия в геноме первой собаки-кандидата одного или более полиморфизмов, выбранных из Chr22_3135144 (SEQ ID NO: 145), и одного или более полиморфизмов в неравновесном сцеплении с ними. Более предпочтительно способ дополнительно включает определение присутствия или отсутствия SNP ChrX_63338063 (ATP7a_Reg3_F_6 SNP; SEQ ID NO: 142) или одного или более полиморфизмов в неравновесном сцеплении с указанным SNP, таких как ChrX_63397393 (ATP7a_Reg16_F_42 SNP; SEQ ID NO: 143). Способ по изобретению может включать определение присутствия или отсутствия аллеля A Chr22_3135144 (SEQ ID NO: 145) и/или аллеля T ChrX_63338063 (SEQ ID NO: 142). Присутствие одного или более из этих SNP является показателем того, что первая собака защищена от накопления меди в печени и таким образом является хорошим кандидатом для вязки со второй собакой. Гомозиготность первой и/или второй собаки является наиболее предпочтительной, так как это увеличивает вероятность того, что потомство будет гомозиготным и, таким образом, защищенным от накопления меди в печени.

Изобретение также относится к способу отбора собаки для получения потомства, защищенного от накопления меди в печени, с использованием полиморфизмов по изобретению, которые являются показателем предрасположенности к накоплению меди. Отсутствие таких полиморфизмов в геноме собаки является показателем того, что собака является хорошим кандидатом для вязки. Таким образом, способ по изобретению может включать определение присутствия в геноме первой собаки-кандидата одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, и таким образом определение того, что первая собака-кандидат является подходящей для получения потомства, защищенного от накопления меди в печени.

Способ может включать детекцию присутствия или отсутствия в геноме первой собаки-кандидата одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a) и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Дополнительно способ может включать определение содержания в геноме второй собаки противоположного первой собаке пола одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени. Таким образом, способ может включать детекцию присутствия или отсутствия в геноме второй собаки одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287;

(b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a) и/или

(c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Если результаты являются такими, что геном первой и/или второй собаки не несет генотипа, являющегося показателем предрасположенности к накоплению меди в печени, первую собаку затем можно вязать со второй собакой с получением потомства, которое неподвержено накоплению меди в печени.

Дополнительно способ может включать детекцию присутствия или отсутствия в геноме первой собаки-кандидата (I) полиморфизма в генах GOLGA5, ATP7A или UBL5, который является показателем предрасположенности к накоплению меди в печени, и/или (II) полиморфизма в неравновесном сцеплении с указанным полиморфизмом (I). Предпочтительно, способ включает определение присутствия или отсутствия в геноме первой собаки-кандидата одного или более полиморфизмов, выбранных из SNP, указанных в таблицах 4-6, и одного или более полиморфизмов в неравновесном сцеплении с ними. Присутствие одного или более из этих полиморфизмов является показателем того, что первая собака подвержена накоплению меди в печени и таким образом не является хорошим кандидатом для вязки со второй собакой с целью получения потомства, защищенного от накопления меди в печени.

Первая собака-кандидат и/или вторая собака могут быть любой породы. Предпочтительно первая собака-кандидат и/или вторая собака имеют генетическую наследственность породы, выбранной из лабрадора-ретривера, добермана-пинчера, немецкой овчарки, кейсхонда, коккер-спаниеля, белого высокогорного терьера, бедлингтон-терьера и скайтерьера. Более предпочтительно, первая собака-кандидат и/или вторая собака имеют генетическую наследственность породы лабрадор-ретривера. Собака может представлять собой чистопородного лабрадора-ретривера.

Альтернативно, собака может представлять собой собаку смешанной породы или гибридную собаку, или беспородную собаку (дворнягу). Одна или обе собаки-родителя могут быть чистопородной собакой лабрадором-ретривером. Один, два, три или четыре прародителя собаки могут быть чистопородными собаками лабрадорами-ретриверами. В генетической основе собаки может содержаться по меньшей мере 50% или по меньшей мере 75% породы лабрадора-ретривера. Таким образом, по меньшей мере 50% или по меньшей мере 75% генома собаки могут быть получены от породы лабрадор-ретривер.

Генетическую наследственность породы собаки можно определять, анализируя аллельные частоты генетических маркеров, например SNP или микросателлитов. Комбинации аллельных частот различных SNP или микросателлитов у собаки обеспечивают сигнатуру, позволяющую определить породу собаки или породы, которые составляют смешанную породу собаки. Такой генетический тест может представлять собой коммерчески доступный тест. Альтернативно, тестирования собаки на генетическое наследование ей конкретной породы может не требоваться вследствие предположения наличия наследования конкретной породы владельцем собаки или ветеринаром. Это можно сделать, например, на основе знания родословной собаки или на основе ее внешнего вида.

Наиболее чистопородные собаки пород, признаваемых общей племенной книгой, контролируются "закрытыми племенными книгами". Как правило, племенная книга представляет собой официальный регистр одобренных собак данной породы, хранимый, например, ассоциацией породы или собаководческим клубом. Как правило, ее называют "закрытой" племенной книгой, если собак можно добавлять только если оба их родителя были зарегистрированы. У большинства пород существуют закрытые племенные книги, что приводит к родственному скрещиванию, так как генетическое разнообразие извне существующей популяции внесено быть не может. В ряде пород, признаваемых собаководческими клубами, это приводит к высоким частотам генетических заболеваний или нарушений и к другим проблемам, таким как уменьшенный размер помета, сниженная продолжительность жизни и неспособность к естественному оплодотворению.

Во избежание проблем, ассоциированных с родственным скрещиванием, для скрещивания желательно из конкретной породы выбирать собак, которые являются наиболее дальними родственниками друг с другом по сравнению с собаками, которые являются более близкородственными. Таким образом, в одном из аспектов изобретения определяют генетическую наследственность породы первой собаки-кандидата и второй собаки-кандидата для определения степени родства этих двух собак. В этом аспекте по изобретению термин "генетическая наследственность породы" относится к генетическому происхождению собаки в пределах конкретной породы. Генетическую наследственность породы собаки можно определять, как описано в настоящем документе. При определении генетической наследственности собаки можно различать собак в пределах одной породы для определения того, насколько они близкородственны.

Таким образом, в одном из аспектов изобретения определяют степень родства первой собаки-кандидата и второй собаки-кандидата, что включает сравнение генетической наследственности породы первой собаки-кандидата со второй собакой-кандидатом той же породы. Предпочтительно собаки являются чистопородными собаками. Генетическую наследственность породы каждой собаки можно определять, например, идентифицируя у указанной собаки присутствие или отсутствие одного или более специфичных для породы полиморфизмов.

Степень родства можно определять на основании количества специфичных для породы полиморфизмов, которые собаки несут совместно. Например, две собаки одной и той же породы могут совместно нести от 0 до 100% тестируемых специфичных для породы полиморфизмов (например, от 10 до 90%, от 20 до 80%, от 30 до 70% или от 40 до 60%). Таким образом, две собаки могут совместно нести по меньшей мере 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% или 90% тестируемых специфичных для породы полиморфизмов. Процентное содержание совместных тестируемых специфичных для породы полиморфизмов у двух собак можно использовать в качестве меры их степени родства. В этом аспекте по изобретению двух собак вяжут, если они в достаточной степени генетически неродственны. Например, их можно вязать, если они совместно несут менее 60%, 50%, 40%, 30% или менее 20% тестируемых специфичных для породы полиморфизмов.

Изобретение также относится к способу отбора одной или более собак для скрещивания с конкретной собакой, где способ включает:

(a) определение для конкретной собаки и для каждой собаки в тестовой группе двух или более собак противоположного конкретной собаке пола содержания в геноме одного или более полиморфизмов, являющихся показателем защиты от накопления меди в печени, и/или одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени; и

(b) отбора из тестовой группы одной или более собак для скрещивания с конкретной собакой.

Тестовая группа может состоять по меньшей мере из 2, 3, 4, 5, 10, 15, 20, 25, 30, 50, 75, 100 или 200 различных собак, например от 2 до 100, от 5 до 70 или от 10 до 50 собак. Как правило, собак выбирают из тестовой группы на основе защищенности от накопления меди в печени. Собака или собаки, выбранные из тестовой группы, могут обладать одной и той же или сходной генетической наследственностью породы, что и конкретная собака.

Конкретная собака и каждая собака в тестовой группе могут быть любой породы. Предпочтительно конкретная собака и/или каждая собака в тестовой группе обладают генетической наследственностью породы, выбранной из лабрадора ретривера, добермана-пинчера, немецкой овчарки, кейсхонда, коккер-спаниеля, белого высокогорного терьера, бедлингтон-терьера и скайтерьера. Более предпочтительно собака обладает генетической наследственностью породы лабрадор-ретривер. Собака может представлять собой чистопородного лабрадора-ретривера. Альтернативно, собака может представлять собой собаку смешанной породы или гибридную собаку или беспородную собаку (дворняга). Один или оба родителей собаки могут быть чистопородными собаками лабрадорами-ретриверами. Один, два, три или четыре прародителей собаки могут быть чистопородными собаками лабрадорами-ретриверами. В генетической основе собаки может содержаться по меньшей мере 50% или по меньшей мере 75% породы лабрадора-ретривера. Таким образом, по меньшей мере 50% или по меньшей мере 75% генома собаки могут быть получены от породы лабрадор-ретривер.

Для скрещивания с конкретной собакой в тестовой группе можно выбирать собаку с наиболее высокой вероятностью защиты от накопления меди в печени, определенной на основе присутствия или отсутствия полиморфизмов, ассоциированных с защитой от накопления или предрасположенностью к накоплению меди в печени. Альтернативно, для скрещивания с конкретной собакой в тестовой группе выбирают ряд собак, которые с высокой вероятностью защищены от накопления меди в печени. Например, в тестовой группе можно выбирать по меньшей мере 2, 3, 4, 5, 10, 15 или 20 собак. Затем из группы можно проводить дополнительный отбор выбранных собак на основе других факторов, например географического нахождения, возраста, племенного состояния, истории болезни (анамнеза), предрасположенности к заболеванию или физических характеристик.

Как описано выше, в пределах одной и той же породы желательно вязать собак наиболее генетически неродственных. Это делают для увеличения или поддержания генетического разнообразия в породе и для снижения вероятности проблем, связанных с родственным скрещиванием, возникающих у потомства. Таким образом, дополнительный отбор собак из тестовой группы может быть основан на генетическом родстве собак с конкретной собакой. Таким образом, дополнительно способ может включать:

(a) сравнение генетической наследственности породы конкретной собаки с генетической наследственностью породы каждой собаки в тестовой группе из двух или более собак той же порода и противоположного конкретной собаке пола;

(b) определение на основании сравнения степени родства между конкретной собакой и каждой собакой в тестовой группе; и

(c) отбор из тестовой группы одной или более собак для скрещивания с конкретной собакой.

Собак из тестовой группы можно выбирать на основании их родства с конкретной собакой (т.е. с собакой для разведения). Предпочтительно собака или собаки, выбранные из тестовой группы, являются наиболее дальними родственниками (т.е. имеют наименьшую степень родства) из тестовой группы собак. Генетическая наследственность породы конкретной собаки и собаки в тестовой группе может быть уже известна или ее можно определять, например, посредством коммерчески доступного теста породы.

Таким образом, изобретение относится к способу рекомендации одной или более подходящих собак для скрещивания с конкретной собакой. Рекомендация можно давать хозяину или опекуну конкретной собаки, ветеринару, селекционеру собак, собаководческому клубу или регистру породы.

Изобретение также относится к способу селекции собак, где перед скрещиванием собак определяют защиту от накопления или предрасположенность к накоплению меди в печени по меньшей мере двух собак противоположного пола, необязательно в пределах одной и той же породы.

Данные о защите собаки от накопления или предрасположенности к накоплению меди в печени можно хранить в электронном формате, например, в компьютерной базе данных. Таким образом, изобретение относится к базе данных, содержащей информацию о предрасположенности к накоплению меди или защиты от накопления меди в печени и поле одной или более собак. База данных может содержать дополнительную информацию о собаке, например о генетической наследственности породы собаки, племенном состоянии, возрасте, географическом нахождении, истории болезни (анамнезе), предрасположенности к заболеванию или физических характеристиках. Как правило, база данных дополнительно содержит уникальный для каждой собаки идентификатор, например зарегистрированное имя собаки. База данных может быть доступна удаленно, например, с использованием интернета.

Изобретение проиллюстрировано приведенными ниже примерами:

ПРИМЕР 1

Полногеномное исследование ассоциаций и идентификация областей, потенциально содержащих информативные гены

В настоящем примере описан общий подход, который применяют для разработки прогностического генетического теста на накопление меди. В нем также подробно описана используемая методология для полногеномного исследования ассоциаций и идентификации областей генома, потенциально содержащих информативные гены.

Общий подход, используемый для разработки прогностического генетического теста на накопление меди, являлся таким, как описано далее. Сначала образцы, полученные у собак, диагностированных как "пораженные" или "непораженные" накоплением меди в печени, обрабатывали на генотипирующей панели с большим количеством маркеров. Это известно как "полногеномное исследование ассоциаций". Анализ этих данных обеспечил идентификацию областей, потенциально содержащих информативные гены. Затем для получения модели использовали SNP в областях с представляющими интерес генами. Параллельно секвенировали представляющие интерес гены для поиска кодирующих мутаций или других мутаций, которые лучше описывают генетическое действие на заболевание. Затем эти мутации использовали для дальнейшего построения модели. На практике, этот процесс включал ответвления и параллельные пути ввиду непрерывного улучшения технологии.

Набор пациентов

Данные получали у 254 лабрадоров-ретриверов. Собак набирали двумя способами. Клинически пораженных собак принимали в отделение гепатологии Faculty of Veterinary Medicine, Utrecht University по направлению ветеринара, активно набирали родственников первой линии пораженных собак посредством регистрационных дел голландского собаководческого клуба породы лабрадор-ретривер.

Диагноз

Каждую собаку подвергали медицинскому осмотру и у нее забирали кровь для тестирования свертывания, определения печеночных ферментов (щелочной фосфатазы и аланинаминотрансферазы), желчных кислот и альбумина. Для выделения ДНК использовали образцы крови с ЭДТА.

Получали образцы биопсии печени у 239 собак способом Менгини посредством ультразвука, управляемого устройством с иглой Trucut 14 калибра, проводимую во время лапароскопии или лапаротомии или проводимую после эвтаназии (Teske et al., 1992, Vet, Rec, 131:30-32). Образцы биопсии печени фиксировали в 4% забуференном формалине в течение 3 часов, переносили в 70% этанол и погружали в парафин. На предметных стеклах закрепляли пятимикронные срезы и окрашивали их гематоксилином и эозином (обычное исследование) по Ван Гизону (окрашивание на ретикулин) и рубеановой кислотой (окрашивание на медь).

Диагноз основывался на гистологической оценке биопсии печени сертифицированным патологом (TSGAMvdI), работающим у авторов. Степень накопления меди оценивали по шкале от 0 до 5, как описано ранее (Teske et al., 1992, Vet, Rec, 131:30-32). Проводили дополнительную биопсию печени в не содержащий медь контейнер, лиофилизировали и количественно определяли медь посредством инструментального нейтронно-активационного анализа (INAA) в сухой массе печени (Bode et al., 2008, Anal, Bioanal, Chem, 390:1653-1658).

Ниже приведена гистологическая шкала:

Степень 0 - медь отсутствует.

Степень 1 - единичные клетки печени содержат незначительные количества содержащих медь гранул.

Степень 2 - небольшие группы или области клеток печени содержат от небольших до умеренных количеств содержащих медь гранул.

Степень 3 - более крупные группы или области клеток печени содержат умеренные количества содержащих медь гранул, иногда, ассоциированные с содержащими медь макрофагами.

Степень 4 - большие области клеток печени со множеством содержащих медь гранул, как правило, ассоциированных с содержащими медь макрофагами.

Степень 5 - диффузное присутствие клеток печени со множеством содержащих медь гранулы, как правило, ассоциированных с содержащими медь макрофагами, по всей доле.

Фенотипирование образцов

Ассоциированный с медью хронический гепатит фенотипически охарактеризован ранее (Hoffmann et al., 2006, J, Vet, Intern, Med, 20: 856-861). На основе оценки образцов биопсии печени определяли четыре фенотипа.

В рамках данных, полученных с чипа 22k (см. ниже),авторы обозначали концентрации меди в печени выше 600 мг/кг сухой массы как "пораженные", а ниже 400 мг/кг сухой массы - как "непораженные" (кол-во пораженных).

Также использовали бинарный фенотип для большинства явных случаев медного токсикоза и контролей (токс, Cu). Случай определяли как наличие уровня меди в печени >1200 мг/кг или окрашивание на медь >3 и гистологические признаки гепатита. Контроль определяли как наличие уровня меди в печени < 400 мг/кг и окрашивание <2 и отсутствие аномалий в гистологическом препарате. Для увеличения разрешения генетического картирования использовали более разделенный фенотип.

В качестве количественного фенотипа использовали полуколичественную оценку патологом, основанную на окрашивании рубеановым водородом (р.к.) (шкала 0-5), и она была доступна для всех собак, которым проводили биопсию печени.

В качестве количественного фенотипа использовали количественный уровень меди в печени ткань (кол. Cu), и он находился в интервале от 65 до 3870 мг/кг.

Генотипирование (чип Illumina 22K)

Полногеномное генотипирование проводили с использованием панели для генотипирования собак Illumina первого поколения, в которой преследуется цель определять приблизительно 22000 локусов SNP (чип 22K). На этой панели авторы проанализировали 251 образец ДНК собаки.

Анализ хи-квадрат

Данные анализировали с использованием группы тестов хи-квадрат. Использовали тест с двумя степенями свободы. Затем локусы ранжировали по величине p для установления приоритетов для дальнейшего исследования.

Парный анализ

Как правило, генетическое картирование проводят посредством генотипирования выбранных образцов по маркерам, расположенных по всему геному. Образцы фенотипировали по признаку, такому как заболевание. Как правило, образцы выбирают из одной субпопуляции и выбирают так, чтобы они были настолько неродственными в пределах популяции, насколько возможно. Это делают для снижения риска получения ложноположительных результатов на основании структуры популяции.

В предыдущих генетических исследованиях собак удовлетворить этим строгим критериям было трудно, так как собак постоянно подвергали большому количеству различных видов генетического отбора. Это создает структуру популяции в массиве данных охватывающую подтипы пород, географических положений, времени и общественных групп. Для анализа генетических данных собак при наличии структуры популяции и близкородственных образцов необходимо было разработать новые способы. Наиболее успешным способом, разработанным для этой цели, явилось парное картирование.

Для определения полиморфизмов, ассоциированных с генетическим признаком в группе индивидуумов, был разработан способ, а именно "картирование распределения" (также известный как "2D-картирование"). Способ в настоящее время ограничен бинарными состояниями (исследования случай/контроль). Комплексные заболевания с генетическим компонентом, как правило, контролируют более одного гена. Эти гены могут нелинейно взаимодействовать, делая сложным их картирование традиционными способами. Посредством работы на уровне пары индивидуумов можно вынести за скобки влияние нескольких генов, так как локус или будет вносить вклад в фенотип у этой пары индивидуумов, или нет. Полная работа этого процесса описана ниже. После проведения этого анализа можно выделить аллели риска в каждой области и построить модель для предсказания фенотипа с использованием других способов.

Алгоритм "картирования распределения" проводит сканирование генома, останавливаясь каждые 50 т.п.н. В каждой из этих точек анализируют каждую пару индивидуумов. Для каждой парой анализируют генотипы для всей хромосомы, сравнивая вероятность генотипов при трех возможных сценариях. Первый сценарий представляет собой то, что у этой пары индивидуумов существует рецессивная мутация, контролирующая фенотип. Второй сценарий представляет собой то, что у этой пары индивидуумов существует доминантная мутация, контролирующая фенотип. Третий сценарий представляет собой то, что важная для фенотипа мутация у этой пары в этом положении отсутствует. Вероятности рассчитывают с использованием скрытой марковской модели, описанной ниже. Сравнивая эти вероятности можно получить коэффициент Байеса для этой пары индивидуумов в пользу или против присутствия в этом положении рецессивной или доминантной мутации, контролирующей фенотип. Берут логарифм этих значений; затем положительное представляет больший вес в пользу сценария рецессивной или доминантной мутации, а отрицательное значение представляет большие основания в пользу отсутствия в этом участке важной мутации.

Пары индивидуумов сортируют в порядке логарифмов коэффициентов Байеса в этом локусе. Затем логарифмы коэффициентов Байеса пар суммируют в нисходящем порядке, принимая в расчет сведения о суммарном весе признака в каждом процентиле данных. В большинстве случаев некоторые логарифмы коэффициентов Байеса являются положительными, а некоторые являются отрицательными. Это дает эффект повышения записываемого значения для определенного процента данных, а затем снижения, Максимум этого значения дает меру веса признака в пользу рецессивной или доминантной моделей. Это обозначает как "пиковое значение".

В некоторых случаях алгоритм имеет погрешность для особенно гомозиготных областей генома или областей с высокой плотностью полиморфизмов. Этот эффект количественно определяют проводя процесс с каждой парой, переставленной среди четырех возможных состояний случай/контроль (случай-случай, случай-контроль, контроль-случай, контроль-контроль). Для любого локуса вычитают пиковое значение в переставленной модели из нормального пикового значения, и это дает скорректированное пиковое значение. Затем можно сравнивать скорректированные пиковые значения в геноме, получая представляющие интерес области.

Этот способ использовали для картирования ряда положений, ассоциированных с уровнем меди в печени. Эти положения маркированы профилями гаплотипов, указывающими на связанный с признаком ген. Затем положения исследовали на возможные гены.

Анализ наличия генов в областях

Области, идентифицированные по полногеномном поиске ассоциаций, затем анализировали на вероятное наличие генов. Процесс включал идентификацию границ информативных областей; идентификацию всех генов в областях в Ensembl; поиск соответствующих белковых доменов, связанных с медью или функцией печени; поиск участников метаболических путей, связанных с медью; и поиск генов, экспрессируемых в соответствующих тканях. Затем на основе этой информации гены ранжировали по вероятности вовлечения в заболевание.

Этим способом идентифицирован ряд генов-кандидатов, ассоциированных с накоплением меди или заболеванием печени.

Генотипирование (чип Illumina 170K)

Позже стал доступен более новый, чем чип 22K, описанный выше, чип SNP, содержащий 172115 маркеров из более разнообразных источников (чип 170K). Этот чип содержит в среднем более 70 маркеров на м.п.н. Авторы анализировали на этой панели те же образцы ДНК, которые они анализировали на чипе 22K, и дополнительные образцы ДНК.

Анализ

Используя результаты, полученные на чипе 170K, проводили полногеномный анализ ассоциаций с использованием программного обеспечения GenABEL (Aulchenko et al., 2007, Bioinformatics, 23: 1294-1296). Для анализа отбирали SNP, которые были успешно типированы у 98% индивидуумов и индивидуумов, у которых успешно генотипировали 98% SNP. Для анализа отбирали SNP, когда существовало по меньшей мере 20 его носителей. После анализа значимо ассоциированные SNP проверяли на равновесие Харди-Вейнберга (HWE).

На основе информации об аутосомных генотипах определяли генетическое родство. Посредством полигенной модели, в которой учитывали субструктурирование популяции рассчитывая матрицу генетического родства, определяли наследственность для трех признаков (медный токсикоз, показатель окрашивания рубеановым водородом и количество меди в печени в мг/кг) (Aulchenko et al., 2007, Genetics, 177: 577-585). В качестве независимых переменных включали возраст и пол. Стратификацию популяции проверяли посредством диаграммы многомерного шкалирования. Проводили коррекцию стратификации посредством проведения оценочного теста на оставшейся от оценок полигенной модели и геномного контроля. Для коррекции стратификации популяции использовали функции grammas (Amin et al., 2007, PloS One, 2: e1274) и fasta (Chen et al., 2007, Am, J, Hum, Genetics, 81: 913-926). В анализе grammas для получения скорректированных значений p для всего генома использовали тысячу перестановок, X-хромосома анализировали отдельно для самцов и самок.

В этом случае также проводили парный способ, описанный выше.

Всего контроль качества прошли 109496 маркеров и 253 собак. Итоговые данные для фенотипов и рассчитанной наследственности (H2) для каждого признака приведены в таблице 1.

Таблица 1
Итоговые данные для фенотипов
Фенотип H2 Кол-во индивидуумов Кол-во индивидуумов Средний возраст в годах (Ст,откл,)
Медный токсикоз (токс. Cu) 0,64 Cases 33 Самцы 8 6,2 (2,2)
Самки 25
Controls 62 Самцы 30 6,0 (2,6)
Самки 32
Показатель окрашивания рубеановым водородом (р.к.) (0-5) 0,49 235 Самцы 80 5,9 (2,6)
Самки 155
Количество меди в печени, в мг/кг (кол, Cu) 0,41 171 Самцы 50 5,9 (2,6)
Самки 121

Полногеномный анализ ассоциаций приводил к результатам, которые были близки к тому, чтобы быть значимыми для всего генома результатами. Результаты 5 наиболее значимых SNP для всех трех анализов приведены в таблице 2.

Таблица 2
Значения p для анализа Fasta для каждого из трех фенотипов
Фенотип Хромосома Положение Название SNP Значение p
Токс, Cu 31 36465117 BICF2P124447 6,632271e-05
27 40245328 BICF2P154172 1,939526e-04
38 12095696 BICF2P981165 2,029342e-04
38 11652179 BICF2P514131 2,138857e-04
10 67858787 BICF2S23647325 2,733150e-04
Р,к, 22 7767302 BICF2G630316066 4,016960e-06
22 12463818 BICF2S23122114 1,464354e-05
22 12495308 BICF2S23320612 1,464354e-05
22 12511354 BICF2S2417189 1,464354e-05
22 7548442 BICF2G630315950 1,526836e-05
Кол, Cu 18 38185045 BICF2G630699136 1,514989e-06
27 43555866 BICF2G630153553 2,723925e-06
18 40278498 BICF2G630697308 3,293349e-06
18 40223465 BICF2G630697352 5,019301e-06
18 40227604 BICF2G630697350 5,019301e-06

Для генотипа р.к. идентифицировали близкую к значимой для всего генома область (значение p после 1000 перестановок в составляло 0,11) на хромосоме 22. Выявлено, что ассоциированная область перекрывает область 15 м.п.н. в начале хромосомы. В этой области в 3,12-3,16 м.п.н. локализовали ген-кандидат ATP7B. Анализ этого гена описан в примере 5.

Пример 2

Получение трехобластной модели

В этом примере описано получение трехобластной модели для определения предрасположенности к накоплению меди в печени. Эта работа также описана в WO 2009/044152 A2, WO 2010/038032 A1 и WO 2010/116137 A1.

Из массива данных извлекали SNP в генах и рядом с генами, которым отдали предпочтение в анализе областей, описанном в примере 1. Их анализировали отдельно и в гаплотипах в поиске информативных аллельных профилей, ассоциированных с уровнем меди в печени.

В модели использовали наиболее значимые (с 1 степенью свободы в тесте хи-квадрат) из этих профилей. Для применения в модели выбрали SNP рядом с тремя генами (ATP7A, ортолог UBL5 и GOLGA5). Затем получали булеву модель, где каждый генный профиль представлен 0 или 1 (где 1 представляет собой генотип или профиль с наибольшим риском) и комбинацией трех профилей посредством последовательности из трех чисел (например, 0-0-0 или 0-1-1). Таким образом, 1-1-1 представляет наибольший риск высокого содержания меди в печени.

В таблице 3 приведен результат для трехобластной модели для прогноза накопления меди. Для каждой области использовали один SNP или группу SNP. Модель демонстрирует очевидное различие риска заболевания в зависимости от генотипа собаки с использованием этой простой модели из SNP в трех геномных областях.

Таблица 3
Модель, прогнозирующая накопление меди с использованием генетических мутаций в трех областях генома
Хромосома 8 положение: 4850000 п. н. (рядом с GOLGA5) Хромосома X положение: 63000000 п. н. (рядом с ATP7A) Хромосома 32 положение: 40000000 п. н. (рядом с UBL5) 3-х аллельный профиль Средняя конц. Cu2 % пораженных собак Кол-во собак с профи-лем
1 1 1 111 1253,09 81,5% 27
1 1 0 110 733,40 60,0% 20
1 0 1 101 1138,90 77,8% 9
1 0 0 100 737,84 60,7% 28
0 1 1 011 502,27 42,9% 7
0 1 0 010 670,83 63,6% 11
0 0 1 001 450,00 50,0% 4
0 0 0 000 332,47 7,1% 14

Ключ к бинарным значениям в таблице 3 является таким, как приведено ниже.

Положение в геноме: хромосома 8 (CFA8), область гена GOLGA5:

1 = если в SNP BICF2P506595 находится генотип AA,

0 = если в SNP BICF2P506595 находится любой другой генотип.

Положение в геноме: хромосома 32 (CFA32), область гена UBL5:

1 = если в BICF2P772765 находится GG, в BICF2S2333187 находится CC и в BICF2P1324008 находится GG

0 = если в любом из этих SNP представлен другой генотип.

Положение в геноме: хромосома X (CFAX), область гена ATP7A:

1 = если в BICF2P591872 находится AA или AG,

0 = если в BICF2P591872 находится GG.

В таблице 3 представлены бинарные состояния аллелей в трех положениях в геноме. В положении в геноме CFA8 использовали один SNP (SNP 1). В положении в геноме CFA32 использовали три SNP (SNP 2, 3 и 4). В положении в геноме CFAX использовали один SNP (SNP 5). Бинарные значения являются показателем собаки с аллелями, которые являются показателем предрасположенности к накоплению меди ("плохие" аллели). Например, 000 представляет собой отсутствие любого из трех плохих аллелей, 111 представляет собой наличие всех трех плохих аллелей.

В таблице 4 приведены положения и последовательность SNP, используемые для получения результатов из таблицы 3.

Результаты включают три положения в геноме (в генах GOLGA5, UBL5 и ATP7A и вокруг них), ассоциированные с предрасположенностью к накоплению меди. Дополнительные SNP в этих областях, которые являются показателем предрасположенности к накоплению меди, приведены в таблице 5.

Пример 3

Идентификация дополнительных SNP, ассоциированных с предрасположенностью к накоплению меди в печени, и протективных SNP

В этом примере описана идентификация дополнительных SNP, ассоциированных с предрасположенностью к накоплению меди в печени, а также некоторых протективных SNP в гене ATP7A. Эта работа также описана в WO 2010/038032 A1 и WO 2010/116137 A1.

Три гена, идентифицированных в примере 2, исследовали для идентификации дополнительных SNP, ассоциированных с предрасположенностью к накоплению меди в печени. Выбирали тридцать три ампликона, перекрывающих каждый экзон трех идентифицированных генов. Их амплифицировали в 72 образцах геномной ДНК собак породы лабрадор-ретривер. Образцы получали у собак с высоким содержанием меди (уровни меди в печени выше 600 мг/кг) или нормальными уровнями меди в печени (ниже 400 мг/кг). Продукт амплификации секвенировали в обоих направлениях способом Сэнгера. Для сборки последовательности в каждом ампликоне использовали программное обеспечение "Seqman 4,0", поставляемое DNASTAR. Затем сборку исследуют для поиска однонуклеотидных полиморфизмов (SNP). Затем эти полиморфизмы генотипируют, исследуя выраженность оснований в SNP в последовательности в обоих направлениях. Если генотипы SNP в обоих направлениях не согласовывались более чем в 10 образцах, SNP классифицировали как артефакт и не учитывали. Идентифицированные SNP предрасположенности приведены в таблице 6.

Выявление протективного SNP в кодирующей области ATP7A

Выявили протективный SNP (ATP7A Reg3_F_6; ChrX_63338063). Он приведен в таблице 7, а последовательность, окружающая SNP, приведена в таблице 8. Этот SNP находится в кодирующей области гена ATP7A (в сцепленном с X хромосомой гене) и приводит к изменению в кодирующей последовательности. Проводили исследование средних уровней меди в печени в зависимости от пола и генотипа ATP7A (таблица 9). На фиг. 1 графически представлены данные из таблицы 9. На фиг. 2 приведены те же данные в качестве гистологических оценок содержания меди. Значение p (0,000396) определяли на основании критерия Крускала-Уоллиса, применяемого к гистологической оценке с полом-генотипом в качестве групп. Из данных понятно, что присутствие аллеля T является показателем собаки, защищенной от высокого содержание меди в печени.

Результаты могут объяснить смещение для хронического гепатита у самок. Самцы собак содержат только одну копию хромосомы X и, таким образом, являются гемизиготными по локусу ATP7A. Действие X-сцепленного рецессивного гена с большей вероятностью наблюдается у самцов, чем у самок, ввиду гемизиготного состояния мужской хромосомы X. Протективный эффект в данном случае является рецессивным, поэтому авторы наблюдают больше случаев в группе самок.

Протективный SNP приводит к замене треонина на изолейцин в положении аминокислоты 328 ATP7A, что приводит к снижению количества потенциальных водородных связей с 3 до 0 и увеличению гидрофобности, потенциально изменяя форму белка. Треонин в этом положении является консервативным у многих млекопитающих, включая лошадь, человека, шимпанзе и дельфина, что является показателем важности этой аминокислоты для функции белка.

Выявление в ATP7A дополнительного протективного, но некодирующего SNP.

Секвенирование гена ATP7A выявило SNP в интроне, который находится почти в полном неравновесном сцеплении с кодирующим SNP ATP7a_Reg3_F_6 (ChrX_63338063). Подобно кодирующему SNP, SNP в интроне (ATP7a_Reg 16_F42) значимо ассоциирован с защитой от накопления меди в печени (таблица 7). Значимость обоих измеряли с использованием хи-квадрат с двумя степенями свободы на основе независимости генотипа и статуса заболевания. Статус заболевания был положительным при количественном определении содержания меди в массе сухого вещества печени >600 мг/кг и гистологической оценке ≥2,5; отрицательным при количественном определении содержания меди в массе сухого вещества печени <400 мг/кг и гистологической оценке <2,5. Таблица ожидаемых значений основана на байесовской оценке частот генотипов и частоты заболевания в выборке в предположении независимости двух переменных.

Рассчитанные меры неравновесного сцепления некодирующего SNP с кодирующим SNP составляют D’ = 0,93 и R-квадрат = 0,86. Таким образом, SNP находятся почти в полном неравновесии по сцеплению.

Последовательность, окружающая ATP7a_Reg 16_F42, приведена в таблице 8.

Пример 4

Исследование распределения протективного SNP ATP7A в породах и по географическому расположению

В этом примере описано исследование распределения протективного SNP в кодирующей области ATP7A в породах и по географическому положению.

SNP в кодирующей области ATP7A (ATP7A Reg3_F_6; ChrX_63338063) в дополнение к лабрадору-ретриверу генотипировали в образцах ДНК собак других пород для определения присутствия этого SNP у других пород. В таблице 10 приведены результаты с количеством собак каждого генотипа. Столбец "T" относится к гомозиготным самкам (TT) и гемизиготным самцам (T). Результаты демонстрируют, что SNP присутствует у различных пород собак, и, таким образом, его можно использовать в качестве показателя защиты от накопления меди в широком множестве различных пород, собак смешанных пород и дворняг. Аллель T SNP также был выявлен в популяциях лабрадоров США и Японии, что демонстрирует, что географическое положение собаки не является помехой для использования SNP.

Таблица 7
Название ампликона Положение SNP Экзонный или интронный Кодирующая замена Номер аминокислоты Основание в Genbank Основание после замены Амино
кислота в
Genbank
Аминокислота после замены Ассоциация с фенотипом
ATP7A Reg 3 ATP7A 30,374 Экзонный Да 328 C T T I 0,001669996
ATP7A Reg 16 ATP7A 89,705 Интронный Нет н.д. C T н.д. н.д. 0,001796187

Таблица 9
Пол Генотип Средний уровень меди Количество
Самки TT 323,3 3
CT 818,3 22
CC 1041,3 45
Самцы T 437,5 13
C 905,8 34

Таблица 10
Порода C CT T (Мутант, ассоциированный с низкими уровнями содержания меди)
Лабрадор-ретривер 31 13 28
Карликовый пудель 3 2 8
Золотистый ретривер 0 0 1

Пример 5

Секвенирование ATP7B

В этом примере описано секвенирование ATP7B (кДНК и гДНК) и выявление мутаций, ассоциированных с накоплением меди.

Секвенирование ATP7B - кДНК

Выбор ампликонов и последовательности праймеров

Праймеры конструировали с использованием Perl Primer и проверяли на специфичность с использованием NCBI Primer Blast. Необходимо было сконструировать праймеры, которые были специфичны для активного ATP7B, а не для псевдогена ATP7B (фрагмент 1106 п. н. в положении (4:38596510-38597615) в геноме. Праймеры (таблица 11) получали, конструируя праймеры, которые не соответствовали псевдогену ATP7B. В соответствии с базой данных NCBI фрагмент основного локуса располагался в экзоне 2 ATP7B. Однако в Ensemble указано, что фрагмент представляет собой экзон 2 (BNSCAFE0φ)000046065) и экзон 3 (ENSCAFE00000046071) с интроном длиной 33 пары оснований между ними.

Таблица 11
Информация о праймерах
Ген Экзон Последовательность прямого праймера
5’→3’
Последовательность обратного праймера
5’→3’
Размер
ампли-
кона
ATP7B хромо-сома 22 NCBI: 2 Ensembl: 2 & 3 GTTACCCTGCAGCTGAGAGT Положение: 790G>A 5024-790G>A 5043 (SEQ ID NO: 227) ATGGCGAGCATCACAGTATC Положение: 790G>A 5355-790G>A 5336 (SEQ ID NO: 228) 332 п. н.

Секвенирование

Полимеразную цепную реакцию (ПЦР) проводили с использованием полимеразы Pfx (Invitrogen, Carlsbad, USA). Результаты секвенирования анализировали с использованием SeqMan (DNAstar8.1). Результаты сравнивали с NCBI (Build2.1) и Ensembl (CanFam 2.0, май 2005, версия базы данных 62.2r). Родословные лабрадоров проверяли на несоответствие закону Менделя.

Результаты

Секвенирование кДНК бигля, полученной из РНК печени для оптимизации праймеров, выявило представляющий интерес фрагмент и, вследствие одновременного секвенирования гДНК ATP7B, впоследствии в подгруппе лабрадоров авторов заявки секвенировали только эту часть ДНК. Результаты секвенирования выявили две представляющих интерес кодирующую, несинонимическую мутации: SNP и повтор. Кроме того, авторы смогли разрешить одно из несоответствий у двух геномных браузеров NCBI и Ensembl. Так как последовательность экзона 1 ATP7B еще не установлена, нумерация экзонов начинается с экзона 2.

Кодирующий повтор в ATP7B (Chr22 3135287)

В предсказании структуры экзонов гена ATP7B у двух геномных браузеров (NCBI и Ensembl) существует несоответствие. В соответствии с NCBI длина экзона 2 составляет 1237 пар оснований (п.н.). Однако в Ensembl указано, что эти 1237 п. н. составляют два экзона, а именно экзон 2 (971 п. н.), интрон 2-3 (33 п. н.) и экзон 3 (233 п. н.). Результаты секвенирования авторов демонстрируют, что длина экзона два фактически составляет 1237 пар оснований и интронной последовательности не существует.

Другим важным открытием было то, что кодирующий фрагмент длиной 33 п. н. варьирует по длине (фиг.3). В Ensemble представлено четыре повтора, тогда как в NCBI представлена гетерозиготность (3 и 4 повтора). Бигль, которого секвенировали авторы, также был гетерозиготен, но с двумя и тремя повторами. В подгруппе лабрадоров авторов заявки авторы выявили гомозиготных (3 повтора), гетерозиготных (3 и 4 повтора) и гомозиготных (4 повтора) собак. Хромосомная локализация первого C в повторе представляет собой 22:3135287. Повтор расположен между третьим и четвертым ассоциированными с тяжелыми металлами доменами ATP7B (фиг.4). Многовидовое выравнивание у плацентарных млекопитающих демонстрирует, что эта конкретная область является не вполне консервативной. Собака является единственным видом, у которого выявлен повтор CGCCCC в этом положении.

Последовательность из NCBI, окружающая повтор, приведена в таблице 12.

Таблица 12
Последовательность выше и ниже повтора CGCCCC
(SEQ ID NO 236, 237 и 238)
500 п. н. выше Повтор CGCCCC
(два, три или четыре повтора)
500 п. н. ниже
tcagcacccaggaggcagtcatcacttaccagccttatc
ttattcaaccccaggacctcagggaccatgtaaacgaca
tggggtttgaagctgtcatcaagaacagagtggcacccg
taagcctgggacccattgatattgggcggttacagagga
ccaacccaaagatgcctttgacttctgataaccagaatc
tcaataactctgagaccttgggccatcaagggagccatg
tggttaccctgcagctgagagtcgacggaatgcactgtc
agtcttgtgtcctgaacattgaagagaatataggccaac
tccccggggttcagaatgtgcaagtgtccttggagaaca
gaacggcccaagtacagtacgacccttcttgtgtcaccg
caggggccctgcagagggccattgaagctctcccaccag
ggaactttaaagtttctcttcctgccgcagcagcaggaa
gtgagacaggtaacaggttttcggcatgtgc
CGCCCCCGCCCC;
CGCCCCCGCCCCCGCCCC; или
CGCCCCCGCCCCCGCCCC
CGCCCC
aagaaccccggcaccgggcaggtgcgatactgtgatgct
cgccattgtgggcatgacctgtgcatcctgcgtccagtc
gatcgaaggcctgatctcccagagggaaggggtgcagca
aatatctgtctctctggctgaagggaccgcagtggttct
ctatgatccctctataattggcccggaagaactccgagc
tgccgtcgaggagatgggatttgagacttcagtcctctc
tggtatgtagtggcaccccgggtcttctcctctctcctt
gggccttacggcagagtgcctgcagggtggcacagggga
gccaccccagctgctcgcctgtcgggttggccaagtccc
gcagcgtttccctgtgtgttgaatgtgtccgggtgggag
aaagagaactttctggtgtgtagattttgcctctcatgg
ggctgggactacattgctaaattctttgttgttgttatt
ttttttaact

ATP7B 790G>A (Chr22_3135144)

Приблизительно на 144 п. н. выше повтора авторы выявили несинонимическую мутацию (ATP7B 790 G>A). Этот SNP также расположен в экзоне 2 в хромосомном положении 3135144. Он представляет собой замену G>A и, как следствие, аминокислота аланин заменяется на треонин. SNP расположен в третьем ассоциированном с тяжелыми металлами домене.

Секвенирование ATP7B - геномное

Повторное секвенирование (по Сэнгеру) ATP7B проводили в Beckmann Coulter у 98 собак, для которых были доступны полные фенотипические данные. Секвенировали экзоны и экзон-интронные границы.

Результаты секвенирования анализировали с использованием SeqMan (DNAstar8.1). Результаты сравнивали с NCBI (Build2.1) и Ensembl (CanFam 2.0, май 2005, версия базы данных 62.2r). Родословные лабрадоров проверяли на несоответствие закону Менделя.

Результаты

Анализ секвенирования всей гДНК ATP7B у 98 лабрадоров выявил 2 экзонные несинонимические мутации (включающих SNP ATP7B 790 G>A; Chr22_3135144) и 4 экзонные синонимические мутации. Детектировали девять однонуклеотидных замен в интронах. Кроме того, в интронных областях детектировали 2 однонуклеотидных вставки/делеции и делецию 7 п. н. Также выявлен кодирующий повтор из 6 пар оснований (описанный выше). Проводили статистический анализ связи с фенотипом. В этой группе из 98 лабрадоров только повтор и 2 несинонимических SNP обладали значимыми ассоциациями с фенотипом. Эти три мутации исследовали в расширенной группе собак (см. следующий раздел) и проводили поиск свидетельств функциональных эффектов.

ATP7B 4145G>A

SNP 4145G>A ATP7B расположен на конце ATP7B, приблизительно на 154 п. н. выше стоп-кодона (экзон 21, хромосомное положение 3167534). Он представляет собой несинонимическую мутацию, в которой замена G>A приводит к появлению аминокислоты глутамина вместо аргинина (фиг.5).

Типирование мутаций в расширенной группе лабрадоров и прогноз эффекта

Два представляющих интерес SNP (SNP790G>A и SNP4145G>A) и повтор, выявленные ATP7B, дополнительно анализировали в более многочисленной подгруппе лабрадоров-ретриверов. Для SNP790G>A типировали 267 лабрадоров и 1 бигля (контроль), а для SNP4145G>A всего типировали 242 лабрадора посредством SNaPshot. Для повтора типировали 216 собак посредством Genescan. Протоколы, используемые для типирования мутаций, более подробно описаны ниже.

Genescan

Genescan проводили для типирования полиморфизма длины фрагмента ДНК в ATP7B с использованием протокола с 3 праймерами. Для амплификации ПЦР ампликона использовали полимеразу Pfx, так как полимераза Platinum Taq не способна детектировать короткие тандемные повторы GC. Для Genescan использовали те же праймеры, как использовали для секвенирования, за исключением того, что к прямому праймеру добавляли концевой фрагмент M13. Последовательности праймеров приведены в таблице 13.

Подчеркнутая последовательность представляет собой концевую часть M13, добавляемую к прямому праймеру.

Результаты Genescan анализировали с использованием программного обеспечения Applied Biosystems GeneMapper версии 4.0. Приоритетом являлись длина и различия в длине микросателлита и гомозиготность или гетерозиготность индивидуумов по этому локусу для микросателлита. Пики сравнивали друг с другом и с размером стандарта для определения надежности пика.

SNaPshot

SNaPshot проводили для точного анализа SNP в расширенной группе лабрадоров-ретриверов.

Для 790G>A (функциональный, специфичный для ATP7B) используемые для секвенирования праймеры также использовали для реакции ПЦР по протоколу SNaPshot. Праймеры для ПЦР для SNP 4145G>A конструировали с использованием Perl Primer и проверяли с использованием NCBI Primer Blast. Эти праймеры были специфичными для функционального гена ATP7B, так как также была включена интронная последовательность. Кроме того, для обоих SNP конструировали праймер SNaPshot. Последовательности праймеров приведены в таблице 14.

Таблица 14
Информация о праймерах
SNP 790G>A SNP 4145G>A
Праймер Последовательность (5’→3’) Положение Праймер Последовательность (5’→3’) Положение
Прямой праймер для ПЦР GTTACCCTGCAGCTGAGAG
(SEQ ID NO: 231)
3135024-3135043 Прямой праймер для ПЦР CGTCTGGATGGGAAGTTTCTC
(SEQ ID NO: 233)
3167222-3167242
Обратный праймер для ПЦР ATGGCGAGCATCACAGTATC
(SEQ ID NO: 228)
3135355-3135336 Обратный праймер для ПЦР TTGTCGGACTTCAGGGAGG
(SEQ ID NO: 234)
3167600-3167582
Праймер SNaPshot (Rv) AGGGTCGTACTGTACTTGGG
(SEQ ID NO: 232)
3135164-3135145 Праймер SNaPshot (Fw) CCGGCGGTGGGACTCCCCGC
(SEQ ID NO: 235)
3167514-3167533

Протокол SNaPshot был одинаковым для обоих SNP, за исключением этапа ПЦР. Матрицу SNP 4145G>A получали с использованием стандартной полимеразы Platinum Taq. В отличие от этого, матрицу SNP 790G>A получали с использованием полимеразы Pfx, которая способна более точно амплифицировать богатые GC участки.

Результаты Genescan анализировали с использованием программного обеспечения Applied Biosystems GeneMapper версии 4.0. Приоритетом являлись различные цвета, где каждый цвет представлял отдельное основание, и гомозиготность или гетерозиготность индивидуумов. Пики сравнивали друг с другом и с размером стандарта для определения надежности пика.

Многовидовое выравнивание

Для проверки консервативности областей мутаций у других видов проводили многовидовое выравнивание с использованием средства многовидового выравнивания Ensemble. Оба одиночных основания были высококонсервативны у других видов, тогда как кодирующий повтор не был. Собака представляет собой единственный вид с повтором в этом положении.

Прогноз эффекта мутаций

Оба SNP оценивали на возможные теоретически рассчитанные вредные воздействия на функцию белка с использованием нескольких программ прогнозирования:

• Align-GVGD (http://agvgd.iarc.fr/index.php).

Средство комбинирует биофизические характеристики аминокислот и выравнивания последовательностей нескольких белков для прогноза того, где бессмысленные замены в представляющих интерес генах соответствуют спектру от более вредных до более нейтральных.

• PolyPhen (http://genetics.bwh.harvard.edu/pph/index.html).

Прогноз возможного влияния замены аминокислоты на структуру и функцию белка человека с использованием непосредственных физических и сравнительных рассматриваемых факторов.

• PhD-SNP (http://gpcr.biocomp.unibo.it/cgi/predictors/PhD-SNP/PhD-SNP.cgi).

Средство используют в качестве средства прогноза неблагоприятных однонуклеотидных полиморфизмов у человека.

• SNAP (http://rostlab.org/services/snap/).

Этот способ предназначен для оценки влияния единичных замен аминокислот на функцию белка.

Так как программы прогноза преимущественно основаны на вводе данных о человеке, не все программы могли эффективно прогнозировать действие замен аминокислот у собак. В соответствии с использованными программами прогноза полагают, что ATP7B 790 G>A обладает наиболее вредными воздействиями на функцию белка.

Расчеты LD

Для кодирующих мутаций в ATP7B и 672 SNP в первой части ATP7B рассчитывали две меры LD (D’ с доверительным интервалом и R-квадрат) с использованием программы Haploview. Результаты для первых трех наиболее ассоциированных SNP из GWAS приведены в таблице 15. Высокий D’ и низкий R-квадрат являются показателями различий аллельных частот любой определяемой комбинации мутаций. Структура LD в области (первые 15 м.п.н. хромосомы 22) приведены на фиг. 6. Существует высокое LD у мутаций и нескольких SNP в этой области, что приводит к большой области, которая ассоциирована в анализе GWAS.

Статистические ассоциации кодирующих мутаций с фенотипом

Кодирующие мутации в ATP7B типировали в расширенной группе лабрадоров и для определения размаха и направления действия мутаций (бета) и значимости ассоциации (значение p) для одиночных мутаций и для всех мутаций в той же модели. Типировали все три мутации в ATP7B и мутацию в ATP7A для 211 лабрадоров. В этой группе у каждой собаки определяли количество аллелей риска и рассчитывали влияние количества аллелей риска на содержание меди в печени на основе окрашивания Р.К.

Для кодирующих мутаций ATP7B проводили линейное моделирование с использованием оценки р.к. для меди в качестве выходного параметра с возрастом, полом и мутациями в качестве независимых переменных. Рассчитывали воздействие одиночных аллелей, а также эффекты каждой мутации, скорректированные на другие две, и результаты подытожены в таблице 16. Мутации моделировали аддитивным способом, таким образом, определяли эффект для каждой дополнительной копии аллеля.

Выявлено, что мутация 790 G/A (Chr22_3135144) является протективной, тогда как каждая дополнительная копия повтора (Chr22_3135287) и каждый дополнительный A в положении 4145 (Chr22_3167534) приводили к значительно большей оценке Р.К. для меди в печени.

Таблица 16
Линейное моделирование для фенотипа Р.К.
и кодирующих мутаций в ATP7B
Одиночные аллели в модели Все аллели в модели
Мутация Бета 95% CI значение p Бета 95% CI Значение p
790 G>A -0,46 -0,75-0,17 0,00216 -0,26 -0,56--0,05 0,099
933_938Dup CGCCCC 0,42 0,02-0,81 0,0398 0,51 0,12-0,91 0,012
4145G>A 0,48 0,26-0,70 3,53e-05 0,51 0,27-0,75 3,62e-05

Для исследования эффекта всех известных кодирующих мутаций, вносящих вклад в фенотип заболевания, проводили линейное моделирование у 211 лабрадоров, у которых успешно типировали три мутации в ATP7B, а также ранее выявленную кодирующую мутацию в ATP7A. Подсчитывали количество аллелей риска для каждой отдельной собака. Аллелями риска являлись: C для кодирующей мутации в ATP7A, G для ATP7B 790, G/A (Chr22_3135144), 3 повтора для повтора в хромосомном положении 22:3135287 ATP7B, и A для ATP7B 4145 G/A (Chr22_3167534). Выходным параметром являлся уровень меди в печени на основе окрашивания Р.К. на медь (уровни 0-5), а количество аллелей риска моделировали как независимую переменную. Каждый дополнительный аллель риска приводил к значимому увеличению оценки окрашивания Р.К. на 0,33 с очень значимым значением p 3.5 e-08. На фиг. 7 представлено влияние количества аллелей риска на количественный уровень меди в печени.

Пример 6

Генотипирование SNP и получение модели

В этом примере описано генотипирование SNP и получение модели.

SNP идентифицировали посредством секвенирования SOLID (с использованием платформы секвенирования SOLID 3) фенотипированных по CACH образцов ДНК. Кроме того, в анализ включали SNP из предыдущей работы и секвенирование генов ATP7A, COMMD1, ATOX1 и ATP7B.

SNP генотипировали посредством GeneSeek во всех доступных фенотипированных образцах ДНК, SNP анализировали с использованием набора тестов хи-квадрат, Использовали тест с двумя степенями свободы с нулевой гипотезой независимости фенотипа и генотипа. Используемые фенотипы представляли собой:

• Гистологическую оценку ≥2,5 в сравнении с гистологической оценкой <2,5

• Количество меди >600 в сравнении с количеством меди <400

Наряду с тестами хи-квадрат использовали тест коэффициента корреляции в отношении количества меди и гистологической оценки. Тест проводили в MATLAB с использованием функции corrcoef выдающей значение p и коэффициента корреляции. Затем локусы ранжировали по значению p для определения приоритета дальнейших исследований. Геномные области выше значимости 0,001 исследовали на потенциальные гены-кандидаты, как описано в разделе, озаглавленном "Анализ наличия генов в областях" в примере 1.

Затем генотипы исследовали на отобранные SNP. Так как функция corrcoef иногда может выдавать ложноположительные результаты для порядковых данных (подобных генотипам) при малом представительстве групп, SNP фильтровали только по тем, которые содержат десять или более образцов по меньшей мере в двух группах, имеющих отличия фенотипа. Оставшиеся SNP использовали при получении модели.

Конечные данные состоят из 386 SNP, генотипированных в 260 образцах. Анализ идентифицировал множество SNP, которые значимо ассоциированы с предрасположенностью к накоплению или с защитой от накопления меди в печени. Этот анализ приведен в таблице 17. Дополнительная информация о SNP, включая окружающие последовательности, приведена в таблице 18.

Примеры SNP в неравновесном сцеплении с SNP, которые, таким образом, также ассоциированы с предрасположенностью к накоплению или защитой от накопления меди в печени, приведены в таблицах 19 и 20.

Таблица 17
Результаты анализа данных GeneSeek. Мутации, являющиеся показателем "защиты" от накопления меди в печени, указаны полужирным шрифтом
Название SNP Значение p
corrcoef –
кол-во Cu
corrcoef R –
кол-во Cu
Значение
p corrcoef - log
кол-ва Cu
corrcoef R-
log кол-ва Cu
Значение p corrcoef –
гист, Cu
corrcoef R –
гист, Cu
значение p хи-
квадрат –
кол-во пораженных
значение p хи-квадрат -hist_aff Хром Лок Информация Гены
Chr22_3167534 0,000828 0,297627 0,007077 0,241694 6,00E-05 0,298521 1,66E-01 2,22E-03 chr22 3167534 Экзонный кодирующий ATP7B - кодирующий
Chr20_55461150 0,164589 -0,10583 0,014631 -0,18482 0,009595 -0,16689 3,46E-03 2,88E-01 chr20 55461150 Рядом STXB2 (ген желчной кислоты)
ChrX_120879711 0,04194 -0,15439 0,003159 -0,22257 0,42838 -0,05136 3,91E-03 2,39E-01 chrX 1,21E+08 Рядом MTMR1
Chr32_38904515 0,043678 -0,15139 0,049299 -0,14759 0,141384 -0,09501 4,95E-03 2,72E-01 chr32 38904515 Экзонный кодирующий ортолог UBL5 - кодирующий
Chr19_6078084 0,015583 0,193361 0,000449 0,277662 8,69E-06 0,298791 1,11E-02 3,94E-03 chr19 6078084 Рядом микросомальная глутатион S-трансфераза 2 (GST)
Chr15_62625262 0,000339 -0,26857 0,000306 -0,27052 0,01002 -0,16628 1,13E-02 7,12E-02 chr15 62625262 Экзонный некодирующий Неизвестен
Chr14_39437543 0,007167 0,203766 0,00359 0,220272 0,007118 0,174397 2,33E-02 7,37E-02 chr14 39437543 Рядом Предшественник интерлейкина-6 (IL-6)
Chr15_62625024 0,023044 -0,17375 0,002611 -0,22881 0,000993 -0,21255 3,14E-02 2,29E-02 chr15 62625024 Экзонный кодирующий Неизвестен
ChrX_63338063 0,034843 -0,15568 0,040425 -0,15124 0,000895 -0,2084 3,85E-02 2,38E-02 chrX 63338063 Экзонный кодирующий ATP7A
Chr3_86838677 0,000256 0,276149 0,000973 0,25003 0,000456 0,226406 1,63E-01 4,69E-02 chr3 86838677 Рядом [CRT 18 (цирроз цыплят индейки - ортолог кератина 18)
Chr8_4892743 0,004603 0,004603 0,328072 0,005334 0,322881 0,287162 0,113417 1,96E-01 5,76E-01 chr8 Интронный GOLGA5
Chr24_4011833 0,030795 0,030795 -0,15758 0,048763 -0,14394 0,005057 -0,17472 2,20E-01 8,27E-02 chr24 Рядом FOXA2
Chr18_60812198 0,005568 0,005568 -0,02432 0,021119 0,058831 0,562541 -0,0378 4,31E-01 5,25E-01 chr18 Потенциальный UTR ATOX1
Chr8_4880518 0,00302 0,00302 0,224225 0,073156 0,136583 0,58772 0,035242 4,78E-01 4,03E-01 chr8 Интронный GOLGA5
Chr10_65209946 0,108151 0,108151 0,120486 0,047767 0,14817 0,00069 0,215782 5,07E-01 2,77E-01 chr10 UTR COMMD1
Chr22_3135144 0,019406 0,184089 0,026966 0,174352 0,00047 0,232303 5,21E-01 5,61E-01 chr22 3135144 Экзонный кодирующий ATP7B - кодирующий

Получение модели

Мутации, идентифицированные в таблицах 17-20, можно использовать самостоятельно для определения предрасположенности к накоплению или защиты от накопления меди в печени. Однако можно обеспечивать более точный способ оценки предрасположенности к накоплению меди или защиты от накопления меди в печени, используя модели, включающие комбинации мутаций. Мутации в таблицах 17 и 18 использовали для получения модели, как описано ниже.

Переменные

Выбранными переменными были все мутации, идентифицированные при генотипировании Geneseek, а также пол, кодируемый как 0 для самцов, 1 для самок. Генотипы кодировали в порядковой форме как 0, 1 или 2 (количество второго аллеля).

Использовали две репортерных переменных, log10 количества меди и гистологическую оценку. Они обе, по-видимому, линейно соответствуют генетическим изменениям и приблизительно друг другу и, таким образом, являются хорошими кандидатами для линейного моделирования этого типа.

Способ

Вследствие количества переменных и доступного размера выборки не все генетические эффекты можно моделировать вместе. Для разрешения этой проблемы использовали способ пошагового моделирования. В этом способе определяют то, какие факторы следует использовать в модели посредством их вставки и удаления при выявлении значимости оценок коэффициентов в модели. Ниже точно описан используемый способ.

1. Данные усредняли для учета отсутствующих данных.

2. Проводили пошаговую регрессию на усредненных данных с использованием пошаговой команды MATLAB. В этом случае использовали доверительный интервал около коэффициентов 0,9.

3. Затем выбранные переменные и коэффициенты записывали и остатки проверяли на соответствующее распределение дисперсии.

4. Для исследования подходящих порогов для диагностики получали отношения шансов, скорректированное на распространенность положительное теоретически рассчитанное значение и скорректированное на распространенность отрицательное теоретически рассчитанное значение для всех потенциальных порогов с построением диаграммы, демонстрирующей сравнительный анализ PPV и NPV при различных порогах. Для этих целей положительным считали >2,5 на гистологической шкале и >600 мг/кг медь на шкале количества меди.

В таблице 21 приведен ключ к используемым при получении модели факторам:

Таблица 21
Фактор Название
XI Chr32_3 8904515 (ортолог UBL5)
X2 Chr20_55461150 (STXB2)
X3 Chr19 6078084 (микросомальная глутатион S-трансфераза 2 (GST))
X4 Chr3 86838677 (KRT18 (цирроз цыплят индейки))
X5 Chr14 39437543 (Предшественник интерлейкина-6 (IL-6))
X6 Chr8_4880518
X7 Chr8_4892743
X8 пол
X9 Chr24_4011833
X10 Chr10_65209946 (COMMD1)
X11 Chr22_3167534 (ATP7B)
X12 Chr22_313 5144 (ATP7B)
X13 ChrX_63338063 (ATP7A)
X14 Chr18_60812198 (ATOX1)
X15 Chr15 62625024 (неизвестный ген)
X16 Chr15 62625262 (неизвестный ген)
X17 ChrX_l 20879711 (MTMR1)

Результаты

Моделирование с использованием последовательного способа позволяло получать прогностические функции, приведенные на фиг. 8 и 9. На фиг. 8 проиллюстрировано пошаговое моделирование гистологической оценки меди. На фиг. 9 проиллюстрировано пошаговое моделирование логарифмической количественной оценки меди.

1. Способ тестирования собаки, имеющей генетическую наследственность породы лабрадор-ретривер, для определения предрасположенности собаки к накоплению меди в печени, включающий:

(i) генотипирование образца ДНК от собаки по одному или более полиморфизмам, выбранным из Chr22_3167534 (представленного положением 101 в SEQ ID NO: 144), наличие аллеля А указывает на предрасположенность к накоплению меди в печени, Chr22_3135144 (представленного положением 101 в SEQ ID NO: 145), наличие аллеля G указывает на предрасположенность к накоплению меди в печени, и повтора CGCCCC в хромосомном положении 22:3135287, наличие по меньшей мере одного дополнительного повтора указывает на предрасположенность к накоплению меди в печени с использованием специфического связывающего средства, которое выбирают из зонда или комбинации праймеров и которое способно обнаруживать или способствовать обнаружению выбранного полиморфизма, и

(ii) определение по результатам стадии генотипирования, является ли собака предрасположенной к накоплению меди в печени.

2. Способ по п.1, дополнительно включающий генотипирование образца по:

(a) Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155); и/или

(b) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158); и/или

(c) ChrX_63338063 (SEQ ID NO: 142).

3. Способ по п.1, где один или более полиморфизмов представляют собой однонуклеотидные полиморфизмы (SNP).

4. Способ по п.1, дополнительно включающий генотипирование образца по одному или более SNP, выбранным из BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4), BICF2P591872 (SEQ ID NO:5), ATP7a_Reg4_F_9 (SEQ ID NO: 131), UBL5_Reg1F_16 (SEQ ID NO: 132), golga5_Reg1_24 (SEQ ID NO: 133), golga5_26 (SEQ ID NO: 134), golga5_27 (SEQ ID NO: 135), golga5_28 (SEQ ID NO: 136), golga5_29 (SEQ ID NO: 137), golga5_30 (SEQ ID NO: 138), golga5_31 (SEQ ID NO: 139), atp7areg17_32 (SEQ ID NO: 140) и atp7areg17_33 (SEQ ID NO: 141).

5. Способ по п.4, включающий генотипирование образца по SNP BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4) и BICF2P591872 (SEQ ID NO:5).

6. Способ по п.1, включающий генотипирование образца по Chr22_3167534 (SEQ ID NO: 144) и дополнительно включающий генотипирование образца по:

(a) Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), Chr19_6078084 (SEQ ID NO: 148), Chr3_86838677 (SEQ ID NO: 152), Chr10_65209946 (SEQ ID NO: 155) и ChrX_63338063 (SEQ ID NO: 142) или

(b) ChrX_120879711 (SEQ ID NO: 147), Chr15_62625262 (SEQ ID NO: 149), Chr8_4892743 (SEQ ID NO: 157), Chr24_4011833 (SEQ ID NO: 153) и Chr18_60812198 (SEQ ID NO: 154).

7. Применение полиморфизма для определения предрасположенности собаки, имеющей генетическую наследственность породы лабрадор-ретривер, к накоплению меди в печени, где полиморфизмом является Chr22_3167534 (представленный положением 101 в SEQ ID NO: 144), наличие аллеля А указывает на предрасположенность к накоплению меди в печени, Chr22_3135144 (представленный положением 101 в SEQ ID NO: 145), наличие аллеля G указывает на предрасположенность к накоплению меди в печени, и повтор CGCCCC в хромосомном положении 22:3135287, наличие по меньшей мере одного дополнительного повтора указывает на предрасположенность к накоплению меди в печени.

8. Способ отбора собаки для получения потомства с защитой от накопления меди в печени, включающий:

- генотипирование образца ДНК от собаки-кандидата, имеющей генетическую наследственность породы лабрадор-ретривер, по одному или более полиморфизму, являющемуся показателем предрасположенности к накоплению меди в печени, способом по п.1 и, таким образом, определение того, является ли собака-кандидат подходящей для получения потомства с защитой от накопления меди в печени;

- необязательно, генотипирование образца ДНК от другой собаки противоположного собаке-кандидату пола одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, способом по п.1; и

- необязательно, вязку собаки-кандидата с другой собакой для получения потомства с защитой от накопления меди в печени.

9. Способ тестирования собаки, имеющей генетическую наследственность породы лабрадор-ретривер, для определения вероятности того, что собака защищена от накопления меди в печени, включающий:

(i) генотипирование образца ДНК от собаки по полиморфизму Chr22_3135144 (представленному положением 101 в SEQ ID NO: 145), наличие аллеля А указывает на защиту от накопления меди в печени с использованием специфического связывающего средства, которое выбирают из зонда или комбинации праймеров и которое способно обнаруживать или способствовать обнаружению выбранного полиморфизма; и

(ii) определение по результатам стадии генотипирования, является ли собака защищенной от накопления меди в печени.

10. Способ по п.9, дополнительно включающий генотипирование образца по присутствию или отсутствию ChrX_63338063 (SEQ ID NO: 142).

11. Способ по п.10, дополнительно включающий генотипирование образца по присутствию или отсутствию ChrX_63338063 (SEQ ID NO: 142) и/или ChrX_63397393 (SNP ATP7a_Reg16_F_42; SEQ ID NO: 143).

12. Способ по п.9, дополнительно включающий генотипирование образца по присутствию или отсутствию одного или более полиморфизмов, выбранных из:

(a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; и/или

(b) Chr32_3890451 (SEQ ID NO: 156), Chr8_4892723 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

13. Способ по п.9, дополнительно включающий генотипирование образца по присутствию или отсутствию одного или более SNP, выбранных из BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4), BICF2P591872 (SEQ ID NO:5), ATP7a_Reg4_F_9 (SEQ ID NO: 131), UBL5_Reg1F_16 (SEQ ID NO: 132), golga5_Reg1_24 (SEQ ID NO: 133), golga5_26 (SEQ ID NO: 134), golga5_27 (SEQ ID NO: 135), golga5_28 (SEQ ID NO: 136), golga5_29 (SEQ ID NO: 137), golga5_30 (SEQ ID NO: 138), golga5_31 (SEQ ID NO: 139), atp7areg17_32 (SEQ ID NO: 140) и atp7areg17_33 (SEQ ID NO: 141).

14. Способ по п.13, дополнительно включающий генотипирование образца по присутствию или отсутствию SNP BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4) и BICF2P591872 (SEQ ID NO:5).

15. Способ по п.9, дополнительно включающий генотипирование образца по присутствию или отсутствию Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), Chr19_6078084 (SEQ ID NO: 148), Chr3_86838677 (SEQ ID NO: 152), Chr10_65209946 (SEQ ID NO: 155) и ChrX_63338063 (SEQ ID NO: 142).

16. Применение полиморфизма для определения вероятности защиты собаки, имеющей генетическую наследственность породы лабрадор-ретривер, от накопления меди в печени, где полиморфизмом является полиморфизм Chr22_3135144 (представленный положением 101 в SEQ ID NO: 145), наличие аллеля А указывает на защиту от накопления меди в печени.

17. Способ отбора собаки для получения потомства с защитой от накопления меди в печени, включающий:

- генотипирование образца ДНК от собаки-кандидата, имеющей генетическую наследственность породы лабрадор-ретривер, по одному или более полиморфизмам, являющимся показателем защиты от накопления меди в печени, способом по п.9 и, таким образом, определение того, является ли собака-кандидат подходящей для получения потомства с защитой от накопления меди в печени;

- необязательно, генотипирование образца ДНК от другой собаки противоположного собаке-кандидату пола одного или более полиморфизмов, являющихся показателем предрасположенности к накоплению меди в печени, способом по п.9; и

- необязательно, вязку собаки-кандидата с другой собакой для получения потомства с защитой от накопления меди в печени.



 

Похожие патенты:

Изобретение относится к области медицины. Предложен способ лечения онкологических заболеваний.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития эссенциальной гипертензии. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, осуществляют выделение ДНК из периферической венозной крови и анализ генетических маркеров матриксных металлопротеиназ.

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 ед/мкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ.

Группа изобретений относится к биотехнологии, в частности к способу прогнозирования резистентности к инфекционному некрозу поджелудочной железы у лосося и способу отбора лосося для использования в качестве производителя.

Изобретение относится к биотехнологии. Предложен способ репликации человеческого митохондриального генома в клетках дрожжей Yarrowia lipolytica.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для профилактики нарушений менструальной функции у пациенток. Определяют уровень витамина D в сыворотке крови.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования пятилетней безметастатической выживаемости у больных раком молочной железы.

Предложенная группа изобретений относится к области медицины. Предложены способ определения, с какой вероятностью пациент с раком реагирует на лечение антагонистом VEGF, и способ выбора терапии для конкретного пациента с раком в популяции пациентов с раком, для которых предполагают проведение терапии.
Изобретение относится к области молекулярной генетики и репродуктивной медицины и предназначено для профилактики привычного невынашивания беременности. У спонтанного абортуса с предварительно установленным нормальным кариотипом, исключающим наличие хромосомных аномалий, определяют статус метилирования импринтированных генов PEG1, DLK1, PEG10, PLAGL1, KCNQ1OT1, РЕG3 и GRB10.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития эссенциальной гипертензии. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, осуществляют выделение ДНК из периферической венозной крови и анализ генетических маркеров матриксных металлопротеиназ.

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 ед/мкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ.

Изобретение относится к области биотехнологии, а именно к способу определения наличия/отсутствия мутации fl2 с применением растительной ткани кукурузы, а также к генетически сконструированному растению кукурузы.

Группа изобретений относится к биотехнологии, в частности к способу прогнозирования резистентности к инфекционному некрозу поджелудочной железы у лосося и способу отбора лосося для использования в качестве производителя.

Изобретение относится к биотехнологии. Предложен способ репликации человеческого митохондриального генома в клетках дрожжей Yarrowia lipolytica.

Изобретение относится к медицине и биотехнологии и раскрывает способ получения питательной среды. Способ включает следующие стадии.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для профилактики нарушений менструальной функции у пациенток. Определяют уровень витамина D в сыворотке крови.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования пятилетней безметастатической выживаемости у больных раком молочной железы.

Предложенная группа изобретений относится к области медицины. Предложены способ определения, с какой вероятностью пациент с раком реагирует на лечение антагонистом VEGF, и способ выбора терапии для конкретного пациента с раком в популяции пациентов с раком, для которых предполагают проведение терапии.

Группа изобретений относится к области биохимии. Предложен аппарат и способ обработки нуклеотидных последовательностей, а также средство для секвенирования нуклеиновых кислот, молекулярной диагностики, анализа биологического образца, анализа химического образца, анализа пищевых продуктов и/или судебно-медицинского анализа.

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора. Представленные способы или применения включают генотипирование образца ДНК от собаки по одному или более полиморфизмам, выбранным из Chr22_3167534, наличие аллеля А указывает на предрасположенность к накоплению меди в печени, Chr22_3135144, наличие аллеля G указывает на предрасположенность к накоплению меди в печени, и повтора CGCCCC в хромосомном положении 22:3135287, наличие по меньшей мере одного дополнительного повтора указывает на предрасположенность к накоплению меди в печени с использованием специфического связывающего средства, которое выбирают из зонда или комбинации праймеров и которое способно обнаруживать или способствовать обнаружению выбранного полиморфизма, и определение по результатам стадии генотипирования, является ли собака предрасположенной к накоплению меди в печени. Изобретения обеспечивают возможность идентификации собак с риском развития или не защищенных от таких заболеваний или патологических состояний печени, как хронический гепатит, цирроз печени или печеночная недостаточность. 6 н. и 11 з.п. ф-лы, 10 ил., 21 табл., 6 пр.

Наверх