Композиции и способы

Предложены варианты применения очищенной популяции способных к прорастанию бактериальных спор для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит у реципиента, представляющего собой млекопитающее, а также варианты терапевтической композиции, содержащей эффективное количество очищенной популяции способных к прорастанию бактериальных спор. Способные к прорастанию бактериальные споры могут быть получены путем осуществления следующих этапов: а) обеспечение фекального материала от донора, представляющего собой млекопитающее, и b) проведение обработки этанолом или термообработки фекального материала, в результате которой получают популяцию способных к прорастанию бактериальных спор. Из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба. При этом споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97% идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896. Группа изобретений обеспечивает эффективное предотвращение, контроль и лечение заболеваний, расстройств и состояний ЖКТ, связанных с Clostridium difficile, и обеспечение здорового функционирования системы пищеварения в целом. 4 н. и 19 з.п. ф-лы, 21 ил., 33 табл., 37 пр.

 

РОДСТВЕННЫЕ ЗАЯВКИ

[001] Настоящая заявка испрашивает приоритет по предварительной заявке на патент США №61/760584, поданной 4 февраля 2013 г., предварительной заявке на патент США №61/760585, поданной 4 февраля 2013 г., предварительной заявке на патент США №61/760574, поданной 4 февраля 2013 г., предварительной заявке на патент США №61/760606, поданной 4 февраля 2013 г., и предварительной заявке на патент США №61/926918, поданной 13 января 2014 г. Все указанные заявки включены посредством ссылки полностью для любых целей.

ССЫЛКА НА ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

[002] Настоящая заявка включает Перечень последовательностей, поданный в электронном формате в виде текстового файла, озаглавленного «25970PCT_sequencelisting.txt», созданного 2 февраля 2014 г. и имеющего размер 4100000 байтов. Указанный перечень последовательностей включен посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

[003] Микроорганизмы колонизируют желудочно-кишечный тракт (ЖКТ), кожу и другие эпителиальные и тканевые ниши в организме млекопитающих, например, ротовую полость, поверхность глаз и влагалище. В желудочно-кишечном тракте локализовано многочисленное и разнообразное сообщество микроорганизмов. Среду или нишу для сообщества множества различных видов или организмов, в том числе разнообразных штаммов бактерий обеспечивает сложная система. Сотни разных видов могут образовывать сообщество комменсалов в ЖКТ здорового индивидуума; указанный набор организмов развивается с момента рождения с формированием функционально зрелой популяции микроорганизмов приблизительно к возрасту 3-х лет. Взаимодействия между штаммами микроорганизмов в указанных популяциях, а также между микроорганизмами и хозяином, например, с иммунной системой хозяина, формируют структуру указанного сообщества, при этом на распределение микроорганизмов влияет доступность ресурсов и конкуренция за ресурсы. Такими ресурсами могут быть пища, местоположение и доступность пространства для роста, или физическая структура, к которой может прикрепляться микроорганизм. Например, рацион питания хозяина вносит вклад в формирование флоры ЖКТ.

[004] Нормальная микробиота обеспечивает ряд преимуществ для хозяина, в том числе устойчивость к колонизации широким спектром патогенов, биосинтез и поглощение важнейших питательных веществ, а также стимуляцию иммунной системы для поддержания здоровья кишечного эпителия и адекватной регуляции системного иммунитета. В условиях «дисбиоза» или нарушенного симбиоза функции микробиоты могут утрачиваться или нарушаться, что приводит к повышенной восприимчивости к патогенам, измененным метаболическим профилям или индукции провоспалительных сигналов, что может приводит к местному или системному воспалению или аутоиммунным реакциям. Таким образом, микробиота ЖКТ играет важную роль в патогенезе многих заболеваний и расстройств, в том числе разнообразных патогенных инфекций пищеварительного тракта. Например, восприимчивость субъектов к патогенным инфекциям повышается, если нормальная микробиота ЖКТ была повреждена в результате применения антибиотиков широкого спектра действия. Многие из указанных заболеваний и расстройств представляют собой хронические состояния, значительно снижающие качество жизни субъекта и способные в конечном итоге приводить к смертельному исходу.

[005] Производители пробиотиков утверждали, что предлагаемые ими составы с бактериями способствуют поддержанию здоровья млекопитающих за счет сохранения естественной микрофлоры ЖКТ и усиления нормального контроля над аберрантными иммунными реакциями. См., например, патент США №8034601. Пробиотики, тем не менее, были ограничены очень узкой группой родов и, соответственно, ограниченным числом видов; таким образом, во многих ситуациях они не заменяют адекватным образом отсутствующую естественную микрофлору ЖКТ.

[006] Таким образом, у практикующих специалистов имеется потребность в способе заселения желудочно-кишечного тракта субъекта разнообразными полезными наборами микробиоты для коррекции дисбиоза.

[007] Соответственно, отвечая на потребность в устойчивых, действенных и эффективных композициях и способах лечения заболеваний ЖКТ путем восстановления или усиления функций микробиоты, авторы настоящего изобретения решают указанные и другие проблемы предшествующего уровня техники, предлагая композиции и способы лечения субъектов.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[008] Раскрытые в настоящем изобретении терапевтические композиции, содержащие непатогенные способные к прорастанию бактериальные споры для предотвращения, контроля и лечения заболеваний, расстройств и состояний ЖКТ и поддержания общего здоровья в области пищеварения. Указанные композиции обладают полезными свойствами, поскольку подходят для безопасного введения человеку и другим субъектам-млекопитающим, а также эффективны при многочисленных желудочно-кишечных заболеваниях, расстройствах и состояниях и для поддержания общего здоровья в области питания.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[009] На фиг. 1А приведено схематическое изображение гена 16S рРНК и указаны координаты гипервариабельных областей 1-9 (V1-V9). Координаты V1-V9: 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 и 1435-1465, соответственно, на основе нумерации с применением системы номенклатуры для Е. coli по Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli, PNAS 75(10):4801-4805 (1978). На фиг. 1В выделены жирным шрифтом нуклеотидные последовательности для каждой гипервариабельной области в типовой референсной последовательности 16S Е. coli, описанной Brosius et al.

[010] На фиг. 2 приведена фотография градиента CsCl, демонстрирующая отделение спор от другого остаточного материала среды обитания.

[011] На фиг. 3 приведено три фазово-контрастных изображения, демонстрирующих нарастающее обогащение спорами из суспензии фекалий; обработанного этанолом и очищенного CsCl состава со спорами; и обработанного этанолом и очищенного CsCl и сахарозой состава со спорами.

[012] На фиг. 4 приведена совокупность кривых выживаемости, демонстрирующих эффективность популяции спор в модели профилактики С. difficile на мышах.

[013] На фиг. 5 приведена совокупность кривых выживаемости, демонстрирующих эффективность популяции спор в модели предотвращения рецидива С. difficile на хомяках.

[014] На фиг. 6 продемонстрирована жизнеспособность клеток при разнообразных вариантах обработки этанолом и термообработки в течение различных периодов времени.

[015] На фиг. 7 продемонстрирована способность к выживанию клеток из четырех донорских образцов фекалий после термообработки при 60°С в течение 5 минут.

[016] На фиг. 8 продемонстрировано, что этанол уменьшает численность и анаэробных, и аэробных бактериальных видов на несколько порядков величины за секунды.

[017] На фиг. 9 продемонстрирована зависимость концентрации спор от времени ь полученных образцах фекалий от нескольких доноров.

[018] На фиг. 10 показана выраженная корреляция и линейная зависимость между измерением концентрации ДНК с применением анализа сопряженных спектров флуоресценции и количеством жизнеспособных споровых колониеобразующих единиц.

[019] На фиг. 11 показан эффект различных обработок способствующим прорастанию веществом на способность бактерий к вегетативному росту в популяции спор.

[020] На фиг. 12 показано увеличение бактериального разнообразия при применении обработки способствующим прорастанию веществом для получения вегетативных форм бактерий из популяций спор.

[021] На фиг. 13 показана роль термоактивации при различных температурах на спорах из трех разных образцов донорских фекалий.

[022] На фиг. 14 показано, что обработка лизоцимом совместно с термоактивацией улучшает прорастание при большинстве температур.

[023] На фиг. 15 приведены концентрации спор, присутствующих в образце фекалий, при культивировании на разных средах.

[024] На фиг. 16 показано аналогичное спорообразование при инкубировании планшетов в течение 2 и 7 дней после прорастания популяции спор на планшетах с различными средами.

[025] На фиг. 17 показана защитная эффективность популяции спор у мышей, стимулированных С. difficile, по оценке на основании изменения массы тела мышей на протяжении эксперимента. Каждый график отражает изменение массы тела индивидуальной мыши относительно дня -1 на протяжении эксперимента. Число смертей на протяжении эксперимента указано сверху над графиком и отражено окончанием линии перед днем 6. На верхних панелях (слева направо) представлены группа с контролем-носителем, группа с суспензией фекалий и группа с необработанным нестимулированным контролем; на нижних панелях представлены обработанный этанолом и очищенный в градиенте состав со спорами; обработанный этанолом очищенный в градиенте «способный к прорастанию» состав со спорами, и обработанные этанолом очищенный в градиенте «способный к споруляции» состав.

[026] На фиг. 18 представлено разнообразие микроорганизмов, измеренное в обработанных этанолом споровых образцах и образцах пациента до лечения и после лечения. Общее разнообразие микроорганизмов определяют с применением индекса альфа-разнообразия Chao1 и измеряют с той же глубиной анализа генома для подтверждения адекватного перекрытия последовательностей для анализа микробиома в целевых образцах. Пациент до лечения (фиолетовый) был носителем микробиома со значительно уменьшенным общим разнообразием по сравнению с обработанными этанолом спорами (красный) и с пациентом после лечения на 5 день (синий), 14 (оранжевый) день и 25 (зеленый) день.

[027] На фиг. 19 показано, как происходит сдвиг экогруппы микроорганизмов у пациента при лечении обработанными этанолом спорами от дисбиотического состояния в сторону здорового состояния. Анализ главных координат на основании общего разнообразия и структуры микробиома (бета-разнообразие Брея-Кертиса) пациента до и после лечения показывает, что сочетание приживления OTU при лечении спорами и стимуляции экогруппы микроорганизмов пациента приводит к получению экогруппы микроорганизмов, отличной как от микробиома до лечения, так и от экогруппы пря лечении обработанными этанолом спорами.

[028] На фиг. 20 показана стимуляция видов Bacteroides у пациентов, получавших лечение популяции спор. Сравнение количества колоний Bacteroides из суспензии фекалий до лечения и на 4 неделе после лечения демонстрирует увеличение в 4 log или более. Колонии нумеровали по серийным разведениям и высевали на агар с желчными кислотами и эскулином для Bacteroides, высокоселективный в отношении труппы В. fragilis. Виды определяли путем идентификации полноразмерных последовательностей 16S.

[029] На фиг. 21 показано увеличение числа приживающихся видов и стимулируемых видов в микробиомах пациента после лечения обработанной этанолом популяции спор. Относительную распространенность видов, которые приживались или были стимулированы согласно описанию, определяли на основании числа прочтений последовательностей 16S. Все графики соответствуют разным пациентам, получавшим лечение рецидивирующего C. difficile обработанной этанолом популяции спор.

[030] На фигурах представлены различные варианты реализации настоящего изобретения исключительно в иллюстративных целях. Специалист в данной области техники легко поймет из приведенного ниже описания, что альтернативные варианты реализации проиллюстрированных в настоящем документе структур и способов могут быть реализованы без отступления от принципов настоящего изобретения, описанных в настоящем документе.

ОПИСАНИЕ ТАБЛИЦ

[031] Таблица 1. Перечень функциональных таксономических единиц (OTU) с таксономической принадлежностью к роду, виду и филогенетической кладе. Принадлежность клад бактериальных OTU основана на данных о последовательностях 16S. Клады определяют на основании топологии филогенетического дерева, сконструированного на основании полноразмерных последовательностей 16S с применением методов максимального правдоподобия, известных специалистам в области филогенетики. Конструируют клады для подтверждения того, что все OTU в определенной кладе: (i) расположены в пределах определенного числа узлов с бутстреп-поддержкой друг от друга, и (ii) отличаются не более чем на 5% в отношении генетического сходства. OTU, принадлежащие одной кладе, можно определить как генетически и филогенетически отличные от OTU другой клады на основании данных секвенирования 16S-V4, при этом OTU, попадающие в одну кладу, являются близкородственными. OTU, попадающие в одну кладу, являются эволюционно близкородственными, и могут быть отличимы или неотличимы друг от друга при применении данных секвенирования 16S-V4. Представители одной клады, благодаря эволюционному родству, играют аналогичные функциональные роли в экогруппе микроорганизмов, например, обнаруживаемых в кишечнике человека. Композиции, где одни виды замещены другими из той же клады, предположительно сохраняют консервативную экологическую функцию и, соответственно, подходят для применения в настоящем изобретении. Для всех OTU обозначено наличие предполагаемой способности образовывать споры и то, являются ли они патогенными или патобионтными (см. определения для описания «патобионта»). Приоритетные патогены по классификации NIAID обозначены как «категория А», «категория В» или «категория С», а оппортунистические патогены обозначены как «ОП». OTU, которые не являются патогенными, или способность которых существовать в виде патогенов неизвестна, обозначены отметкой «НЕТ». «SEQ ID №» соответствует идентификатору OTU в Перечне последовательностей; «№ доступа в общедоступной базе данных» соответствует идентификационному номеру OTU в общедоступной базе последовательностей.

[032]

[033] В таблице 2 приведены бактериальные OTU, идентифицированные с помощью анализа 16s обработанной этанолом популяции спор до и после очищения в градиенте CsCl.

[034] В таблице 3 приведены смертность и изменение массы тела мышей, получавших лечение суспензией донорских фекалий и обработанным этанолом и/или термообработанным составом со спорами в различных разведениях,

[035] В таблице 4 приведены OTU, идентифицированные среди спорообразующих видов, полученных путем выделения колоний из состава со спорами, включая различные варианты термообработки

[036] Таблица 5 содержит OTU, не идентифицированные в необработанных фекальных суспензиях, однако идентифицированные в обработанных этанолом или термообработанных популяциях спор.

[037] Таблица 6 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора А.

[038] Таблица 7 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора В.

[039] Таблица 8 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора С.

[040] Таблица 9 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора D.

[041] Таблица 10 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора Е.

[042] Таблица 11 содержит OTU, идентифицированные в обработанной этанолом популяции спор, выделенной из образца микробиома от донора F.

[043] Таблица 12 содержит OTU, идентифицированные в культивируемых обработанных этанолом популяциях спор на разных средах типов.

[044] Таблица 13. Виды, идентифицированные как «способные к прорастанию» и «способные к споруляции» методом точечного выделения колоний

[045] Таблица YYY. Виды, идентифицированные как «способные к прорастанию» с применением метода 16S-V4 NGS.

[046] Таблица ZZZ. Виды, идентифицированные как «способные к споруляции» с применением метода 16s-V4 NGS.

[047] На таблице АС приведены данные относительно содержания спор для 3 разных обработанных этанолом составов со спорами, примененных для успешного лечения 3 пациентов, страдающих рецидивирующей инфекцией С. difficile.

[048] Таблица AD. Дозы ДПК в таблице АС при нормировании к 4×105 СКОЕ на дозу

[049] Таблица GB. OTU, детектированные минимум по десяти прочтения последовательностей 16S-V4 по меньшей мере в одном обработанном этанолом составе со спорами (панмикробиом). Отмечены OTU, приживающиеся у получавших лечение пациентов, и процент пациентов, у которых они приживаются, а также клады, статус спорообразования и статус ключевых OTU. Отмеченные звездочкой OTU встречаются в ≥80% обработанных этанолом составов и приживаются у ≥50% получавших лечение пациентов.

[050] В таблице GC ранжированы первые 20 OTU по CES, при этом имеется дополнительное требование: должно быть показано, что OTU приживается, чтобы она считалась коровым экологическим элементом.

[051] Таблица GD: Коровые экологические подгруппы, протестированные в модели на мышах с С. difficile

[052] Таблица GE: Результаты для бактериальных композиций, протестированных в модели на мышах с С. difficile.

[053] Таблица GF. OTU и принадлежность их клад, протестированные в тройных комбинациях, с результатами анализа ингибирования in vitro

[054] Таблица ZA. Композиции с микроорганизмами, которые вводят через оральный зонд в день -1

[055] Таблица TAB. Популяция OTU в 2, 3 и 4 день после дозирования композициями с микроорганизмами

[056] Таблица ТАС. Популяция клад в 2, 3 и 4 дни после дозирования композициями с микроорганизмами

[057] Таблица TAD. Смертность в экспериментальной группе мышей, стимулированных 104,5 спор С. difficile в 0 день

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

ОБЩИЙ ОБЗОР

[058] В настоящем изобретении раскрыты терапевтические композиции, содержащие непатогенные, способные к прорастанию бактериальные споры, для предотвращения, контроля и лечения заболеваний, расстройств и состояний ЖКТ и поддержания общего здоровья в области пищеварения. Указанные композиции обладают полезными свойствами, поскольку подходят для безопасного введения человеку и другим субъектам-млекопитающим, а также эффективны при многочисленных желудочно-кишечных заболеваниях, расстройствах и состояниях и для поддержания общего здоровья в области пищеварения. Хотя композиции на основе спор известны, их обычно получают с применением других техник, таких как лиофилизация или высушивание распылением жидких бактериальных культур, что приводит к неудовлетворительной эффективности, нестабильности, существенной вариабельности и отсутствию адекватной безопасности и эффективности.

[059] Было обнаружено, что популяции бактериальных спор могут быть получены из биологических материалов, полученных от субъектов-млекопитающих, в том числе человека. Указанные популяции вводят в состав композиций согласно настоящему изобретению и вводят субъектам-млекопитающим с применением способов согласно описанию в настоящем документе.

ОПРЕДЕЛЕНИЯ

[060] «Микробиота» относится к сообществу микроорганизмов, которые встречаются (продолжительное время или временно) в организме и на организме субъекта-животного, как правило, млекопитающего, такого как человек, в том числе эукариот, архей, бактерий и вирусов (включая бактериальные вирусы, т.е. фаги).

[061] «Микробном» относится к генетическому содержанию сообществ микроорганизмов, живущих в организме и на организме человека, продолжительное время или временно, в том числе эукариот, архей, бактерий и вирусов (включая бактериальные вирусы (т.е. фаги)), при этом «генетическое содержание» включает геномную ДНК, РНК, такую как рибосомальная РНК, эпигеном, плазмиды и все другие типы генетической информации.

[062] «Носительство микроорганизмов» или просто «носительство» относится к популяции микроорганизмов, населяющей нишу в организме или на поверхности организма человека. Носительство часто определяют как относительную распространенность. Например, OTU1 содержит 60% от общего носительства микроорганизмов, что означает, что относительная распространенность OTU1 составляет 60% относительно других OTU в образце, для которого проводилось измерение. Носительство чаще всего определяют на основании данных геномного секвенирования, в этом случае относительная распространенность или носительство одной OTU или группы OTU определяется по отношению числа прочтений секвенирования, которые относятся К указанной(ым) OTU, и общего числа прочтений секвенирования для указанного образца.

[063] «Стимуляция микроорганизмов» или просто «стимуляция» относится к формированию или значимому увеличению популяции микроорганизмов, которые (i) отсутствуют или не детектируются (по оценке с применением стандартных геномных и микробиологических техник) во вводимой терапевтической композиции с микроорганизмами, (ii) отсутствуют, не детектируются или редко встречаются в нише организма хозяина (например, желудочно-кишечном тракте, коже, в ноздрях или влагалище) до доставки композиции с микроорганизмами, и (iii) обнаруживаются после введения композиции с микроорганизмами, или их численность значительно увеличивается, например 2-кратно, 5-кратно, 1×102, 1×103, 1×104, 1×105, 1×106, 1×107, или более чем на 1×108, в тех случаях, когда они ранее редко встречались. Микроорганизмы стимулированных групп могут быть получены из экзогенных источников, таких как пища и окружающая среда, или вырастать в микронишах в организме хозяина, где они встречаются с низкой частотой.

[064] Введение указанной терапевтической композиции с микроорганизмами индуцирует экологический сдвиг в целевой нише, способствующий созданию благоприятных условий для роста указанных комменсальных микроорганизмов. В отсутствие лечения терапевтической композицией с микроорганизмами хозяин может постоянно подвергаться воздействию указанных микроорганизмов; тем не менее, устойчивый рост и положительное влияние на здоровье, связанные со стабильной популяцией микроорганизмов с повышенной численностью, составляющих стимулированную экогруппу, не наблюдаются.

[065] «Приживление микроорганизмов» или просто «приживление» относится к приживлению OTU, содержащих терапевтическую композицию с микроорганизмами в целевой нише которые отсутствуют у получающего лечение хозяина до лечения. Микроорганизмы, которые составляют прижившуюся экогруппу, присутствуют в терапевтической композиции с микроорганизмами и становятся компонентами экогруппы микроорганизмов хозяина при лечении. Прижившиеся OTU могут сохраняться временно, или демонстрируют долгосрочную стабильность в экогруппе микроорганизмов, которые заселяют организм хозяина после лечения терапевтической композицией с микроорганизмами. Прижившаяся экогруппа может индуцировать в целевой нише экологический сдвиг, который способствует созданию благоприятных условий для роста комменсальных микроорганизмов, способных катализировать сдвиг дисбиотической экогруппы к экогруппе, соответствующей здоровому состоянию.

[066] «Экологическая ниша» или просто «ниша» относится к экологическому пространству, которое занимает организм или группа организмов. Ниша характеризует то, как организм или популяция организмов отвечает на распределение ресурсов, физические показатели (например, пространство в тканях хозяина) и конкуренцию (например, ростом, если ресурсов достаточно, а хищники, паразиты и патогены немногочисленны), и как он, в свою очередь, изменяет эти же показатели (например, ограничивая доступ к ресурсам для других организмов, функционируя в качестве источника пищи для хищников и потребителя добычи).

[067] «Дисбиоз» относится к состоянию микробиоты пищеварительного тракта или другой области организма субъекта, в том числе поверхностей слизистых оболочек и кожи, где нарушено(а) нормальное разнообразие и/или функция экосистемы. Указанное болезненное состояние может быть обусловлено уменьшением разнообразия, избыточным ростом одного или большего количества патогенов или патобионтов, симбиотических организмов, способных вызывать заболевание только тогда, когда у субъекта имеются определенные генетические условия и/или условия окружающей среды, или сдвиг в сторону экосистемы микроорганизмов, которая уже не обеспечивает необходимую функцию у субъекта-хозяина, и, соответственно уже не способствует поддержанию здоровья.

[068] «Патобионты» или «оппортунистические патогены» относится к симбиотическим организмам, способным вызывать заболевание исключительно тогда, когда у субъекта имеются определенные генетические условия и/или условия окружающей среды.

[069] «Филогенетическое дерево» относится к графическому представлению эволюционных взаимосвязей между генетическими последовательностями, полученных с применением определенного набора алгоритмов филогенетической реконструкции (например, принцип экономии, максимального правдоподобия, или байесовский метод). Узлы дерева соответствуют отдельным предковым последовательностям; достоверности любого узла обеспечиваются бутстепом или критерием байесовской апостериорной вероятности, измеряющей неопределенность ветвей.

[070] «Функциональные таксономические единицы», «OTU», относятся к конечному листу филогенетического дерева и определяются последовательностью нуклеиновых кислот, например, всего генома или конкретной генетической последовательностью, и всеми последовательностями, обладающими идентичностью последовательностей с указанной последовательностью нуклеиновых кислот на уровне вида. Согласно некоторым вариантам реализации специфическая генетическая последовательность может представлять собой последовательность 16S или часть последовательности 16S. Согласно другим вариантам реализации секвенируют и сравнивают полные геномы двух элементов. Согласно другому варианту реализации выбранные области, такие как мультилокусные метки последовательностей (MLST), специфические гены или группы генов могут генетически сравниваться. Во вариантах реализации с 16S OTU, обладающие ≥97% средней идентичности нуклеотидов по всем 16S, или некоторым вариабельным областям 16S, считаются одной OTU (см., например, Claesson MJ, Wang Q, O'Sullivan O, Greene-Diniz R, Cole JR, Ros RP, and O'Toole PW. 2010. Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucleic Acids Res 38: e200. Konstantinidis KT, Ramette A, and Tiedje JM. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc bond В Biol Sci 361: 1929-1940.). Согласно вариантам реализации, задействующим весь геном, метки MLST, специфические гены или группы генов OTU, обладающие ≥95% средней идентичности нуклеотидов, считают одной OTU (см., например, Achtman M, and Wagner M. 2008. Microbial diversity and the genetic nature of microbial species. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, Ramette A, and Tiedje JM. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc bond В Biol Sci 361: 1929-1940.).OTU часто определяют через сравнение последовательностей у разных организмов. Обычно последовательности менее чем с 95% идентичностью последовательностей не считают принадлежащими одной OTU. OTU могут также описываться любой комбинацией нуклеотидных маркеров или генов, в частности, высококонсервативных генов (например, генов «домашнего хозяйства»), или их комбинацией. Такое описание задействует, например, данные секвенирования WGS или последовательности всего генома.

[071] «Остаточные продукты среды обитания» относится к материалу, происходящему из местообитания микробиоты в организме или на организме человека или животного. Например, микробиота обитает в экскрементах, в желудочно-кишечном тракте, на собственно коже, в слюне, слизи дыхательных путей или выделениях мочеполового тракта (т.е. это биологические материалы, связанные с сообществом микроорганизмов). «По существу не содержащий остаточных продуктов среды обитания» означает, что бактериальная композиция уже не содержит биологического материала, связанного со средой обитания микроорганизмов на организме или в организме субъекта, человека или животного, и является на 100%, 99%, 98%, 97%, 96% или 95% свободной от любого загрязняющего биологического материала, связанного с сообществом микроорганизмов. Остаточные продукты среды обитания могут включать абиотические материалы (в том числе непереваренную пищу) или могут включать нежелательные микроорганизмы. «По существу не содержащий остаточных продуктов среды обитания» может также означать, что бактериальная композиция не содержит детектируемых клеток человека или животного, и что детектируются только клетки микроорганизмов. Согласно одному варианту реализации «по существу не содержащий остаточных продуктов среды обитания» может также означать, что бактериальная композиция не содержит детектируемых вирусных загрязняющих примесей (в том числе бактериальных вирусов (т.е. фагов)), грибных и микоплазменных загрязняющих примесей. Согласно другому варианту реализации это означает, что менее чем 1×10-2%, 1×10-3%, 1×10-4%, 1×10-5%, 1×10-6%, 1×10-7%, 1×10-8 жизнеспособных клеток в бактериальной композиции принадлежать человеку или животному, а не клеткам микроорганизмов. Существует несколько способов обеспечения указанной степени чистоты, ни один из которых не являются ограничивающим. Так, загрязнение может быть уменьшено путем выделения требуемых компонентов путем проведения нескольких этапов пересева одиночных колоний методом штриха на твердых средах, до того момента, когда дублирующие штрихи (например, не ограничиваясь указанным, два штриха) из последовательных одиночных колоний не будут обеспечивать морфологию исключительно одиночных колоний. Как вариант, уменьшение загрязнения может достигаться путем проведения нескольких циклов серийных разведении до получения одиночных нужных клеток (например, разведение 10-8 или 10-9), например, путем проведения несколько 10-кратных серийных разведении. Затем можно подтвердить получение одиночных клеток, показав, что в нескольких изолированных колониях наблюдается аналогичная форма клеток и окрашивание по Граму. Другие способы подтверждение надлежащей чистоты включают генетический анализ (например, ПЦР, секвенирование ДНК), серологический и антигенный анализ, ферментный и метаболический анализ, и способы с применением таких инструментов, как проточная цитометрия с реагентами для различения нужных компонентов и загрязняющих примесей.

[072] «Клада» относится к OTU или представителям филогенетического дерева, расположенным ниже статистически достоверного узла филогенетического дерева. Клада содержит набор конечных листьев филогенетического дерева, представляющих собой отдельные монофилетические эволюционные единицы, обладающие определенной степенью сходства последовательностей.

[073] В области микробиологии, «16S-секвенирование», или «16S-рРНК», или «16S» относится к последовательности, полученной в результате определения нуклеотидов, которые содержат ген(ы) рибосомальной РНК 16S. Длина бактериальных 16S рРНК составляет приблизительно 1500 нуклеотидов и используют для реконструкции эволюционных взаимосвязей и сходства последовательностей между бактериальными изолятами с применением филогенетических методов. Последовательности 16S используют для филогенетической реконструкции, поскольку они обычно высококонсервативны, однако содержат специфические гипервариабельные области, содержащие достаточно разнообразные нуклеотиды для различения родов и видов большинства бактерий.

[074] Термин «области V1-V9» 16S рРНК относится к первым девяти гипервариабельным областям гена 16S рРНК, которые используют для генотипирования бактериальных образцов. Указанные области у бактерий определяют нуклеотиды 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 и 1435-1465, соответственно, с применением нумерации на основе системы номенклатуры Е. coli. Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli, PNAS 75(10):4801-4805 (1978). Согласно некоторым вариантам реализации по меньшей мере что-либо одно из областей V1, V2, V3, V4, V5, V6, V7, V8, и V9 используют для определения OTU. Согласно одному варианту реализации области V1, V2, и V3 используют для определения OTU. Согласно другому варианту реализации области V3, V4 и V5 используют для определения OTU. Согласно другому варианту реализации используют область V4 для определения OTU. Специалист в данной области техники может идентифицировать специфические гипервариабельные области кандидатной 16S рРНК путем сравнения указанной представляющей интерес кандидатной последовательности с референсной последовательностью и идентифицировать гипервариабельные области на основании сходства с референсными гипервариабельными областами; или, как вариант, можно использовать характеризацию микроорганизмов или сообщества микроорганизмов с применением полногеномного секвенирования методом «дробовика» (WGS).

[075] Термин «субъект» относится к любому субъекту-животному, в том числе человеку, лабораторным животным (например, приматам, крысам, мышам), сельскохозяйственным животным (например, коровам, овцам, козам, свиньям, индейкам и курам) и домашним животным (например, собакам, кошкам и грызунам). Субъект может страдать дисбиозом, в том числе, но не ограничиваясь перечисленными, инфекцией, обусловленной патогеном ЖКТ, или у него возможно имеется риск развития или передачи окружающим инфекции, обусловленной патогеном ЖКТ.

[076] Термин «фенотип» относится к набору поддающихся наблюдению характеристик индивидуального объекта. Например, индивидуальный субъект может иметь фенотип, соответствующий «здоровому состоянию» или «заболеванию». Фенотипы описывают состояние объекта, и все объекты, имеющие определенный фенотип, обладают одинаковым набором характеристик, описывающий указанный фенотип. Фенотип индивидуума обусловлен отчасти или полностью взаимодействием генома и/или микробиома объекта с окружающей средой.

[077] Термин «экосистема» относится к объединению OTU, которые совместно встречаются у ряда субъектов. В настоящем документе «систему» определяют математически с применением графа, отражающего то, как специфические узлы (т.е. OTU) и ребра (соединения между специфическими OTU) соотносятся друг с другом, для определения экологической структуры объединения OTU. Любая заданная экосистема обладает собственным филогенетическим разнообразием и функциональными свойствами. Экосистема может также быть определена через функцию, где, например, узлы будут включать такие элементы, как, не ограничиваясь перечисленными, фермемы, кластеры ортологичных групп (COGS; http://www.ncbi.nlm.nih.gov/books/NBK21090/) или пути KEGG (www.genome.jp/kegg/).

[078] Термины «класс системы», «коровая система» и «коровая экосистема» относятся к группе экосистем, как правило, как определено численными методами, содержат экогруппы с аналогичными филогенетическими и/или функциональными характеристиками. Коровая система, соответственно, содержит важные биологические признаки группы (т.е. кластера), определенные либо филогенетически, либо функционально, родственных экосистем. Одним из вариантов реализации коровой экосистемы является сконструированное объединение микроорганизмов, как правило, непатогенных бактерий, отражающее коровые характеристики набора филогенетически или функционально связанных экосистем, наблюдаемых у большого числа разных субъектов. Во многих случаях коровая система, сконструированная согласно описанию в настоящем документе, существует в виде экосистемы, наблюдаемой у одного или большего количества субъектов. Экогруппы коровой системы подходят для устранения или уменьшения дисбиоза у субъектов в тех случаях, когда была повреждена базовая родственная экосистема.

[079] Термин «ключевые OTU» относится к одной или большему количеству OTU, обычных для многих экосистем и являющихся представителями экосистем, которые встречаются у многих субъектов (т.е. являются распространенными) (фиг. 1). Ввиду универсальной природы ключевых OTU они играют важнейшую роль в функционировании экосистем у здоровых субъектов и часто отсутствуют, либо их уровни снижены, у субъектов с заболеванием. Ключевые OTU могут присутствовать у субъектов с низкой, умеренной или высокой распространенностью.

[080] Термин «неключевые OTU» относится к OTU, наблюдаемым в экосистеме и не являющимся ключевыми OTU.

[081] Термин «филогенетическое разнообразие» относится к биоразнообразию, свойственному определенной экосистеме или коровой экосистеме, по оценке на основании OTU, которые содержатся в указанной системе. Филогенетическое разнообразие представляет собой относительный термин, то есть экосистема или коровая система, сравнительно более филогенетически разнообразная относительно другой системы, содержит большее число уникальных видов, родов и таксономических семейств. Уникальность видов, родов или таксономического семейства обычно определяют с применением филогенетического дерева, которое отражает генетическое разнообразие все видов, родов и таксономических семейств относительно друг друга. Согласно другому варианту реализации филогенетическое разнообразие может быть измерено с применением общей длины ветвей или средней длины ветвей филогенетического дерева.

[082] «Спора», или «эндоспора» относится к элементу, в частности, бактериальному элементу, находящемуся в покоящемся, не вегетативном и не репродуктивном состоянии. Споры обычно устойчивы к стресс-факторам окружающей среды, таким как излучение, высыхание, обработка ферментами, изменение температуры, недостаток питательных веществ и химические дезинфицирующие средства.

[083] «Популяция спор» относится к совокупности спор, присутствующих в композиции. Синонимы, используемые в настоящем документе, включают споровую композицию, состав со спорами, обработанную этанолом споровую фракцию и споровую экогруппу. Популяция спор может быть очищена из донорского фекального материала, например, с применением этанола или термообработки, или разделения в градиенте плотности, или любой комбинации способов, описанных в настоящем документе, для увеличения чистоты, активности и/или концентрации спор в образце. Как вариант, популяция спор может быть получена с применением методов культивирования, начиная с выделенных спорообразующих видов или спорообразующих OTU, или смеси таких видов, в вегетативной форме либо в виде спор.

[084] Согласно одному варианту реализации состав со спорами содержит спорообразующие виды, при этом остаточные неспорообразующие виды инактивированы с применением химической или физической обработки, в том числе этанолом, детергентом, нагреванием, ультразвуком и т.п.; или указанные неспорообразующие виды удалены из состава со спорами путем проведения различных этапов разделения, в том числе разделения в градиенте плотности, центрифугирования, фильтрации и/или хроматографии; либо способы инактивации и разделения комбинируют для получения указанного состава со спорами. Согласно еще одному варианту реализации состав со спорами содержит спорообразующие виды, обогащенные спорами относительно жизнеспособных не образующих спор или вегетативных форм спорообразующих бактерии. Согласно указанному варианту реализации наблюдается 2-кратное, 5-кратное, 10-кратное, 50-кратное, 100-кратное, 1000-кратное, 10000-кратное или более чем 10000-кратное обогащение по спорам по сравнению со всеми вегетативными формами бактерий. Согласно еще одному варианту реализации споры в споровом составе частично прорастают при обработке и получении препаратов, так что конечная композиция содержит споры и вегетативные бактерии, происходящие из спорообразующих видов.

[085] «Способствующее прорастанию вещество» представляет собой материал, или композицию, или физико-химический процесс, способный индуцировать вегетативный рост у бактерий, которые находятся в покоящейся споровой форме, или группы бактерий в споровой форме, напрямую или опосредованно, в организме-хозяине и/или in vitro.

[086] «Индуцирующий споруляцию агент» представляет собой материал или физико-химический процесс, способный индуцировать споруляцию у бактерии, прямо или непрямо, в организме-хозяине и/или in vitro.

[087] Термин «увеличивать получение бактериальных спор» включает индуцирующую(ий) споруляцию активность или агент.«Получение» включает преобразование вегетативных бактериальных клеток в споры и увеличение скорости такого преобразования, а также уменьшение прорастания бактерий в форме спор, уменьшение скорости разложения спор in vivo или ex vivo, или увеличение общего выхода спор (например, за счет увеличения объемного выхода фекального материала).

[088] «Колонизация» организма-хозяина включает не носящее временного характера пребывание бактерии или другого микроскопического организма. В настоящем документе «уменьшение колонизации» желудочно-кишечного тракта субъекта-хозяина (или любой другой микробиотической ниши) патогенной бактерией включает уменьшение времени пребывания указанного патогена в желудочно-кишечном тракте, а также снижение количества (или концентрации) указанного патогена в желудочно-кишечнсм тракте или прикрепленного к люминальной поверхности желудочно-кишечного тракта. Измерение снижения количества адгезивных патогенов может быть продемонстрировано, например, в биопсийном образце, или снижение может быть измерено непрямо, например, путем измерения патогенной нагрузки в экскрементах хозяина-млекопитающего.

[089] «Комбинация» двух или большего числа бактерий включает физическое сосуществование двух бактерий, в одном и том же материале или продукте либо в физически связанных продуктах, а также совместное по времени введение или колокализацию двух бактерий.

[090] «Цитотоксическая» активность или бактерия включает способность вызывать гибель бактериальной клетки, например, патогенной бактериальной клетки. «Цитостатическая» активность или бактерия включает способность ингибировать, частично или полностью, рост, метаболизм и/или пролиферацию бактериальной клетки, например, патогенной бактериальной клетки.

[091] Не содержащий «непищевых продуктов» означает, что бактериальная композиция или другой описанный в настоящем документе материал не содержит существенного количества несъедобного продукта, например, продукта или материала, непригодного для употребления в пищу, вредного или по иным причинам нежелательного для продукта, подходящего для введения, например, перорального введения, субъекту-человеку. Непищевые продукты часто присутствуют в составах с бактериями, известных из предшествующего уровня техники.

[092] В настоящем документе термин «витамин» включает любые из рада жирорастворимых или водорастворимых органических веществ (неограничивающие примеры включают витамин А, витамин В1 (тиамин), витамин В2 (рибофлавин), витамин В3 (ниацин или ниацинамид), витамин В5 (пантотеновую кислоту), витамин В6 (пиридоксин, пиридоксаль или пиридоксамин, или гидрохлорид пиридоксина), витамин В7 (биотин), витамин В9 (фолиевую кислоту) и витамин В12 (различные кобаламины; в витаминных добавках, как правило, цианокобаламин), витамин С, витамин D, витамин Е, витамин K, K1 и K2 (т.е. MK-4, MK-7), фолиевую кислоту и биотин), необходимые в незначительных количествах для нормального роста и активности организма, и получаемые в естественных условиях из растительной и животной пищи или синтетически, провитамины, производные, аналоги.

[093] В настоящем документе термин «минеральные вещества» включают бор, кальций, хром, медь, йод, железо, магний, марганец, молибден, никель, фосфор, калий, селен, кремний, олово, ванадий, цинк или их комбинации.

[094] В настоящем документе термин «антиоксидант» включает любой один или большее количество различных веществ, таких как бета-каротин (предшественник витамина А), витамин С, витамин Е и селен), которые ингибируют окисление или реакции, стимулируемые реактивными кислородными веществами («ROS») и другими радикалами и не являющимися радикалами веществами. Кроме того, антиоксиданты являются молекулами, которые способны замедлять или предотвращать окисление других молекул. Неограничивающие примеры антиоксидантов включают астаксантин, каротиноиды, кофермент Q10 («CoQ10»), флавоноиды, глутатион, ягоды годжи (дереза), гесперидин, состав на основе молока и ягод годжи (Lacto-Wolfberry), лигнан, лютеин, ликопен, полифенолы, селен, витамин А, витамин С, витамин Е, зеаксантин или их комбинации.

КОМПОЗИЦИИ

[095] Раскрытые в настоящем изобретении терапевтические композиции, содержащие непатогенные, способные к прорастанию бактериальные споры, для предотвращения, контроля и лечения заболеваний, расстройств и состояний ЖКТ и поддержания общего здоровья в области пищеварения. Указанные композиции обладают полезными свойствами, поскольку подходят для безопасного введения человеку и другим субъектам-млекопитающим, а также эффективны при многочисленных желудочно-кишечных заболеваниях, расстройствах и состояниях, и для поддержания общего здоровья в области пищеварения. Хотя композиции на основе спор известны, их обычно получают с применением других техник, таких как лиофилизация или высушивание распылением жидких бактериальных культур, что приводит к неудовлетворительной эффективности, нестабильности, существенной вариабельности и отсутствию адекватной безопасности и эффективности.

[096] Было обнаружено, что популяции бактериальных спор могут быть получены из биологических материалов, полученных от субъектов-млекопитающих, в том числе человека. Указанные популяции вводят в состав композиций согласно настоящему изобретению, и вводят субъектам-млекопитающим с применением способов согласно описанию в настоящем документе.

[097] Предложены терапевтические композиции, содержащие очищенную популяцию бактериальных спор. В настоящем документе термины «очищать», «очищенный» и «очищение» относятся к состоянию популяции (например, к совокупности известной или неизвестной численности и/или концентрации) требуемых бактериальных спор, подвергнутых одному или нескольким процессам очищения, например, отбору по требуемым бактериальным спорам или обогащению требуемыми бактериальными спорами, или как вариант, к удалению или уменьшению количества остаточных продуктов среды обитания согласно описанию в настоящем документе. Согласно некоторым вариантам реализации в очищенной популяции отсутствует детектируемая нежелательная активность или, как вариант, уровень или количество нежелательной активности являются приемлемыми или ниже приемлемых уровня или количества. Согласно другим вариантам реализации очищенная популяция содержит приемлемое(ую) количество и/или концентрацию требуемых бактериальных спор или количество и/или концентрацию. Согласно другим вариантам реализации указанное отношение требуемой и нежелательной активностей (например, спор и вегетативных бактерий), изменялось в 2, 5, 10, 30, 100, 300, 1×104, 1×105, 1×106, 1×107, 1×108 или более чем 1×108 раз. Согласно другим вариантам реализации очищенная популяция бактериальных спор обогащена относительно исходного материала (например, фекального материала), из которого получают указанную популяцию. Указанное обогащение может составлять 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999%, 99,9999% или более чем 99,999999% по сравнению с исходным материалом.

[098] Согласно определенным вариантам реализации в указанных очищенных популяциях бактериальных спор наблюдаются пониженные или недетектируемые уровни одной или большего числа патогенных активностей, таких как токсичность, способность вызывать инфекцию у реципиента - субъекта-млекопитающего, нежелательная иммуномодулирующая активность, аутоиммунный ответ, метаболический ответ, или воспалительный ответ, или неврологическая реакция. Такое уменьшение патогенной активности может составлять 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999%, или более чем 99,9999% по сравнению с исходным материалом. Согласно другим вариантам реализации в очищенных популяциях бактериальных спор содержится меньше органолептических компонентов по сравнению с фекальным материалом, например, менее выраженный запах, вкус, внешний вид и умами.

[099] Предложены очищенные популяции бактериальных спор, по существу не содержащие остаточных продуктов среды обитания. Согласно определенным вариантам реализации это означает, что композиция с бактериальными спорами уже не содержит существенного количества биологического вещества, связанного с сообществом микроорганизмов, обитающих на организме или в организме субъекта-человека или животного, и очищенная популяция спор может быть на 100%, 99%, 98%, 97%, 96% или 95% очищена от каких-либо загрязнений биологическим веществом, связанным с указанным сообществом микроорганизмов. «По существу не содержащие остаточных продуктов среды обитания» может также означать, что композиция с бактериальными спорами не содержит детектируемых клеток человека или животного, и что детектируются только клетки микроорганизмов, в частности, детектируются только требуемые клетки микроорганизмов. Согласно другому варианту реализации это означает, что менее чем 1×10-2%, 1×10-3%, 1×10-4%, 1×10-5%, 1×10–6%, 1×10-7%, 1×10-8% клеток в бактериальной композиции принадлежат человеку или животному, а не микроорганизмам. Согласно другому варианту реализации количество остаточного продукта среды обитания, присутствующего в очищенной популяции, уменьшается по меньшей мере до определенного уровня относительно фекального материала, полученного от донора - субъекта-млекопитающего, например, по меньшей мере приблизительно на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999% или более чем на 99,9999%.

[0100] Согласно одному варианту реализации «по существу не содержащие остаточных продуктов среды обитания» или «по существу не содержащие патогенного материала на детектируемом уровне» означает, что бактериальная композиция не содержит детектируемых вирусных загрязнений (в том числе бактериальных вирусов (т.е. фагов)), грибных, микоплазменных или токсоплазменных загрязнений, или эукариотических паразитов, например, гельминтов. Как вариант, очищенные популяции спор по существу не содержат бесклеточного материала, например, ДНК, материала вирусной оболочки или нежизнеспособного бактериального материала. Как вариант, очищенная популяция спор может быть обработана способом, который обеспечивает гибель, инактивацию или устранение одного или большего количества специфических нежелательных вирусов, таких как кишечный вирус, в том числе норовирус, полиовирус или вирус гепатита А.

[0101] Согласно описанию в настоящем документе, очищение популяций спор может быть продемонстрировано с помощью генетического анализа (например, ПЦР, секвенирования ДНК), серологического и антигенного анализа, микроскопического анализа, анализа микроорганизмов, в том числе прорастания и культивирования, и способов с применением таких инструментов, как проточная цитометрия с реагентами для различения требуемых бактериальных спор и нежелательных загрязняющих материалов.

[0102] Примеры биологических материалов включают фекальные материалы, такие как экскременты, или материалы, выделенные из различных сегментов тонкого и толстого кишечника. Фекальные материалы получают от донора - субъекта-млекопитающего, или они могут быть получены от более чем одного субъекта-донора, например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, 1000 или от более чем 1000 доноров, при этом такие материалы затем объединяют до очищения требуемых бактериальных спор. Согласно другому варианту реализации фекальные материалы могут быть получены многократно от единственного субъекта-донора и может быть объединена совокупность образцов, например, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 32, 35, 40, 45, 48, 50, 100 образцов от единственного донора.

[0103] Согласно альтернативным вариантам реализации указанные требуемые бактериальные споры очищают из одного образца фекального материала, полученного от единственного донора, и после такого очищения комбинируют с очищенными популяциями спор, также полученными при очищении, либо от одного и того же донора в разные моменты времени, или от одного или нескольких разных доноров, или используют оба варианта.

[0104] Доноры - субъекты-млекопитающие обычно отличаются нормальным состоянием здоровья и обладают микробиотой, соответствующей указанному нормальному состоянию здоровья. Часто субъектам-донорам не вводили соединений с антибиотической активностью в течение определенного периода времени перед получением фекального материала. Согласно определенным вариантам реализации указанные субъекты-доноры не страдают ожирением или избыточной массой тела, и могут иметь показатели индекса массы тела (ИМТ) ниже 25, например, от 18,5 до 24,9. Согласно другим вариантам реализации субъекты-доноры не имеют психических заболеваний или не имеют в личном или семейном анамнезе психических заболеваний, таких как тревожное расстройство, депрессия, биполярное расстройство, расстройства аутистического спектра, шизофрения, панические расстройства, расстройства, связанные с дефицитом внимания (гиперактивностью), расстройства пищевого поведения или расстройства настроения. Согласно другим вариантам реализации у субъектов-доноров отсутствует заболевание, связанное с раздражением кишечника (например, болезнь Крона, язвенный колит), синдром раздраженного кишечника, целиакия, рак ободочной и прямой кишки или указанные заболевания отсутствуют в семейном анамнезе. Согласно другим вариантам реализации проводят скрининг доноров на переносимые с кровью патогены и передающиеся через фекалии патогены с применением стандартных техник, известных специалистам в данной области техники (например, тестирования на нуклеиновые кислоты, серологического тестирования, тестирования на антигены, техник культивирования, ферментативного анализа, анализов бесклеточных фекальных фильтратов на токсины на чувствительных субстратах - клеточных культурах).

[0105] Согласно некоторым вариантам реализации доноров также отбирают на основании присутствия определенных родов и/или видов, обеспечивающих повышенную эффективность терапевтических композиций, содержащих указанные роды или виды. Согласно другим вариантам реализации в фекальном материале предпочтительных доноров образуются относительно более высокие концентрации спор, чем у других доноров. Согласно дополнительным вариантам реализации предпочтительные доноры обеспечивают фекальный материал, из которого очищают споры, отличающиеся повышенной эффективностью; указанную повышенную эффективность измеряют в исследованиях in vitro или на животных согласно приведенному ниже описанию. Согласно некоторым вариантам реализации указанный донор может подвергаться одной или нескольким обработкам до взятия донорского материала для уменьшения количества нежелательного материала в фекальном материале и/или увеличения количества требуемых популяций спор.

[0106] Целесообразно проводить скрининг состояния здоровья субъекта-донора перед и, необязательно, один или несколько раз после сбора фекального материала. Такой скрининг позволяет идентифицировать доноров-носителей патогенных материалов, такие как вирусы (ВИЧ, гепатит, полиовирус) и патогенные бактерии. После сбора материала проводят скрининг доноров в течение приблизительно одной недели, двух недель, трех недель, одного месяца, двух месяцев, трех месяцев, шести месяцев, одного года или более чем одного года, и такой скрининг может проводиться ежедневно, еженедельно, раз в две недели, ежемесячно, раз в два месяца, раз в полгода или ежегодно. Доноров, которые прошли скрининг, результаты тестов для которых не были положительными до или после, либо ни до, ни после отбора донорского материала, считают «валидированными» донорами.

[0107] Обработка растворителем. Для очищения бактериальных спор фекальный материал один или несколько раз обрабатывают растворителем. Обработка растворителем представляет собой обработку смешивающимся растворителем (частично смешивающимся или полностью смешивающимся) или обработку несмешивающимся растворителем. Смешиваемость представляет собой способность двух жидкостей смешиваться друг с другом с образованием гомогенного раствора. Вода и этанол, например, полностью смешиваются, так что смесь, содержащая воду и этанол в любом соотношении, будет однофазной. Смешиваемость выражают через массовые % или через массу одного из растворителей на 100 г конечного раствора. Если два растворителя полностью смешиваются в любых пропорциях, их смешиваемость составляет 100%. Полностью смешивающиеся с водой растворы образуют спирты, например, метанол, этанол, изопропанол, бутанол, пропандиол, бутандиол и т.д. Спирты могут быть заранее соединены с водой; например, могут быть представлены в виде 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% или более чем 95% раствором. Другие растворители являются только частично смешивающимися, что означает, что только определенная часть растворяется в воде. Простой диэтилэфир, например, частично способен смешиваться с водой. До 7 г простого диэтилэфира растворяются в 93 г воды с получением 7% (масс. %) раствора. Если добавить большее количество диэтилэфира, образуется двухфазный раствор с отдельным слоем диэтилэфира над водой. Другие частично смешиваемые материалы включают простые эфиры, пропаноат, бутаноат, хлороформ, диметоксиэтан или тетрагидрофуран. С другой стороны, масло, например, алкан и вода являются несмешиваемыми и образуют две фазы. Также обработку несмешивающимся растворителем необязательно комбинируют с детергентом, либо ионогенным, либо неионогенным. Примеры детергентов включают Triton Х-100, Tween 20, Tween 80, Nonidet P40, плюроник или полиол. Этапы обработки растворителем снижает жизнеспособность неспорообразующих бактериальных видов на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, 99,9%, 99,99%, 99,999%, или на 99,9999%, и он может необязательно снижать жизнеспособность контаминирующих протистов, паразитов и/или вирусов.

[0108] Хроматографическая обработка. Для очищения популяций спор фекальные материалы подвергают одной или нескольким хроматографическим обработкам, последовательно или параллельно. При хроматографической обработке раствор, содержащий фекальный материал, приводят в контакт с твердой средой, содержащей а среду для хроматографии с гидрофобным взаимодействием (HIC) или среду для аффинной хроматографии. Согласно альтернативному варианту реализации твердую среду, способную абсорбировать остаточный продукт среды обитания, присутствующий в фекальном материале, приводят в контакт с твердой средой, которая адсорбирует остаточный продукт среды обитания. Согласно определенным вариантам реализации указанная среда для HIC содержит сефарозу или дериватизированную сефарозу, например, бутилсефарозу, октилсефарозу, фенилсефарозу или бутил-s-сефарозу. Согласно другим вариантам реализации указанная среда для аффинной хроматографии содержит материал, дериватизированный муцином типа I, II, III, IV, V или VI, или олигосахаридами, происходящими из муцинов или аналогичными происходящим из муцинов типа I, II, III, IV, V или VI. Как вариант, среда для аффинной хроматографии содержит материал, дериватизированный антителами, распознающими споробразующие бактерии.

[0109] Механическая обработка. Предложено физическое разрушение фекального материала, в частности, путем одной или нескольких механических обработок, таких как смешивание, перемешивание, встряхивание, обработка на вортексе, ударная пульверизация и обработка ультразвуком. Согласно настоящему изобретению указанная обработка с механическим разрушением по существу разрушает неспоровый материал, присутствующий в фекальном материале, и по существу не разрушает споры, присутствующие в фекальном материале, или может разрушать споровый материал в меньшей степени, чем неспоровый материал, например, в 2 раза, в 5, 10, 30, 100, 300, 1000 или более чем в 1000 раз. Кроме того, механическая обработка гомогенизирует материал для последующего взятия образцов, тестирования и обработки. Механическая обработка необязательно включает обработку фильтрацией, при которой нужные популяции спор остаются на фильтре, а нежелательные (неспоровые) фекальные компоненты проходят через фильтр, и затем споровую фракцию извлекают из фильтрующей среды. Как вариант, нежелательные частицы и эукариотические клетки могут оставаться на фильтре, а бактериальные клетки, в том числе споры, могут проходить через фильтр. Согласно некоторым вариантам реализации споровую фракцию, остающуюся на фильтре, подвергают диафильтрации, при этом указанные оставшиеся споры приводят в контакт с жидкостью для промывания, как правило, стерильным содержащим соли раствором или другим разбавителей, таким как совместимый с водой полимер, например, раствором полиэтиленгликоля (ПЭГ) с низкой молекулярной массой, для дополнительного уменьшения количества или удаления нежелательных фекальных компонентов.

[0110] Термообработка. Предложено термическое разрушение фекального материала. Обычно фекальный материал смешивают с содержащим соли раствором, таким как забуференный фосфатом солевой раствор (ФСБ), и помещают в среду с повышенной температурой, например, в теплую комнату, инкубатор, на водяную баню, или т.п., таким образом, чтобы между нагретой средой и фекальным материалом происходил эффективный теплообмен. Предпочтительно раствор фекального материала перемешивают во время инкубирования для увеличения теплопроводности и разрушения агрегатов частиц. Термообработка может модулироваться за счет температуры окружающей среды и/или продолжительности термообработки. Например, фекальный материал или жидкость, содержащую фекальный материал, подвергают воздействию среды с повышенной температурой, например, горячей водяной бани, температура которой составляет по меньшей мере приблизительно 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 или более чем 100°С, в течение по меньшей мере приблизительно 1, 5, 10, 15, 20, 30, 45 секунд, или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 или 50 минут, или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более 10 часов. Согласно определенным вариантам реализации термообработка происходит при двух различных температурах, например, в течение 30 секунд в среде с температурой 100 градусов Цельсия, а затем в течение 10 минут в среде с температурой 50 градусов Цельсия. Согласно предпочтительным вариантам реализации температура и продолжительность термообработки являются достаточными для гибели или удаления патогенных материалов, и при этом по существу не повреждают или не уменьшают, количество способных к прорастанию спор. Согласно другим предпочтительным вариантам реализации температура и продолжительность термообработки являются достаточно небольшими для уменьшения прорастания популяции спор.

[0111] Обработка облучением. Предложены способы обработки фекального материала или разделенных компонентов фекального материала ионизирующим излучением, как правило, гамма-излучением, ультрафиолетовым излучением или облучением электронным пучком с обеспечением уровня энергии, достаточного для гибели патогенных материалов, но по существу не повреждающего нужные популяции спор. Например, ультрафиолетовое излучение с длиной волны 254 нм с обеспечением уровня энергии, составляющим менее чем приблизительно 22000 мкВт на см2 в секунду, обычно не разрушает требуемые споры.

[0112] Обработка центрифугированием и разделение по плотности. Предложены способы отделения требуемых популяций спор от других компонентов фекального материала путем центрифугирования. Раствор, содержащий фекальный материал, один или несколько раз обрабатывают центрифугированием, например, приблизительно при 200×g, 1000×g, 2000×g, 3000×g, 4000×g, 5000×g, 6000×g, 7000×g, 8000×g или более чем 8000×g. Дифференциальное центрифугирование позволяет отделить требуемые споры от нежелательного неспорового материала; при малых мощностях споры остаются в растворе, а при более высоких мощностях споры осаждаются, тогда как примеси меньшего размера (например, вирусные частицы, фаги, микроскопические волокна, биологические макромолекулы, такие как свободный белок, нуклеиновые кислоты и липиды) остаются в растворе. Например, при первом центрифугировании с малой мощностью осаждаются волокнистые материалы; при втором центрифугировании с большей мощностью осаждаются нежелательные эукариотические клетки, а при третьем центрифугировании с еще большей мощностью осаждаются требуемые споры, однако загрязняющие примеси более малого размера остаются в суспензии. Согласно некоторым вариантам реализации градиенты или «подушки» плотности или подвижности (например, «ступенчатые подушки»»), такие как градиенты CsCl, перколла, фиколла, никоденза, гистоденза или градиенты сахарозы, используют для разделения требуемых популяций спор и других материалов в фекальном материале.

[0113] Также в настоящем документе предложены способы получения популяций спор, сочетающие два или большее число вариантов обработки, описанных в настоящем документе, для синергетического очищения требуемых спор наряду с уничтожением или удалением нежелательных материалов и/или активностей из популяции спор. Как правило, желательно сохранение популяций спор в не способствующих прорастанию и росту условиях и средах, для минимизации роста патогенных бактерий, присутствующих в популяциях спор, и для минимизации прорастания спор с образованием вегетативных бактериальных клеток.

[0114] Очищенные популяции спор. Согласно описанию в настоящем документе очищенные популяции спор содержат комбинации комменсальных бактерии кишечной микробиоты человека, обладающие способностью значимо способствовать функции здоровой микробиоты при введении субъекту-млекопитающему. Считается, что, не ограничиваясь конкретным механизмом, такие композиции ингибируют рост патогена, такого как С. difficile, Salmonella spp., энтеропатогенные Е. coli, Fusobacterium spp., Klebsiella spp. и устойчивые к ванкомицину Enterococcus spp., таким образом, что может поддерживаться здоровая, разнообразная защитная микробиота или, в случае инфекций патогенными бактериями, например, инфекции С. difficile, заново заселять просвет кишечника для восстановления экологического контроля над потенциальными патогенами. Согласно одному варианту реализации очищенные популяции спор могут приживаться у хозяина и присутствовать в течение 1 дня, 2 дней, 3 дней, 4 дней, 5 дней, 6 дней, 7 дней, 10 дней, 14 дней, 21 дней, 25 дней, 30 дней, 60 дней, 90 дней или дольше чем 90 дней. Кроме того, очищенные популяции спор могут индуцировать приживление у хозяина других здоровых комменсальных бактерий, обнаруживаемых в здоровом кишечнике, не присутствующих в указанных очищенных популяциях спор или присутствующих в меньшем количестве, и, соответственно, считается, что указанные виды «стимулируют» введенные популяции спор. Таким образом, стимуляция комменсальных видов в очищенной популяции спор в кишечнике реципиента приводит к формированию более разнообразной популяции кишечной микробиоты по сравнению с присутствующей изначально.

[0115] Предпочтительные бактериальные роды включают Acetanaerobacterium, Acetivibrio, Alicyclobacillus, Alkaliphilus, Anaerofustis, Anaerosporobacter, Anaerostipes, Anaerotruncus, Anoxybacillus, Bacillus, Bacteroides, Blautia, Brachyspira, Brevibacillus, Bryantella, Bulleidia, Butyricicoccus, Butyrivibrio, Catenibacterium, Chlamydiales, Clostridiaceae, Clostridiales, Clostridium, Collinsella, Coprobacillus, Coprococcus, Coxiella, Deferribacteres, Desulfitobacterium, Desulfotomaculum, Dorea, Eggerthella, Erysipelothrix, Erysipelotrichaceae, Ethanoligenens, Eubacterium, Faecalibacterium, Filifactor, Flavonifractor, Flexistipes, Fulvimonas, Fusobacterium, Gemmiger, Geobacillus, Gloeobacter, Holdemania, Hydrogenoanaerobacterium, Kocuria, Lachnobacterium, Lachnospira, Lachnospiraceae, Lactobacillus, Lactonifactor, Leptospira, Lutispora, Lysinibacillus, Mollicutes, Moorella, Nocardia, Oscillibacter, Oscillospira, Paenibacillus, Papillibacter, Pseudoflavonifractor, Robinsoniella, Roseburia, Ruminococcaceae, Ruminococcus, Saccharomonospora, Sarcina, Solobacterium, Sporobacter, Sporolactobacillus, Streptomyces, Subdoligranulum, Sutterella, Syntrophococcus, Thermoanaerobacter, Thermobifida, Turicibacter

[0116] Предпочтительные бактериальные виды представлены в таблице 1 и отмечены как спорообразующие. В тех случаях, когда приведены конкретные штаммы вида, специалисту в данной области техники будет понятно, что приведенный штамм может быть заменен на другие штаммы указанного вида.

[0117] Согласно некоторым вариантам реализации споробразующие бактерии идентифицируют по присутствию последовательностей нуклеиновых кислот, которые модулируют споруляцию. В частности, характерные для споруляции гены высококонсервативны у всех представителей дальнородственных родов, в том числе Clostridium и Bacillus. С применением традиционных подходов «прямой» генетики были идентифицированы многие, если не все, гены, критически важные для споруляции (spo). Программа развития споруляции частично управляется последовательным действием четырех компартмент-специфических сигма-факторов (наблюдаемых в следующем порядке: σF, σЕ, σG и σK), активность которых ограничена проспорой (σF и σG) или материнской клеткой (σЕ и σK). Согласно другим вариантам реализации споробразующие бактерии идентифицируют по биохимической активности продуцирующих ДПК ферментов или путем анализа содержания ДПК в культурах. В ходе бактериальной споруляции продуцируются большие количества ДПК, составляющие 5-15% от массы споры. Поскольку не все жизнеспособные споры прорастают и растут в известных условиях среды, сложно оценить общее число спор в популяции бактерий. Таким образом, измеренное содержание ДПК хорошо коррелирует с содержанием спор и представляет собой подходящий показатель для определения общего содержания спор в бактериальной популяции.

[0118] Предложены популяции спор, содержащие более чем один тип бактерий. В настоящем документе «тип» или более одного «типа» бактерий может различаться на уровне рода, вида, подвида, штамма, или с применением любого другого таксономического метода, согласно описанию в настоящем документе и иными известными в данной области техники способами.

[0119] Согласно некоторым вариантам реализации все или по существу все бактериальные споры, присутствующие в очищенной популяции, получены из фекального материала, обработанного согласно описанию в настоящем документе или иным известным способом в данной области техники. Согласно альтернативным вариантам реализации одну или большее количество бактериальных спор или типов бактериальных спор получают в культуре и комбинируют для получения очищенной популяции спор. Согласно другим альтернативным вариантам реализации одну или большее количество указанных полученных в культуре популяций спор комбинируют с полученной из фекального материала популяцией спор для получения гибридной популяции спор. Бактериальные композиции могут содержать по меньшей мере два типа указанных предпочтительных бактерий, в том числе штаммы одного вида. Например, бактериальная композиция может содержать по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, или по меньшей мере 20 или более чем 20 типов бактерий, по оценке на основании видов или функциональной таксономической единицы (OTU), включающей такие виды.

[0120] Таким образом, предложены способы получения композиции, содержащей популяцию бактериальных спор, подходящую для терапевтического введения нуждающемуся в этом субъекту-млекопитающему. Указанную композицию получают, как правило, путем проведения этапов: (а) получения фекального материала, полученного от донора - субъекта-млекопитающего; и (b) проведения по меньшей мере одного варианта очищения или этапа очищения указанного фекального материала в таких условиях, чтобы получить из указанного фекального материала популяцию бактериальных спор. Состав с указанной композицией получают таким образом, что одна доза для перорального приема содержит по меньшей мере приблизительно 1×104 колониеобразующих единиц указанных бактериальных спор, и одна доза для перорального приема, как правило, содержит приблизительно 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015 или более чем 1×1015 КОЕ указанных бактериальных спор. Присутствие и/или концентрация определенного типа бактериальных спор могут быть известны или неизвестны в определенной очищенной популяции спор. В случае, когда известна, например, концентрация спор определенного штамма, или совокупности всех штаммов составляет, например, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015 или более чем 1×1015 жизнеспособных бактериальных спор на грамм композиции или на введенную дозу.

[0121] В некоторых составах указанная композиция содержит по меньшей мере приблизительно 0,5%, 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более чем 90% спор по массе. В некоторых составах введенная доза не превышает 200, 300, 400, 500, 600, 700, 800, 900 мг или 1; 1,1; 1,2; 1,3; 1,4; 1,5; 1,6; 1,7; 1,8; или 1,9 г по массе.

[0122] Бактериальные споровые композиции обычно вводят в составы для перорального введения или гастрального введения, как правило, субъекту-млекопитающему. Согласно конкретным вариантам реализации указанную композицию вводят в состав для перорального введения в твердой, полутвердой, гелевой или жидкой форме, например, в форме пилюль, таблеток, капсул или пастилок. Согласно некоторым вариантам реализации такие составы содержат кишечнорастворимое покрытие или покрыты кишечнорастворимым покрытием для защиты бактерий при прохождении через желудок и тонкий кишечник, хотя споры обычно устойчивы в желудке и тонком кишечнике. Согласно другим вариантам реализации указанные бактериальные споровые композиции могут быть введены в состав со способствующим прорастанию веществом для улучшения приживления или эффективности. Согласно другим вариантам реализации указанные бактериальные споровые композиции могут быть введены в состав с пребиотическими веществами или вводиться вместе с пребиотическими веществами для улучшения приживления или эффективности.

[0123] Может быть получен состав с бактериальными споровыми композициями, эффективный у определенного субъекта-млекопитающего при однократном введении или при многократном введении. Например, однократное введение по существу эффективно для уменьшения содержания Cl. difficile и/или токсина Cl. difficile у субъекта-млекопитающего, которому вводят указанную композицию. По существу эффективный означает, что содержание Cl. difficile и/или токсин Cl. difficile у субъекта уменьшается по меньшей мере на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% или более чем на 99% после введения указанной композиции. Как вариант, эффективность может быть измерена по отсутствию симптомов диареи или отсутствию носительства C. difficile или токсина C. difficile через 2 дня, 4 дня, 1 неделю, 2 недели, 4 недели, 8 недель или более 8 недель.

Бактериальные композиции

[0124] Предложены бактерии и комбинации бактерий кишечной микробиоты человека, обладающие способностью значимо способствовать функциям здоровой микробиоты при введении хозяевам-млекопитающим. Считается, не ограничиваясь конкретным механизмом, что такие композиции ингибируют рост, пролиферацию, и/или колонизацию одной или множества(ом) патогенных бактерий в дисбиотической микробиотической нише, таким образом нормальная разнообразная защитная микробиота колонизирует и заселяет просвет кишечника для формирования или восстановления экологического контроля над патогенами или потенциальными патогенами (например, некоторые бактерии являются патогенными только при присутствии в дисбиотической среде). Ингибирование патогенов включает такие патогены, такие как C. difficile, Salmonella spp., энтеропатогенные Е coli, обладающие множественной лекарственной устойчивостью бактерии, такие как Klebsiella и Е. coli, устойчивые к карбапенемам Enterobacteriaceae (CRE), устойчивые к бета-лактамам расширенного спектра Enterococci (ESBL) и устойчивые к ванкомицину Enterococci (VRE).

[0125] В настоящем документе «тип» или более одного «типа» бактерий может различаться на уровне рода, вида, подвида, штамма или с применением любого другого таксономического метода, согласно описанию в настоящем документе и иными известными в данной области техники способами.

[0126] Бактериальные композиции могут содержать два типа бактерий (называясь «бинарными комбинациями» или «бинарными парами») или более чем два типа бактерий. Например, бактериальная композиция может содержать по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, по меньшей мере 20, или по меньшей мере 21, 22, 23, 24, 25, 26, 27, 28, 29 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, или по меньшей мере 40, по меньшей мере 50 или более чем 50 типов бактерий, по оценке на основе видов или функциональных таксономических единиц (OTU), или иным образом согласно описанию в настоящем документе.

[0127] Согласно другому варианту реализации число типов бактерий, присутствующих в бактериальной композиции, равно известному значению или ниже известного значения. Например, в таких вариантах реализации бактериальная композиция содержит 50 или менее типов бактерий, например, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, или 10 или менее, или 9 или менее типов бактерий, 8 или менее типов бактерий, 7 или менее типов бактерий, 6 или менее типов бактерий, 5 или менее типов бактерий, 4 или менее типов бактерий, или 3 или менее типов бактерий. Согласно другому варианту реализации бактериальная композиция содержит от 2 до не более чем 40, от 2 до не более чем 30, от 2 до не более чем 20, от 2 до не более чем 15, от 2 до не более чем 10, или от 2 до не более чем 5 типов бактерий.

Бактериальные композиции, описанные через виды

[0128] Могут быть получены бактериальные композиции, содержащие по меньшей мере два типа выделенных бактерий, выбранных из видов в таблице 1.

[0129] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Enterococcus faecalis (ранее была известна как Streptococcus faecalis), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 и 1108-1), Clostridum bifermentans и Blautia producta (ранее была известна как Peptostreptococcus productus). Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0130] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Enterococcus faecalis (ранее была известна как Streptococcus faecalis), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 и 1108-1), Clostridum bifermentans и Blautia producta (ранее была известна как Peptostreptococcus productus). Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0131] Согласно другому варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну из предпочтительно, более чем одну из следующих бактерий: Acidaminococcus intestinalis, Bacteroides ovatus, два штамма Bifidobacterium adolescentis, два штамма Bifidobacterium longum, Blautia producta, Clostridium cocleatum, Collinsella aerofaciens, два штамма Dorea longicatena, Escherichia coli, Eubacterium desmolans, Eubacterium eligens, Eubacterium limosum, четыре штамма Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lachnospira pectinoshiza, Lactobacillus casei, Lactobacillus casei/paracasei, Paracateroides distasonis, Raoultella sp., один штамм Roseburia (выбранный из Roseburia faecalis или Roseburia faecis), Roseburia intestinalis, два штамма Ruminococcus torques, два штамма Ruminococcus obeum и Streptococcus mitis. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0132] Согласно еще одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Barnesiella intestinihominis; Lactobacillus reuteri; вид, описанный как один из Enterococcus hirae, Enterococus faecium или Enterococcus durans; вид, описанный как один из Anaerostipes caccae или Clostridium indolis; вид, описанный как один из Staphylococcus warneri или Staphylococcus pasteuri; и Adiercreutzia equolifaciens. Согласно альтернативному варианту реализации по меньшей мере какий-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0133] Согласно другим вариантам реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bartlettii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium felsineum, Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenominatum, Clostridium novyi, Clostridium oroticum, Clostridium paraputrificum, Clostridium perfringens, Clostridium piliforme, Clostridium putrefaciens, Clostridium putrificum, Clostridium ramosum, Clostridium sardiniense, Clostridium sartagoforme, Clostridium scindens, Clostridium septicum, Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme, Clostridium sporogenes, Clostridium subterminale, Clostridium symbiosum, Clostridium tertium, Clostridium tetani, Clostridium welchii и Clostridium villosum. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0134] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Clostridium innocuum, Clostridum bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis, три штамма Escherichia coli и Lactobacillus sp. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0135] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum, три штамма Escherichia coli, три штамма Bacteroides и Blautia producta. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0136] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Bacteroides sp., Escherichia coli и непатогенная Clostridia, в том числе Clostridium innocuum, Clostridium bifermentans и Clostridium ramosum. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0137] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: виды Bacteroides, Escherichia coli и непатогенная Clostridia, например, Clostridium butyricum, Clostridium bifermentans и Clostridium innocuum. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0138] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerthii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis-ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroides stercoris, Bacteroides tectum, Bacteroides thetaiotaomicron, Bacteroides uniformis, Bacteroides ureolyticus и Bacteroides vulgatus. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0139] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, анаэробные кокки, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas и Peptostreptococcus. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

[0140] Согласно одному варианту реализации указанная бактериальная композиция содержит по меньшей мере какую-либо одну и, предпочтительно, более чем одну из следующих бактерий: Bacteroides fragilis ss. Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (ранее была известна как Peptostreptococcus productus II), Bacteroides fragilis ss. Distasonis, Fusobacterium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Blautia producta (ранее была известна как Peptostreptococcus productus I), Ruminococcus bronii, Bifidobacterium adolescentis, Gemmiger formicilis, Bifidobacterium longum, Eubacterium siraeum, Ruminococcus torques, Eubacterium rectale III-H, Eubacterium rectale IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium leptum, Bacteroides fragilis ss. A, Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale III-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss. fragilis, Bacteroides AR, Coprococcus catus, Eubacterium hadrum, Eubacterium cylindroides, Eubacterium ruminantium, Eubacterium CH-1, Staphylococcus epidermidis, Peptostreptococcus BL, Eubacterium limosum, Bacteroides praeacutus, Bacteroides L, Fusobacterium mortiferum I, Fusobacterium naviforme, Clostridium innocuum, Clostridium ramosum, Propionibacterium acnes, Ruminococcus flavefaciens, Ruminococcus AT, Peptococcus AU-1, Eubacterium AG, -AK, -AL, -AL-1, -AN; Bacteroides fragilis ss. ovatus, -ss. d, -ss. f; Bacteroides L-1, L-5; Fusobacterium nucleatum, Fusobacterium mortiferum, Escherichia coli, Streptococcus morbiliorum, Peptococcus magnus, Peptococcus G, AU-2; Streptococcus intermedius, Ruminococcus lactaris, Ruminococcus CO Gemmiger X, Coprococcus BH, -CC; Eubacterium tenue, Eubacterium ramulus, Eubacterium AE, -AG-H, -AG-M, -AJ, -BN-1; Bacteroides clostridiiformis ss. clostridliformis, Bacteroides coagulans, Bacteroides orails, Bacteroides ruminicola ss. brevis, -ss. ruminicola, Bacteroides splanchnicus, Desuifomonas pigra, Bacteroides L-4, -N-i; Fusobacterium H, Lactobacillus G и Succinivibrio А. Согласно альтернативному варианту реализации по меньшей мере какой-либо один из вышеперечисленных видов по существу не присутствует в указанной бактериальной композиции.

Бактериальные композиции, определенные через функциональные таксономические единицы (OTU)

[0141] Могут быть получены бактериальные композиции, содержащие по меньшей мере два типа выделенных бактерий, выбранные из видов в таблице 1.

[0142] Согласно одному варианту реализации OTU могут характеризоваться одной или большим количеством вариабельных областей последовательности 16S (V1-V9). Указанные области у бактерий определяют нуклеотиды 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 и 1435-1465, соответственно, с применением нумерации на основе системы номенклатуры Е. coli. (См., например, Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli, PNAS 75(10):4801-4805 (1978)). Согласно некоторым вариантам реализации для определения OTU используют по меньшей мере какую-либо одну из областей V1, V2, V3, V4, V5, V6, V7, V8 и V9. Согласно одному варианту реализации области V1, V2, и V3 используют для определения OTU. Согласно другому варианту реализации области V3, V4, и V5 используют для определения OTU. Согласно другому варианту реализации область V4 используют для определения OTU.

Бактериальные композиции, не содержащие определенных бактериальных видов или штаммов

[0143] Согласно одному варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Enterococcus faecalis (ранее была известна как Streptococcus faecalis), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 и 1108-1), Clostridum bifermentans и Blautia producta (ранее была известна как Peptostreptococcus productus).

[0144] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Acidaminococcus intestinalis, Bacteroides ovatus, два вида Bifidobacterium adolescentis, два вида Bifidobacterium longum, Collinsella aerofaciens, два вида Dorea longicatena, Escherichia coli, Eubacterium eligens, Eubacterium limosum, четыре вида Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lactobacillus casei, Lactobacillus paracasei, Paracateroides distasonis, Raoultella sp., один вид Roseburia (выбранный из Roseburia faecalis или Rosebuna faecis), Roseburia intestinalis, два вида Ruminococcus torques и Streptococcus mitis.

[0145] Согласно еще одному варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Barnesiella intestinihominis; Lactobacillus reuteri; вид, описанный как один из Enterococcus hirae, Enterococus faecium, или Enterococcus durans; вид, описанный как один из Anaerostipes сассае или Clostridium indolis; вид, описанный как один из Staphylococcus warneri или Staphylococcus pasteuri; и Adiercreutzia equolifaciens.

[0146] Согласно другим вариантам реализации указанная бактериальная композиция не содержит по меньшей мере что-либо одно из Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium felsineum, Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenominatum, Clostridium novyi, Clostridium oroticum, Clostridium paraputrificum, Clostridium perfringens, Clostridium piliforme, Clostridium putrefaciens, Clostridium putriflcum, Clostridium ramosum, Clostridium sardiniense, Clostridium sartagoforme, Clostridium scindens, Clostridium septicum, Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme, Clostridium sporogenes, Clostridium subterminale, Clostridium symbiosum, Clostridium tertium, Clostridium tetani, Clostridium welchii и Clostridium villosum.

[0147] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Clostridium innocuum, Clostridum bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis, три штамма Escherichia coli и Lactobacillus sp.

[0148] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum, три штамма Escherichia coli, три штамма Bacteroides и Blautia producta (ранее была известна как Peptostreptococcus productus).

[0149] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Bacteroides sp., Escherichia coli, и непатогенной Clostridia, в том числе Clostridium innocuum, Clostridium bifermentans и Clostridium ramosum.

[0150] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из более чем одного вида Bacteroides, Escherichia coli и непатогенной Clostridia, например, Clostridium butyricum, Clostridium bifermentans и Clostridium innocuum.

[0151] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerihii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis-ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroides stercoris, Bacteroides tectum, Bacteroides thetaiotaomicron, Bacteroides uniformis, Bacteroides ureolyticus и Bacteroides vulgatus.

[0152] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, анаэробных кокков, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas и Peptostreptococcus.

[0153] Согласно другому варианту реализации указанная бактериальная композиция не содержит по меньшей мере какую-либо одну бактерию из Bacteroides fragilis ss. Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (ранее была известна как Peptostreptococcus productus II), Bacteroides fragilis ss. Distasonis, Fusobacterium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Blautia producta (ранее была известна как Peptostreptococcus productus I), Ruminococcus bromii, Bifidobacterium adolescentis, Gemmiger formicilis, Bifidobacterium longum, Eubacterium siraeum, Ruminococcus torques, Eubacterium rectale III-H, Eubacterium rectale IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium leptum, Bacteroides fragilis ss. A, Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale III-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss. fragilis, Bacteroides AR, Coprococcus catus, Eubacterium hadrum, Eubacterium cylindroides, Eubacterium ruminantium, Eubacterium CH-1, Staphylococcus epidermidis, Peptostreptococcus BL, Eubacterium limosum, Bacteroides praeacutus, Bacteroides L, Fusobacterium mortiferum I, Fusobacterium naviforme, Clostridium innocuum, Clostridium ramosum, Propionibacterium acnes, Ruminococcus flavefaciens, Ruminococcus AT, Peptococcus AU-1, Eubacterium AG, -AK, -AL, -AL-1, -AN; Bacteroides fragilis ss. ovatus, -ss. d, -ss. f; Bacteroides L-1, L-5; Fusobacterium nucleatum, Fusobacterium mortiferum, Escherichia coli. Streptococcus morbiliorum, Peptococcus magnus, Peptococcus G, AU-2; Streptococcus intermedius, Ruminococcus lactaris, Ruminococcus CO Gemmiger X, Coprococcus BH, -CC; Eubacterium tenue, Eubacterium ramulus, Eubacterium AE, -AG-H, -AG-M, -AJ, -BN-1; Bacteroides clostridiiformis ss. clostridliformis, Bacteroides coagulans, Bacteroides orails, Bacteroides ruminicola ss. brevis, -ss. ruminicola, Bacteroides splanchnicus, Desuifomonas pigra, Bacteroides L-4,-N-i; Fusobacterium H, Lactobacillus G и Succinivibrio A.

Ингибирование бактериальных патогенов

[0154] Согласно некоторым вариантам реализации указанная бактериальная композиция обеспечивает защитный или терапевтический эффект от инфекции одним или большим количеством представляющих интерес патогенов ЖКТ.

[0155] Перечень типовых бактериальных патогенов приведен в таблице 1, на что указывает патогенный статус.

[0156] Согласно некоторым вариантам реализации указанная патогенная бактерия выбрана из группы, состоящей из Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bifidobacterium, Bacillus, обладающих множественной лекарственной устойчивостью бактерий, устойчивых к бета-лактамам расширенного спектра энтерококков (ESBL), устойчивых к карбапенемам Enterobacteriaceae (CRE) и устойчивых к ванкомицину энтерококков (VRE).

[0157] Согласно некоторым вариантам реализации указанные патогены включают, не ограничиваясь перечисленными, Aeromonas hydrophila, Campylobacter fetus, Plesiomonas shigelloides, Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, энтероагрегативную Escherichia coli, энтерогеморрагическую Escherichia coli, энтероинвазивную Escherichia coli, энтеротоксигенную Escherichia coli (например, но не ограничиваясь перечисленными, LT и/или ST), Escherichia coli 0157:H7, Helicobacter pylori, Klebsiellia pneumonia, Lysteria monocytogenes, Plesiomonas shigelloides, Salmonella spp., Salmonella typhi, Salmonella paratyphi, Shigella spp., Staphylococcus spp., Staphylococcus aureus, устойчивые к ванкомицину Enterococcus spp., Vibrio spp., Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus и Yersinia enterocolitica.

[0158] Согласно одному варианту реализации представляющий интерес патоген представляет собой по меньшей мере один патоген, выбранный из Clostridium difficile, Salmonella spp., патогенной Escherichia coli, устойчивых к ванкомицину Enterococcus spp.и устойчивых к бета-лактамам расширенного спектра Enterococci (ESBL).

Очищенные популяции спор

[0159] Согласно некоторым вариантам реализации бактериальные композиции содержат очищенные популяции спор. Очищенные популяции спор содержат комбинации комменсальных бактерии кишечной микробиоты человека, обладающие способностью значимо способствовать функциям нормальной микробиоты при введении субъекту-млекопитающему. Считается, что, не ограничиваясь конкретным механизмом, такие композиции ингибируют рост патогена, такого как C. difficile, Salmonella spp., энтеропатогенных Е. coli и устойчивых к ванкомицину Enterococcus spp., поддерживая таким образом здоровую разнообразную защитную микробиоту, или, в случае инфекций патогенными бактериями, например, инфекции C. difficile, позволяя ей заново заселять просвет кишечника для восстановления экологического контроля над потенциальными патогенами. Согласно некоторым вариантам реализации споры дрожжей и другие грибные споры также очищают и отбирают для терапевтического применения.

[0160] Раскрытые в настоящем изобретении терапевтические композиции, содержащие непатогенные способные к прорастанию бактериальные споры, для предотвращения, контроля и лечения заболеваний, расстройств и состояний ЖКТ и поддержания общего здоровья в области пищеварения. Указанные композиции обладают полезными свойствами, поскольку подходят для безопасного введения человеку и другим субъектам-млекопитающим, а также эффективны при многочисленных желудочно-кишечных заболеваниях, расстройствах и состояниях и для поддержания общего здоровья в области пищеварения. Хотя композиции на основе спор известны, их обычно получают с применением других техник, таких как лиофилизация или высушивание распылением жидких бактериальных культур, что приводит к неудовлетворительной эффективности, нестабильности, существенной вариабельности и отсутствию адекватной безопасности.

[0161] Было обнаружено, что популяции бактериальных спор могут быть получены из биологических материалов, полученных от субъектов-млекопитающих, в том числе человека. Указанные популяции вводят в состав композиций согласно настоящему изобретению и вводят субъектам-млекопитающим с применением способов согласно описанию в настоящем документе.

[0162] Предложены терапевтические композиции, содержащие очищенную популяцию бактериальных спор. В настоящем документе термины «очищать», «очищенный» и «очищать» относятся к состоянию популяции (например, совокупности известной или неизвестной численности и/или концентрации) требуемых бактериальных спор, подвергнутых одному или нескольким процессам очищения, например, отбору или обогащению по требуемым бактериальным спорам, или, как вариант, к удалению или уменьшению количества остаточных продуктов среды обитания согласно описанию в настоящем документе. Согласно некоторым вариантам реализации в очищенной популяции отсутствует детектируемая нежелательная активность или, как вариант, уровень или количество нежелательной активности являются приемлемыми или ниже приемлемых уровня или количества. Согласно другим вариантам реализации очищенная популяция содержит приемлемое(ую) количество и/или концентрацию требуемых бактериальных спор или большее(ую) количество и/или концентрацию. Согласно другим вариантам реализации указанный очищенная популяция бактериальных спор обогащена относительно исходного материала (например, фекального материала), из которого получают указанную популяцию. Указанное обогащение может составлять 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999%, или более чем 99,9999% по сравнению с исходным материалом.

[0163] Согласно определенным вариантам реализации в указанных очищенных популяциях бактериальных спор наблюдаются пониженные или недетектируемые уровни одной или большего числа патогенных активностей, таких как токсичность, способность вызывать инфекцию у реципиента - субъекта-млекопитающего, нежелательная иммуномодулирующая активность, аутоиммунный ответ, метаболический ответ, или воспалительный ответ, или неврологическая реакция. Такое уменьшение патогенной активности может составлять 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%Г90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999%, или более чем на 99,9999% по сравнению с исходным материалом. Согласно другим вариантам реализации в очищенных популяциях бактериальных спор содержится меньше органолептических компонентов по сравнению с фекальным материалом, например, менее выраженный запах, вкус, внешний вид и умами.

[0164] Предложены очищенные популяции бактериальных спор, которые по существу не содержат остаточных продуктов среды обитания. Согласно определенным вариантам реализации это означает, что композиция с бактериальными спорами уже не содержит существенного количества биологического вещества, связанного с сообществом микроорганизмов, обитающих на организме или в организме субъекта-человека или животного, и очищенная популяция спор может быть на 100%, 99%, 98%, 97%, 96% или 95% очищена от каких-либо загрязнений биологическим веществом, связанным с указанным сообществом микроорганизмов. «По существу не содержащие остаточные продукты среды обитания» может также означать, что композиция с бактериальными спорами не содержит детектируемых клеток человека или животного, и что детектируются исключительно клетки микроорганизмов, в частности, детектируются только требуемые клетки микроорганизмов. Согласно другому варианту реализации это означает, что менее чем 1×10-2%, 1×10-3%, 1×10-4%, 1×10-5%, 1×10-6%, 1×10-7%, 1×10-8% клеток в бактериальной композиции принадлежат человеку или животному, а не микроорганизмам. Согласно другому варианту реализации количество остаточного продукта среды обитания, присутствующего в очищенной популяции, уменьшается по меньшей мере до определенного уровня относительно фекального материала, полученного от донора - субъекта-млекопитающего, например, уменьшается по меньшей мере приблизительно на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, 99,9999%, или более чем на 99,9999%.

[0165] Согласно одному варианту реализации «по существу не содержащие остаточных продуктов среды обитания» или «по существу не содержащие на детектируемом уровне патогенного материала» означает, что бактериальная композиция не содержит детектируемых вирусных загрязнений (в том числе бактериальных вирусов (т.е. фагов)), грибных, микоплазменных или токсоплазменных загрязнений, или эукариотических паразитов, таких как гельминты. Как вариант, очищенные популяции спор по существу не содержат бесклеточного материала, например, ДНК, материала вирусной оболочки, или нежизнеспособного бактериального материала.

[0166] Согласно описанию в настоящем документе очищение популяций спор может быть продемонстрировано с помощью генетического анализа (например, ПЦР, секвенирования ДНК), серологического и антигенного анализа, и способов с применением таких инструментов, как проточная цитометрия с реагентами для различения требуемых бактериальных спор и нежелательных загрязняющих материалов.

[0167] Примеры биологических материалов включают фекальные материалы, такие как кал, или материалы, выделенные из различных сегментов тонкого и толстого кишечника. Фекальные материалы получают от донора - субъекта-млекопитающего, или они могут быть получены от более чем одного субъекта-донора, например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, 1000 или от более чем 1000 доноров, при этом такие материалы затем объединяют до очищения требуемых бактериальных спор.

[0168] Согласно альтернативным вариантам реализации указанный требуемые бактериальные споры очищают из одного образца фекального материала, полученного от единственного донора, и после такого очищения комбинируют с очищенными популяциями спор, также полученными при очищении, либо от одного и того же донора в разные моменты времени, или от одного или нескольких разных доноров, или используют оба варианта.

[0169] Предпочтительные бактериальные роды включают Acetonema, Alkaliphilus, Alicyclobacillus, Amphibacillus, Ammonifex, Anaerobacter, Anaerofustis, Anaerostipes, Anaerotruncus, Anoxybacillus, Bacillus, Blautia, Brevibacillus, Bryantella, Caldicellulosiruptor, Caloramator, Candidatus, Carboxydibrachium, Carboxydothermus, Clostridium, Cohnella, Coprococcus, Dendrosporobacter Desulfitobacterium, Desulfosporosinus, Desulfotomaculum, Dorea, Eubacterium, Faecalibacterium, Filifactor, Geobacillus, Halobacteroides, Heliobacillus, Heliobacterium, Heliophilum, Heliorestis, Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceanobacillus, Orenia (S.), Oxalophagus, Oxobacter, Paenibacillus, Pelospora, Pelotomaculum, Propionispora, Roseburia, Ruminococcus, Sarcina, Sporobacterium, Sporohalobacter, Sporolactobacillus, Sporomusa, Sporosarcina, Sporotomaculum, Subdoligranulum, Symbiobacterium, Syntrophobotulus, Syntrophospora, Terribacillus, Thermoanaerobacter и Thermosinus.

[0170] Предпочтительные бактериальные виды представлены в таблице Х4. В тех случаях, когда приведены конкретные штаммы вида, специалисту в данной области техники будет понятно, что приведенный штамм может быть заменен на другие штаммы указанного вида.

[0171] Согласно некоторым вариантам реализации споробразующие бактерии идентифицируют по присутствию последовательностей нуклеиновых кислот, которые модулируют споруляцию. В частности, характерные для споруляции гены высококонсервативны у всех представителей дальнородственных родов, в том числе Clostridium и Bacillus. С применением традиционных подходов «прямой» генетики были идентифицированы многие, если не все, гены, критически важные для споруляции (spo). Программа развития споруляции частично управляется последовательным действием четырех компартмент-специфических сигма-факторов (наблюдаемых в следующем порядке: σF, σE, σG и σK), активность которых ограничена проспорой (σF и σG) или материнской клеткой (σE и σK).

[0172] Предложены популяции спор, содержащие более одного типа бактерий. В настоящем документе «тип» или более одного «типа» бактерий может различаться на уровне рода, вида, подвида, штамма или с применением любого другого таксономического метода, согласно описанию в настоящем документе и иными известными в данной области техники способами.

[0173] Согласно некоторым вариантам реализации все или по существу все бактериальные споры, присутствующие в очищенной популяции, получены из фекального материала, обработанного согласно описанию в настоящем документе или иным известным способом в данной области техники. Согласно альтернативным вариантам реализации одну или большее количество бактериальных спор или типов бактериальных спор получают в культуре и комбинируют для получения очищенной популяции спор. Согласно другим альтернативным вариантам реализации одну или большее количество указанных полученных в культуре популяций спор комбинируют с полученной из фекального материала популяцией спор для получения гибридной популяции спор. Бактериальные композиции могут содержать по меньшей мере два типа указанных предпочтительных бактерий, в том числе штаммы одного вида. Например, бактериальная композиция может содержать по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12. по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, или по меньшей мере 20 или более чем 20 типов бактерий, по оценке на основании видов или функциональных таксономических единиц (OTU), включающих такие виды.

[0174] Таким образом, предложены способы получения композиций, содержащих популяцию бактериальных спор, подходящую для терапевтического введения нуждающемуся в этом субъекту-млекопитающему. Указанную композицию получают, как правило, путем проведения этапов: (а) получения фекального материала от донора - субъекта-млекопитающего; и (b) проведения по меньшей мере одного варианта очищения или этапа очищения указанного фекального материала в таких условиях, чтобы получить из указанного фекального материала популяцию бактериальных спор. Состав с указанной композицией получают таким образом, что одна доза для перорального приема содержит по меньшей мере приблизительно 1×104 колониеобразующих единиц указанных бактериальных спор, и одна доза для перорального приема, как правило, содержит приблизительно 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012; 1×1013, 1×1014, 1×1015, или более чем на 1×1015 КОЕ указанных бактериальных спор. Присутствие и/или концентрация определенного типа бактериальных спор может быть известно или неизвестно для определенной очищенной популяции спор. Если известна, например, концентрация спор определенного штамма или совокупности всех штаммов, она составляет, например, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015 или более чем 1×1015 жизнеспособных бактериальных спор на грамм композиции или на введенную дозу.

[0175] В некоторых составах композиция содержит по меньшей мере приблизительно 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более чем 90% спор по массе. В некоторых составах введенная доза не превышает 200, 300, 400, 500, 600, 700, 800, 900 мг или 1; 1,1; 1,2; 1,3; 1,4; 1,5; 1,6; 1,7; 1,8; или 1,9 г по массе.

[0176] Бактериальные споровые композиции обычно вводят в составы для перорального или гастрального введения, как правило, субъекту-млекопитающему. Согласно конкретным вариантам реализации указанную композиция вводят в состав для перорального введения в виде твердой, полутвердой, гелевой или жидкой формы, например, в форме пилюли, таблетки, капсулы или пастилки. Согласно некоторым вариантам реализации такие составы содержат кишечнорастворимое покрытие или покрыты кишечнорастворимым покрытием для защиты бактерии при прохождении через желудок и тонкий кишечник, хотя споры обычно устойчивы в желудке и тонком кишечнике.

[0177] Бактериальные споровые композиции могут быть введены в состав, эффективный у определенного субъекта-млекопитающего при однократном введении или при многократном введении. Например, однократное введение по существу эффективно для уменьшения содержания токсина Cl. difficile и/или Cl. difficile у субъекта-млекопитающего, которому вводят указанную композицию. «По существу эффективный» означает, что содержание токсина Cl. difficile и/или Cl. difficile у субъекта уменьшается но меньшей мере на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% или более чем на 99% после введения указанной композиции.

СПОСОБЫ

Способы определения последовательностей 16S

[0178] OTU могут быть определены либо посредством полного 16S-секвенирования гена рРНК, секвенированием конкретной гипервариабельной области указанного гена (т.е. V1, V2, V3, V4, V5, V6, V7, V8 или V9), или посредством секвенирования любой комбинации гипервариабельных областей указанного гена (например, V1-3 или V3-5). Длина бактериальных 16S рРНК составляет приблизительно 1500 нуклеотидов, и их используют для реконструкции эволюционных взаимосвязей и сходства последовательностей между бактериальными изолятами с применением филогенетических методов. Последовательности 16S используют для филогенетической реконструкции, поскольку они обычно высококонсервативны, однако содержат специфические гипервариабельные области, содержащие достаточно разнообразные нуклеотиды для различения родов и видов большинства микроорганизмов.

[0179] Используя хорошо известные техники, для определения полной последовательности 16S или последовательности любой гипервариабельной области последовательности 16S, геномную ДНК экстрагируют из бактериального образца, 16S рРНК (полностью или специфические гипервариабельные области) амплифицировали с применением полимеразной цепной реакции (ПЦР), очищали продукты ПЦР и определяли нуклеотидные последовательности для определения генетического состава гена 16S или субдомена указанного гена. В том случае, если проводится полное 16S-секвенироние, используемый метод секвенирования может быть представлен, не ограничиваясь указанным, секвенированием по Сэнгеру. В том случае, если используется одна или большее количество гипервариабельных областей, таких как область V4, секвенирование может быть проведено, не ограничиваясь перечисленным, с применением метода Сэнгера или метода секвенирования нового поколения, например, метода от Illumina (секвенирование синтезом) с применением штрихкодированных праймеров, позволяющих проводить несколько реакций.

[0180] OTU могут быть определены по комбинации нуклеотидных маркеров или генов, в частности, высококонсервативных генов (например, генов «домашнего хозяйства») или их комбинации, полной последовательности генома или части последовательности генома, полученной с применением амплифицированных генетических продуктов, или последовательности всего генома (WGS). С применением хорошо известных способов специфические геномные области ДНК, экстрагированной из бактериального образца, амплифицируют с применением ПЦР и секвенируют для определения нуклеотидной последовательности амплифицированных продуктов. При секвенировании полного генома методом дробовика (WGS) экстрагированную ДНК прямо секвенируют без амплификации. Информация о последовательностях может быть получена с применением любой технологии секвенирования, включая, но не ограничиваясь перечисленными, метод Сэнгера, метод от Illumina, 454 Life Sciences, Ion Torrent, ABI, Pacific Biosciences и/или Oxford Nanopore.

Способы получения бактериальной композиции для введения субъекту

[0181] Способы получения бактериальных композиций могут включать три основных этапа обработки в сочетании с одним или несколькими этапами смешивания. Указанные этапы включают создания банков организмов, получения организмов и их сохранение.

[0182] Для получения банков штаммы, входящие в бактериальную композицию, могут (1) быть выделены прямо из образца или взяты из банкированного основного раствора, (2) необязательно культивироваться на питательном агаре или бульоне, который обеспечивает рост, для получения жизнеспособной биомассы, и (3) указанную биомассу необязательно сохраняют в виде нескольких аликвот для долгосрочного хранения.

[0183] Согласно вариантам реализации, в которых используется этап культивирования, агар или бульон могут содержать питательные вещества, обеспечивающие существенные элементы и специфические факторы, которые обеспечивают рост. Примером является среда, состоящая из 20 г/л глюкозы, 10 г/л дрожжевого экстракта, 10 г/л соевого пептона, 2 г/л лимонной кислоты, 1.5 г/л одноосновного фосфата натрия, 100 мг/л цитрата аммония железа, 80 мг/л сульфата магния, 10 мг/л геминхлорида, 2 мг/л хлорида кальция, 1 мг/л менадиона. Разнообразные микробиологические среды и варианты хорошо известны в данной области техники (например, R.M. Atlas, Handbook of Microbiological Media (2010) CRC Press). Среда может быть добавлена в культуру в начале, может быть во время культивирования или может протекать через культуру периодически/постоянно. Штаммы в бактериальной композиции могут культивироваться по отдельности, в виде подгруппы бактериальной композиции или как целая коллекция, содержащая указанную бактериальную композицию. Например, первый штамм может культивироваться вместо с вторым штаммом в смешанной непрерывной культуре, при скорости разведения ниже максимальной скорости роста любой клетки для предотвращения вымывания культуры из культуральной среды.

[0184] Инокулированную культуру инкубируют в благоприятных условиях на протяжении времени, достаточного для наращивания биомассы. В случае бактериальных композиций для применения у человека это часто соответствует температуре 37°С, pH, и другим показателям со значениями, сходными с нормальной нишей в организме человека. Среда может активность контролироваться, пассивно контролироваться (например, с помощью буферов), либо ей позволяют произвольно изменяться. Например, для анаэробных бактериальных композиций (например, микробиоты кишечника) может использоваться бескислородная/восстановительная среда. Это может достигаться путем добавления восстановительных агентов, таких как цистеин, в бульон, и/или удаление из него кислорода. Например, культура бактериальной композиции может культивироваться при 37°С, pH 7, в описанной выше среде, предварительно восстановленной 1 г/л цистеина HCl.

[0185] При достижении культурой достаточной биомассы, указанная культура может быть подвергнута предохраняющей обработке для банкирования. Указанные организмы могут быть помещены в химическую среду, защищающую их от замерзания (добавление 'криопротекторов'), высыхания ('лиопротекторы') и/или осмотического шока ('осмопротекторы), распределены по нескольким (необязательно идентичным) контейнерам для получения однородного банка, и затем культура может быть обработана для предохранения. Контейнеры обычно непроницаемы и снабжены механизмом закрытия, обеспечивающим изоляцию от окружающей среды. Криоконсервацию проводят путем замораживания жидкости при сверхнизких температурах (например, при -80°С или ниже). При консервации высушиванием воду из культуры удаляют путем испарения (в случае высушивания распылением или «холодной сушки») или сублимацией (например, при лиофилизации, лиофильной распылительной сушке). Удаление воды улучшает стабильность бактериальной композиции при долгосрочном хранении при температурах выше криогенных. Если бактериальная композиция содержит спорообразующие виды и обеспечивает образование спор, конечная композиция может быть очищена дополнительными способами, например, законсервирована центрифугированием в градиенте плотности с применением описанных выше техник. Банкирование бактериальной композиции может быть выполнено путем культивирования и консервации штаммов по отдельности, или путем смешивания штаммов друг с другом с получением комбинированного банка. В примере криоконсервации культура бактериальной композиции может быть собрана путем центрифугирования для осаждения клеток из культуральной среды, супернатант декантирован и заменен свежим культуральным бульоном, содержащим 15% глицерина. Затем аликвоты культуры могут быть помещены в криопробирки объемом 1 мл, запечатаны и помещены в среду с температурой -80°С для длительного сохранения жизнеспособности. Указанная процедура обеспечивает приемлемую жизнеспособность при восстановлении из замороженного состояния.

[0186] Получение организмов может проводиться с применением аналогичных банкированию этапов культивирования, в том числе в аналогичного состава среды и условий культивирования. Оно может проводиться в большем масштабе, в частности для клинических разработок или коммерческого производства. При больших масштабах может проводиться несколько субкультиваций бактериальной композиции перед итоговой культивацией. В конце культивации культуру собирают для дальнейшего включения в лекарственную форму для введения. Последнее может включать концентрацию, удаление нежелательных компонентов среды и/или введение в химическую среду, сохраняющую бактериальную композицию и придающую ей надлежащие качества для введения выбранным способом. Например, бактериальная композиция может культивироваться до концентрации 1010 КОЕ/мл, затем быть сконцентрирована 20-кратно с применением тангенциальной проточной микрофильтрации; отработанная среда может быть заменена диафильтрацией на консервирующую среду, состоящую из 2% желатина, 100 мМ трегалозы, и 10 мМ натрий-фосфатного буфера. Затем суспензия может быть лиофилизирована с получением порошка и титрована.

[0187] После высушивания порошок может быть перемолот до подходящей степени, смешан с другими культурами и/или наполнителем, таким как микрокристаллическая целлюлоза, для обеспечения структуры и удобства использования, и получен состав с бактериальной композицией согласно описанию в настоящем документе.

Введение бактериальных композиций.

[0188] Бактериальные композиции, предложенные в настоящем изобретении, подходят для введения нуждающимся в этом млекопитающим и не являющимся млекопитающими животным. Согласно определенным вариантам реализации указанный субъект-млекопитающее представляет собой субъекта-человека, у которого имеются один или большее количество симптомов дисбиоза, в том числе, но не ограничиваясь перечисленными, избыточный рост нежелательного патобионта или патогена, уменьшение представленности ключевых бактериальных таксонов, таких как Bacteroidetes или Firmicutes, или соответствующих им родов или видов, или уменьшение разнообразия видов микроорганизмов по сравнению со здоровым индивидуумом, или уменьшение общей распространенности анаэробных бактерий.

[0189] В том случае, если субъект-млекопитающее страдает заболеванием, расстройством или состоянием, характеризующимся аберрантной микробиотой, бактериальные композиции, описанные в настоящем документе, подходят для лечения указанного заболевания, расстройства или состояния. Согласно некоторым вариантам реализации указанный субъект-млекопитающее не получал антибиотики до лечения указанными бактериальными композициями. Например, указанному субъекту-млекопитающему не вводили по меньшей мере две дозы ванкомицина, метронидазола и/или аналогичного соединения с антибиотической активностью в течение одной недели перед введением указанной терапевтической композиции. Согласно другим вариантам реализации указанный субъект-млекопитающее ранее не получал соединение с антибиотической активностью в течение месяца перед введением указанной терапевтической композиции. Согласно другим вариантам реализации указанный субьект-млекопитающее получал один или большее количество вариантов лечения одним или несколькими разными соединениями с антибиотической активностью, и такое лечение не приводило к улучшению или приводило к ухудшению симптомов. Согласно некоторым вариантам реализации указанную композицию со спорами вводят после успешного курса антибиотиков для предотвращения дисбиоза и улучшения восстановления разнообразной нормальной микробиоты.

[0190] Согласно некоторым вариантам реализации указанное заболевание расстройство или состояние ЖКТ представляет собой диарею, вызываемую C. difficile, в том числе рецидивирующую инфекцию C. difficile, язвенный колит, колит, болезнь Крона или синдром раздраженного кишечника. Благоприятным образом, указанную терапевтическую композицию вводят всего один раз до улучшения состояния при заболевании, расстройстве или состоянии. Согласно некоторым вариантам реализации терапевтическую композицию вводят с интервалами более чем два дня, например, один раз каждые три, четыре, пять или шесть дней, или еженедельно, или реже, чем еженедельно. Состав также может вводиться периодически в соответствии с установленной схемой, например, один раз в сутки, еженедельно или один раз в месяц, или тогда, когда у субъекта происходит рецидив первичной болезни. Согласно другому варианту реализации указанный состав может вводиться на долговременной основе индивидуумам, у которых имеется риск инфекции указанными патогенами, или индивидуумам, которые могут быть носителями указанных патогенов, в том числе индивидуумам, у которых будет проведена инвазивная медицинская процедура (такая как хирургическое вмешательство), подлежащим госпитализации, живущим в учреждении для долгосрочной медицинской помощи или реабилитации, контактирующим с патогенами по роду профессиональной деятельности (индивидуумы, работа которых связана с сельскохозяйственными животными и переработкой животных продуктов) или потенциальным носителям патогенов (в том числе работникам больниц, таким как врачи, медицинские сестры и другие медицинские специалисты).

[0191] Также предложены способы лечения или профилактики у субъекта-млекопитающего, страдающего заболеванием, расстройством или состоянием обмена веществ, или имеющего риск развития заболевания, расстройства или состояния обмена веществ, выбранного из группы, состоящей из диабета, метаболического синдрома, ожирения, заболевания сердца, аутоиммунного заболевания, заболевания печени и аутизма с применением терапевтических композиций, описанных в настоящем документе.

[0192] Согласно вариантам реализации композицию с бактериальными спорами вводят энтерально. Это преимущественно включает пероральное введение или введение через оральный или назальный зонд (в том числе назогастральный, назоеюнальный, орогастральный или ороеюнальный). Согласно другим вариантам реализации введение включает ректальное введение (в том числе с применением клизмы, суппозитория или колоноскопии). Бактериальная композиция может вводиться по меньшей мере в одну область желудочно-кишечного тракта, в том числе рот, пищевод, желудок, тонкий кишечник, толстый кишечник и прямую кишку. Согласно некоторым вариантам реализации ее вводят во все области желудочно-кишечного тракта. Бактериальные композиции могут вводиться перорально в форме медикаментов, таких как порошки, капсулы, таблетки, гели или жидкости. Бактериальные композиции могут также вводиться в гелевой или жидкой форме перорально или через назогастральный зонд, или ректально в гелевой или жидкой форме, через клизму или путем инстилляции через колоноскоп, или в виде суппозитория.

[0193] Если композицию вводят колоноскопически и, необязательно, если бактериальную композицию вводят ректально иным способом (например, с применением клизмы или суппозитория) или субъект может получать состав для очищения толстой кишки даже если у указанного субъекта используется пероральное введение. Состав для очищения толстой кишки может облегчать надлежащее использование колоноскопа или другого устройства для введения, однако даже если он не выполняет механическую функцию, он может максимизировать долю бактериальной композиции относительно других организмов, ранее присутствовавших в желудочно-кишечном тракте указанного субъекта. Может быть использован любой легкодоступный состав для очищения толстой кишки, например, состав, обычно используемый при проведении у субъекта колоноскопии.

[0194] Для оценки субъекта симптомы дисбиоза оценивают после лечения в диапазоне времени от 1 дня до 6 месяцев после введения очищенной популяции спор. В течение указанного периода собирают фекальный материал, и микроорганизмы, присутствующие в желудочно-кишечном тракте, могут быть проанализированы с помощью анализа секвенирования 16S рРНК или метагеномного секвенирования или других анализов, общеупотребительных среди специалистов. В указанный период времени наблюдается восстановление популяции видов, происходящих из популяции спор, а также стимуляция комменсальных микроорганизмов, не присутствующих в популяции спор, поскольку популяция спор катализирует восстановление состояния экогруппы пищеварительного тракта, соответствующее здоровому биозу. Наилучшим образом понять приведенное описание можно в свете информации из цитируемых в описании источников. Представленные в описании варианты реализации иллюстрируют варианты реализации и не предназначены для ограничения объема. Для специалиста будет ясно, что включены многие другие варианты реализации. Все публикации и патент, цитируемые в настоящем описании, полностью включены посредством ссылки. В тех случаях, когда включенный посредством ссылки материал противоречит или не согласуется с настоящим описанием, настоящее описание имеет преимущественную силу относительно любого такого материала. Цитирование каких-либо источников не означает, что такие источники представляют предшествующий уровень техники.

Способы лечения субъекта

[0195] Согласно некоторым вариантам реализации раскрытые в настоящем изобретении композиции вводят пациенту или потребителю (иногда называемому общим термином «субъект»). В настоящем документе «вводить» и «введение» охватывает варианты реализации, в которых один индивидуум направляет другого с целью потребления последним бактериальной композиции определенным образом и/или для определенной цели, а также ситуации, в которых потребитель использует бактериальную композицию определенным образом и/или для определенной цели независимо или противоречащим каким-либо полученным от второго индивидуума инструкциям образом. Неограничивающие примеры вариантов реализации, согласно которым один индивидуум направляет другого с целью потребления последним бактериальной композиции определенным образом и/или для определенной цели, включают варианты, когда лечащий врач прописывает курс действий и/или лечения пациенту, когда родитель руководит потреблением бактериальной композиции несовершеннолетним потребителем (например, ребенком), когда тренер рекомендует потребителю (например, спортсмену) конкретный курс действий и/или лечения, и когда производитель, распространитель или поставщик рекомендует условия применения конечному потребителю, например, с использованием рекламы или этикетки на упаковке или на других материалах, предлагаемых вместе с продаваемым или поставляемым на рынок продуктом.

[0196] Указанные бактериальные композиции обеспечивают защитный и/или терапевтический эффект от инфекции одним или большим количеством представляющих интерес патогенов ЖКТ и могут вводиться после окончания эпизода острой инфекции для предотвращения рецидива, во время эпизода острой инфекции в качестве дополнения к терапии антибиотиками, если бактериальная композиция не чувствительная к тем же антибиотикам, что и патоген ЖКТ, или для предотвращения инфекции или уменьшения передачи от носителей заболевания.

[0197] Предлагаемые бактериальные композиции могут подходить для применения в разнообразных клинических ситуациях. Например, указанные бактериальные композиции могут вводиться в качестве дополнительного лечения вместе с антибиотиками, если пациент страдает острой инфекцией, для снижения риска рецидива после ослабления острой инфекции или в том случае, когда пациент находится в непосредственной близости от других индивидуумов, у которых имеются серьезные желудочно-кишечные инфекции или риск их развития (врачи, медицинские сестры, работники больниц, члены семей больных или госпитализированных субъектов).

[0198] Предлагаемые бактериальные композиции могут вводиться животным, в том числе человеку, лабораторным животным (например, приматам, крысам, мышам), сельскохозяйственным животным (например, коровам, овцам, козам, свиньям, индейкам, курам) и домашним животным (например, собакам, кошкам, грызунам).

[0199] Согласно предложенному способу бактериальная композиция может вводиться энтерально, другими словами, с доступом в желудочно-кишечный тракт. Это включает пероральное введение, ректальное введение (в том числе через клизму, в виде суппозитория или с применением колоноскопии), введение через оральный или назальный зонд (назогастральный, назоеюнальный, орогастральный, или ороеюнальный), как более подробно изложено в настоящем документе.

Протоколы предварительной обработки

[0200] Перед введением бактериальной композиции необязательно проводят предварительную обработку пациента согласно протоколу для подготовки желудочно-кишечного тракта к получению бактериальной композиции. Указанный протокол предварительной обработки целесообразен при определенных вариантах реализации, например, если у пациента имеется острая инфекция высокоустойчивым патогеном. Согласно другим вариантам реализации указанный протокол предварительной обработки является полностью необязательным, например, если патоген, вызывающий инфекцию, не является устойчивым, или в тех случаях, когда у указанного пациента имелась острая инфекция, которая была успешно излечена, однако лечащий врач опасается, что инфекция может рецидивировать. В таких случаях протокол предварительной обработки может повысить способность бактериальной композиции оказывать воздействие на микробном пациента.

[0201] Одним из способов подготовки пациента к введению экосистемы микроорганизмов может быть введение по меньшей мере одного антибиотика для изменения состава бактерий у пациента. Другим способом подготовки пациента к введению экосистемы микроорганизмов может быть введение указанному пациенту состава для очищения толстой кишки для опустошения толстой кишки по существу, например, состава, используемого при подготовке пациентов к колоноскопии. Под «опустошением толстой кишки по существу» в настоящей заявке подразумевается удаление по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95% или приблизительно 100% содержимого обычного объема толстой кишки. Лечение антибиотиками может предшествовать осуществлению протокола очищения толстой кишки.

[0202] В том случае, если пациент получал антибиотик для лечения инфекции, или если пациент получал антибиотик в ходе осуществления конкретного протокола предварительной обработки, согласно одному варианту реализации введение указанного антибиотика может быть заблаговременно прекращено, чтобы обеспечить снижение в кишечнике концентрации антибиотика по существу до введения бактериальной композиции. Согласно одному варианту реализации введение антибиотика может быть прекращено за 1, 2 или 3 дня до введения бактериальной композиции. Согласно другому варианту реализации введение антибиотика может быть прекращено за 3, 4, 5, 6 или 7 периодов полу жизни указанного антибиотика до введения бактериальной композиции. Согласно другому варианту реализации антибиотик может быть выбран таким образом, что компоненты бактериальной композиции имеют MIC50, превышающую концентрацию указанного антибиотика в кишечнике.

[0203] MIC50 бактериальной композиции или элементов указанной композиции может быть определена с применением способов, хорошо известных в данной области техники. Reller et al., Antimicrobial Susceptibility Testing: A Review of General Principles and Contemporary Practices, Clinical Infectious Diseases 49(11):1749-1755 (2009). Согласно такому варианту реализации дополнительный период времени между введением антибиотика и введением бактериальной композиции не является необходимым. Если в лечение острой инфекции включен протокол предварительной обработки, антибиотик может быть подобран так, что указанная инфекция будет чувствительна к указанному антибиотику, а компоненты бактериальной композиции будут нечувствительны к указанному антибиотику.

Способы введения

[0204] Бактериальные композиции, предложенные в настоящем изобретении, подходят для введения нуждающемуся в этом млекопитающим и не являющимся млекопитающими животным. Согласно определенным вариантам реализации указанный субъект-млекопитающее представляет собой субъекта-человека, у которого присутствуют один или большее количество симптомов дисбиоза.

[0205] Если субъект-млекопитающее страдает заболеванием, расстройством или состоянием, характеризующимся аберрантной микробиотой, для его лечения подходят бактериальные композиции, описанные в настоящем документе. Согласно некоторым вариантам реализации указанный субъект-млекопитающее не получал антибиотики до лечения бактериальными композициями. Например, указанному субъекту-млекопитающему не вводили по меньшей мере две дозы ванкомицина, метронидазола и/или аналогичного соединения с антибиотической активностью в течение одной недели перед введением указанной терапевтической композиции. Согласно другим вариантам реализации указанный субъект-млекопитающее ранее не получал соединения с антибиотической активностью в течение месяца перед введением указанной терапевтической композиции. Согласно другим вариантам реализации проводили лечение указанного субъекта-млекопитающего один или большее количество раз одним или несколькими разными соединениями с антибиотической активностью, и такое лечение не привело к улучшению или привело к ухудшению симптомов.

[0206] Согласно некоторым вариантам реализации указанное заболевание, расстройство или состояние ЖКТ представляет собой диарею, вызванную С. difficile, в том числе рецидивирующей инфекцией С. difficile, язвенный колит, колит, болезнь Крона или синдром раздраженного кишечника. Благоприятным образом, терапевтическую композицию вводят только один раз до улучшения состояния при указанном заболевании, расстройстве или состоянии. Согласно некоторым вариантам реализации терапевтическую композицию вводят с интервалами более чем два дня, например, один раз в три, четыре, пять или шесть дней, каждую неделю или реже, чем еженедельно. Согласно другим вариантам реализации указанный состав может вводиться периодически в соответствии с заданной схемой, например, один раз в сутки, один раз в неделю или один раз в месяц, или тогда, когда у субъекта происходит рецидив первичного заболевания. Согласно другому варианту реализации указанный состав может вводиться на долгосрочной основе субъектам, у которых имеется риск инфекции указанными патогенами или субъектам, которые могут являться носителями указанных патогенов, в том числе субъектам, у которых будет проведена инвазивная медицинская процедура (такая как хирургическое вмешательство), подлежащим госпитализации, живущим в учреждении для долгосрочной медицинской помощи или реабилитации, контактирующим с патогенами по роду профессиональной деятельности (субъекты, работа которых связана с сельскохозяйственными животными и переработкой животных продуктов), или потенциальным носителям патогенов (в том числе работникам больниц, таким как врачи, медицинские сестры и другие медицинские специалисты).

[0207] Согласно определенным вариантам реализации указанную бактериальную композицию вводят энтерально. Это преимущественно включает пероральное введение, или введение через оральный или назальный зонд (в том числе назогастральный, назоеюнальный, орогастральный или ороеюнальный). Согласно другим вариантам реализации введение включает ректальное введение (в том числе клизму, суппозитории или колоноскопию). Бактериальная композиция может вводиться по меньшей мере в одну область желудочно-кишечного тракта, в том числе в рот, пищевод, желудок, тонкий кишечник, толстый кишечник и прямую кишку. Согласно некоторым вариантам реализации ее вводят во все области желудочно-кишечного тракта. Бактериальные композиции могут вводиться перорально в форме таких медикаментов, как порошки, капсулы, таблетки, гели или жидкости. Бактериальные композиции могут также вводиться в гелевой или жидкой форме перорально или через назогастральный зонд, или ректально в гелевой или жидкой форме, с помощью клизмы, или путем инстилляции через колоноскоп, или в форме суппозитория.

[0208] Если композицию вводят колоноскопически и, необязательно, если бактериальную композицию вводят ректально иным способом (например, с применением клизмы или суппозитория) или даже если у субъекта используется пероральное введение, указанный субъект может получать состав для очищения толстой кишки. Состав для очищения толстой кишки может облегчать надлежащее использование колоноскопа или других устройств для введения, но даже если он не выполняет механическую функцию, он может максимизировать долю бактериальной композиции относительно других организмов, ранее присутствовавших в желудочно-кишечном тракте указанного субъекта. Может быть использован любой легкодоступный состав для очищения толстой кишки, например, составы, обычно используемые у субъекта при колоноскопии.

Дозировки и схема введения

[0209] Согласно некоторым вариантам реализации предложены бактерии и бактериальные композиции в дозированной лекарственной форме. Согласно определенным вариантам реализации указанная лекарственная форма предназначена для введения по меньшей мере одной OTU или их комбинации, раскрытых в настоящем изобретении, при этом указанное общее количество введенной бактериальной композиции выбирают из 0,1 нг - 10 г, 10 нг - 1 г, 100 нг - 0,1 г, 0,1-500 мг, 1-100 мг или 10-15 мг. Согласно другим вариантам реализации указанная бактериальная композиция потребляется со скоростью от 0,1 нг до 10 г в день, от 10 нг до 1 г в день, 100 нг до 0,3 г в день, 0,1 мг - 500 мг в день, 1-100 мг в день, или 10-15 мг в день, или более.

[0210] Согласно определенным вариантам реализации период лечения составляет по меньшей мере 1 день, по меньшей мере 2 дней, по меньшей мере 3 дня, по меньшей мере 4 дня, по меньшей мере 5 дней, по меньшей мере 6 дней, по меньшей мере 1 неделю, по меньшей мере 2 недели, по меньшей мере 3 недели, по меньшей мере 4 недели, по меньшей мере 1 месяц, по меньшей мере 2 месяца, по меньшей мере 3 месяца, по меньшей мере 4 месяца, по меньшей мере 5 месяцев, по меньшей мере 6 месяцев или по меньшей мере 1 год. Согласно некоторым вариантам реализации период лечения составляет от 1 дня до 1 недели, от 1 недели до 4 недель, от 1 месяца до 3 месяцев, от 3 месяцев до 6 месяцев, от 6 месяцев до 1 года, или более года.

[0211] Согласно одному варианту реализации пациенту в виде определенной лекарственной формы может вводиться общее количество микроорганизмов 105 и 1012. Согласно другому варианту реализации эффективное количество может обеспечиваться в виде 1-500 мл или 1-500 г бактериальной композиции, содержащей от 107 до 1011 бактерий на мл или на грамм, или в виде капсулы, таблетки или суппозитория, содержащей(его) от 1 мг до 1000 мг лиофилизированного порошка, содержащего от 107 до 1011 бактерий. Получающим острое лечение пациентам могут вводиться более высокие дозы по сравнению с получающими хроническое лечение (например, работниками больниц или пациентами учреждений долгосрочной медицинской помощи).

[0212] Любые составы, описанные в настоящем документе, могут вводиться в виде одной дозы однократно или многократно, например, один раз в сутки на протяжении нескольких дней, или более чем один раз в сутки в день введения (в том числе дважды а сутки, трижды в сутки, или до пяти раз в сутки). Согласно другому варианту реализации указанный состав может вводиться периодически в соответствии с принятой схемой, например, один раз еженедельно, один раз в месяц, или тогда, когда у субъекта происходит рецидив первичного заболевания. Согласно одному варианту реализации указанный состав может вводиться на долгосрочной основе индивидуумам, у которых имеется риск инфекции указанными патогенами или индивидуумам, которые могут являться носителями указанных патогенов, в том числе индивидуумам, у которых будет проведена инвазивная медицинская процедура (такая как хирургическое вмешательство), подлежащим госпитализации, живущим в учреждении для долгосрочной медицинской помощи или реабилитации, индивидуумам, контактирующим с патогенами по роду профессиональной деятельности (индивидуумам, работа которых связана с сельскохозяйственными животными и переработкой животных продуктов), или потенциальным носителям патогенов (в том числе работникам больниц, таким как врачи, медицинские сестры и другие медицинские специалисты).

Выбор пациентов

[0213] Конкретные бактериальные композиции могут быть выбраны для индивидуальных пациентов или для пациентов с конкретными профилями. Например, у определенного пациента может быть проведено 16S-секвенирование для идентификации бактерий, присутствующих в его/ее микробиоте. Указанное секвенирование может либо обеспечивать профилирование полного микробиома пациента с применением 16S-секвенирования (до уровня семейства, рода или вида), части микробиома пациента с применением 16S-секвенирования, или может использоваться для детекции присутствия или отсутствия специфических кандидатных бактерий, которые являются биомаркерами здоровья или конкретного болезненного состояния, например, маркерами обладающих множественной лекарственной устойчивостью организмов или конкретных представляющих интерес родов, таких как Escherichia. На основании информации о биомаркерах может быть выбрана конкретные композиция для введения пациенту для расширения или дополнения микробиоты пациента, для восстановления здоровья, или лечения или предотвращения заболевания. Согласно другому варианту реализации может проводиться скрининг пациентов для определения состава их микробиоты для определения вероятности успешного лечения.

Комбинированная терапия

[0214] Бактериальные композиции могут вводиться с другими агентами в режиме комбинированной терапии, в том числе с противомикробными агентами и пребиотиками. Введение может быть последовательным, на протяжении периода нескольких часов или дней, или одновременным.

[0215] Согласно одному варианту реализации бактериальные композиции включают в комбинированную терапию одним или несколькими противомикробными агентами, которые включают антибактериальные агенты, фунгицидные агенты, противовирусные агенты и противопаразитарные агенты.

[0216] Антибактериальные агенты могут включать цефалоспориновые антибиотики (цефалексин, цефуроксим, цефадроксил, цефазолин, цефалотин, цефаклор, цефамандол, цефокситин, цефпрозил и цефтобипрол); фторхинолоновые антибиотики (ципро, левакин, флоксин, текин, авелокс и норфлокс); тетрациклиновые антибиотики (тетрациклин, миноциклин, окситетрациклин и доксициклин); пенициллиновые антибиотики (амоксициллин, ампициллин, пенициллин V, диклоксациллин, карбенициллин, ванкомицин и метициллин); и карбапенемовые антибиотики (эртапенем, дорипенем, имипенем/циластатин и меропенем).

[0217] Противовирусные агенты могут включать абакавир, ацикловир, адефовир, ампренавир, атазанавир, цидофовир, дарунавир, делавирдин, диданозин, докозанол, эфавиренц, элвитегравир, эмтрицитабин, энфувиртид, этравирин, фамцикловир, фоскарнет, фомивирсен, ганцикловир, индинавир, идоксуридин, ламивудин, лопинавир, маравирок, MK-2048, нелфинавир, невирапин, пенцикловир, ралтегравир, рилпивирин, ритонавир, саквинавир, ставудин, тенофовир, трифлуридин, валацикловир, валганцикловир, видарабин, ибацитабин, амантадин, озелтамивир, римантадич, типранавир, зальцитабин, занамивир и зидовудин.

[0218] Примеры фунгицидных соединений включают, не ограничиваясь перечисленными, полиеновые фунгицидные средства, такие как натамицин, римоцидин, филипин, нистатин, амфотерицин, кандицин и хамицин; имидазольные фунгицидные средства, такие как миконазол, кетоконазол, клотримазол, эконазол, омоконазол, бифоназол, бутоконазол, фентиконазол, изоконазол, оксиконазол, сертаконазол, сульконазол и тиоконазол; триазольные фунгицидные средства, такие как флуконазол, итраконазол, изавуконазол, равуконазол, позаконазол, вориконазол, терконазол и альбаконазол; тиазольные фунгицидные средства, такие как абафунгин; аллиламиновые фунгицидные средства, такие как тербинафин, нафтифин и бутенафин; и эхинокандиновые фунгицидные средства, такие как анидулафунгин, каспофунгин и микафунгин. Другие соединения, обладающие фунгицидными свойствами, включают, не ограничиваясь перечисленными, полигодиал, бензойную кислоту, циклопирокс, толнафтат, ундециленовую кислоту, флуцитозин или 5-фторцитозин, гризеофульвин и галопрогин.

[0219] Согласно одному варианту реализации бактериальные композиции включены в комбинированную терапию с одним или несколькими кортикостероидами, месалазином, месаламином, сульфасалазином, производными сульфасалазина, иммуносупрессивными лекарственньши средствами, циклоспорином А, меркаптопурином, преднизолоном, азатиопурином, метотрексатом, антигистаминными средствами, глюкокортикоидами, адреналином, теофиллином, кромолином натрия, антилейкотриенами, антихолинергическими лекарственньши средствами для лечения ринитов, антихолинергическими противоотечными средствами, стабилизаторами тучных клеток, вакцинами с моноклональными антителами против IgE и их комбинациями.

[0220] Пребиотик представляет собой избирательно ферментируемый ингредиент, обеспечивающий специфические изменения и состава, и/или активности микробиоты ЖКТ, благоприятные для самочувствия и состояния здоровья хозяина. Пребиотики могут включать сложные углеводы, аминокислоты, пептиды или другие необходимые питательные компоненты для выживания бактериальной композиции. Пребиотики включают, не ограничиваясь перечисленными, аминокислоты, биотин, фруктоолигосахариды, галактоолигосахариды, инулин, лактулозу, маннановые олигосахариды, обогащенный олигофруктозой инулин, олигофруктозу, олигодекстрозу, тагатозу, транс-галактоолигосахарид и ксилоолигосахариды.

Способы тестирования способности бактериальных композиций к заселению

Анализ in vivo для оценки заселения желудочно-кишечного тракта субъекта бактериальной композицией

[0221] Для определения того, заселяет ли бактериальная композиция желудочно-кишечного тракт субъекта, может использоваться модель на животных, например, модель на мышах. Реализация модели может начинаться с оценки микробиоты мышей. Качественную оценку можно получить с применением 16S-профилирования сообщества микроорганизмов в экскрементах здоровых мышей. С этой целью может также использоваться полногеномное секвенирование, полногеномное секвенирование методом «дробовика» (WGS) или традиционные микробиологические техники. Количественную оценку можно получить с применением количественной ПЦР (кПЦР), описанной ниже, или с применением традиционных микробиологических техник и подсчета образующихся колоний.

[0222] Мыши необязательно могут получать лечение антибиотиками для имитации состояния дисбиоза. Лечение антибиотиками может снижать таксономическое изобилие, разнообразие и равномерность распределения сообщества, в том числе снижение распространенности значительного числа бактериальных таксонов. Dethlefsen et al., The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing, PLoS Biology 6(11):3280 (2008). По меньшей мере один антибиотик может использоваться, и антибиотики хорошо известны. Антибиотики могут включать аминогликозидный антибиотик (амикацин, арбекацин, гентамицин, канамицин, неомицин, нетилмицин, паромомицин, родострептомицин, стрептомицин, тобрамицин и апрамицин), амоксициллин, ампициллин, аугментин (комбинация амоксициллина/клавуланата калия), цефалоспорин (цефаклор, цефадроксил, цефазолин, цефиксим, цефокситин, цефпрозил, цефтазидим, цефуроксим, цефалексин), клавуланат калия, клиндамицин, колистин, гентамицин, канамицин, метронидазол или ванкомицин. В качестве индивидуального неограничивающего конкретного примера, мышам может предоставляться питьевая вода, содержащая смесь антибиотиков канамицина, колистина, гентамицина, метронидазола и ванкомицина в концентрации 40 мг/кг, 4,2 мг/кг, 3,5 мг/кг, 21,5 мг/кг и 4,5 мг/кг (мг на среднюю массу тела мыши), соответственно, в течение 7 дней. Как вариант, мышам может вводиться ципрофлоксацин в дозе 15-20 мг/кг (мг на среднюю массу тела мыши) в течение 7 дней.

В том случае, если мыши получают антибиотик, может выдерживаться «отмывочный период» продолжительностью от одного дня до трех дней, без лечения антибиотиками и без лечения бактериальной композицией.

[0223] Затем тестируемую бактериальную композицию вводят мышам через оральный зонд. Тестируемая бактериальная композиция может вводиться в объеме 0,2 мл, содержащем 104 КОЕ бактерий каждого типа, входящего в бактериальную композицию. Зависимость доза-ответ может оцениваться с использованием диапазона доз, в том числе, но не ограничиваясь перечисленными, 102, 103, 104, 105, 106, 107, 108, 109 и/или 1010.

[0224] Может проводиться исследование мышей с применением 16S-секвенирования, полногеномного секвенирования, полногеномного секвенирования методом «дробовика» (WGS) или традиционных микробиологических техник для определения того, заселяет ли тестируемая бактериальная композиция желудочно-кишечный тракт мышей. Например, через день, через три дня, через неделю, через две недели и через один месяц после введения бактериальной композиции мышам, проводят 16S-профилирование для определения того, заселила ли тестируемая бактериальная композиция желудочно-кишечный тракт мышей. Дополнительно или в альтернативных вариантах в те же периоды времени может проводиться количественный анализ, в том числе с применением кПЦР и традиционных микробиологических техник, таких как подсчет колоний.

[0225] Кроме того, может оцениваться зависимость числа секвенированных последовательностей, точно соответствующих последовательностям бактериальной композиции, от времени, для определения того, какие конкретно компоненты бактериальной композиции остаются в желудочно-кишечном тракте через конкретный период времени. Согласно одному варианту реализации штаммы бактериальной композиции сохраняются на протяжении требуемого периода времени. Согласно другому варианту реализации указанный компоненты бактериальной композиции сохраняются на протяжении требуемого периода времени, в то же время повышая способность других микроорганизмов (например, присутствующих в окружающей среде, пище и т.п.) заселять желудочно-кишечный тракт, что дополнительно увеличивает общее разнообразие, согласно описанию ниже.

Способность бактериальных композиций заселять различные области желудочно-кишечного тракта

[0226] Также может оцениваться способность предложенных бактериальных композиций заселять различные области желудочно-кишечного тракта. Согласно одному варианту реализации бактериальная композиция может быть выбрана исходя из способности заселять одну или более чем одну область желудочно-кишечного тракта, в том числе, но не ограничиваясь перечисленными, желудок, тонкий кишечник (двенадцатиперстная кишка, тощая кишка и подвздошная кишка), толстый кишечник (слепая кишка, ободочная кишка (восходящая кишка, поперечноободочная кишка, нисходящая кишка и сигмовидная кишка) и прямая кишка).

[0227] Может проводиться исследование in vivo для определения того, какие области желудочно-кишечного тракта заселяет определенная бактериальная композиция. Может использоваться модель на мышах, аналогичная вышеописанной, за исключением того, что вместо анализа экскрементов, продуцируемых мышами, могут быть извлечены и исследованы по отдельности конкретные области желудочно-кишечного тракта. Например, может быть извлечена по меньшей мере одна конкретная область желудочно-кишечного тракта, и может быть проведено качественное или количественное определение содержимого указанной области желудочно-кишечного тракта. Согласно другому варианту реализации необязательно может быть извлечено указанное содержимое, и может проводиться качественное или количественное определение извлеченных тканей мыши.

кПЦР

[0228] Одним из количественных методов для определения того, заселяет ли бактериальная композиция желудочно-кишечный тракт, может быть количественная ПЦР (кПЦР). Могут использоваться стандартные техники получения стандартной кривой для представляющей интерес бактериальной композиции, для всех компонентов бактериальной композиции совместно, либо индивидуально, либо для подгрупп (если это применимо). Геномная ДНК может быть экстрагирована из образцов с применением коммерчески доступных наборов, таких как набор для выделения ДНК Мо Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния), набор для выделения ДНК Мо Bio Powersoil® DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния) или мининабор для выделения ДНК из кала QIAamp DNA Stool Mini Kit (QIAGEN, Валенсия, Калифорния) в соответствии с инструкциями производителя.

[0229] Согласно некоторым вариантам реализации кПЦР может проводиться с применением HotMasterMix (5PRIME, Гейтерсберг, Мэриленд) и праймероа, специфических в отношении представляющей интерес бактериальной композиции, и может проводиться на 96-луночном штрихкодированном реакционном планшете MicroAmp® (MicroAmp®Fast Optical 96-well Reaction Plate with Barcode) (0,1 мл) (Life Technologies, Гранд-Айленд, Нью-Йорк) и выполняться на термоциклере BioRad C1000™, оснащенном системой реального времени CFX96™ (BioRad, Геркулес, Калифорния), с регистрацией флуоресценции в каналах FAM и ROX. Значение Cq для каждой лунки в канале FAM определяют с помощью программного обеспечения CFX Manager™, версия 2.1. log10(KOE/мл) для каждого экспериментального образца рассчитывают подстановкой значений Cq для определенного образца в установленную по стандартной кривой линейную регрессионную модель, сравнивающую значения Cq для лунок, использованных для построения стандартной кривой, с известной log10(KOE/мл) для указанных образцов. Специалист может использовать и другие альтернативные режимы кПЦР.

Способы характеризации бактериальных композиций

[0230] Согласно определенным вариантам реализации предложены способы тестирования определенных характеристик бактериальных композиций. Например, определяют чувствительность бактериальных композиций к определенным параметрам окружающей среды, например, для отбора конкретных желательных характеристик для определенной композиции, состава и/или использования. Например, компоненты бактериальной композиции могут тестироваться на pH-устойчивость, устойчивость к желчным кислотам и/или чувствительность к антибиотикам, либо индивидуально, то есть поочередно тестируется чувствительность каждого компонента, либо совместно, поскольку бактериальная композиция содержит несколько бактериальных компонентов (совместно называемых в данном разделе бактериальной композицией).

Тестирование на pH-чувствительность

[0231] Если предполагается введение бактериальной композиции не через толстую или прямую кишку (т.е., например, перорально), необязательное тестирование на pH-устойчивость улучшает качество отбора бактериальных композиций с максимальной выживаемостью в условиях варьирующих значений pH различных областей ЖКТ. Понимание того, как бактериальные композиции реагируют на значения pH в ЖКТ, также помогает при приготовлении составов, то есть количество бактерий в лекарственной форме может быть увеличено, если это целесообразно, и/или композиция может вводиться в покрытой кишечнорастворимым покрытием капсуле или таблетке, либо с буферной или защитной композицией. Поскольку значения pH в желудке могут на непродолжительное время опускаться до pH 1-2 после приема богатой белком пищи и до того, как физиологические механизмы обеспечат коррекцию до pH 3-4, а в состоянии покоя значения pH часто составляют pH 4-5, а значения pH в тонком кишечнике могут варьировать от pH 6 до 7,4, могут быть получены бактериальные композиции, выживающие в указанных варьирующих диапазонах значений pH (в частности, отличающиеся тем, что по меньшей мере 1%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или до 100% бактерий способны выживать в течение времени прохождения по ЖКТ в различных диапазонах значений pH). Эта способность может быть протестирована путем воздействия на бактериальную композицию значений pH в варьирующих диапазонах, на протяжении ожидаемого времени прохождения через ЖКТ при значениях pH в указанных диапазонах. Соответственно, согласно неограничивающему примеру, культуры бактериальных композиций возрастом 18 часов могут культивироваться на стандартной среде, например, среде для кишечной микробиоты («GMM», см. Goodman et al., Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice, PNAS 108(15):6252-6257 (2011)) или другой не содержащей продуктов животного происхождения среде, с добавлением корректирующих pH агентов для обеспечения значений pH 1-2 на протяжении 30 минут, pH 3-4 на протяжении 1 часа, pH 4-5 на протяжении 1-2 часов и pH 6-7,4 на протяжении 2,5-3 часов. Альтернативный способ тестирования устойчивости к кислотам описан в патенте США №4839281. Выживаемость бактерий может быть определена путем культивирования указанных бактерий и подсчета колоний на подходящих селективных или неселективных средах.

Тестирование на чувствительность к желчным кислотам

[0232] Дополнительно, согласно некоторым вариантам реализации тестирование на чувствительность к желчным кислотам улучшает качество отбора бактериальных композиций, выживающих при воздействии желчной кислоты при прохождении через ЖКТ. Желчные кислоты секретируются в тонкий кишечник и могут, как и значения pH, влиять на выживаемость бактериальных композиций. Указанная способность может быть протестирована путем воздействия на бактериальные композиции желчными кислотами на протяжении ожидаемого времени воздействия желчных кислот в ЖКТ. Например, могут быть получены растворы желчных кислот в нужных концентрациях с применением 0,05 мМ Tris при pH 9 в качестве растворителя. После растворения желчной кислоты pH раствора может быть доведен до значения 7,2 добавлением 10% HCl. Бактериальные композиции могут культивироваться в 2,2 мл состава с желчными кислотами, имитирующего концентрацию и тип желчных кислот у пациента, 1,0 мл среды с 10% стерилизованных фильтрацией экскрементов и 0,1 мл 18-часовой культуры определенного штамма бактерий. Инкубирование может проводиться в течение 2,5-3 часов или дольше. Альтернативный способ тестирования стабильности при воздействии желчной кислотой описан в патенте США №4839281. Выживаемость бактерий может быть определена путем культивирования указанных бактерии и подсчета колоний на подходящих селективных или неселективных средах.

Тестирование на чувствительность к антибиотикам

[0233] Дополнительным необязательным тестом на чувствительность может быть тестирование бактериальных композиций на чувствительность к антибиотикам. Согласно одному варианту реализации бактериальные композиции могут быть выбраны таким образом, что бактериальные компоненты чувствительны к антибиотикам, соответственно, при необходимости они могут быть элиминированы или их количество в желудочно-кишечном тракте пациента по существу уменьшено при применении по меньшей мере одного антибиотика, направленно воздействующего на указанную бактериальную композицию.

Адгезивность в отношении клеток ЖКТ

[0234] Необязательно может проводиться тестирование бактериальных композиций на способность прикрепляться к клеткам ЖКТ. Способ тестирования адгезии к клеткам ЖКТ описан в патенте США №4839281.

Способы очищения спор

Обработка растворителем

[0235] Для очищения бактериальных спор фекальный материал один или несколько раз обрабатывают растворителем. Обработка растворителем представляет собой обработку смешивающимся растворителем (частично смешивающимся или полностью смешивающимся) или обработка несмешивающимся растворителем. Смешиваемость представляет собой способность двух жидкостей смешиваться друг с другом с образованием гомогенного раствора. Вода и этанол, например, полностью смешиваются, так что смесь, содержащая воду и этанол в любом соотношении, будет однофазной. Смешиваемость выражают через массовые % или через массу одного из растворителей на 100 г конечного раствора. Если два растворителя полностью смешиваются в любых пропорциях, их смешиваемость составляет 100%. Полностью смешивающиеся с водой растворы образуют спирты, например, метанол, этанол, изопропанол, бутанол и т.п. Спирты могут быть заранее соединены с водой; например, например, могут быть представлены 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% или более чем 95% раствором. Другие растворители являются только частично смешивающимися, что означает, что только определенная часть растворяется в воде. Простой диэтилэфир, например, частично способен смешиваться с водой. До 7 г простого диэтилэфира растворяются в 93 г воды с получением 7% (масс. %) раствора. Если добавить большее количество диэтилэфира, образуется двухфазный раствор с отдельным слоем диэтилэфира над водой. Другие смешиваемые материалы включают простые эфиры, диметоксиэтан или тетрагидрофуран. Напротив, масло, такое как алкан, и вода являются несмешиваемыми и образуют две фазы. Также обработку несмешивающимся растворителем необязательно комбинируют с детергентом, либо ионогенным, либо неионогенным. Примеры детергентов включают Triton Х-100, Tween 20, Tween 80, Nonidet P40, плюроник или полиол.

Хроматографическая обработка

[0236] Для очищения популяций спор фекальный материал подвергают одной или нескольким хроматографическим обработкам последовательно или параллельно. При хроматографической обработке раствор, содержащий фекальный материал, приводят в контакт с твердой средой, содержащей среду для хроматографии с гидрофобным взаимодействием (HIC) или среду для аффинной хроматографии. Согласно альтернативному варианту реализации твердую среду, способную абсорбировать остаточный продукт среды обитания, присутствующий в фекальном материале, приводят в контакт с твердой средой, которая адсорбирует остаточный продукт среды обитания. Согласно определенным вариантам реализации указанная среда для HIC содержит сефарозу или дериватизированную сефарозу, например, бутилсефарозу, октилсефарозу, фенилсефарозу или бутил-s-сефарозу. Согласно другим вариантам реализации указанная среда для аффинной хроматографии содержит материал, дериватизированный муцином типа I, II, III, IV, V или VI, или олигосахаридами, происходящими из муцинов или аналогичные происходящим из муцинов типа I, II, III, IV, V или VI. Как вариант, среда для аффинной хроматографии содержит материал, дериватизированный антителами, распознающими споробразующие бактерии.

Механическая обработка

[0237] Предложено физическое разрушение фекального материала, в частности, путем одной или нескольких механических обработок, таких как смешивание, перемешивание, встряхивание, обработка на вортексе, ударная пульверизация и обработка ультразвуком. Согласно настоящему изобретению указанная обработка с механическим разрушением по существу разрушает неспоровый материал, присутствующий в фекальном материале, и по существу не разрушает споры, присутствующие в фекальном материале. Механическая обработка необязательно включает обработку фильтрацией, при которой нужные популяции спор остаются на фильтре, а нежелательные (неспоровые) фекальные компоненты проходят через фильтр, и споровую фракцию извлекают из фильтрующей среды. Как вариант, нежелательные частицы и эукариотические клетки могут оставаться на фильтре, а бактериальные клетки, в том числе споры, могут проходить через фильтр. Согласно некоторым вариантам реализации споровую фракцию, оставшуюся на фильтрующей среде, подвергают диафильтрации, при этом указанные оставшиеся споры приводят в контакт с жидкостью для промывания, как правило, стерильным содержащим соли раствором или другим разбавителем, для дополнительного уменьшения количества или устранения нежелательных фекальных компонентой.

Термообработка

[0238] Предложено термическое разрушение фекального материала. Обычно фекальный материал смешивают с содержащим соли раствором, таким как забуференный фосфатом солевой раствор (ФСБ), и помещают в среду с повышенной температурой, например, в теплую комнату, инкубатор, на водяную баню, или т.п., таким образом, чтобы между нагретой средой и фекальным материалом происходил эффективный теплообмен. Предпочтительно раствор фекального материала перемешивают во время инкубирозания для увеличения теплопроводности и разрушения агрегатов частиц. Термообработка может модулироваться за счет температуры окружающей среды и/или продолжительности термообработки. Например, фекальный материал или жидкость, содержащую фекальный материал, подвергают воздействию среды с повышенной температурой, например, горячей водяной бани, температура которой составляет по меньшей мере приблизительно 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 или более чем 100°С, в течение по меньшей мере приблизительно 1, 5, 10, 15, 20, 30, 45 секунд, или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 или 50 минут, или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более 10 часов. Согласно определенным вариантам реализации термообработка происходит при двух различных температурах, например, в течение 30 секунд в среде с температурой 100 градусов Цельсия, а затем в течение 10 минут в среде с температурой 50 градусов Цельсия. Согласно предпочтительным вариантам реализации температура и продолжительность термообработки являются достаточными для гибели или удаления патогенных материалов, и при этом по существу не повреждают или не уменьшают количество способных к прорастанию спор.

Обработка облучением

[0239] Предложены способы обработки фекального материала или разделенных компонентов фекального материала ионизирующим излучением, как правило, гамма-излучением, ультрафиолетовым излучением или облучением электронным пучком с обеспечением уровня энергии, достаточного для гибели патогенных материалов, но по существу не повреждающего нужные популяции спор. Например, ультрафиолетовое излучение с длиной волны 254 нм с обеспечением уровня энергии, составляющим менее чем приблизительно 22000 мкВт на см2 в секунду, обычно не разрушает требуемые споры.

Обработка центрифугированием и разделение по плотности

[0240] Предложены способы отделения требуемых популяций спор от других компонентов фекального материала путем центрифугирования. Раствор, содержащий фекальный материал, один или несколько раз обрабатывают центрифугированием, например, приблизительно при 1000×g, 2000×g, 3000×g, 4000×g, 5000×g, 6000×g, 7000×g, 8000×g или более чем 8000×g. Дифференциальное центрифугирование обеспечивает отделение требуемых спор от ненужного неспорового материала; при малых мощностях споры остаются в растворе, а при более высоких мощностях споры осаждаются, тогда как примеси меньшего размера (например, вирусные частицы, фаги) остаются в растворе. Например, при первом центрифугировании с малой мощностью осаждаются волокнистые материалы; при втором центрифугировании с большей мощностью осаждаются нежелательные эукариотические клетки, а при третьем центрифугировании с еще большей мощностью осаждаются требуемые споры, хотя загрязняющие примеси небольших размеров остаются в суспензии. Согласно некоторым вариантам реализации используются градиенты или «подушки» для разделения в градиенте плотности или подвижности (например, «ступенчатые подушки»), например, градиенты перколла, фиколла, никоденза, гистоденза или сахарозы, для разделения требуемых популяций спор и других материалов в фекальном материале.

[0241] Также в настоящем документе предложены способы получения популяций спор, сочетающие два или большее число вариантов обработки, описанных в настоящем документе, для синергетического очищения требуемых спор наряду с уничтожением или удалением нежелательных материалов и/или активностей из популяции спор. Как правило, желательно сохранение популяций спор в не способствующих прорастанию и росту условиях и средах для минимизации роста патогенных бактерий, присутствующих в указанных популяциях спор, и для минимизации прорастания спор с образованием вегетативных бактериальных клеток.

ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ И СОСТАВЫ

Составы

[0242] Предложены составы для введения человеку и другим нуждающимся в этом субъектам. Обычно бактериальные композиции комбинируют с дополнительными активными и/или неактивными материалами для получения конечного продукта, которые могут быть представлены единичной дозированной формой или многодозовым форматом.

[0243] Согласно некоторым вариантам реализации указанная композиция содержит по меньшей мере один углевод. «Углевод» относится к сахару или полимеру сахаров. Термины «сахарид», «полисахарид», «углевод» и «олигосахарид» могут быть использованы взаимозаменяемо. Большинство углеводов представляют собой альдегиды или кетоны с многочисленными гидроксильными группами, как правило, по одной на каждом атоме углерода в молекуле. Углеводы обычно имеют молекулярную формулу CnH2nOn. Углевод может представлять собой моносахарид, дисахарид, трисахарид, олигосахарид или полисахарид. Большинство основных углеводов представляют собой моносахариды, например, глюкоза, сахароза, галактоза, манноза, рибоза, арабиноза, ксилоза и фруктоза. Дисахариды представляют собой два соединенных моносахаридз. Примеры дисахаридов включают сахарозу, мальтозу, целлобиозу и лактозу. Как правило, олигосахарид включает от трех до шести моносахаридных единиц (например, раффиноза, стахиоза), а полисахариды включают шесть или более моносахаридных единиц. Примеры полисахаридов включают крахмал, гликоген и целлюлозу. Углеводы могут содержать модифицированные сахаридные единицы, например, 2'-дезоксирибозу, где удалена гидроксильная группа, 2'-фторрибозу, где гидроксильная группа заменена на фтор, или N-ацетилглюкозамин, азотсодержащую форму глюкозы (например, 2'-фторрибоза, дезоксирибоза и гексоза). Углеводы могут существовать в виде множества различных форм, например, конформеров, циклических форм, ациклических форм, стереоизомеров, таутомеров, аномеров и изомеров.

[0244] Согласно некоторым вариантам реализации указанная композиция содержит по меньшей мере один липид. В настоящем документе «липид» включает жиры, масла, триглицериды, холестерин, фосфолипиды, жирные кислоты в любой форме, включая свободные жирные кислоты. Жиры, масла и жирные кислоты могут быть насыщенными, ненасыщенными (цис или транс) или частично ненасыщенными (цис или транс). Согласно некоторым вариантам реализации указанный липид содержит по меньшей мере одну жирную кислоту, выбранную из лауриновой кислоты (12:0), миристиновой кислоты (14:0), пальмитиновой кислоты (16:0), пальмитолеиновой кислоты (16:1), маргариновой кислоты (17:0), гептадеценовой кислоты (17:1), стеариновой кислоты (18:0), олеиновой кислоты (18:1), линолевой кислоты (18:2), линоленовой кислоты (18:3), октадекатетраеновой кислоты (18:4), арахидоновой кислоты (20:0), эйкозеновой кислоты (20:1), эйкозадиеновой кислоты (20:2), эйкозатетраеновой кислоты (20:4), эйкозапентаеновой кислоты (20:5) (ЭПК), докозановой кислоты (22:0), докозеновой кислоты (22:1), докозапентаеновой кислоты (22:5), докозагексановой кислоты (22:6) (ДГК), и тетракозановой кислоты (24:0). Согласно другим вариантам реализации указанная композиция содержит по меньшей мере один модифицированный липид, например, липид, который был модифицирован посредством кулинарной обработки.

[0245] Согласно некоторым вариантам реализации указанная композиция содержит по меньшей мере один дополнительный минеральное вещество или источник минерального вещества. Примеры минеральных веществ включают, без ограничения: хлорид, натрий, кальций, железо, хром, медь, йод, цинк, магний, марганец, молибден, фосфор, калий и селен. Подходящий формы любых из перечисленных минеральных веществ включают растворимые минеральные соли, малорастворимые минеральные соли, нерастворимые минеральные соли, хелатированные минеральные вещества, минеральные комплексы, нереакционноспособные минеральные вещества, такие как карбонильные минеральные вещества, и восстановленные минеральные вещества и их комбинации.

[0246] Согласно определенным вариантам реализации указанная композиция содержит по меньшей мере один дополнительный витамин. Указанный по меньшей мере один витамин может относиться к жирорастворимым или водорастворимым витаминам. Подходящие витамины включают, не ограничиваясь перечисленными, витамин С, витамин А, витамин Е, витамин В12, витамин K, рибофлавин, ниацин, витамин D, витамин В6, фолиевую кислоту, пиридоксин, тиамин, пантотеновую кислоту и биотин. Подходящие формы любых из перечисленных витаминов представлены солями витамина, производными витамина, компонентами, обладающими идентичной или аналогичной витамину активностью, и метаболитами витамина.

[0247] Согласно другим вариантам реализации указанная композиция содержит вспомогательное вещество. Неограничивающие примеры подходящих вспомогательных веществ включают буферизующий агент, консервант, стабилизатор, связывающее вещество, уплотняющий агент, смазывающее вещество, усилитель диспергирования, улучшающий распадаемость агент, вкусоароматический агент, подсластитель и красящий агент.

[0248] Согласно другому варианту реализации указанное вспомогательное вещество представляет собой буферизующий агент. Неограничивающие примеры подходящих буферизующих агентов включают цитрат натрия, карбонат магния, бикарбонат магния, карбонат кальция и бикарбонат кальция.

[0249] Согласно некоторым вариантам реализации указанное вспомогательное вещество содержит консервант. Неограничивающие примеры подходящих консервантов включают антиоксиданты, такие как альфа-токоферол и аскорбат, и противомикробные средства, такие как парабены, хлорбутанол и фенол.

[0250] Согласно другим вариантам реализации указанная композиция содержит связывающее вещество в качестве вспомогательного вещества. Неограничивающие примеры подходящих связывающих веществ включают крахмал, прежелатинизированный крахмал, желатин, поливинилпирролидон, целлюлозу, метилцеллюлозу, карбоксиметилцеллюлозу натрия, этилцеллюлозу, полиакриламиды, поливинилоксоазолидон, поливиниловые спирты, спирт жирной кислоты C12-C18, полиэтиленгликоль, полиолы, сахариды, олигосахариды и их комбинации.

[0251] Согласно другому варианту реализации указанная композиция содержит смазывающее вещество в качестве вспомогательное вещество. Неограничивающие примеры подходящих смазывающих веществ включают стеарат магния, стеарат кальция, стеарат цинка, гидрогенизированные растительные масла, стеротекс, полиоксиэтилена моностеарат, тальк, полиэтиленгликоль, бензоат натрия, лаурилсульфат натрия, лаурилсульфат магния и легкое минеральное масло.

[0252] Согласно другим вариантам реализации указанная композиция содержит усилитель диспергирования в качестве вспомогательного вещества. Неограничивающие примеры подходящих диспергирующих агентов включают крахмал, альгиновую кислоту, поливинилпирролидоны, гуаровую камедь, каолин, бентонит, очищенную древесную целлюлозу, натрия крахмала гликолят, изоаморфный силикат и микрокристаллическую целлюлозу как эмульгирующие поверхностно-активные вещества с высоким ГЛБ.

[0253] Согласно некоторым вариантам реализации указанная композиция содержит разрыхлитель в качестве вспомогательного вещества. Согласно другим вариантам реализации указанный разрыхлитель представляет собой нешипучий разрыхлитель. Неограничивающие примеры подходящих нешипучих разрыхлителей включают крахмал, например, кукурузный крахмал, картофельный крахмал, их прежелатинизированный и модифицированный крахмал, подсластители, глины, такие как бентонит, микрокристаллическую целлюлозу, альгинаты, натрия крахмала гликолят, камеди, такие как агар-агар, гуаровая камедь, камедь плодов рожкового дерева, камедь карайя, пектин и трагакант. Согласно другому варианту реализации указанный разрыхлитель представляет собой шипучий разрыхлитель. Неограничивающие примеры подходящих шипучих разрыхлителей включают бикарбонат натрия в комбинации с лимонной кислотой, и бикарбонат натрия в комбинации с винной кислотой.

[0254] Согласно другому варианту реализации указанное вспомогательное вещество содержит вкусоароматический агент. Вкусоароматические агенты могут быть выбраны из синтетических ароматических масел и вкусоароматических веществ; природных масел; экстрактов растений, листьев, цветов и плодов; и их комбинаций. Согласно некоторым вариантам реализации вкусоароматический агент выбирают из коричных масел; масла гаультерии; перечно-мятных масел; масла клевера; масла плевела пастбищного; масла аниса; эвкалипта; ванили; цитрусового масла, например, масла лимона, масла апельсина, винограда, грейпфрута; и фруктовых эссенций, в том числе яблока, персика, груши, клубники, малины, вишни, сливы, ананаса и абрикоса.

[0255] Согласно другим вариантам реализации указанное вспомогательное вещество включает подсластитель. Неограничивающие примеры подходящих подсластителей включают глюкозу (кукурузный сироп), декстрозу, инвертный сахар, фруктозу и их смеси (когда они не используются в качестве носителя); сахарин и различные соли сахарина, такие как натриевая соль; дипептидные подсластители, такие как аспартам; дигидрохалконовые компоненты, глицирризин; Stevia Rebaudiana (стевиозид); хлорные производные сахарозы, такие как сукралоза; и сахарные спирты, такие как сорбит, маннит, силит, и т.п. Также включены гидрогенизированные гидролизаты крахмала и синтетический подсластитель 3,6-дигидро-6-метил-1,2,3-оксатиазин-4-он-2,2-диоксид, в частности, его калиевая соль (ацесульфам-K), а также натриевые и кальциевые соли.

[0256] Согласно другим вариантам реализации указанная композиция содержит красящий агент. Неограничивающие примеры подходящих красящих агентов включают пищевые, лекарственные и косметические красители (FD&C), лекарственные и косметические красители (D&C), и лекарственные и косметические красители для наружного применения (Ext. D&C). Красящие агенты могут использоваться в форме красителей или соответствующих им пигментов.

[0257] Массовая доля вспомогательного вещества или комбинации вспомогательных веществ в составе составляет обычно приблизительно 99% или менее, например, приблизительно 95% или менее, приблизительно 90% или менее, приблизительно 85% или менее, приблизительно 80% или менее, приблизительно 75% или менее, приблизительно 70% или менее, приблизительно 65% или менее, приблизительно 60% или менее, приблизительно 55% или менее, 50% или менее, приблизительно 45% или менее, приблизительно 40% или менее, приблизительно 35% или менее, приблизительно 30% или менее, приблизительно 25% или менее, приблизительно 20% или менее, приблизительно 15% или менее, приблизительно 10% или менее, приблизительно 5% или менее, приблизительно 2% или менее, или приблизительно 1% или менее от общей массы указанной композиции.

[0258] Бактериальные композиции, раскрытые в настоящем изобретении, могут быть введены в разнообразные составы и могут вводиться с применением ряда различных способов. Указанные композиции могут вводиться перорально, ректально или парентерально, в виде составов, при необходимости содержащих стандартные приемлемые носители, адъюванты и основы. Термин «парентеральный» в настоящем документе включает техники подкожного, внутривенного, внутримышечного или внутригрудинного инъецирования и инфузии. Согласно примеру варианта реализации бактериальную композицию вводят перорально.

[0259] Твердые дозированные формы для перорального введения включают капсулы, таблетки, каплеты, пилюли, драже, пастилки, порошки и гранулы. Капсула, как правило, содержит материал сердцевины, содержащий бактериальную композицию, и оболочку, которая инкапсулирует материал сердцевины. Согласно некоторым вариантам реализации указанный материал сердцевины содержит по меньшей мере что-либо одно из твердого вещества, жидкости и эмульсии. Согласно другим вариантам реализации указанный материал оболочки содержит по меньшей мере что-либо одно из мягкого желатина, твердого желатина и полимера. Подходящие полимеры включают, не ограничиваясь перечисленными: полимеры целлюлозы, такие как гидроксипропилцеллюлоза, гидроксиэтилцеллюлоза, гидроксипропилметилцеллюлоза (НРМС), метилцеллюлоза, этилцеллюлоза, ацетат целлюлозы, фталат ацетата целлюлозы, тримеллитат ацетата целлюлозы, фталат гидроксипропилметилцеллюлозы, сукцинат гидроксипропилметилцеллюлозы и карбоксиметилцеллюлоза натрия; полимеры и сополимеры акриловой кислоты, такие как образованные из акриловой кислоты, метакриловой кислоты, метилакрилата, метилакрилата аммония, этилакрилата, метилметакрилата и/или этилметакрилата (например, сополимеры, продаваемые под торговым наименованием «Эудрагит» (Eudragit)); виниловые полимеры и сополимеры, такие как полвинилпирролидон, поливинилацетат, поливинилацетатфталат, сополимер винилацетата и кротоновой кислоты и сополимеры этилена и винилацетата; и шеллак (очищенный сырой шеллак). Согласно другим вариантам реализации по меньшей мере один полимер функционирует в качестве маскирующего вкус агента.

[0260] Таблетки, пилюли и т.п. могут быть прессованными, многократно прессованными, многослойными и/или покрытыми оболочкой. Покрытие может быть однослойным или многослойным. Согласно одному варианту реализации материал для покрытия содержит по меньшей мере что-либо одно из сахарида, полисахарида и гликопротеинов, экстрагированных по меньшей мере из чего-либо одного из растения, гриба и микроорганизма. Неограничивающие примеры включают кукурузный крахмал, пшеничный крахмал, картофельный крахмал, тапиоковый крахмал, целлюлоза, гемицеллюлоза, декстраны, мальтодекстрин, циклодекстрины, инулины, пектин, маннаны, гуммиарабик, камедь плодов рожкового дерева, камедь мескитового дерева, гуаровую камедь, камедь карайя, камедь гхатти, трагакантовую камедь, фунори, каррагинаны, агар-агар, альгинаты, хитозаны или геллановую камедь. Согласно некоторым вариантам реализации материал для покрытия содержит белок. Согласно другому варианту реализации указанный материал для покрытия содержит по меньшей мере что-либо одно из жира и масла. Согласно другим вариантам реализации указанное по меньшей мере что-либо одно из жира и масла имеет высокую температуру плавления. Согласно еще одному варианту реализации указанное по меньшей мере что-либо одно из жира и масла гидрогенизировано или частично гидрогенизировано. Согласно одному варианту реализации по меньшей мере что-либо одно из жира и масла получено из растения. Согласно другим вариантам реализации указанный по меньшей мере что-либо одно из жира и масла содержит по меньшей мере что-либо одно из глицеридов, свободных жирных кислот и сложных эфиров жирных кислот. Согласно некоторым вариантам реализации указанный материал для покрытия содержит по меньшей мере один пищевой воск. Указанный пищевой воск может быть получен из животных, насекомых или растений. Неограничивающие примеры включают пчелиный воск, ланолин, воск мирики, карнаубский воск и воск рисовых отрубей. Кроме того, могут быть получены таблетки и пилюли с кишечнорастворимыми покрытиями.

[0261] Как вариант, порошки или гранулы, в форме которых реализованы бактериальные композиции, раскрытые в настоящем изобретении, могут быть включены в пищевой продукт. Согласно некоторым вариантам реализации указанный пищевой продукт представляет собой напиток для перорального приема. Неограничивающие примеры подходящих напитков включают фруктовый сок, фруктовый напиток, искусственно ароматизированный напиток, искусственно подслащенный напиток газированный напиток, спортивный напиток, жидкий молочный продукт, коктейль, алкогольный напиток, напиток с кофеином, детское питание и т.д. Другие подходящие способы перорального введения включают водные и неводные растворы, эмульсии, суспензии, а также растворы и/или суспензии, восстанавливаемые из нешипучих гранул, содержащих по меньшей мере что-либо одно из подходящих растворителей, консервантов, эмульгирующих агентов, суспендирующих агентов, разбавителей, подсластителей, красящих агентов и вкусоароматических агентов.

[0262] Согласно некоторым вариантам реализации указанный пищевой продукт может представлять собой твердый пищевой продукт. Подходящие примеры твердого пищевого продукта включают без ограничения питательный батончик, закусочный батончик, печенье, брауни, маффин, крекер, брикет мороженого, замороженный йогуртовый брикет и т.п.

[0263] Согласно другим вариантам реализации раскрытые в настоящем изобретении композиции включены в продукты лечебного питания. Согласно некоторым вариантам реализации указанные продукты лечебного питания представляют собой готовый к применению пищевой продукт, который необязательно содержит некоторые или все необходимые макроэлементы и микроэлементы. Согласно другому варианту реализации раскрытые в настоящем изобретении композиции включены в пищевую добавку, предназначенную для смешивания с обычной пищей. Согласно одному варианту реализации указанная пищевая добавка содержит некоторые или все необходимые макроэлементы и микроэлементы. Согласно другому варианту реализации раскрытые в настоящем изобретении бактериальные композиции смешивают или добавляют в обычную пищу для повышения белковой ценности пищи. Примеры включают основные виды продовольствия (зерновые продукты, соль, сахар, масло для приготовления пищи, маргарин), напитки (кофе, чай, газированные напитки, пиво, спиртные напитки, спортивные напитки), снэки, сладости и другие пищевые продукты.

[0264] Согласно одному варианту реализации указанными составами наполняют желатиновые капсулы для перорального введения. Примером подходящей капсулы является желатиновая капсула массой 250 мг, содержащая от 10 (до 100 мг) лиофилизированного порошка (от 108 до 1011 бактерий), 160 мг микрокристаллической целлюлозы, 77,5 мг желатина и 2,5 мг стеарата магния. Согласно альтернативному варианту реализации может быть использовано от 105 до 1012, от 105 до 107, от 106 до 107, или от 108 до 1010 бактерий, с соответствующими корректировками вспомогательных веществ при необходимости. Согласно альтернативному варианту реализации может использоваться капсула или таблетка с кишечнорастворимым покрытием или с буферной или защитной композицией.

ПРИМЕРЫ

[0265] Ниже приведены примеры конкретных вариантов реализации настоящего изобретения. Указанные примеры предложены исключительно в иллюстративных целях, и не предназначены для какого-либо ограничения объема настоящего изобретения. Были предприняты усилия, чтобы обеспечить точность приводимых численных значений (например, количеств, температур и т.п.), однако следует, разумеется, учитывать возможность определенных экспериментальных ошибок и погрешностей.

[0266] При реализации настоящего изобретения используются, если не указано иное, стандартные способы химии белков, биохимии, техник рекомбинантной ДНК и фармакологии на существующем уровне техники. Такие техники подробно описаны в литературе. См., например, Т.Е. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., текущее издание); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rd Ed. (Plenum Press) Vols A and B (1992).

Пример 1. Получение фекального материала.

[0267] Свежие образцы фекалий получали от здоровых доноров-людей, прошедших скрининг на общее хорошее состояние здоровья и отсутствие инфекционных заболеваний, отвечающих критериям включения и исключения, при этом критерии включения включают хорошее состояние здоровья, отсутствие серьезных заболеваний в анамнезе, по результатам физического осмотра или аномальных клинических показателей, регулярное опорожнение кишечника со стулом, внешний вид которого соответствует, как правило, 2, 3, 4, 5 или 6 типу согласно Бристольской шкале стула, и имеющих ИМТ≥18 кг/м2 и ≤25 кг/м2. Критерии исключения, как правило, предусматривали значимые хронические или острые медицинские состояния, в том числе заболевания почек, печени, легких, ЖКТ, сердечно-сосудистой системы, мочеполовой системы, эндокринной системы, иммунной системы, обмена веществ, неврологическое или гематологическое заболевание, наличие в семейном анамнезе воспалительного заболевания кишечника, в том числе болезни Крона и язвенного колита, синдрома раздраженного кишечника, злокачественные новообразования толстой кишки, желудка или другой области ЖКТ, или синдромы полипоза желудочно-кишечного тракта, или недавнее употребление йогурта или коммерческих пробиотических материалов, где первичным(и) компонентом(ами) являет(ют)ся организм(ы). Образцы собирали непосредственно с применением системы сбора образцов на основе кресла-туалета, включающей пластиковый держатель, устанавливаемый на туалетное сиденье, и контейнер для сбора образцов, установленный на держателе. Экскременты попадали в контейнер, после чего на контейнер помещали крышку и плотно закрывали. Затем помещенный на лед образец не позднее чем через 1-4 часов доставляли для обработки. Образцы перемешивали стерильным одноразовым инструментом, и аликвоты массой 2-4 г взвешивали, помещали в пробирки и мгновенно замораживали на ледяной бане с сухим льдом/этанолом. Аликвоты хранили в замороженном состоянии при -80°С до использования.

[0268] Необязательно фекальный материал суспендировали в растворе, и/или удаляли волокна и/или частицы. Извлекали замороженную хранящуюся при -80°С аликвоту, содержащую известную массу экскрементов, и размораживали при комнатной температуре. Добавляли стерильный 1×ФСБ для получения 10% суспензии (масса/объем), и интенсивно перемешивали на вортексе для суспендирования фекального материала до достижения гомогенного внешнего вида материала. Затем материалу позволяли отстояться в течение 10 минут при комнатной температуре для осаждения волокон и частиц. После этого суспензию над осадком аккуратно забирали в новую пробирку, и она содержала очищенную популяцию спор. Необязательно, затем суспензию центрифугировали на низкой скорости, например, 1000×g, в течение 5 минут для осаждения частиц, в том числе волокон. Осадок утилизировали, а супернатант, содержащий вегетативные организмы и споры, помещали в новую пробирку. Затем супернатант центрифугировали при 6000×g в течение 10 минут для осаждения вегетативных организмов и спор. Затем осадок ресуспендировали в 1×ФСБ при интенсивном перемешивании на вортексе до достижения гомогенного внешнего вида материала.

Пример 2. Очищение спор из обработанного спиртом фекального материала.

[0269] 10% суспензию (масса/объем) фекального материала человека в ФСБ смешивали с абсолютным этанолом в соотношении 1:1 и перемешивали на вортексе в течение 1 минуты. Суспензию инкубировали при 37°С в течение 1 часа. После инкубирования суспензию центрифугировали на 13000 об/мин в течение 5 минут для осаждения спор. Супернатант утилизировали, а осадок ресуспендировали в равном объеме ФСБ. Добавляли глицерин до конечной концентрации 15% и помещали очищенную споровую фракцию на хранение при -80°С.

Пример 2А. Получение состава со спорами из обработанного спиртом фекального материала.

[0270] 10% суспензию (масса/объем) фекального материала человека в ФСБ смешивали с абсолютным этанолом в соотношении 1:1 и перемешивали на вортексе в течение 1 минуты. Суспензию инкубировали при 37°С в течение 1 часа. После инкубирования суспензию центрифугировали при 13000 об/мин в течение 5 минут для концентрации спор в осадке, содержащем очищенный споровый состав. Супернатант утилизировали, а осадок ресуспендировали в равном объеме ФСБ. Добавляли глицерин до конечной концентрации 15% и помещали очищенный состав со спорами на хранение при -80°С.

Пример 3. Очищение спор из термообработанного фекального материала.

[0271] 10% суспензию (масса/объем) фекального материала человека в ФСБ инкубировали на водяной бане при 80°С в течение 30 минут. Добавляли глицерин до конечной концентрации 15% и помещали обогащенный споросодержащий материал на хранение при -80°С.

Пример 4. Очищение спор из обработанного спиртом и термообработанного фекального материала.

[0272] 10% суспензию (масса/объем) экскрементов человека в ФСБ смешивали с абсолютным этанолом в соотношении 1:1 и перемешивали на вортексе в течение 1 минуты. Суспензию инкубировали на водяной бане в аэробных условиях при 37°С в течение 1 часа. После инкубирования суспензию центрифугировали на 13000 об/мин в течение 5 минут для осаждения спор. Супернатант утилизировали, а осадок ресуспендировали в равном объеме ФСБ. Затем обработанную этанолом популяцию спор инкубировали на водяной бане при 80°С в течение 30 минут. Добавляли глицерин до конечной концентрации 15% и помещали очищенную споровую фракцию на хранение при -80 С.

Пример 5. Очищение спор из обработанного детергентом фекального материала.

[0273] Получают 10% суспензию (масса/объем) экскрементов человека в ФСБ, содержащую конечную концентрацию Triton Х-100 от 0,5 до 2%. После инкубирования при встряхивании в течение 30 минут при 25-37°С образец центрифугировали на 1000 g в течение 5-10 минут для осаждения частиц и больших клеток. Бактериальные споры извлекают из фракции супернатанта, при этом очищенная популяция спор может необязательно подвергаться дополнительной обработке, например, согласно примеру 4. Без привязки к конкретной теории, добавление детергента к фекальной смеси обеспечивает получение более качественных популяций спор, по меньшей мере отчасти за счет улучшения отделения спор от частиц, что приводит к большему выходу спор.

Пример 6. Очищение спор путем хроматографического разделения фекального материала.

[0274] Обогащенную спорами популяцию, например, полученную согласно примерам 1-5 выше, смешивают с NaCl до конечной общей концентрации соли 4М и приводят в контакт с октилсефарозой 4 Fast Flow для связывания гидрофобной споровой фракции. Смолу промывают 4М NaCl для удаления менее гидрофобных компонентов, споры элюируют дистиллированной водой, и собирают нужную обогащенную споровую фракцию на основании УФ-поглощения.

Пример 7. Очищение спор путем фильтрации фекального материала.

[0275] Обогащенную спорами популяцию, например, полученную согласно примерам 1-6 выше, разбавляют ФСБ до 1:10 и помещают в резервуар системы для тангенциальной проточной микрофильтрации. Гидрофильный тангенциальный фильтр из смешанного эфира целлюлозы с размером пор 0,2 мкм соединяют с резервуаром, например, посредством трубки, замкнутой в петлю. Разбавленный состав со спорами многократно прокачивают по петле насосом, и под действием градиента давления на стенках микрофильтра жидкость супернатанта проходит через поры фильтра. При правильном выборе размера пор фильтра требуемые бактериальные споры удерживаются, а загрязняющие примеси меньшего размера, такие как клеточный дебрис, и другие загрязняющие примеси в экскрементах, такие как бактериофаги, проходят через фильтр. Периодически в резервуар добавляют свежий ФСБ-буфер для улучшения вымывания загрязняющих примесей. В конце диафильтрации споры концентрируют приблизительно десятикратно до исходной концентрации. Очищенные споры собирали из резервуара и хранили согласно описанию в настоящем документе.

Пример 8. Характеризация очищенных популяций спор.

[0276] Количество жизнеспособных спор подсчитывают, выполняя 10-кратные серийные разведения в ФСБ и высевая в чашки Петри на кровяной агар для Brucella или подходящую твердую среду. Планшеты инкубируют при 37°С в течение 2 дней. Подсчитывают колонии на чашке для разведения с 50-400 колоний и используют для обратного подсчета числа жизнеспособных спор в популяции. Также продемонстрирована способность к росту с образованием вегетативных бактерий. Визуально количество подсчитывают с применением фазово-контрастной микроскопии. Состав со спорами либо разводят в ФСБ, либо концентрируют путем центрифугирования, и аликвоту объемом 5 мкл помещают в счетную камеру Петрова-Хауссера для визуализации при увеличении 400×. Подсчитывают споры в полях сетки размером 0,05 мм × 0,05 мм, определяют среднее подсчитанное число спор на поле и используют для расчета количества спор на мл состава. Уменьшение количества липополисахарида (ЛПС) в очищенных популяциях спор измеряют с применением анализа с лизатом амебоцитов мечехвоста (LAL), например, коммерчески доступного набора ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Пискатауэй, Нью-Джерси) или других стандартных способов, известных специалистам в данной области техники.

Пример 9. Определение бактериальных патогенов в очищенных популяциях спор.

[0277] Бактериальные патогены, присутствующие в очищенной популяции спор, определяют с помощью кПЦР с применением специфических олигонуклеотидных праймеров следующим образом.

[0278] Получение стандартных кривых. Стандартную кривую строят на основании лунок, содержащих представляющий интерес патоген в известной концентрации, или одновременно количественно определяют с применением селективного посева бляшкой. Серийные разведения культур в двух повторностях выполняют в стерильном забуференном фосфатом солевом растворе. Затем из образцов для стандартной кривой наряду с другими образцами экстрагируют геномную ДНК.

Экстракция геномной ДНК.

[0279] Геномная ДНК может быть экстрагирована из 100 мкл образцов фекалий, происходящих из фекалий образцов или очищенных составов со спорами с применением набора для выделения ДНК Мо Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Карлсбад, Калифорния) в соответствии с инструкциями производителя, с двумя исключениями: измельчение гранулами выполняют в течение 2×4:40 минут с применением гомогенизатора BioSpec Mini-Beadbeater-96 (BioSpec Products, Бартлезвилль, Оклахома) и ДНК элюируют в 50 мкл раствора С6. Как вариант, геномная ДНК может быть выделена с применением набора для выделения ДНК Мо Bio Powersoil® DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния), набора для ПЦР Sigma-Aldrich Extract-N-Amp™Plant PCR Kit, мининабора QIAamp DNA Stool Mini Kit (QIAGEN, Валенсия, Калифорния) в соответствии с инструкциями производителей.

Состав и условия для кПЦР.

[0280] Реакция кПЦР для детекции C. difficile включает 1× HotMasterMix (5PRIME, Гейтерсберг, Мэриленд), 900 нМ Wr-tcdB-F (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG, IDT, Коралвилль, Айова), 900 нМ Wr-tcdB-R (CATGCTTTTTTAGTTTCTGGATTGAA, IDT, Коралвилль, Айова), 250 нМ We-tcdB-P (6FAM-CATCCAGTCTCAATTGTATATGTTTCTCCA-MGB, Life Technologies, Гранд-Айленд, Нью-Йорк) и воду для ПЦР (Мо Bio Laboratories, Карлсбад, Калифорния) до 18 мкл (модифицированные праймеры на основе: Wroblewski, D. et al. Rapid Moiecular Characterization of Clostridium difficile and Assessment of Populations of C. difficile in Stool Specimens. Journal of Clinical Microbiology 47:2142-2148 (2009)). Аликвоты указанной реакционной смеси распределяют в лунки 96-луночного штрихкодированного реакционного планшета MicroAmp® Fast Optical 96-well Reaction Plate with Barcode (0,1 мл) (Life Technologies, Гранд-Айленд, Нью-Йорк). К указанной реакционной смеси добавляют 2 мкл экстрагированной геномной ДНК. Проводят кПЦР на термоциклере BioRad С1000™, оборудованном системой реального времени CFX96™ Real-Time System (BioRad, Геркулес, Калифорния). Используют следующие условия термоциклирования: 95°С в течение 2 минут с последующими 45 циклами при 95°С по 3 секунды, 60°С по 30 секунд, и регистрируют флуоресценцию в каналах FAM и ROX. Другие бактериальные патогены могут быть детектированы с применением праймеров и зонда, специфических в отношении представляющего интерес патогена.

Анализ данных.

[0281] Значение Cq для каждой лунки канала FAM определяют с применением программного обеспечения CFX Manager™, версия 2.1. Значение log10(KOE/мл) для каждого экспериментального образца рассчитывают путем подстановки значения Cq определенного образца в линейную регрессионную модель, установленную по стандартной кривой, сравнивающую значения Cq лунок, использованных для стандартной кривой, с известными log10(КОЕ/мл) для указанных образцов.

[0282] Вирусные патогены, присутствующие в очищенной популяции спор, определяют с помощью кПЦР согласно описанию в настоящем документе, а также иными известными в данной области техники способами.

Пример 10: Идентификация видов

[0283] Идентичность спорообразующих видов, выросших из комплексной фракции, может быть определена несколькими способами. Во-первых, индивидуальные колонии могут высеваться уколом в жидкую среду в формате 96-луночных планшетов, культивироваться и храниться в виде основных растворов в 15% глицерине при -80С. Аликвоты указанных культур могут быть помещены в лизирующий клеточный буфер, и могут использоваться методы ПЦР колоний для амплификации и секвенирования гена 16S рРНК (Пример 2). Как вариант, колонии могут быть полностью очищены несколькими пересевами методом штриха на твердой среде. Хорошо выраженные колонии высевают методом штриха на новые чашки того же типа и инкубируют в течение 48-72 часов при 37°С. Процесс повторяют несколько раз для подтверждения полной чистоты. Чистые культуры могут анализироваться с применением фенотипических методов или секвенирования, в том числе амплификации и секвенирования 16S рРНК согласно описанию в примерах 11 и 12. Определение последовательностей в чистых изолятах или смешанных сообществах, например, соскобах с чашек и споровых фракциях, может также включать полногеномное секвенирование методом «дробовика». Последний метод подходит для определения присутствия генов, связанных со споруляцией, устойчивостью к антибиотикам, патогенности и вирулентности. Колонии могут также собираться соскобом с чашек en masse и секвенироваться с применением метода массивного параллельного секвенирования согласно описанию в примерах 11 и 12, что обеспечивает идентификацию индивидуальных 16S-«сигнатур» в комплексной смеси. Необязательно образец может быть секвенирован до прорастания (при использовании подходящих процедур выделения ДНК для лизиса и высвобождения ДНК из спор) для сравнения разнообразия способных к прорастанию видов с общим числом видов в споровом образце. В качестве альтернативного варианта или как дополнение к анализу 16S может также использоваться времяпролетная масс-спектрометрия с ионизацией лазерной десорбцией при содействии матрицы (МАЛДИ) для идентификации видов (см. обзор в Anaerobe 22:123).

Пример 11: 16S-секвенирование для определения функциональных таксономические единиц (OTU)

Способ определения последовательности 16S

[0284] OTU могут быть определены посредством полного 16S-секвенирования гена рРНК, посредством секвенирования конкретной гипервариабельной области указанного гена (т.е. V1, V2, V3, V4, V5, V6, V7, V8 или V9) или посредством секвенирования любой комбинации гипервариабельных областей указанного гена (например, V1-3 или V3-5). Длина бактериальных 16S рРНК составляет приблизительно 1500 нуклеотидов и их используют для реконструкции эволюционных взаимосвязей и сходства последовательностей между бактериальными изолятами с применением филогенетических методов. Последовательности 16S используют для филогенетической реконструкции, поскольку они обычно высококонсервативны, однако содержат специфические гипервариабельные области, содержащие достаточно разнообразные нуклеотиды для различения родов и видов большинства микроорганизмов.

[0285] С применением хорошо известных техник, для определения полной последовательности 16S или последовательности любой гипервариабельной области последовательности 16S, геномную ДНК экстрагируют из бактериального образца, 16S рРНК (полную область или конкретные гипервариабельные области) амплифицировали с применением полимеразной цепной реакции (ПЦР), очищали продукты ПЦР и устанавливали нуклеотидные последовательности для определения генетического состава гена 16S или суб домена указанного гена. При проведении 16S-секвенирования используемый способ секвенирования может представлять собой, не ограничиваясь указанным, секвенирование по Сэнгеру. Если используются одна или большее количество гипервариабельных областей, таких как область V4, секвенирование может проводиться с применением, не ограничиваясь перечисленными, метода Сэнгера или метода секвенирования нового поколения, такого как секвенирование Illumina (секвенирование путем синтеза) с применением штрихкодированных праймеров, позволяющих проводить несколько реакций.

[0286] Помимо гена рРНК 16S, OTU можно определять путем секвенирования выбранной группы генов, которые известны как маркерные гены определенного вида или таксономической группы OTU. Указанные гены могут, как вариант, анализироваться с применением стратегии скрининга на основе ПЦР. Например, различные штаммы патогенной Escherichia coli можно отличить, используя ДНК генов, кодирующих термолабильные (LTI, LTIIa и LTIIb) и термостабильные (STI и STII) токсины, веротоксин типов 1, 2 и 2е (VT1, VT2 и VT2e, соответственно), цитотоксические некротизирующие факторы (CNF1 и CNF2), механизмы прикрепления и сглаживания (eaeA), энтероагрегативные механизмы (Eagg) и энтероинвазивные механизмы (Einv). Специалистам в области таксономической идентификации на основе секвенирования известны оптимальные гены для использования в качестве маркерных генов при определении таксономической принадлежности OTU.

Экстракция геномной ДНК

[0287] Геномную ДНК экстрагируют из чистых культур микроорганизмов с применением метода горячего щелочного лизиса. 1 мкл культуры микроорганизмов добавляют к 9 мкл лизирующего буфера (25 мМ NaOH, 0,2 мМ EDTA), и смесь инкубируют при 95°С в течение 30 минут. Затем образцы охлаждают до 4°С и нейтрализуют добавлением 10 мкл нейтрализующего буфера (40 мМ Tris-HCl), и 10-кратно разводят элюирующим буфером (10 мМ Tris-HCl). Как вариант, геномную ДНК экстрагируют из чистых культур микроорганизмов с применением коммерчески доступных наборов, таких как набор для выделения ДНК Мо Bio Ultraclean® Microbial DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния), или с помощью стандартных способов, известных специалистам в данной области техники.

Амплификация последовательностей 16S для прямого секвенирования по Сэнгеру

[0288] Для амплификации бактериальных 16S рРНК (фиг. 1А) 2 мкл экстрагированной гДНК добавляют в 20 мкл конечного объема ПЦР-реакции. В случае полноразмерного 16S-секвенирования реакция ПЦР также включает 1× HotMasterMix (5PRIME, Гейтерсберг, Мэриленд), 250 нМ 27f (AGRGTTTGATCMTGGCTCAG, IDT, Коралвилль, Айова) и 250 нМ 1492r (TACGGYTACCTTGTTAYGACTT, IDT, Коралвилль, Айова) с водой для ПЦР (Мо Bio Laboratories, Карлсбад, Калифорния) для уравновешивания объема. Как вариант, используют другие универсальные бактериальные праймеры или термостабильные полимеразы, известные специалистам в данной области техники. Например, специалистам в данной области техники доступны праймеры для секвенирования «V1-V9-областей» 16S рРНК (фиг. 1А). Указанные области относятся к первым девяти гипервариабельным областям гена 16S рРНК, которые используют для генотипирования бактериальных образцов. Указанные области у бактерий определяют нуклеотиды 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 и 1435-1465, соответственно, с применением нумерации на основе системы номенклатуры Е. coli. Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli, PNAS 75(10):4801-4805 (1978). Согласно некоторым вариантам реализации по меньшей мере какую-либо одну из областей V1, V2, V3, V4, V5, V6, V7, V8 и V9 используют для определения OTU. Согласно одному варианту реализации области V1, V2, и V3 используют для определения OTU. Согласно другому варианту реализации области V3, V4, и V5 используют для определения OTU. Согласно другому варианту реализации область V4 используют для определения OTU. Специалист в данной области техники может идентифицировать специфические гипервариабельные области кандидатной 16S рРНК (на фиг. 1А) путем сравнения представляющей интерес кандидатной последовательности с референсной последовательностью (фиг. 1В) и идентификации гипервариабельных областей на основании сходства с референсными гипервариабельными областями.

[0289] ПЦР выполняют на коммерчески доступных термоциклерах, например, BioRad MyCycler™ (BioRad, Геркулес, Калифорния). Реакции проводят при 94°С в течение 2 минут с последующими 30 циклами при 94°С в течение 30 секунд, 51°С в течение 30 секунд, и 68°С в течение 1 минуты и 30 секунд, с последующим 7-минутным удлинением при 72°С и периодом неопределенной продолжительности при 4°С. После ПЦР проводят гель-электрофорез части реакционных продуктов для подтверждения успешной амплификации продукта размером ~1,5 кБ.

[0290] Для удаления нуклеотидов и олигонуклеотидов из продуктов ПЦР 2 мкл НТ ExoSap-IT (Affymetrix, Санта-Клара, Калифорния) добавляют к 5 мкл продукта ПЦР с последующим 15-минутным инкубированием при 37°С, и затем 15-минутной инактивацией при 80°С.

Амплификация последовательностей 16S для прямого определения с применением технологий массивного параллельного секвенирования

[0291] Для проведения амплификации для прямого секвенирования с использованием технологий на основе коротких прочтений, такой как Illumina, требуется применение праймеров, известных специалистам в данной области техники, дополнительно включающих основанную на последовательностях штрихкодированную метку. Например, для амплификации гипервариабельной области V4 16s бактериальной 16S pPHK, 2 мкл экстрагированной гДНК добавляют к 20 мкл конечного объема реакции ПЦР. Реакция ПЦР также включает 1× HotMasterMix (5PRIME, Гейтерсберг, Мэриленд), 200 нМ V4_515f_adapt (AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGCGGTAA, IDT, Коралвилль, Айова), 200 нМ штрихкодированный 806rbc (CAAGCAGAAGACGGCATACGAGAT_12bpGolayBarcode_AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT, IDT, Коралвилль, Айова) с водой для ПЦР (Мо Bio Laboratories, Карлсбад, Калифорния) для уравновешивания объема. Указанные праймеры включают штрихкодированные адаптеры для секвенирования синтезом от Illumina. Необязательно может проводиться две, три или четыре идентичных параллельных реакции. Как вариат, используют другие универсальные бактериальные праймеры или термостабильные полимеразы, известные специалистам в данной области техники, для получения других уровней погрешности при амплификации и секвенировании, а также результатов для альтернативных технологий секвенирования.

[0292] ПЦР-амплификацию выполняют на коммерчески доступных термоциклерах, таких как BioRad MyCycler™ (BioRad, Геркулес, Калифорния). Реакции проводят при 94°С в течение 3 минут с последующими 25 циклами при 94°С в течение 45 секунд, 50°С в течение 1 минуты, и 72°С в течение 1 минуты и 30 секунд, с последующим 10-минутным удлинением при 72°С и периодом неопределенной продолжительности при 4°С. После ПЦР проводят гель-электрофорез части реакционных продуктов для подтверждения успешной амплификации продукта размером ~1,5 кБ. Очищение продуктов ПЦР выполняют согласно описанию в предыдущем примере.

Секвенирование по Сэнгеру целевых ампликонов из чистых гомогенных образцов

[0293] Для детекции нуклеиновых кислот для каждого образца проводят две реакции секвенирования для получения прямого и обратного прочтения последовательности. Для полноразмерного 16S-секвенирования используют праймеры 27f и 1492r. 40 нг очищенных ExoSap-IT продуктов ПЦР смешивают с 25 пмоль праймера для секвенирования и водой для молекулярной биологии от Мо Bio (Мо Bio Laboratories, Карлсбад, Калифорния) с получением общего объема 15 мкл. Указанную реакционную смесь отправляют для проведения секвенирования по Сэнгеру в коммерческую организацию, такую как Genewiz (Саут-Плейнфилд, Нью-Джерси).

Массивное параллельное секвенирование целевых ампликонов из гетерогенных образцов

[0294] Количественное определение ДНК и конструирование библиотеки. Очищенные продукты ПЦР-амплификации количественно определяют с применением аналитического набора Quant-iT™ PicoGreen® dsDNA Assay Kit (Life Technologies, Гранд-Айленд, Нью-Йорк) в соответствии с инструкциями производителя. После количественного определения очищенные штрихкодированные продукты ПЦР комбинируют таким образом, что все отдельные продукты ПЦР присутствуют в эквимолярных отношениях, для получения готовой библиотеки Illumina.

[0295] Детекция нуклеиновых кислот. Полученную библиотеку секвенируют на секвенаторах Illumina HiSeq или MiSeq (Illumina, Сан-Диего, Калифорния), с определением кластеров, гибридизацией на матрице, изотермальной амплификацией, линеаризацией, блокированием, денатурацией и гибридизацией праймеров секвенирования в соответствии с инструкциями производителя. Для секвенирования используют 16SV4SeqFw (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA), 16SV4SeqRev (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT) и 16SV4Index (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT) (IDT, Коралвилль, Айова). Могут использоваться другие технологии секвенирования, например, но не ограничиваясь перечисленными, 454, Pacific Biosciences, Helicos, Ion Torrent и Nanopore, с применением протоколов, стандартных для специалиста в области геномного секвенирования.

Пример 12: Определение принадлежности прочтений секвенирования

[0296] Определение принадлежности первичных прочтений

[0297] Последовательности нуклеиновых кислот анализируют и определяют таксономическую принадлежность с использованием сходства последовательностей и методов филогенетической классификации, или комбинации указанных двух стратегий. Аналогичный подход может использоваться для присвоения наименований белкам, транскрипционным факторам и любых других схем классификации последовательностей нуклеиновых кислот. Способы на основе сходства последовательностей включают способы, известные специалистам в данной области техники, включая, но не ограничиваясь перечисленными, BLAST, BLASTx, tBLASTn, tBLASTx, RDP-классификатор, DNAclust и различные варианты реализации указанных алгоритмов, такие как Qiime или Mothur. Указанные способы основаны на картировании прочтений секвенирования на референсную базу данных и отборе совпадений с лучшим показателем и собственным значением. Стандартные базы данных включают, не ограничиваясь перечисленными, Human Microbiome Project, неизбыточную базу данных NCBI, Greengenes, RDP и Silva. Филогенетические способы могут использоваться в комбинации с методами на основе сходства последовательностей для улучшения точности прогнозирования принадлежности или таксономического определения. В настоящей работе древовидная топология и узловая структура используются для увеличения разрешающей способности анализа. При указанном подходе авторы анализируют последовательности нуклеиновых кислот с применением одного из многочисленных методов на основе сходства последовательностей и действенных филогенетических способов, которые хорошо известны специалистам в данной области техники, в том числе, но не ограничиваясь перечисленными, филогенетической реконструкции методом максимального правдоподобия (см., например, Liu K, Under CR, and Warnow T. 2011. RAxML and FastTree: Comparing Two Methods for Large-Scale Maximum Likelihood Phylogeny Estimation. PLoS ONE 6: e27731. McGuire G, Denham MC, and Balding DJ. 2001. Models of sequence evolution for DNA sequences containing gaps. Mol. Biol. Evol 18: 481-490. Wrobel В. 2008. Statistical measures of uncertainty for branches in phylogenetic trees inferred from molecular sequences by using model-based methods. J. Appl. Genet. 49: 49-67.) Прочтения последовательностей располагают в референсной филогенетической системе, содержащей подходящие референсные последовательности. Определение приналежности осуществляют на основании расположения прочтения на филогенетическом дереве. Определенность или значимость установленной принадлежности OTU определяют на основе сходства последовательностей OTU с референсной последовательностью нуклеиновых кислот, и близости последовательности OTU к одной или нескольким референсным последовательностям в филогенетической системе. Например, специфичность определения таксономической принадлежности определяют со степенью достоверности на уровне семейства, рода, вида или штамма, при этом степень достоверности основана на положении ветвей с бутстреп-поддержкой на референеном филогенетическом дереве относительно расположения последовательности исследуемой OTU.

[0298] Распределение клад

[0299] Возможность идентификации по 16S-V4 принадлежности OTU к конкретному виду зависит отчасти от разрешающей способности области 16S-V4 гена 16S для конкретного вида или группы видов. Как плотность доступных референсных последовательностей 16S для разных областей указанного дерева, так и природная вариабельность гена 16S у разных видов определяет точность таксономической классификации. С учетом топологической природы филогенетического дерева и того факта, что указанное дерево отражает иерархические взаимоотношения OTU, основанные на сходстве их последовательностей и базовой эволюционной модели, таксономическая классификация прочтения может быть распространена на более высокий уровень с применением основанной на кладах процедуры определения принадлежности (таблица 1). При применении указанного подхода клады определяют на основании топологии филогенетического дерева, сконструированного на основании полноразмерных последовательностей 16S с применением максимального правдоподобия или других филогенетических моделей, известных специалистам в области филогенетики. Клады конструируют для подтверждения того, что все OTU в определенной кладе: (i) в пределах определенного числа узлов с бутстреп-поддержкой друг от друга (обычно, 1-5 значений бутстрепа), и (ii) отличаются не более чем на 5% в отношении генетического сходства OTU, принадлежащие одной кладе, можно определить как генетически и филогенетически отличные от OTU другой клады на основании данных секвенирования 16S-V4. OTU, попадающие в одну кладу, являются эволюционно близкородственными и могут быть отличимы или неотличимы друг от друга при применении данных секвенирования 16S-V4. Мощность основанного на кладах анализа заключается в том, что представители одной клады, благодаря эволюционному родству, предположительно играют аналогичные функциональные роли в экогруппе микроорганизмов, например, обнаруживаемых в кишечнике человека. Композиции, где одни виды замещены другими из той же клады, предположительно сохраняют консервативную экологическую функцию и, соответственно, подходят для применения в настоящем изобретении.

[0300] Примечательно, что последовательности 16S из изолятов определенных OTU филогенетически располагаются в соответствующих кладах, что иногда противоречит определению до вида и рода на основе микробиологических методов, которое может предшествовать определению на основе 16S. Расхождения между таксономическим определением на основании микробиологических характеристик относительно определения на основе генетического секвенирования известны из литературы.

Пример 13: Проращивание спор

[0301] Проращивание споровой фракции увеличивает число жизнеспособных спор, которые растут на разных типах сред. Для проращивания популяции спор образец перемещают в анаэробную камеру, ресуспендируют в предварительно восстановленном ФСБ, перемешивают и инкубируют в течение 1 часа при 37°С для обеспечения прорастания. Способствующие прорастанию вещества могут включать аминокислоты (например, аланин, глицин), сахара (например, фруктоза), нуклеозиды (например, инозин), соли желчных кислот (например, холат и таурохолат), катионы металлов (например, Mg2+, Ca2+), жирные кислоты и длинноцепочечные алкиламины (например, додециламин, «Germination of bacterial spores with alkyl primary amines» J. Bacteriology, 1961). Указанные смеси или более сложные природные смеси, такие как сок рубца или бычья желчь, могут использоваться для индуцирования прорастания. Бычья желчь представляет собой дегидратированную бычью желчь, состоящую из жирных кислот, желчные кислоты, неорганические соли, сульфаты, желчные пигменты, холестерин, муцин, лецитин, глюкуроновые кислоты, порфирины и мочевину. Прорастание может также осуществляться в ростовой среде, такой как предварительно восстановленная среда BHIS с бычьей желчью для прорастания, в которой за счет BHIS (порошок сердечно-мозгового бульона (37 г/л), дрожжевого экстракта (5 г/л), L-цистеина HCl (1 г/л)) обеспечиваются пептиды, аминокислоты, неорганические ионы и сахара в комплексных смесях BHI и дрожжевых экстрактах, а бычья желчь обеспечивает дополнительные способствующие прорастанию желчные кислоты.

[0302] Кроме того, для проращивания спор может применяться давление. Выбор способствующих прорастанию веществ могут варьировать в зависимости от требуемого микроорганизма. Для разных видов требуются разные способствующие прорастаним вещества; и разные способствующие прорастанию вещества могут требоваться для оптимального прорастания разных изолятов одного и того же вида. Наконец, важно разводить смесь до посева, поскольку некоторые способствующие прорастанию вещества ингибируют рост микроорганизмов в вегетативном состоянии. Например, было показано, что алкиламины должны быть нейтрализованы анионными липофилами для стимуляции оптимального роста. Желчные кислоты могут также ингибировать рост некоторых организмов, несмотря на то, что они способствуют их прорастанию, и их необходимо разводить перед посевом для получения жизнеспособных клеток.

[0303] Например, раствор BHIS/бычьей желчи используют в качестве способствующего прорастанию вещества; он содержит 0,5Х среды BHIS с 0,25% бычьей желчи (дегидратированной бычьей желчи), где 1× среда BHIS содержит на литр раствора следующее: 6 г сердечно-мозгового бульона из сухого вещества, 7 г пептического гидролизата животной ткани, 14,5 г панкреатического гидролизата казеина, 5 г дрожжевого экстракта, 5 г хлорида натрия, 2 г глюкозы, 2,5 г динатрия фосфата и 1 г цистеина. Кроме того, Са-ДПК представляет собой способствующее прорастанию вещество и содержит 40 мМ CaCl2 и 40 мМ дипиколиновой кислоты (ДПК). Сок рубца (Bar Diamond, Inc.) также представляет собой способствующее прорастанию вещество. Искусственный желудочный сок (Ricca Chemical) представляет собой способствующее прорастанию вещество и состоит из 0,2% (масса/объем) хлорида натрия в 0,7% (об/об) соляной кислоты. Муциновая среда представляет собой способствующее прорастанию вещество, и ее получают путем добавления следующих компонентов к 1 л дистиллированной стерильной воды: 0,4 г KH2PO4,0,53 г Na2HPO4, 0,3 г NH4Cl, 0,3 г NaCl, 0,1 г MgCl2×6Н2О, 0,11 г CaCl2, 1 мл раствора щелочных микроэлементов, 1 мл раствора кислых микроэлементов, 1 мл витаминного раствора, 0,5 мг резазурина, 4 г NaHCO3, 0,25 г Na2S×9H2O. Растворы микроэлементов и витаминов получали согласно существующему описанию (Stams et al., 1993). Все компоненты автоклавировали, за исключением витаминов, которые стерилизовали фильтрацией. К базовой среде добавляли 0,7% (об/об) осветленного стерильного сока рубца и 0,25% (об/об) коммерческого свиного желудочного муцина (тип III; Sigma), очищенного осаждением в этаноле согласно существующему описанию (Miller & Hoskins, 1981). Указанная среда в настоящем документе называется муциновой средой.

[0304] Фетальная бычья сыворотка (Gibco) может использоваться в качестве способствующего прорастанию вещества, и содержит 5% термоинактивированной ФБС, в забуференном фосфатом солевом растворе (ФСБ, Fisher Scientific), содержащем 0,137М хлорида натрия, 0,0027М хлорида натрия, 0,0119М фосфатного буфера. Тиогликолят представляет собой способствующее прорастанию вещество согласно существующему описанию (Kamiya et al Journal of Medical Microbiology 1989) и содержит 0,25М (pH10) тиогликолята натрия. Раствор додециламина, содержащий 1 мМ додециламин в ФСБ, представляет собой способствующее прорастанию вещество. Раствор сахара может использоваться в качестве способствующего прорастанию вещества и содержит 0,2% фруктозы, 0,2% глюкозы и 0,2% маннита. Раствор аминокислот может также применяться в качестве способствующего прорастанию вещества; он содержит 5 мМ аланин, 1 мМ аргинин, 1 мМ гистидин, 1 мМ лизин, 1 мМ пролин, 1 мМ аспарагин, 1 мМ аспарагиновой кислоты, 1 мМ фенилаланин. Способствующая прорастанию смесь, называемая здесь Germix 3, может представлять собой способствующее прорастанию вещество; она содержит 5 мМ аланин, 1 мМ аргинин, 1 мМ гистидин, 1 мМ лизин, 1 мМ пролин, 1 мМ аспарагин, 1 мМ аспарагиновой кислоты, 1 мМ фенилаланин, 0,2% таурохолата, 0,2% фруктозы, 0,2% маннита, 0,2% глюкозы, 1 мМ инозин, 2,5 мМ Са-ДПК и 5 мМ KCl. Среда BHIS+ДПК представляет собой способствующую прорастанию смесь и содержит среду BHIS и 2 мМ Са-ДПК. Супернатант отработанной среды от Escherichia coli, называемый здесь EcSN, представляет собой способствующее прорастанию вещество; его получают путем культивирования Е. coli MG1655 на среде SweetB/Fos с инулином в анаэробных условиях в течение 48 часов, осаждения клеток центрифугированием при 20000 ОСЦ в течение 20 минут, сбора супернатанта и нагревания до 60°С на протяжении 40 минут. Наконец, указанный раствор стерилизуют фильтрацией и используют в качестве способствующего прорастанию раствора.

Пример 14: Выбор сред для роста

[0305] Важно подобрать подходящие среды для поддержания роста, в том числе предпочтительные источники углерода. Например, некоторые организмы предпочитают сложные сахара, такие как целлобиоза, простым сахарам. Примеры сред, используемых для выделения спорулирующих организмов включают EYA, BHI, BHIS и GAM (см. ниже полные названия и ссылки). Ряд разведении высевают для подтверждения того, что на некоторых планшетах образуются хорошо изолированные колонии для анализа, или как вариант, с планшетов с плотными колониями может быть взять соскоб и суспендирован в ФСБ для получения смешанного разнообразного сообщества.

[0306] Планшеты инкубируют в анаэробных условиях или в аэробных условиях при 37°С в течение 48-72 или более часов, при ориентации на анаэробные или аэробные спорообразующие бактерии, соответственно.

[0307] Твердые среды для планшетов включают:

- Анаэробную среду Гифу (GAM, Nissui) без декстрозы с добавлением фруктоолигосахариды/инулина (0,4%), маннита (0,4%), инулина (0,4%), или фруктозы (0,4%), или их комбинации.

- Модифицированную Sweet GAM [Анаэробная среда Гифу (GAM, Nissui)], с добавлением глюкозы, целлобиозы, мальтозы, L-арабинозы, фруктозы, фруктоолигосахаридов/инулина, маннита и лактата натрия)

- Кровяной агар для Brucella (BBA, Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010)

- ФЭА-среду с овечьей кровью (Anaerobe Systems; 5% агар с овечьей кровью с фенилэтиловым спиртом)

- Яично-желточный агар (EYA) (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010)

- Сульфитный молочный агар с полимиксином (Mevissen-Verhage et al., J. Clin. Microbiol. 25:285-289(1987))

- Муциновый агар (Derrien et al., IJSEM 54: 1469-1476 (2004))

- Полигалактуронатный агар (Jensen & Canale-Parola, Appl. Environ. Microbiol. 52:880-997 (1986))

- M2GSC (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010)

- Агар М2 (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) с добавлением крахмала (1%), маннита (0,4%), лактата (1,5 г/л) или лактозы (0,4%)

- Sweet В - Сердечно-мозговой агар (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) с добавлением дрожжевого экстракта (0,5%), гемина, цистеина (0,1%), мальтозы (0,1%), целлобиозы (0,1%), растворимого крахмала (Sigma, 1%), морфолинпропансульфоновая кислота (MOPS) (50 мМ, pH 7).

- ПДА с салицином (пептонно-дрожжевой агар с добавлением салицина) (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010).

- Модифицированный сердечно-мозговой бульон (М-BHI) [[сладкий и кислый]] содержит на литр: 37,5 г порошка сердечно-мозгового бульона (Remel), 5 г дрожжевого экстракта, 2,2 г мясного экстракта, 1,2 г экстракта печени, 1 г цистеина HCl, 0,3 г гиогликолята натрия, 10 мг гемина, 2 г растворимого крахмала, 2 г ФОС/инулина, 1 г целлобиозы, 1 г L-арабинозы, 1 г маннита, 1 Na-лактата, 1 мл Tween 80, 0,6 г MgSO4×7H2O, 0,6 г CaCl2, 6 г (NH4)2SO4, 3 г KH2PO4, 0,5 г K2HPO4, 33 мМ уксусную кислоту, 9 мМ пропионовую кислоту, 1 мМ изомасляную кислоту, 1 мМ изовалериановую кислоту, 15 г агара, и после автоклавирования добавляют 50 мл 8% раствора NaHCO3 и 50 мл 1М MOPS-KOH (pH 7).

- Агар для Eubacterium по Noack-Blaut (см. Noack et al. J. Nutr. (1998) 128:1385-1391)

- Агар BHIS az1/ge2 - BHIS az/ge (Reeves et. al. Infect. Immun. 80:3786-3794 (2012)) [Сердечно-мозговой агар (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) с добавлением дрожжевого экстракта 0,5%, цистеина 0,1%, 0,1% целлобиозы, 0,1% инулина, 0,1% мальтозы, азтреонама 1 мг/л, гентамицина 2 мг/л]

- BHIS CInM az1/ge2 - BHIS CInM [Сердечно-мозговой агар (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) с добавлением дрожжевого экстракта 0,5%, цистеина 0,1%, 0,1% целлобиозы, 0,1% инулина, 0,1% мальтозы, азтреонама 1 мг/л, гентамицина 2 мг/л]

Пример 15: Очищение и выделение спорообразующей фракции из экскрементов

[0308] Для очищения и избирательного выделения эффективных спор из фекального материала донорский материал сначала смешивают с солевым раствором с применением устройства гомогенизации (например, лабораторного блендера) для получения 20% суспензии (масса/объем). Добавляют 100% этанол в качестве инактивирующей обработки, продолжающейся от 10 секунд до 1 часа. Конечная концентрация спирта может варьировать от 30-90%, предпочтительно 50-70%. Выполняют высокоскоростное центрифугирование (3200 ОСЦ в течение 10 мин) для удаления растворителя; осадок сохраняют и промывают. Затем, после того как промытый осадок ресуспендирован, проводят этап центрифугирования на низкой скорости (200 ОСЦ в течение 4 мин) для удаления растительных частиц большого размера, и сохраняют супернатант, содержащий споры. Выполняют высокоскоростное центрифугирование (3200 ОСЦ в течение 10 мин) супернатанта для концентрирования спорового материала. Затем промывают и ресуспендируют осадок для получения 20% суспензии. Указанная суспензия представляет собой обработанный этанолом состав со спорами. Концентрированную суспензию отделяют в градиенте плотности, например, в градиенте CsCl, сахаразы или с использованием их комбинации, с получением обработанного этанолом очищенного в градиенте состава со спорами. Например, очищение в градиенте CsCl проводят, загружая 20% объема суспензии спор сверху на 80% объема последовательного градиента CsCl (масса/объем), содержащего уровни 64%, 50%, 40% CsCl (масса/объем), и центрифупгэуя в течение 20 минут на 3200 ОСЦ. Затем споровую фракцию пропускают через градиент сахарозы с уровнями 67%, 50%, 40% и 30% (масса/объем). При центрифугировании в качающемся бакет-роторе в течение 10 мин при 3200 ОСЦ. Споры остаются в основном в 30% и 40% фракциях сахарозы. Нижнюю споровую фракцию (фиг. 2) извлекали и промывали с получением концентрированного обработанного этанолом очищенного в градиенте состава со спорами. Используя светоотражающие свойства спор, наблюдаемые при применении фазово-контрастной микроскопия (споры яркие и отражают свет, в то же время проросшие споры и вегетативные клетки выглядят темными), можно наблюдать обогащение споровой фракцией бактериальных клеток из суспензии фекалий (фиг. 3, слева) по сравнению с обработанным этанолом очищенном в градиенте CsCl составом со спорами (фиг. 3, в центре) и обработанным этанолом очищенном в градиенте CsCl и в градиенте сахарозы составом со спорами (фиг. 3, справа).

[0309] Кроме того, рост спор после обработки способствующим прорастанию веществом может также использоваться для количественного определения жизнеспособной популяции спор. Вкратце, образцы инкубировали со способствующим прорастанию веществом (бычья желчь, 0,5%, до 1 часа), разводили и высевали в анаэробных условиях на ВВА (кровяной агар для Brucella) или аналогичную среду (см., например, примеры 4 и 5). Точечно отбирали индивидуальные колонии и выделяли ДНК для полноразмерного 16S-секвенирования для идентификации видового состава (см., например, примеры 2 и 3). Анализ показал, что всего присутствовало 22 вида (таблица 2), большинство из которых присутствует и в материале, очищенном с применением градиента, так и в материале, очищенном без применения градиента, что указывает на отсутствие сдвига или на присутствие несущественного сдвига экогруппы в результате очищения в градиенте. Подсчет выхода спор демонстрирует эффективное выделение 38% спор исходного фекального материала, как показывает прорастание и посев спор на ВВА или измерение уровня ДПК в образце.

Пример 16: Бактериальные композиции предотвращают инфекцию C. difficile в модели на мышах

[0310] Для тестирования терапевтического потенциала бактериальных композиций использовали модель на мышах профилактики инфекции C. difficile (модель на основе Chen, et al., A mouse model of Clostridium difficile associated disease, Gastroenterology 135(6): 1984-1992). Две клетки, каждая с пятью мышами, использовали для тестирования для каждой группы эксперимента. Все мыши получали коктейль антибиотиков, состоящий из 10% глюкозы, канамицина (0,5 мг/мл), гентамицина (0,044 мг/мл), колистина (1062,5 ед/мл), метронидазола (0,269 мг/мл), ципрофлоксацина (0,156 мг/мл), ампициллина (0,1 мг/мл) и ванкомицина (0,056 мг/мл) в питьевой воде с -14 по -5 день включительно, и дозу 10 мг/кг клиндамицина через оральный зонд на -3 день. На -1 день они получали либо тестируемый состав, либо контроль-носитель через оральный зонд. На 0 день их стимулировали введением приблизительно 4,5 log10 КОЕ C. difficile (ATCC 43255) через оральный зонд. Необязательно группа положительного контроля получала ванкомицин с -1 по 3 день помимо антибиотика и описанной выше стимуляции C. difficile. Экскременты собирали из клеток для анализа носительства бактерий, смертность оценивали каждый день с 0 по 6 день, и оценивали массу тела и последующее изменение массы тела у животного, при этом снижение массы тела считали связанным с инфекцией C. difficile. Смертность и уменьшение снижения массы тела при применении тестируемого состава по сравнению с основой использовали для оценки успешности применения тестируемого состава. Кроме того, проводили оценку симптомов C. difficile ежедневно, с -1 по 6 день включительно. Клинический показатель присваивали по шкале от 0 до 4, комбинируя показатели внешнего вида (0-2 пункта на основании нормального внешнего вида, сгорбленности, пилоэрекции или летаргического состояния) и клинические признаки (0-2 пункта на основании нормального внешнего вида, мокрого хвоста, пониженной на ощупь температуры или изоляции от других животных).

[0311] В нестимулированной контрольной группе животных стимулировали C. difficile. В группе положительного контроля с ванкомицином животные получали дозу C. difficile и лечение ванкомицином с -1 по 3 день включительно. Отрицательный контроль получал через зонд только ФСБ без бактерий. В экспериментальных группах тестировали разведения 1×, 0,1×, 0,01× происходящие из состава с обработанными этанолом спорами от одного донора (см., например, пример 6) или термообработанные экскременты, полученные путем нагревания 20% суспензии в течение 30 минут при 80С. Дозы для подсчитанных КОЕ определяли по конечным обработанным этанолом спорам; вводили разведения от общего числа спор, дозы 1×, 0,1×, 0,01× споровой смеси для обработанной этанолом фракции, и дозу 1× для термообработанной фракции.

[0312] Снижение массы тела и смертность оценивали на 3 день. У отрицательного контроля, получавшего только C. difficile, наблюдалась 20% смертность и снижение массы тела на 3 день, тогда как у положительного контроля, получавшего 10% суспензию фекалий человека, не наблюдалось смертей или снижения массы тела на 3 день (Таблица 3). Обработанные EtOH экскременты предотвращают смертность и снижение массы тела в трех разведениях, а термообработанная фракция оказывала защитный эффект в единственной протестированной дозировке. Эти данные указывают на то, что споровая фракция эффективна для предотвращения инфекции C. difficile у мышей.

Пример 17: Модель профилактики и предотвращения рецидивов на хомяках

[0313] Предыдущие исследования на хомяках с применением токсигенных и нетоксигенных штаммов C. difficile показали, что модель на хомяках подходит для изучения рецидивов после лечения антибиотиками и эффектов профилактического лечения флорой слепой кишки при инфекции C. difficile (Wilson et al. 1981, Wilson et al. 1983, Borriello et al. 1985) и, в более широком смысле, инфекционной болезни желудочно-кишечного тракта. Для демонстрации профилактического применения тестируемого состава для облегчения инфекции C. difficile используют следующую модель на хомяках. В профилактической модели клиндамицин (10 мг/кг п/к) вводят на -5 день, тестируемый состав или контроль вводят на -3 день, а стимуляция C. difficile происходит на 0 день. В группе положительного контроля затем вводили ванкомицин на 1-5 день (а контроль-носитель вводили на -3 день). Экскременты собирают на -5, -4, -1, 1, 3, 5, 7, 9 день и оценивают носительство и снижение уровня патогена в образцах фекалий с помощью микробиологических методов, 16S-секвенирования или других способов, используемых специалистами в данной области техники. Смертность оценивают на протяжении эксперимента в течение 21 дня после стимуляции C. difficile. Кривые процента выживаемости показывают, что обработанные этанолом споры и обработанные этанолом очищенные в градиенте споры оказывают лучший защитный эффект на хомяков по сравнению с ванкомициновым контролем и контролем-носителем.

[0314] См. фиг. 4: Профилактическая модель с обработанным этанолом составом со спорами и обработанным этанолом очищенным в градиенте составом со спорами.

[0315] В модели предотвращения рецидива хомяков стимулируют токсигенными штаммами C. difficile на 0 день, вводят клиндамицин через оральный зонд на 1 день и дозируют ванкомицином на 2-6 день. Затем вводят экспериментальное или контрольное лечение на 7, 8 и 9 день. Состав хомяков для каждой группы включал 8 хомяков на группу. Фекальный материал собирают на -1, 1, 3, 5, 7, 10 и 13 день и оценивают смертность у хомяков на протяжении всего эксперимента. Кривые выживаемости используют для оценки успешности применения тестируемого состава, например, обработанных этанолом спор, или обработанных этанолом очищенных в градиенте спор относительно контрольного лечения для предотвращения смертности у хомяков. Кривые выживаемости демонстрируют максимальную эффективность обработанных этанолом очищенных в градиенте спор, затем идут обработанные этанолом споры. Оба варианта лечения увеличивали процент выживаемости по сравнению с лечением только ванкомицином

[0316] См. фиг. 5: Модель предотвращения рецидива с обработанными этанолом спорами и обработанными этанолом очищенными в градиенте спорами

Пример 18: Клиническое лечение рецидивирующей C. difficile у пациентов

[0317] Для оценки эффективности тестируемого состава (например, обработанных этанолом составов со спорами, см. пример 15) для лечения рецидивирующей C. difficile у пациентов-людей выполняли следующую процедуру: брали экскременты от здорового донора, инактивировали с применением описанного ниже протокола обработки этанолом состава со спорами, и лечили рецидивирующую C. difficile у пациентов, имеющих такие показания. Проводили скрининг общего анамнеза не являющихся родственниками доноров на отсутствие хронических медицинских состояний (в том числе воспалительного заболевания кишечника; синдрома раздраженного кишечника; целиакии; или любых злокачественных новообразований ЖКТ или полипоза в анамнезе), отсутствие факторов риска в отношении передаваемых инфекций, отсутствие использования антибиотиков в течение предшествующих 6 месяцев, и отрицательные результаты лабораторных анализов на передаваемые с кровью патогены (ВИЧ, ТЛВЧ, ВГС, ВГВ, ЦМВ, ВГА и Treponema pallidum) и фекальные бактериальные патогены (Salmonella, Shigella, Yersinia, Campylobacter, E. coli 0157), яйца паразитов и паразиты, и другие инфекционные агенты (Giardia, Cryptosporidium Cyclospora, Isospora) до сдачи стула.

[0318] Экскременты донора быстро замораживали после получения и готовили образцы для тестирования. Для использования приблизительно 75 г экскрементов донора размораживали и ресуспендировали в 500 мл небактериостатического нормального солевого раствора и перемешивали в одноразовом стеклянном или пластиковом блендере. Полученную суспензию последовательно проводили через стерильные одноразовые сита, устраняющие частицы размером 600, 300 и 200 микрон. Затем суспензию непродолжительно центрифугировали (200 ОСЦ в течение 4 мин) для разделения волокнистого материала и частиц, и супернатант (содержащий бактериальные клетки и споры) переносили в новый контейнер. Этанол добавляли до конечной концентрации 50% и полученную ~1500 мл суспензию инкубировали при комнатной температуре на протяжении 1 часа при непрерывном перемешивании для инактивации вегетативных бактериальных клеток. В середине инактивации суспензию переносили в новый сосуд для подтверждения полного контакта с этанолом. Твердое вещество осаждали центрифугированием и троекратно промывали нормальным солевым раствором для удаления остаточного этанола. Полученный осадок ресуспендировали в минимальном объеме 100% стерильного глицерина чистоты USP и наполняли приблизительно 30 капсул для отсроченного высвобождения размера 0 (гипромеллозные капсулы DRcaps, Capsugel, Inc.), no 0,65 мл суспензии в каждую капсулу. Капсулы немедленно закрывали и помещали на замораживающий алюминиевый блок с сухим льдом при температуре -80°C для замораживания. Замороженные капсулы, в свою очередь, заключали в капсулы DRcaps размера 00 для повышения стабильности капсул, наносили метки и немедленно помещали на хранение при температуре <-65°С. Конечный продукт хранили при <-65°С до дня и момента использования. Инкапсулированный продукт может храниться неопределенно долго при <-65°С. В день дозирования капсулы нагревали на водном льду в течение 1-2 часов для улучшения переносимости, и затем вводили с водой ad libitium.

[0319] Пациент 1 представляет собой женщину возрастом 45 лет с инфекцией C. difficile и диареей в анамнезе по меньшей мере за 1 год до лечения. Ранее она получала лечение несколькими курсами антибиотиков, после которых каждый раз возникал рецидив связанной с C. difficile диареи.

[0320] Пациент 2 представляет собой женщину в возрасте 81 года, страдавшую рецидивирующей инфекцией C. difficile на протяжении 6 месяцев до лечения, несмотря на адекватную терапию антибиотиками после каждого рецидива.

[0321] За 24 часа до начала перорального лечения терапию антибиотиками против CDAD прекращали. У каждого пациента проводили подготовку толстой кишки с целью уменьшить конкурентную микробную нагрузку в желудочно-кишечном тракте и облегчить восстановление популяции спорообразующими организмами в исследуемом продукте.

[0322] Утром первого дня лечения пациенты получали дозу в виде капсул с отсроченным высвобождением, содержащих исследуемый продукт, с водой ad libitum. Пациентов просили воздержаться от приема пищи в течение 1 часа после приема. На следующий день пациент возвращался в клинику для получения дополнительной дозы. Пациентов просили воздержаться от приема пищи в течение 4 часов до получения второй дозы и в течение 1 часа после дозирования.

[0323] Проводилось тщательное наблюдение за обеими пациентками для обнаружения признаков рецидива или нежелательных симптомов после лечения. Пациенткам звонили по телефону на 2 день, 4 день и через 1, 2 и 4 недели, и каждую пациентку опрашивали относительно общего состояния и состояния CDAD и связанных симптомов. Образцы стула собирали в исходный момент и через 1, 2, 4 и 8 недель после лечения для оценки изменений в микробиоте кишечника путем 16S-секвенирования и подсчета спор с помощью описанных ранее способов (см., например, примеры 11 и 12). На протяжении 4 недель после лечения у каждой пациентки наблюдалось постепенное улучшение без признаков рецидива C. difficile.

[0324] Шестеро других пациентов с рецидивирующей связанной с C. difficile диарей получали аналогичное лечение, рецидивы CDI отсутствовали и не требовалось возобновление применения антибиотиков (всего 8 пациентов). Кроме того, отсутствовали связанные с лечением серьезные нежелательные явления.

Пример 19: обработка суспензии фекалий этанолом или термообработка значительно уменьшает число вегетативных клеток и приводит к обогащению спорообразующими видами

[0325] Обработка образца, предпочтительно образца фекалий человека, для инактивации или гибели по существу всех вегетативных форм бактерий, присутствующих в указанном образце, приводит к отбору и обогащению по споровой фракции. Способы инактивации могут включать нагревание, сонификацию (обработку ультразвуком), лизирование детергентами, ферментативное расщепление (например, лизоцимом и/или протеиназой K), обработку этанолом или кислотой, воздействие растворителями (тетрагидрофураном, 1-бутанолом, 2-бутанолом, 1,2 пропандиолом, 1,3 пропандиолом, бутаноатом, пропаноатом, хлороформом, простым диметилэфиром и детергентом наподобие Тритона Х-100, простым диэтилэфиром), или комбинацию указанных способов. Чтобы показать эффективность индуцированной этанолом инактивации вегетативных клеток, 10% суспензию фекалий смешивали с абсолютным этанолом в соотношении 1:1 и перемешивали на вортексе в течение 1 минуты. Суспензию инкубировали при комнатной температуре в течение 30 минут, 1 ч, 4 ч или 24 ч. После инкубирования суспензию центрифугировали при 13000 об/мин в течение 5 минут для осаждения спор. Супернатант утилизируют, а осадок ресуспендируют в равном объеме ФСБ. Жизнеспособные клетки подсчитывали согласно приведенному ниже описанию.

[0326] Чтобы показать эффективность термообработки для инактивации вегетативных клеток, 10-20% суспензию фекалий инкубировали при 70°С, 80°С, 90°С или 100°С в течение 10 мин или 1 часа.

[0327] После обработки этанолом или термообработки оставшиеся жизнеспособные клетки подсчитывали после 24 часов инкубирования на планшетах путем определения зависимости титра бактерий на кровяном агаре для Brucella (BBA) от обработки и времени (см. фиг. 6). Обработка этанолом в течение 1 часа и 25 часов оказывала аналогичный эффект, уменьшая число жизнеспособных клеток приблизительно на 4 log, тогда как повышение температуры и времени воздействия высокими температурами приводит к большему уменьшению числа жизнеспособных клеток, при отсутствии детектируемых колоний при воздействии 100°С на протяжении либо 10 минут, либо 1 часа. В данном эксперименте не использовались способствующие прорастанию вещества. Через несколько дней дополнительного культивирования на планшетах несколько колоний отбирали точечным методом из обработанных образцов и идентифицировали посредством анализа 16S рРНК (см., например, примеры 11 и 12). Они включали известные спорообразующие Clostridium spp. а также виды, ранее не описанные как спорообразующие бактерии, в том числе Ruminococcus bromii и Anaerotruncus colihominis (Lawson, et al 2004), и Eubacterium sp. (таблица 4). См. фиг. 6: Термообработка и обработка этанолом уменьшают жизнеспособность клеток

[0328] Чтобы показать, что число вегетативных клеток значительно уменьшается при обработке этанолом, известные неспорообразующие бактерии обрабатывает этанолом согласно приведенному описанию (см., например, пример 15) и определяли жизнеспособность путем посева на ВВА в анаэробных условиях (см., например, пример 14). Фекальный материал от четырех независимых доноров подвергали действию температуры 60°С в течение 5 минут, а затем высевали на три типа селективных сред либо в аэробных (+O2), либо в анаэробных условиях (-O2) (ВВА + аэробная среда, Мак-Конки с лактозой + аэробная среда, среда для Bacteroides с желчными кислотами и эскулином + анаэробная среда) для идентификации известных неспорообразующих Enterobacteria (выживающих на агаре Мак-Конки) и бактерий группы Bacteroides fragilis (выживающих на чашках с агаром для Bacteroides с желчными кислотами и эскулином). Предел детекции данных анализов составляет приблизительно 20 КОЕ/мл. Способствующие прорастанию вещества не использовались в данном эксперименте (фиг. 7). И обработка этанолом, и термоактивации значительно снижают жизнеспособность клеток из фекального материала до порога детекции при применении лактозного агара Мак-Конки и агара ВВЕ. Оставшиеся клетки, идентифицированные на среде ВВА при культивировании в анаэробных условиях, содержат независимые от способствующих прорастанию веществ спорообразующие виды. См. фиг. 7: Уменьшение количества неспорообразующих вегетативных клеток при обработке температурой 60°С в течение 5 минут

[0329] Кроме того, при обработке этанолом, как было показано, быстро гибнут как аэробные, так и неспорообразующие анаэробные колониеобразующие единицы в 10% суспензии фекалий, как было определено путем посева на богатую среду (ВВА). Уменьшение количества высеваемых КОЕ составляет 4 порядка величины за секунды, как показано на фиг. 8.

[0330] См. фиг. 8: Видно, что с течением времени обработка этанолом уменьшает число КОЕ как анаэробных, так и аэробных бактерий

Пример 20: Виды, идентифицированные и выделенные как спорообразующие бактерии при обработке этанолом

[0331] Чтобы показать, что при применении способов термообработки или обработки этанолом происходит обогащение спорообразующими видами, проводили сравнение >7000 изолятов колоний с повторностями для идентификации видов (например, идентифицировали независимым образом в нескольких составах, см. примеры 1, 2 и 3), выделенных только из суспензии фекалий, обработанной 50% этанолом или термообработанной, и не выделенных из необработанной суспензии фекалий (таблица 5). Эти данные указывают на возможность отбора спорообразующих видов из фекального материала, и идентифицируют как спорообразующие бактерии организмы, ранее не описанные как спорообразующие в литературе. В каждом случае организмы отбирали точечным методом в виде изолированных колоний, культивировали в анаэробных условиях, а затем проводили полноразмерное 16S-секвенирование для идентификации видов.

[0332] Для дальнейшей идентификации спорообразующих бактерий обработанные этанолом образцы фекалий от доноров А, В, С, D, Е и F высевали на разнообразные типы твердых сред, одиночные колонии собирали точечным методом и культивировали в бульоне в формате 96-луночных планшетов (таблицы 6-11). Затем амплифицировали посредством ПЦР ген 16S рРНК и выполняли прямое циклическое секвенирование (см. примеры 11 и 12). Идентификация основана на прямых прочтениях, полученных при прямом циклическом секвенировании гена 16S рРНК.

[0333] У разных индивидуумов наблюдается неожиданная гетерогенность микробиомов (Clemente et al., 2012), что оказывает влияние на определение потенциальной эффективности различных доноров для получения подходящий споровых композиций. Описанный ниже способ подходит для скрининга доноров, в тех случаях, когда, например, целесообразно или необходимо получение конкретного количества или разнообразия спорообразующих организмов для репопуляции микробиома после лечения антибиотиками или лечения конкретного заболевания или состояния. Кроме того, такой скрининг целесообразен в случаях, когда существует потребность в проведении скрининга доноров с целью выделения микроорганизмов, способных к спорообразованию, или в случаях, когда требуется получить очищенный состав спорообразующих организмов от конкретного донора.

[0334] Общее число спор также представляет собой меру активности конкретного донорского материала или очищенного состава со спорами, и критически важен для определения качества материала, необходимого для обеспечения требуемого уровня дозы. Для исследования вариабельности общего числа спор донорские образцы получали и обрабатывали согласно описанию в предыдущих примерах. Затем определяли число спор в материалах донора в КОЕ/г путем культивирования на чашках со средой в различных титрах для определения содержания спор в донорском материале. Кроме того, для оценки содержания спор использовали анализ ДПК (обозначено как «споровый эквивалент») согласно описанию в примере 21. Как видно на фиг. 9, у индивидуальных доноров в течением времени наблюдается различие, составляющее 2log, а между разными донорами возможны отличия, составляющие до 3log. Одной из возможных причин различий в содержании спор является то, что нежизнеспособные споры и неспособные к прорастанию споры не выявляются при посеве, однако содержат достаточно ДПК для измерения. Другая возможность заключается в том, что из-за межвидовой вариабельности содержания ДПК в спорах некоторые сложные смеси содержат богатые ДПК споры, тогда как другие смеси содержат бедные ДПК споры. Отбор доноров, обеспечивающих высокое число спор, важен для определения продуктивности выделения спор из образцов донорских фекалий путем идентификации предпочтительных доноров.

[0335] См. фиг. 9: Концентрация спор в донорском материале от клинических доноров

[0336] Свежий образец фекалий от донора F обрабатывали согласно описанию в примере 15 для получения обработанной этанолом споровой фракции, проращивали обработкой BHIS с бычьей желчью в течение 1 ч согласно описанию (см., например, Пример 13), а затем высевали на разнообразные среды (см., например, пример 14). Колонии высевали точечным методом, следя за тем, чтобы несколько колоний каждого морфологически отличного типа попало в каждую чашку для захвата максимально возможного разнообразия. Колонии подсчитывают на чашках с каждым типом среды с хорошо изолированными колониями для подсчета числа колониеобразующих единиц на мл (таблица 12). Колонии высевали точечным методом на одну из нескольких жидких сред, определяли 16S рРНК последовательности (см., например, примеры 11 и 12) и анализировали согласно описанию выше. Число уникальных OTU для каждого типа среды приведено внизу, первыми указаны среды с наибольшим числом уникальных OTU (таблица 12). Комбинации 3-5 первых 5 типов сред обеспечивают разнообразие, а некоторые другие могут быть выбраны для нацеливания на конкретные представляющие интерес виды. Колониеобразующие единицы могут быть подсчитаны для определенного вида с использованием данных 16S, и указанные значения могут использоваться для определения того, представлен ли на достаточной уровне определенный организм. Совокупность спор от донора F согласно определению в данном эксперименте включает указанные 52 вида согласно данным 16S-секвенирования (таблица 12).

[0337] Для скрининга доноров-людей на присутствие разнообразия спорообразующих бактерий и/или на специфические споробразующие бактерии, образцы фекалий подготавливали с применением способствующих прорастанию веществ и селективных методов культивирования, собирали колонии точечным методом (см., например, примеры 13 и 14) и анализировали разнообразие 16S согласно приведенному описанию (см. примеры 11 и 12). Оценка разнообразия у донора может включать подсчет КОЕ/мл устойчивых к этанолу клеток на среде определенного типа, или КОЕ/мл определенного вида, с применением анализа 16S полученных на указанной среде точечным методом колоний для определения уровня спор определенного представляющего интерес вида. Указанный тип основанного на культивировании анализа может быть дополнен независимыми от культивирования способами, такими как кПЦР с зондами, специфическими в отношении видов или родов, представляющих интерес, или метагеномное секвенирование составов со спорами, или 16S-профилирование составов со спорами с применением методов секвенирования вариабельных областей от Illumina 16S (см., например, примеры 11 и 12).

Пример 21: Количественное определение концентрации спор с применением анализа на ДПК

[0338] Способы оценки концентрация спор в сложных смесях, как правило, требуют разделения и отбора спор с последующим культивированием индивидуальных видов для определения числа колониеобразующих единиц. На существующем уровне техники отсутствуют способы количественного проращивания всех спор сложной смеси, поскольку для многих видов не были идентифицированы подходящие способствующие прорастанию вещества. Кроме того, споруляция предположительно является стохастическим процессом в результате эволюционного отбора, что означает, что не все споры одного вида прорастают с одинаковым откликом на воздействие способствующим прорастанию веществом в некоторой концентрации и с некоторой продолжительностью и другие условия окружающей среды. Как вариант, был разработан способ количественного определения споровых частиц в образце на основе ключевого метаболита бактериальных спор, дипиколиновой кислоты (ДПК), позволяющий избежать влияния на результаты фекальных загрязняющих примесей. В указанном анализе использован тот факт, что ДПК хелатирует Тербий 3+ с образованием люминесцентного комплекса (Fichtel et al, FEMS Microbiology Ecology, 2007; Kort et al. Applied and Environmental Microbiology, 2005; Shafaat and Ponce, Applied and Environmental Microbiology, 2006; Yang and Pones, International Journal of Food Microbiology, 2009; Hindle and Hall, Analyst 1999). При флуоресцентном анализе с временным разрешением детектируется люминесценция тербия в присутствии ДПК, что обеспечивает количественную оценку концентрации ДПК в растворе.

[0339] Для проведения анализа 1 мл оцениваемого спорового стандарта переносили в микроцентрифужную пробирку объемом 2 мл. Образцы центрифугировали на 13000 ОСЦ в течение 10 мин, и образец промывали в 1 мл стерильной деионизированной Н2О. Еще раз промывали, повторяя центрифугирование. Переносили 1 мл раствора в пробирки Хангейта и автоклавировали образцы в режиме пара в течение 30 минут при 250С. Добавляли 100 мкл 30 мкМ раствора TbCl3 (400 мМ ацетата натрия, pH 5, 0, 30 мкМ TbCl3) к образцу. Получали серийные разведения автоклавированного материала и измеряли флуоресценцию каждого образца с возбуждением светом на 275 нм и измерением излучения на длине волны 543 нм со временем интегрирования 1,25 мс и задержкой 0,1 мс.

[0340] Очищенные споры получали согласно существующему описанию (например, см. http://www.epa.gov/pesticides/способы/MB-28-00.pdf). Готовили серийные разведения очищенных спор из культур C. bifermentans, C. sporogenes и C. butyricum и оценивали путем посева на среду ВВА и инкубирования в течение ночи при 37°С для определения значения КОЕ/мл. На фиг. 10 представлена линейная зависимость у разных спорообразующих бактерий, с изменениями, составляющими несколько логарифмических единиц, подтверждающая, что анализ ДПК подходит в качестве способа оценки содержания спор.

[0341] См. фиг. 10: Линейный диапазон анализа ДПК по сравнению с подсчетом числа КОЕ/мл

[0342] Расхождение между оценкой содержания спор по числу КОЕ способных, к прорастанию спор и оценкой при анализе ДПК для сложных популяций спор имеет большое значение для определения активности обработанного этанолом состава со спорами при клиническом применении. В таблице АС приведены данные по содержанию спор для 3 разных обработанных этанолом составов со спорами, использованных для успешного лечения 3 пациентов страдающих рецидивирующей инфекцией C. difficile. Содержание спор для каждого состава со спорами определяют с применением двух описанных способов.

[0343] Очевиден тот факт, что содержание спор в 30 капсулах значительно варьирует. При оценке по способным к прорастанию СКОЕ содержание спор варьирует более чем в 10000 раз. По оценке с применением анализа ДПК содержание спор варьирует более чем в 100 раз. В отсутствие анализа ДПК сложно установить минимальную дозу для введения пациенту. Например, в отсутствие данных анализа ДПК можно заключить, что минимальная эффективная доза спор составляет 4×105 или менее с применением анализа СКОЕ (например, состав 1, таблица АС). Однако при использовании указанной дозы СКОЕ для нормирования доз в клинических условиях фактическая доза спор, получаемая пациентами, будет значительно ниже для других обработанных этанолом составов со спорами по оценке с применением анализа ДПК (таблица AD).

[0344] Становится ясно, что из-за вариабельности показателей СКОЕ и ДПК в разных донорских материалах использование СКОЕ в качестве меры активности в определенных случаях будет приводить к существенному занижению дозы. Например, выбор дозы 4×105 СКОЕ (измеренная эффективная доза для донорского состава 1) для продукта с составом 3 приведет к потенциальному более чем 100-кратному занижению дозы. Эта ситуация может быть исправлена только определением активности на основании анализа ДПК, лучше отражающим общее число спор в обработанном этанолом составе со спорами. Неожиданное открытие, сделанное авторами настоящего исследования, заключается в том, что анализ ДПК уникальным образом подходит для определения активности и дозировок обработанного этанолом состава со спорами.

Пример 22: Демонстрация улучшения роста при воздействии способствующим прорастанию веществом

[0345] Для повышения способности к прорастанию обработанных этанолом спор и демонстрации жизнеспособности спор споры от трех разных доноров проращивали с применением различной обработки и высевали на разные среды. Стимуляцию прорастания с применением BHIS/бычьей желчи (BHIS ох), Са-ДПК, сока рубца (RF), искусственного желудочного сока (ИЖС), муциновой среды (Muc), фетальной бычьей сыворотки (ФБС) или тиогликолята (Thi) в течение 1 часа при 37°С в анаэробных условиях проводили согласно имеющемуся описанию (см., например, примеры 13 и 14) на образцах от двух независимых доноров (фиг. 11). Обработанную способствующим прорастанию спор веществом смесь серийно разводили и высевали на чашки с различными средами, в том числе ВВА, Sweet В, Sweet В + лизоцим (2 мкг/мл), M2GSC и M2GSC + лизоцим (2 мкг/мл) согласно вышеприведенному описанию (см., например, примеры 13 и 14) для оценки прорастания спор. Подсчитывали колониеобразующие единицы и определяли титры с применением стандартных техник, известных специалистам в данной области техники. Ка видно на фиг. 11, максимальное число колониеобразующих единиц получено при обработке BHI с бычьей желчью. Указанная стимулирующая прорастание обработка также значительно увеличивает разнообразие, судя по оценке числа OTU, идентифицированных при 16S-секвенировании образцов (см., например, примеры 11 и 12) по сравнению с посевами без этапа стимуляции прорастания (фиг. 12). Как видно на фиг. 11, обработка разными способствующими прорастанию веществами оказывает варьирующие эффекты на число КОЕ от донора А (сверху слева) и донора В (снизу справа). По оси Y отложено число КОЕ спор на мл. Как видно на фиг. 12, проращивание значительно повышает разнообразие культивированных спорообразующих OTU.

[0346] Для тестирования эффекта термоактивации на стимуляцию прорастания обработанные этанолом образцы фекалий от трех разных доноров обрабатывали в течение 15 мин, воздействуя комнатной температурой, температурой 55С, 65С, 75С или 85С, а затем проращивали с применением BHIS + Бычья желчь в течение 1 ч при 37°С и высевали на среду ВВА (фиг. 13) согласно вышеприведенному описанию (см., например, примеры 13 и 14). Предварительное воздействие комнатной температурой обеспечивало получение равного или даже большего количества спор, чем воздействие более высокими температурами, для образцов от всех трех доноров. Также исследовали влияние температуры при проращивании, инкубируя образцы при комнатной температуре или при 37С на протяжении 1 часа в анаэробных условиях до посева на ВВА. Различий в количествах КОЕ для указанных двух вариантов условий не наблюдалось. Также тестировали влияние добавления лизоцима в чашки (2 мкг/мл) на образце от одного донора, используя различные температуры активации с последующим инкубированием в присутствии или в отсутствие лизоцима. Добавление лизоцима оказывало незначительный эффект при посеве на среду Sweet В или M2GSC, но меньший, чем при обработке BHIS с бычьей желчью без лизоцима в течение 1 часа (фиг. 14).

[0347] Как видно на фиг. 13, термоактивация в качестве стимулирующей прорастание обработки с применением BHIS + бычья желчь. Как видно на фиг. 14, лизоцим оказывает незначительный эффект, способствующий прорастанию.

[0348] Также исследовали время прорастания, обрабатывая 10% суспензию обработанных этанолом экскрементов от одного донора (см., например, пример 15), чем-либо из BHIS, таурохолата, бычьей желчи или Germix в течение 0, 15, 30 или 60 минут с последующим посевом на среду BHIS, EYA или ВВА (см., например, примеры 13 и 14). Через 60 минут большинство КОЕ во всех использованных комбинациях прорастали и тестирование сред завершалось.

Пример 23: Демонстрация эффективности способных к прорастанию и способных к споруляции фракций обработанных этанолом спор

[0349] Для оценки способов идентификации и очищения, и для усиления (например, путем модуляции разнообразия в композициях) активной спорообразующей экогруппы, происходящей из образцов донорских фекалий, обработанную этанолом популяцию спор (согласно описанию в примере 15) дополнительно разделяли на фракции. «Способную к прорастанию фракцию» получали обработкой обработанного этанолом состава со спорами бычьей желчью, посевом на различные твердые среды с последующим, через 2 дня или 7 дней культивирования, соскобом всех выросших бактерий с чашек в 5 мл ФСБ на чашку для получения бактериальной суспензии. «Способную к споруляции фракцию» получали согласно описанию выше, за исключением того, что клеткам позволили расти на твердой среде в течение 2 дней или 7 дней (продолжительность увеличивали для обеспечения споруляции, что является обычным для протоколов споруляции), и полученную бактериальную суспензию обрабатывали 50% этанолом для получения популяции «способных к споруляции» спор, или видов, способных образовывать споры. При подготовке указанных фракций фекальный материал от донора А использовали для получения обработанного этанолом состава со спорами согласно вышеприведенному описанию в примере 15; затем содержание спор определяли анализом ДПК и КОЕ/мл при культивировании на разных средах (фиг. 15) согласно вышеприведенному описанию (см. пример 21). См. фиг. 15: Споры, изначально присутствующие в обработанном этанолом составе со спорами по оценке с применением ДПК и КОЕ/мл при культивировании на определенных средах.

[0350] Для определения фракции, которая способна к споруляции оценивали содержание КОЕ и ДПК в 2-дневных и 7-дневных «способных к прорастанию» фракциях до и после обработки этанолом для получения споровой фракции. Бактериальные суспензии обрабатывали этанолом, проращивали с применением бычьей желчи, и высевали на те же типы сред, на которых культивировали «способную к прорастанию» фракцию. Данные по ДПК показали, что при культивировании на чашках в течение 2 и 7 дней образовывалось такое же общее количество спор. Колонии с нескольких типов сред собирали точечным методом для анализа последовательностей 16S для идентификаций присутствующих спорообразующих бактерий (таблица 13).

[0351] 2-дневную «способную к прорастанию» фракцию и 7-дневную «способную к споруляции» фракцию использовали для лечения в аналитической модели профилактики на мышах согласно приведенному описанию (см., например, пример 16). В качестве контроля подготовленную 10% суспензию фекалий от донора (Донор В) также вводили мышам для моделирования трансплантации фекальной микробиоты (FMT). Снижение массы тела и смертность в различных экспериментальных и контрольных группах исследования представлены на графиках на фиг. 17 и обобщены в таблице 15, которая также содержит информацию о дозировках. Указанные данные ясно показывают, что и «способная к прорастанию» и «способная к споруляции» фракции эффективны для защиты мышей от C. difficile при стимуляции C. difficile в модели профилактики на мышах (см., например, пример 16). Эффективность указанных фракций показывает также, что присутствующие в них виды ответственны за эффективность споровой фракции, поскольку выделение фракций дополнительно уменьшает присутствие каких бы то ни было потенциальных загрязняющих примесей из исходного состава со спорами.

[0352] См. фиг. 16: Титр «способной к прорастанию» фракции через 2 дня (слева) и способной к споруляции фракции (справа), по ДПК и КОЕ/мл. «Способную к споруляции» фракцию, полученную через 7 дней роста, измеряли согласно вышеприведенному описанию с применением анализов прорастания и роста или содержания ДПК согласно вышеприведенному описанию (см. пример 21).

[0353] Виды, присутствующие в «способных к прорастанию» и «способных к споруляции» фракциях определяли посредством секвенирования полноразмерных 16S полученных точечным методом колоний и посредством 16S-секвенирования нового поколения (16S-NGS) собственно фракций. Данные для выделенных точечным методом колоний указывают на то, что виды Clostridium очень многочисленны в обеих фракциях, а данные NGS-секвенирования показывают наличие других спорообразующих организмов, которые, как правило, обнаруживаются в обработанных этанолом составы со спорами.

[0354] Результаты представлены следующим образом: см. таблицу 13. Виды, идентифицированные как «способные к прорастанию» и «способные к споруляции» с применением точечного метода выделения колоний. См. таблицу YYY. Виды, идентифицированные как «способные к прорастанию» с применением 16S-V4 NGS-секвенирования. См. таблицу ZZZ. Виды, идентифицированные как «способные к споруляции» с применением подхода 16s-V4 NGS. См. фиг. 17: В модели профилактики на мышах продемонстрировано, что «способные к прорастанию» и «способные к споруляции» составы обеспечивают защиту при стимуляции C. difficile. Каждый график отражает изменение индивидуальной массы тела мышей относительно дня -1 на протяжении эксперимента. Число смертей на протяжении эксперимента указано сверху над графиком и отражено линейным окончанием перед днем 6. На верхних панелях (слева направо) представлены группа с контролем-носителем, группа с суспензией фекалий и группа необработанного нестимулированного контроля, тогда как нижние панели соответствуют обработанному этанолом очищенному в градиенте составу со спорами; обработанному этанолом очищенному в градиенте «способному к прорастанию» составу и обработанному этанолом очищенному в градиенте «способному к споруляции» составу. См. таблицу 15: Результаты профилактической модели на мышах и информация о дозировании

Пример 24: Эффективность объединенных донорских образцов для профилактики у мышей

[0355] Для тестирования эффективности и дозировок объединенных донорских образцов используется модель профилактики на мышах с C. difficile (например, см. пример 16) со смешанными двумя и более донорскими образцами согласно вышеприведенному описанию. Снижение массы тела и смертность при применении смешанного спорового продукта относительно спорового продукта, происходящего от одного донора при разных дозировках определяют, эквивалентны ли две указанные схемы лечения или одна значительно эффективнее другой.

[0356] Дозировка спорового продукта, происходящего от одного или нескольких доноров составляет от 1Е4 до 1Е10 КОЕ/мл. Споровый продукт получают смешиванием продуктов, происходящих от любого числа доноров в диапазоне от 1 до 10 либо в равных концентрациях, либо в других известных концентрациях.

[0357] Кроме того, указанный способ может использоваться для размножения споровой фракции для целей производства. Для целей производства обогащенная споровую фракцию (например, очищенную и обработанную EtOH фракцию образца фекалий) сохраняют в виде совокупности аликвот, формирующих банк жизнеспособных спорообразующих организмов. Аликвоту из указанного банка восстанавливают обработкой способствующим прорастанию веществом с последующим культивированием на среде и в условиях, в целом благоприятных для спорообразующих организмов и стимулирующих споруляцию. Через достаточное для размножения время размножившиеся бактерии, в том числе споры, собирают, и указанный состав растворяют или проводят термообработку для выделения споровой фракции. Указанная фракция может быть дополнительно очищена от неспоровых форм и компонентов культуральной среды. Процесс размножения, выделения спор и, необязательно, очищения может быть повторен в возрастающих объемах для получения больших количеств для дальнейшего использования. Когда собрано достаточно размноженного способного к прорастанию/способного к споруляции материала, он может быть дополнительно очищен, сконцентрирован или разведен, и/или законсервирован в виде, подходящем для дальнейшего использования, например, для клинического дозирования.

[0358] В описанный выше процесс могут быть включены характеристики, обеспечивающие возможность его дальнейшего использования, в частности, применения продукта, например, клинического применения. Получение исходной споровой фракции может проводиться в контролируемых условиях (условиях cGMP), и может быть валидировано удаление неспоровых организмов с высокой степенью надежности. Прорастание может проводиться с применением реагентов, более стандартизированных, чем природные продукты, такие как бычья желчь, например, синтетические смеси солей желчных кислот. Размножение может осуществляться с использованием сред, компоненты которых являются предпочтительными в отношении клинической безопасности, например, получены от сертифицированных животных или получены не из животных. Условия могут быть подобраны так, чтобы обеспечивать стабильные композиции спорулирующих организмов, менее подверженные загрязнению и лучше подходящих для масштабирования, например, закрытые ферментеры с мешалкой, оборудованные системой обратной связи. Спорулирующие организмы могут быть выделены из процесса с применением процедур, по отдельности или в сочетании жестко элиминирующих неспоровые элементы и другие остаточные продукты процесса, например, обработки растворителем, экстракция в двухфазной водной системе и/или продолжительная термообработка при 60°С. Консервация может включать добавление вспомогательных веществ и/или коррекцию условий таким образом, чтобы обеспечить преобразование в предпочтительную лекарственную форму, пригодную для длительного хранения, например, добавление трегалозы с последующей лиофилизацией или распылительной сушкой, дополнительного смешивания порошка с микрокристаллической целлюлозой и заключение в желатиновую капсулу с образованием подходящего для перорального дозирования продукта.

Пример 25: Приживление, стимуляция и снижение носительства патогена у пациентов, получавших лечение споровыми композициями

[0359] Для характеризации состава микробиоты пациента за 1, 2, 3, 4, и 5, 6, 7, 8, 9 и 10 недель до лечения (перед лечением) и до 4 недель после лечения использовали дополнительные геномные и микробиологические способы.

[0360] Для определения OTU, приживающихся при лечении обработанным этанолом составом со спорами у пациентов, и ответного изменения их микробиома, указанный микробном определяли посредством секвенирования 16S-V4 до лечения (перед лечением) обработанным этанолом составом со спорами и до 25 дней после получения лечения. Например, лечение пациента 1 обработанным этанолом составом со спорами приводило к приживление OTU при лечении спорами и к стимуляции микробиома пациента (фиг. 18 и фиг. 19). К 25 дню после лечения в общем пуле микроорганизмов доминировали виды следующих таксономических групп: Bacteroides, Sutterella, Ruminococcus, Blautia, Eubacterium, Gemmiger/Faecalibacterium и не образующие спор Lactobacillus (см. конкретные OTU в таблице 16 и таблице 2). Первые два рода представляют OTU, не образующие спор, а последние таксономические группы представляют OTU, которые, предположительно, образуют споры.

[0361] Лечение пациентов обработанным этанолом составом со спорами приводит к формированию экогруппы микроорганизмов, обладающей большим разнообразием, чем до лечения (фиг. 18). Характеризация микробиома на основе генома подтверждала приживление диапазона OTU, которые отсутствовали у пациента до лечения (таблица 16). Указанные OTU содержали как бактериальные виды, способные или не способные образовывать споры, так и OTU, представляющие несколько филогенетических клад. Организмы, которые отсутствуют у пациента 1 до лечения, либо приживаются, непосредственно попадая из обработанной этанолом споровой фракции, либо происходит их стимуляция благодаря созданию в кишечнике среды, благоприятной для разнообразной здоровой микробиоты. Кроме того, численность бактерий группы Bacteroides fragilis увеличивалась на 4log и 6log у пациентов 1 и 2 (фиг. 20).

[0362] OTU, составляющие стимулированную экогруппу, не присутствуют у пациента до лечения и/или встречаются исключительно редко, так что не составляют значимую фракцию от общего носительства микроорганизмов и не детектируются с помощью методов геномного и/или микробиологического анализа. OTU, которые являются представителями приживающихся и стимулированных экогрупп, идентифицировали путем определения OTU, относительная распространенность которых увеличивается после лечения, и которые, соответственно: (i) присутствуют в обработанном этанолом составе со спорами и отсутствуют у пациента до лечения, или (ii) отсутствуют в обработанном этанолом составе со спорами, но их относительная распространенность увеличивается со временем после лечения составом благодаря формированию в результате лечения благоприятных для роста условий. Примечательно, что последние OTU способны вырастать из резервуаров, где они встречаются у пациента с низкой частотой, или появляться из экзогенных источников, например, из пищи. OTU, которые составляют «коровую» стимулируемую или приживающуюся экогруппу, могут быть определены по общему проценту пациентов, у которых наблюдается их приживление и\или стимуляция; чем выше указанный процент, тем более вероятно, что они входят в коровую экогруппу, отвечающую за катализирование сдвига в направлении от дисбиотической экогруппы. Доминирующие OTU в экогруппе могут быть идентифицированы с применением нескольких способов, в том числе, но не ограничиваясь перечисленными, определение OTU, имеющих максимальную относительную распространенность либо в стимулированных, либо в приживающихся экогруппах, и определение порога общей относительной распространенности. Например, доминирующие OTU в стимулируемой экогруппе пациента 1 идентифицировали путем определения OTU с максимальной относительной распространенности, которые совместно составляют 60% носительства микроорганизмов, входящих в указанную стимулируемую экогруппу у пациента.

[0363] См. фиг. 18: Разнообразие микроорганизмов, измеренное в образцах после обработки обработанными этанолом спорами и образцах от пациента до и после лечения. Общее разнообразие микроорганизмов определяют с применением индекса альфа-разнообразия Chao1 и измеряют при разной глубине анализа генома для подтверждения адекватного покрытия последовательностей для анализа микробиома в целевых образцах. Пациент до лечения (фиолетовый) был носителем микробиома со значительно уменьшенным общим разнообразием по сравнению пациентом, получавшим лечение обработанными этанолом спорами (красный) и пациентом после лечения на 5 день (синий), 14 день (оранжевый) и 25 день (зеленый).

[0364] См. фиг. 19: В экогруппе микроорганизмов пациента при лечении обработанными этанолом спорами происходит сдвиг от дисбиотического состояния к здоровому состоянию. Анализ главных координат на основании общего разнообразия и структуры микробиома (бета-разнообразие Брея-Кертиса) пациента до и после лечения показывает, что приживление OTU при лечении спорами и стимуляция экогруппы микроорганизмов у пациента приводит к формированию экогруппы микроорганизмов, отличной как от микробиома до лечения, так и от экогруппы при лечении обработанными этанолом спорами (таблица 16).

[0365] См. фиг. 20: Стимуляция видов Bacteroides у пациентов. Сравнение числа групп вида Bacteroides fragilis на КОЕ/г экскрементов до лечения и на 4 неделе после лечения обнаруживает увеличение 4log или более. Возможность с помощью 16S-V4-идентификации OTU определять принадлежность OTU к конкретному виду зависит отчасти от разрешения области 16S-V4 гена 16S для конкретного вида или группы видов. Как плотность доступных референсных последовательностей 16S для разных областей указанного дерева, так и свойственная гену 16S вариабельность у разных видов определяют точность таксономической классификации определенного прочтения последовательности. С учетом топологической природы филогенетического дерева и того, что дерево отражает иерархические взаимоотношения OTU на основании сходства их последовательностей и базовой эволюционной модели, таксономическая классификация прочтения может быть распространена на более высокий уровень с применением основанной на кладах процедуры определения принадлежности (таблица 1). При использовании указанного подхода клады определяют на основании топологии филогенетического дерева, сконструированного на основании полноразмерных последовательностей 16S с применением максимального правдоподобия или других филогенетических моделей, известных специалистам в области филогенетики. Клады конструируют для подтверждения того, что все OTU в определенной кладе: (i) расположены в пределах определенного числа узлов с бутстреп-поддержкой друг от друга (обычно, 1-5 значений бутстрепа), и (ii) отличаются не более чем на 5% в отношении генетического сходства. OTU, принадлежащие одной кладе, можно определить как генетически и филогенетически отличные от OTU другой клады на основании данных секвенирования 16S-V4. OTU, попадающие в одну кладу, являются эволюционно близкородственными, и могут быть отличимы или неотличимы друг от друга на основании данных секвенирования 16S-V4. Мощность основанного на кладах анализа обусловлена тем, что представители одной клады, благодаря эволюционному родству, играют аналогичные функциональные роли в экогруппе микроорганизмов, например, обнаруживаемых в кишечнике человека. Композиции, где одни виды замещены другими из той же клады, предположительно сохраняют консервативную экологическую функцию и, соответственно, подходят для применения в настоящем изобретении.

[0366] Образцы стула разделяли на аликвоты и ресуспендировали 10× (объем/масса) либо в 100% этаноле (для определения генома) или в ФСБ, содержащем 15% глицерина (для выделения микроорганизмов), а затем хранили при -80°С до использования. Для анализа геномных 16S-последовательностей определяли полные 16S-последовательности для полученных точечным методом из изолятов на чашках колоний согласно описанию в примерах 11 и 12, и первичные образцы стула подготавливали для направленной работы с 16S-V4 с применением способа для гетерогенных образцов в примере 10.

[0367] Примечательно, что последовательности 16S изолятов определенной OTU филогенетически располагаются в составе соответствующих им клад, несмотря на то, что фактическое таксономическое определение вида и рода может указывать на их таксономическое отличие от других представителей клад, в которые они распределены. Расхождения между таксономическим наименованием OTU на основе микробиологических характеристик и на основе генетического секвенирования известны из литературы. Для перечисленных в сноске OTU из указанной таблицы известны расхождения при разных способах присвоения таксономического наименования.

[0368] Приживление OTU у пациента при лечении обработанным этанолом составом со спорами, а также итоговая стимуляция резидентного микробиома приводили к значительному снижению уровней и элиминированию у пациента носительства других патогенных видов помимо C. difficile. 16S-V4-секвенирование первичных образцов стула показало, что до лечения 20% прочтений соответствовали роду Klebsiella и еще 19% принадлежали роду Fusobacterium. Эти поразительные данные свидетельствуют о присутствии глубоко дисбиотической микробиоты, связанной с рецидивирующей C. difficile инфекцией и хроническим применением антибиотиков. У здоровых индивидуумов Klebsiella является резидентом микробиома человека всего у приблизительно 2% субъектов на основании анализа базы данных НМР (www.hmpdacc.org), и средняя относительная распространенность Klebsiella составляет всего приблизительно 0,09% в экскрементах указанных людей. Неожиданное обнаружение 20% относительной распространенности у пациента 1 до лечения указывает на провоспалительное состояние ЖКТ, позволяющее «патобионту» разрастаться и побеждать в конкурентной борьбе комменсальные организмы, в норме обнаруживаемые в кишечнике. Аналогичным образом, резко выраженный избыточный рост Fusobacterium указывает на глубокий дисбиоз микробиоты ЖКТ. Один вид Fusobacterium, F. nucleatum (OTU филогенетически неотличима от Fusobacterium sp. 3_1_33 на основании 16S-V4), был назван «новым патогеном ЖКТ» на основании связи с ВЗК, болезнью Крона и раком ободочной и прямой кишки у людей, а также подтвержденной способности вызывать развитие рака ободочной и прямой кишки в моделях на животных [Allen-Vercoe, Gut Microbes (2011) 2:294-8]. Важно, что ни Klebsiella, ни Fusobacterium не были детектированы среди прочтений 16S-V4 на 25 день (Таблица 18).

[0369] Для дальнейшего определения колонизации пищеварительного тракта Klebsiella и другими Enterobacteriaceae и для идентификации видов указанных организмов образцы фекалий, собранные до лечения и на 25 день, хранящиеся при -80С в виде суспензий с ФСБ и глицерином, высевали на разнообразные селективные среды, в том числе на лактозную среду Мак-Конки (селективную среду для грамотрицательных энтеробактерий) и цитратную среду Симмонса с инозитолом (селективную среду для Klebsiella spp) [Van Cregten et al, J. Clin. Microbiol. (1984) 20: 936-41]. Идентифицированные в образцах от пациента энтеробактерий включали K. pneumoniae, Klebsiella sp. Со_9935 и Е. coli. Удивительным образом, численность всех видов Klebsiella уменьшалась на 2-4 логарифмических единицы, тогда как Е. coli, нормального комменсального организма, присутствующего в нормальной микробиоте, уменьшалось менее чем на Hog (таблица 19). Указанное уменьшение носительства Klebsiella spp. наблюдается у нескольких пациентов (таблица 19). У четырех индивидуальных пациентов исследовали присутствие Klebsiella spp. до лечения и через 4 недель после лечения. Klebsiella spp. детектировали по росту на селективной цитратной среде Симмонса с инозитолом согласно вышеприведенному описанию. Проведение серийных разведении и посева с последующим определением титров КОЕ/мл для морфологически отличных видов и идентификация представителей указанных морфологически отличных классов с применением секвенирования полноразмерных последовательностей 16S, позволили рассчитать титры для конкретных видов.

[0370] Род Bacteroides представляет собой важного члена микробиоты ЖКТ; 100% образцов стула согласно проекту «Микробном человека» («Human Microbiome Project») содержат по меньшей мере один вид Bacteroides с общей относительной распространенностью в указанных образцах, составляющей от 0,96% до 93,92% с медианной относительной распространенностью 52,67% (справочные данные HMSMCP, www.hmpdacc.org). Была показана связь Bacteroides в кишечнике с ферментацией аминокислот и разложением сложных полисахаридов. Его присутствие в кишечнике стимулируется богатыми продуктами животного происхождения диетами, свойственными типичному западному рациону питания [David, L.A. et al, Nature (2013) doi:10.1038/nature12820]. Удивительным образом, до лечения менее чем 0,008% прочтений 16S-V4 от пациента 1 картировались на род Bacteroides, с высокой вероятностью указывая на отсутствие видов Bacteroides на уменьшение численности жизнеспособных Bacteroides до экстремально малых уровней в микробиоме кишечника пациента. После лечения через 5 дней ≥42% прочтений 16S-V4 может быть отнесено к роду Bacteroides, а к 25 дню после лечения 59,48% микробиома кишечника пациентов составлял Bacteroides. Указанные результаты подтверждали микробиологически по отсутствию детектируемых Bacteroides в образце, взятом до лечения, путем посева на две разные селективные среды дл Bacteroides: агар для Bacteroides с желчными кислотами и эскулином (ВВЕ), селективный в отношении группы Bacteroides fragilis [Livingston, S.J. et al J. Clin. Microbiol (1978). 7: 448-453] и арабинозный агар без полиаминов (PFA) [Noack et al. J. Nutr. (1998) 128: 1385-1391; модифицирован замещением глюкозы арабинозой]. Предел детекции для взятого до лечения образца в высокоселективном агаре ВВЕ составлял <2×103 КОЕ/г, а предел детекции Bacteroides на агаре PFA составлял приблизительно 2×107 КОЕ/г из-за роста на указанной среде многих не относящихся к Bacteroides видов. Число колоний видов Bacteroides на 25 день достигало 2×1010 КОЕ/г, что согласуется с данными 16S-V4-секвенирования и указывает глубокую реорганизацию микробиоты пищеварительного тракта у пациента 1 (Таблица 20).

[0371] Примечательна значительная распространенность Bacteroides у пациента 1 на 25 (а также уже на 5 день по данным 16S-V4-секвенирования). Жизнеспособные бактерии группы Bacteroides fragilis отсутствовали в обработанный этанолом споровой популяция на основании микробиологических посевов (при пороге детекции 10 КОЕ/мл). Таким образом, введение обработанной этанолом популяции спор пациенту 1 приводило не только к приживлению спорообразующих видов, но также и к восстановлению высоких уровней неспорообразующих видов, обычно обнаруживаемых у здоровых индивидуумов, путем создания ниши, позволяющей обеспечить восстановление популяции видов Bacteroides. Указанные организмы с наибольшей вероятностью либо присутствуют с крайне низкой распространенностью в ЖКТ пациента 1, или присутствуют в резервуаре в ЖКТ, из которого способны восстанавливаться до высокого титра. Указанные виды могут также быть реинокулированы перорально из пищи после лечения. Авторы настоящего изобретения называют указанное восстановление здоровой популяции пищеварительного тракта с OTU, не присутствующих в обработанной этанолом популяции спор «стимуляцией». Стимуляция представляет собой важное явление, демонстрирующее возможность использования обработанной этанолом споровой экогруппу для восстановления нормальной микробиоты за счет заселения другой совокупностью организмов или комменсальных организмов, фактически не являющихся компонентами собственно обработанной этанолом популяции спор; в частности лечение спорами и приживление OTU из споровой композиции создает нишу, благоприятную для разрастания OTU, необходимых для сдвига дисбиотического состава микробиома в сторону связанных со здоровым состоянием экогруппы микроорганизмов. Разнообразие видов Bacteroides и их приблизительная относительная распространенность в кишечнике пациента 1 представлены в таблице 21, включающей по меньшей мере 8 разных видов.

[0372] См. фиг. 21: Приживающиеся виды и стимулируемые виды в микробиомах пациентов после лечения обработанной этанолом популяцией спор. Относительная распространенность прижившихся или стимулированных видов определяли согласно описанию на основании числа прочтений 16S-последовательностей. Каждый график соответствует одному пациенту, получавшему лечение от рецидивирующей C. difficile обработанной этанолом популяцией спор.

[0373] Влияние лечения обработанной этанолом популяцией спор на носительство устойчивых к имипенему Enterobacteriaceae оценивали путем посева из клинических образцов от пациентов 2, 4 и 5, взятых до лечения и на 28 день, на лактозную среду Мак-Конки с 1 мкг/мл имипенема. Количество резистентных организмов определяли морфологически, регистрировали и получали ДНК для секвенирования полноразмерных 16S рРНК согласно описанию выше. Изоляты идентифицировали как Morganella morganii, Providencia rettgeri и Proteus pennerii. Все указанные организмы представляют собой комменсальные организмы кишечника; избыточный рост может приводить к бактеремии и/или инфекциям мочевыводящих путей, при которых требуется агрессивное лечение антибиотиками и, в некоторых случаях, госпитализация [Kim, B-N, et al Scan J. Inf Dis (2003) 35: 98-103; Lee, I-K и Liu, J-W J. Microbiol Immunol Infect (2006) 39: 328-334; O'Hara et al, Clin Microbiol Rev (2000) 13: 534]. Титры организмов до лечения и на 28 день для каждого пациента представлен в таблице 22. Важно, что введение обработанного этанолом состава со спорами приводило более чем к 100-кратному снижению в 4 из 5 случаев носительства Enterobacteriaceae с рядом устойчивых к имипенему организмов (Таблица 22).

[0374] Помимо определения вида и регистрации, несколько изолятов каждого организма от пациента 4 культивировали в течение ночи в 96-луночных планшетах, содержащие серии 2-кратных разведении имипенема для количественного определения минимальной ингибирующей концентрации (MIC) антибиотика. Рост организмов детектировали по рассеянию света на 600 нм с помощью планшет-ридера SpectraMax M5e. В клинических условиях указанные виды считают устойчивыми к имипенему, если MIC для них составляет 1 мкг/мл или выше. MIC для изолятов М. morganii из образцов от пациента D до лечения составляли 2-4 мкг/мл, а MIC для P. pennerii изолятов составляли 4-8 мкг/мл. Таким образом, введение обработанной этанолом популяции спор пациенту 4 приводило к выведению двух устойчивых к имипенему организмов (таблица 16).

Пример 26. Обогащение и очищение бактерий.

[0375] Для очищения индивидуальных бактериальных штаммов выбирали чашки с разведениями, плотность на которых позволяла произвести разделение одиночных колоний. Колонии собирали точечным методом с помощью стерильного инструмента (стерильной петли или иглы) и повторно высевали методом штриха на ВВА или другую твердую среду. Планшеты инкубировали при 37°С в течение 3-7 дней. Одну или большее количество хорошо изолированных одиночных колоний основного морфологического типа пересевали методом штриха. Указанный процесс повторяли по меньшей мере трижды до появления стабильной единственной морфологии колоний. Выделенный микроорганизм затем культивировали в анаэробных условиях в жидкой среде в течение 24 часов или более для получения чистой культуры с 106-1010 КОЕ/мл. Жидкая ростовая среда может включать среду на основе сердечно-мозгового бульона (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) с добавлением дрожжевого экстракта, гемина, цистеина и углеводов (например, мальтозы, целлобиозы, растворимого крахмала) или другой ранее описанной среды (см., например, пример 14). Культуру центрифугировали при 10000×g в течение 5 минут для осаждения бактерий, отработанную культуральную среду удаляли, и бактерии ресуспендировали в стерильном ФСБ. Добавляли стерильный 75% глицерин до конечной концентрации 20%. Аликвоту глицеринового основного раствора титровали методом серийных разведении и посева. Оставшуюся часть основного раствора замораживали на сухом льду в течение 10-15 минут и затем помещали в условия с температурой -80С для длительного хранения.

Пример 27. Состав клеточных банков.

[0376] Клеточные банки (RCB) бактериальных штаммов получали следующим образом. Бактериальные штаммы высевали из хранящихся при -80°С замороженных базовых составов с глицерином на кровяной агар для Brucella с гемином или витамином K (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010), M2GSC (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) или другую твердую ростовую среду, и инкубировали от 24 до 48 ч при 37°С в анаэробной камере с газовой смесью H2:CO2:N2 10:10:80. Одиночные колонии собирали точечным методом и использовали для инокуляции от 250 мл до 1 л бульона Вилкинса-Шалгрена, бульона с сердечно-мозговым экстрактом, бульона M2GSC или другой ростовой среды, и культивировали до достижения середины экспоненциальной фазы - поздней экспоненциальной фазы, либо до достижения стационарной фазы роста. Как вариант, одиночные колонии могут быть использованы для инокуляции пилотной культуры объемом 10 мл, затем используемой для инокуляции культуры большего объема. Ростовую среду и фазу роста для сбора выбирали таким образом, чтобы максимизировать титр клеток, споруляцию (при необходимости) и фенотипы, которые могут быть связаны с нужными клетками in vitro или in vivo. Культуры необязательно культивировали в статическом режиме или при перемешивании, в зависимости от того, что именно обеспечивало максимальный титр клеток. Затем культуры концентрировали 10-кратно или более путем центрифугирования при 5000 об/мин в течение 20 минут, и ресуспендировали в стерильном забуференном фосфатом солевом растворе (ФСБ) с добавлением 15% глицерина. Аликвоты объемом 1 мл переносили в криопробирки объемом 1,8 мл, которые замораживали на сухом льду и хранили при -80С. Идентичность определенного клеточного банка подтверждали путем ПЦР-амплификации гена 16S рРНК с последующим прямым циклическим секвенированием по Сэнгеру, и сравнения с курируемой базой данных рРНК для определения таксономического идентификатора. Затем подтверждали, что каждый банк обеспечивает получение колоний с единственной морфологией при высевании методом штриха на кровяной агар для Brucella или агар M2GSC. Если наблюдалось более одного варианта морфологии, принадлежность колоний к предполагаемому виду подтверждали путем ПЦР-анализа и секвенирования гена 16S рРНК. Варианты морфологии колоний могут наблюдаться и в чистых культурах; для многих бактерий подробно описаны механизмы образования колоний с варьирующей морфологией (van der Woude, Clinical Microbiology Reviews, 17:518, 2004), в том числе для видов Clostridium (Wadsworth-KTL Anaerobic Bacteriology Manual, 6th Ed, Jousimie-Somer, et al 2002). Для RCB облигатных анаэробов подтверждали отсутствие аэробных колониеобразующих единиц с порогом детекции 10 КОЕ/мл.

Пример 28. Определение титра.

[0377] Число жизнеспособных клеток на мл определяли на свежесобранной промытой и концентрированной культуре путем посева серийных разведении RCB на кровяной агар для Brucella или другую твердую среду, и оно варьировало от 106 до 1010 КОЕ/мл. Влияние замораживания на жизнеспособность определяли путем титрования банков после одного или двух циклов замораживания-размораживания на сухом льду или при -80°С, с последующим размораживанием в анаэробной камере при комнатной температуре. Для некоторых штаммов наблюдалось падение числа жизнеспособных КОЕ/мл на 1-3log после первого или второго цикла замораживания-размораживания, тогда как на жизнеспособность других это не влияло.

Пример 29. Состав бактериальных композиций.

[0378] Индивидуальные штаммы, как правило, размораживали на льду и комбинировали в анаэробной камере для получения смесей, с последующим вторым замораживанием при -80°С для сохранения смешанных образцов. При получении комбинаций штаммов для анализов in vitro или in vivo число КОЕ в конечной смеси оценивали на основании титра при втором замораживании-размораживании индивидуальных штаммов. При экспериментах на грызунах штаммы могут быть скомбинированы в равных количествах для доставки от 1е4 до 1е10 на штамм. Кроме того, некоторые бактерии могут не вырастать до титра, достаточного для создания клеточных банков, обеспечивающих получение композиций, в которых все бактерии присутствовали бы в количестве 1е10.

Пример 30. Идентификация ключевых OTU и функций

[0379] Организм человека представляет собой экосистему, в которой микробиота, и микробном играют важную роль в основных нормальных функциях систем человека (например, метаболической, иммунологической и неврологической). Микробиота и конечный микробном содержат экогруппу микроорганизмов, которые сосуществуют у индивидуальных субъектов, взаимодействуя друг с другом и с хозяином (т.е. субъектом-млекопитающим) с формированием динамического сообщества с присущим ему биоразнообразием и функциональными характеристиками. В указанных системах взаимодействия микроорганизмов (т.е. экогруппах) конкретные представители могут вносить более существенный вклад, чем другие; соответственно, указанные представители также обнаруживаются во многих экогруппах, и удаление указанных микроорганизмов из экогруппы может оказывать существенное влияние на функциональные возможности конкретной экогруппы. В 1969 году Робертом Пейном (Robert Paine) была предложена концепция «ключевых видов» (см. Paine RT. 1969. A note on trophic complexity and community stability. The American Naturalist 103: 91-93.) для описания существования таких ключевых видов, составляющих неотъемлемую часть определенной экосистемы независимо от их распространенности в экологическом сообществе. Изначально Пейн описал роль морской звезды Pisaster ochraceus в морских экосистемах; с тех пор концепция была экспериментально подтверждена для многочисленных экосистем.

[0380] Ключевые OTU и/или функции определяют вычислительными методами путем анализа экосистем, обнаруженных в определенном наборе образцов, имеющих специфический фенотип. Ключевые OTU и/или функции определены как все узлы заданной группы систем, отвечающие двум или большему числу следующих критериев. Согласно Критерию 1 узел часто встречается в системах, и системы, где встречается указанный узел, обнаруживаются у значительного количества индивидуумов; частота встречаемости указанных узлов в системах и распространенность указанных систем у индивидуумов показывает, что указанные узлы выполняют важную биологическую функцию у многих индивидуумов. Согласно Критерию 2, узел часто наблюдается в системах, и каждая из систем, где наблюдается указанный узел, содержит значительное число узлов - эти узлы, таким образом, являются «суперконнекторами», то есть образуют ядро большинства система и, соответственно, обладают большой биологической значимостью в смысле функционального вклада в определенную экогруппу. Согласно Критерию 3, узел обнаруживается в системах, содержащих значительное число узлов (т.е, больших системах), и известно, что указанные системы, где обнаруживается указанный узел, встречаются у большого числа субъектов; указанные системы потенциально представляют большой интерес, поскольку маловероятно, что большие системы, встречающиеся у многих индивидуумов, образуются исключительно случайным образом; с высокой вероятностью это указывает на биологическую значимость. Необязательно, нужные пороги для частоты, с которой узел встречается в экогруппах системы, частоты, с которой определенная система встречается в образцах от субъектов и для размера определенной системы, необходимого для ее классификации как ключевого узла, определяют как 50-й, 70-й, 80-й или 90-й процентили распределения указанных переменных. Необязательно, нужные пороги определяют по значению определенной переменной, существенно отличающемуся от среднего ли медианного значения определенной переменной, с применением стандартных параметрических или непараметрических критериев статистической значимости. Согласно другому варианту реализации ключевой узел определяют узел, встречающийся в образце с представляющим интерес фенотипом, например, но не ограничиваясь указанным, «здоровый» фенотип, и в то же время не встречающийся в образце с не представляющим интереса фенотипом, например, но не ограничиваясь указанным, «болезненным» фенотипом. Необязательно, ключевой узел определяют как узел, который, как показано, значимо отличается от обнаруживаемых с применением данных пермутационных тестов для оценки значимости.

Пример 31. Идентификация коровой экогруппы в обработанном этанолом составе со спорами

[0381] Десять разных обработанных этанолом составов со спорами получали от 6 разных доноров (согласно описанию в примере 15). Указанные составы со спорами использовали для лечения 10 пациентов, каждый из которых страдал рецидивирующей инфекцией C. difficile. Пациентов идентифицировали с применением критериев включения/исключения, описанных в примере 18, а доноров идентифицировали, с использованием критериев, описанных в примере 1. Ни у одного из пациентов не наблюдалось рецидива C. difficile за 4 недели наблюдения после лечения, хотя исходя из литературных источников, можно было ожидать возникновения рецидива у 70-80% субъектов после отмены антибиотика [Van Nood, et al, NEJM (2013)]. Таким образом, обработанные этанолом составы со спорами от нескольких разных доноров и нескольких взятий донорских материалов продемонстрировали примечательную клиническую эффективность.

[0382] Для определения коровой экогруппы, определяющей примечательную клиническую эффективность обработанного этанолом состава со спорами, проводили следующий анализ. Состав OTU состава со спорами определяли путем секвенирования 16S-V4 рРНК, и численными методами определяли принадлежность OTU согласно примеру 12. В качестве надежного порога для определения только OTU, с крайне малой вероятностью появившихся в результате ошибок во время амплификации или секвенирования, устанавливали требование детекции по меньшей мере 10 прочтений последовательностей OTU в обработанном этанолом составе со спорами. В рутинных способах, используемых специалистами в области определения микробиома геномными методами, для относительной распространенности прочтения в качестве значения отсечения применяется порог, существенно меньший, чем значение ≥10 прочтений, используемое для указанного анализа, и составляющий 0,005% (см., например, Bokulich, А. et al. 2013. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods 10: 57-59), что эквивалентно ≥2 прочтениям при глубине секвенирования, достигаемой для образцов при анализе в данном примере, Все таксономические определения и распределение клад выполнялись для каждой OTU согласно описанию в примерах 12. Итоговый перечень OTU, распределение клад и частота детекции в составах со спорами приведены в таблице GB. Указаны OTU, которые приживаются у получавших лечение пациентов, и процент пациентов, у которых они приживаются, а также клады, статус спорообразования и статус ключевых OTU. Отмеченные звездочкой OTU встречаются в ≥80% обработанных этанолом составов и приживаются у ≥50% получавших лечение пациентов.

[0383] Далее, был сделан вывод, что для признания OTU представителем коровой экогруппы состава со спорами необходимо подтверждение того, что указанная OTU приживается у пациента. Приживление имеет важное значение по двум причинам. Во-первых, приживление представляет собой обязательный элемент механизма восстановления микробиома и элиминации колонизации C. difficile. Приживающиеся с большей частотой OTU с высокой вероятностью являются компонентами коровой экогруппы состава со спорами. Во-вторых, OTU, детектированные посредством секвенирования состава со спорами (согласно таблице GB) могут включать нежизнеспособные споры или другие загрязняющие молекулы ДНК, не связанные со спорами. Требование подтвержденного приживления OTU у пациента позволяет устранить OTU, соответствующие нежизнеспособным спорам или загрязняющим последовательностям. В таблице GB также приведены все OTU, детектированные в составе со спорами, которые, как было показано, приживаются по меньшей мере у одного пациента после лечения. OTU, составляющие значительный процент в проанализированных обработанных этанолом составах со спорами, которые приживаются у большого числа пациентов, представляют собой подгруппу коровой экогруппы, с высокой вероятностью катализирующую сдвиг от дисбиотической экосистемы, характериной для болезненного состояния, к здоровому микробному.

[0384] Третий подход применяли для дополнительного исследования коровой экогруппы состава со спорами. Анализ систем на основе численных методов позволили описать экогруппы микроорганизмов, присутствующих в микробиоте значительной популяции здоровых индивидуумов. Указанные экогруппы составлены множеством OTU, некоторые которых определены как ключевые OTU. Ключевые OTU определяют численными методами согласно описанию в примере 30. Ключевые OTU образуют основу экогрупп микроорганизмов, в которых встречаются, и, соответственно, являются критически важными для функционирования системных экогрупп у здоровых субъектов. Ключевые OTU, связанные с экогруппами микроорганизмов, ассоциированных со здоровыми субъектами, часто отсутствуют или их численность понижена у субъектов с заболеванием. Ключевые OTU могут встречаться у субъектов с низкой, умеренной или высокой распространенностью. В таблице GB дополнительно отмечено, какие из OTU в составе со спорами являются ключевыми OTU, связанными исключительно со здоровыми индивидуумами, которые не являются носителями заболевания.

[0385] На основании указанных данных было сделано несколько важных выводов. Относительно незначительное число видов, всего 16, детектируются во всех составах со спорами от 6 доноров при 10 отборах донорских материалов. Эти результаты являются неожиданными, поскольку в базе данных НМР (www.hmpdacc.org) описана огромная вариабельность комменсальных видов у здоровых индивидуумов. Присутствие незначительного числа стабильных OTU поддерживает концепцию коровой экосистемы. Данные о приживлении также подтверждают указанное заключение. Регрессионный анализ показывает значимую корреляцию между частотой детекции в составе со спорами и частотой приживления у донора: R=0,43 (p<0,001). Априорного условия, определяющего, что OTU, часто детектируемые в составе со спорами, необязательно должны или будут приживаться, не существует. Например, Lutispora thermophila, спорообразующий вид, обнаруживаемый во всех 10 составах со спорами, не приживается ни у одного пациента. Bilophila wadsworthia, грамотрицательный анаэроб, присутствует в 9 из 10 донорских материалов, и, тем не менее, не приживаются ни у одного пациента, что, предположительно, указывает на его присутствие в обработанном этанолом составе со спорами в качестве нежизнеспособной примеси. Наконец, следует отметить выраженное преобладание ранее определенных ключевых OTU среди наиболее часто встречающихся OTU в составах со спорами.

[0386] Указанные три фактора - преобладание в составе со спорами, частота приживления и определение как ключевой OTU - позволили разработать «показатель коровой экогруппы» (CES) для ранжирования индивидуальных OTU. CES определяли следующим образом:

- 40% множитель для присутствия OTU в составе со спорами

- коэффициент 1 для присутствия в 1-3 составах со спорами

- коэффициент 2,5 для присутствия в 4-8 составах со спорами

- коэффициент 5 для присутствия в ≥9 составах со спорами

- 40% множитель для приживления у пациента

- коэффициент 1 для приживления у 1-4 пациентов

- коэффициент 2,5 для приживления у 5-6 пациентов

- коэффициент 5 для приживления у ≥7 пациентов

- 20% множитель для ключевых OTU

- коэффициент 1 для ключевых OTU

- коэффициент 0 для неключевой OTU

[0387] При применении указанного руководства показатель CES имеет максимально возможное значение, равное 5 и минимальное возможное значение, равное 0,8. Например, OTU, обнаруживаемой в 8 из 10 составов со спорами, приживавшихся у 3 пациентов, и представляющей собой ключевую OTU, было бы присвоено следующее значение CES:

CES=(0,4×2,5)+(0,4×1)+(0,2×1)=1,6

[0388] В таблице GC ранжированы по CES первые 20 OTU, при дополнительном условии продемонстрированного приживления OTU для того, чтобы OTU считалась коровым экологическим элементом.

Пример 32. Определение эффективных коровых экологических подгрупп

[0389] Количество организмов желудочно-кишечном тракте человека, а также различия разнообразия между здоровыми индивидуумами, указывают на функциональную избыточность экогруппы микробиома здорового кишечника (см. The Human Microbiome Consortia. 2012. Structure, function and diversity of the healthy human microbiome. Nature 486: 207-214). Указанная избыточность с высокой вероятностью означает, что коровые экологические подгруппы описывают терапевтически благоприятные компоненты обработанного этанолом состава со спорами, и что такие подгруппы могут сами по себе представлять полезные композиции для лечения инфекции C. difficile при условии наличия функциональных характеристик экогруппы. Используя CES, можно установить приоритет индивидуальных OTU при оценке эффективности в качестве коровой экологической подгруппы.

[0390] Другой аспект функциональной избыточности заключается в том, что эволюционно родственные организмы (т.е. близко расположенные на филогенетическом дереве, например, сгруппированные в одну кладу) также будут представлять собой эффективные заместители в коровой экогруппе или ее подгруппе при лечении C. difficile.

[0391] Для специалиста в данной области техники выбор подходящих подгрупп OTU для тестирования in vitro (см., например, пример 33 ниже) или in vivo (см., например, примеры 16 или 17) является простым. Подгруппы могут быть отобраны путем выделения любых 2, 3, 4, 5, 6, 7, 8, 9, 10 или более чем 10 OTU из таблицы GB, в частности, с фокусом на OTU, имеющих более высокие CES, например, OTU, приведенных в таблице GC. Кроме того, используя информацию о взаимосвязях между кладами согласно примеру 12 и таблице 1 выше, можно подобрать родственные OTU для замещения OTU с приемлемыми значениями CES. Указанные организмы могут культивироваться в анаэробных условиях in vitro с применением подходящих сред (выбранных из описанных в примере 14 выше), а затем скомбинированы в требуемой пропорции. В типовом эксперименте в модели с C. difficile на мышах используется по меньшей мере 104 и предпочтительно по меньшей мере 105, 106, 107, 108, 109 или более чем 109 колониеобразующих единиц каждого микроорганизма из композиции. Вариации продуктивности культуры иногда могут означать, что организмы сочетаются в неравных пропорциях, например, 1:10, 1:100, 1:1000, 1:10000, 1:100000, или более 1:100000. При этом важно, чтобы в указанных композициях каждый штамм присутствовал в минимально достаточном количестве для того, чтобы можно было измерить вклад указанного штамма в эффективность коровой экологической подгруппы. Используя принципы и инструкции, приведенные в настоящем документе, специалист в данной области техники сможет легко определить на основании клад заместителей для тестирования эффективности подгрупп коровой экосистемы. В таблице GB представлены клады для всех OTU, детектированных в составе со спорами, а в таблице 1 представлены OTU, которые могут быть использованы в качестве заместителей на основании взаимосвязей клад.

Пример 33. Тестирование коровых экологических подгрупп в модели на мышах

[0392] Ряд коровых экологических подгрупп был протестирован в модели на мышах с C. difficile. Отрицательный контроль представлял собой забуференный фосфатом солевой раствор, а положительный контроль представлял собой 10% суспензию фекалий человека. Указанные подгруппы описаны в таблице GD.

[0393] Две клетки по 5 мышей в каждой использовали для тестирования для каждой группы эксперимента. Все мыши получали коктейль антибиотиков, состоящий из 10% глюкозы, канамицина (0,5 мг/мл), гентамицина (0,044 мг/мл), колистина (1062,5 ед/мл), метронидазола (0,269 мг/мл), ципрофлоксацина (0,156 мг/мл), ампициллина (0,1 мг/мл) и ванкомицина (0,056 мг/мл) в питьевой воде с -14 по -5 день включительно, и дозу 10 мг/кг клиндамицина через оральный зонд на -3 день. На день -1 они получали либо тестируемые составы, либо контрольные продукты через оральный зонд. На 0 день их стимулировали введением приблизительно 4,5 log10 КОЕ C. difficile (ATCC 43255) через оральный зонд. Смертность оценивали каждый день с 0 по 6 день; оценивали массу тела и последующее изменение массы тела у животного, при этом снижение массы тела считали связанным с инфекцией C. difficile. Смертность и уменьшение снижения массы тела при применении тестируемого состава по сравнению с пустой основой использовали для оценки успешности применения тестируемого состава. Кроме того, ежедневно проводили оценку симптомов C. difficile от -1 дня до 6 дня включительно. Оценку симптомов проводили на основании внешнего вида (0-2 пункта на основании нормального вида, сгорбленности, пилоэрекции или летаргического состояния), дыхания (0-2 пункта на основании нормального, быстрого или поверхностного дыхания, с диафрагмальным дыханием), клинических признаков (0-2 пункта на основании нормального внешнего вида, мокрого хвоста, пониженной на ощупь температуры или изоляции от других животных).

[0394] Помимо определения кумулятивной смертности для каждой группы рассчитывают среднюю минимальную относительную массу тела как среднее значение минимальной массы тела каждой мыши относительно дня -1, и средний максимальный клинический показатель как среднее значение максимального комбинированного клинического показателя каждой мыши с присвоением значения 4 в случае смерти. Результаты представлены в таблице GE.

Пример 34. Определение коровых экологических подгрупп в анализе ингибирования C. difficile in vitro

[0395] Флаконы с банкированным глицериновым основным раствором, хранящиеся при температуре -80°С, размораживали и разводили до 1е8 КОЕ/мл. Выбранные штаммы и принадлежность их клад приведены в таблице GF. Каждый штамм затем разводили 10х (до конечной концентрации 1е7 КОЕ/мл каждого штамма) в 200 мкл ФСБ + 15% глицерина в лунках 96-луночного планшета. Затем планшеты замораживали при -80°С. Перед проведением анализа планшеты извлекали из среды с температурой -80°С и размораживали при комнатной температуре в анаэробных условиях для тестирования в анализе ингибирования C. difficile in vitro (CivSim).

[0396] Ночную культуру Clostridium difficile культивируют в анаэробных условиях на SweetB-FosIn или другой подходящей среде для роста C. difficile. SweetB-FosIn представляет собой комплексную среду, состоящую из сердечно-мозгового бульона, дрожжевого экстракта, цистеина, целлобиозы, мальтозы, растворимого крахмала, фруктоолигосахаридов/инулина и гемина, и его забуферивают MOPS. Через 24 ч роста культуру разбавляют 100000-кратно комплексной средой, такой как SweetB-FosIn, которая подходит для роста широкого спектра анаэробных бактериальных видов. Аликвоты разведенной смеси C. difficile переносят в лунки 96-луночного планшета (180 мкл в каждую лунку). Затем добавляют 20 мкл подгруппы коровой экосистемы в каждую лунку в конечной концентрации 1е6 КОЕ/мл каждого вида. Как вариант, каждый вид может тестироваться в анализе при разных начальных концентрациях (1е9 КОЕ/мл, 1е8 КОЕ/мл, 1е7 КОЕ/мл, 1е5 КОЕ/мл, 1е4 КОЕ/мл, 1е3 КОЕ/мл, 1е2 КОЕ/мл). Контрольные лунки, инокулированные только C. difficile, включены для сравнения с ростом C. difficile без ингибирования. Дополнительные лунки используют для контролей, которые либо ингибируют, либо не ингибируют рост C. difficile. Одним из примеров положительного контроля, который ингибирует рост, является комбинация Blautia producta, Clostridium bifermentans и Escherichia coli. Одним из примеров контроля, демонстрирующего пониженное ингибирование роста C. difficile, является комбинация Bacteroides thetaiotaomicron, Bacteroides ovatus и Bacteroides vulgatus. Планшеты заворачивают в парафильм и инкубируют в течение 24 ч при 37°С в анаэробных условиях. Через 24 ч. проводят серийные разведения содержимого лунок, содержащих только C. difficile, и высевают для определения титра. 96-луночный планшет замораживают при -80С до количественного определения C. difficile с применением анализа кПЦР.

[0397] Строят стандартную кривую на основе лунки из каждого аналитического планшета, содержащей только патогенный C. difficile, культивированный на среде SweetB + FosIn, и количественно определенный с применением селективного посева бляшкой. Серийные разведения культуры выполняют в стерильном забуференном фосфатом солевом растворе. Геномную ДНК экстрагируют из образцов, использованных для стандартной кривой, наряду с другими лунками.

[0398] Геномную ДНК экстрагируют из 5 мкл каждого образца с использованием протокола разведения, замораживания/оттаивания и термического лизиса. 5 мкл размороженных образцов добавляют в 45 мкл ультрачистой воды (UltraPure, Life Technologies, Карлсбад, Калифорния) и перемешивают пипетированием. Планшеты с разведенными образцами замораживают при -20°С до использования для кПЦР, которая включает этап термического лизиса перед амплификацией. Как вариант, геномную ДНК выделяют с применением набора для выделения ДНК Мо Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния), набора для выделения ДНК Мо Bio Powersoil® DNA Isolation Kit (Мо Bio Laboratories, Карлсбад, Калифорния) или мининабора для выделения ДНК из стула QIAamp DNA Stool Mini Kit (QIAGEN, Валенсия, Калифорния) в соответствии с инструкциями производителя.

[0399] Реакционная смесь для кПЦР содержит 1× универсальных зондов SsoAdvanced Universal Probes Supermix, 900 нМ праймер Wr-tcdB-F (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG, IDT, Коралвилль, Айова), 900 нМ праймер Wr-tcdB-R (CATGCTTTTTTAGTTTCTGGATTGAA, IDT, Коралвилль, Айова), 250 нМ зонд Wr-tcdB-P (6FAM-CATCCAGTCTCAATTGTATATGTTTCTCCA-MGB, Life Technologies, Гранд-Айленд, Нью-Йорк) и воду для молекулярно-биологических целей (Мо Bio Laboratories, Карлсбад, Калифорния), до 18 мкл (модифицированные праймеры по: Wroblewski, D. et al., Rapid Molecular Characterization of Clostridium difficile and Assessment of Populations of C. difficile in Stool Specimens, Journal of Clinical Microbiology 47:2142-2148 (2009)). Аликвоты указанной реакционной смеси распределяют в лунки 96-луночного твердого тонкостенного низкопрофильного планшета для ПЦР с «юбкой» (BioRad, Геркулес, Калифорния). К указанной реакционной смеси добавляют 2 мкл разведенных, замороженных и размороженных образцов и планшет запечатывают герметизирующим материалом Microseal 'В' (BioRad, Геркулес, Калифорния). кПЦР выполняют на термоциклере BioRad C1000™, оборудованном системой реального времени CFX96™ Real-Time System (BioRad, Геркулес, Калифорния). Используют следующие условия термоциклирования: 95°С в течение 15 минут с последующим 45 циклами при 95°С по 5 секунд, 60°С по 30 секунд; флуоресценцию регистрируют в канале FAM. Как вариант, кПЦР выполняют другими стандартными способами, известными специалистам в данной области техники.

[0400] Значение Cq для каждой лунки в канале FAM определяют с помощью ПО CFX Manager™ 3.0. log10(KOE/мл) C. difficile для каждого экспериментального образца рассчитывают подстановкой значения Cq для определенного образца в линейную регрессионную модель, установленную по стандартной кривой, сравнивающей значения Cq для лунок стандартной кривой с известными log10(KOE/мл) для указанных образцов. Логарифмизированное ингибирование рассчитывают для каждого образца путем вычитания log10(KOE/мл) C. difficile в образце из log10(KOE/мл) C. difficile в образце на каждом аналитическом планшете, использованном для получения стандартной кривой, куда не добавлялись дополнительные бактерии. Среднее логарифмизированное ингибирование рассчитывают для всех повторностей для каждой композиции.

[0401] Строят гистограммы размаха и стандартного отклонения для каждой композиции. Значения размаха или стандартные отклонения логарифмизированного ингибирования, которые отклоняются от общего распределения, исследуют как вероятные выбросы. Если удаление одной точки данных логарифмизированного ингибирования из одной из бинарных пар, идентифицированных на гистограммах, приводит к согласованности размаха или стандартного отклонения со значениями для большинства образцов, указанную точку данных удаляют как выброс и производят перерасчет среднего логарифмизированного значения ингибирования.

[0402] Объединенную дисперсию для всех образцов, оцениваемых в анализе, определяют как среднее взвешенное значение дисперсий образцов с учетом числа степеней свободы образцов. Затем рассчитывают объединенную стандартную ошибку как квадратный корень объединенной дисперсии, разделенный на квадратный корень числа образцов. Доверительные интервалы для нулевой гипотезы определяют, умножая объединенную стандартную ошибку на z-показатель, соответствующий определенному процентному порогу. Средние логарифмизированные значения ингибирования за пределами доверительного интервала считают ингибирующими при положительных значениях, или стимулирующими при отрицательных значениях, при проценте достоверности, соответствующем используемому интервалу. Тройные комбинации со средним логарифмизированным значением ингибирования более чем 0,312 регистрируют как ++++ (≥99% доверительный интервал (ДИ) для нулевой гипотезы), со средним логарифмизированным значением ингибирования от 0,221 до 0,312 как +++ (95%<ДИ<99%), со средним логарифмизированным значением ингибирования от 0,171 до 0,221 как ++ (90%<ДИ<95%), со средним логарифмизированным значением ингибирования от 0,113 до 0,171 как + (80%<ДИ<90%), со средним логарифмизированным значением ингибирования от -0,113 и -0.171 как - (80%<ДИ<90%), со средним логарифмизированным значением ингибирования от -0,171 до -0,221 как -- (90%<ДИ<95%), со средним логарифмизированным значением ингибирования от -0,221 до -0,312 как --- (95%<ДИ<99%) и со средним логарифмизированным значением ингибирования менее -0,312 как ---- (99%<ДИ).

[0403] Анализ CivSim показывает, что многие тройные комбинации ингибируют C. difficile. 39 из 56 комбинаций демонстрировали ингибирование с доверительным интервалом >80%; 36 из 56 с ДИ>90%; 36 из 56 с ДИ>95%; 29 из 56 с ДИ>99%. Неограничивающие примеры тройных комбинаций включают комбинации со средним логарифмизированным снижением более чем на 0,171, например, любую комбинацию из приведенных в таблице 6 с показателем ++++, например, Colinsella aerofaciens, Coprococcus comes и Blautia producta. Что не менее важно, анализ CivSim описывает тройные комбинации, эффективно не ингибирующие C. difficile. 5 из 56 комбинаций способствуют росту с достоверностью >80%; 2 из 56 способствуют росту с достоверностью >90%; 1 из 56, Coprococcus comes, Clostridium symbiosum и Eubacterium rectale, способствуют росту с достоверностью >95%. 12 из 56 комбинаций нейтральны по оценке в указанном анализе, что означает, что они не способствуют росту и не ингибируют рост C. difficile в измеряемых пределах.

[0404] Для специалиста в данной области техники очевидна возможность использования метода CivSim для определения эффективных подгрупп коровой экосистемы, полученных из обработанной этанолом споровой фракции и продемонстрировавших эффективность для лечения от C. difficile у человека.

Пример AAZA: Бактериальные композиции, заселяющие ЖКТ в модели на мышах.

[0405] В модели на мышах оценивали способность двух бактериальных композиций заселять желудочно-кишечный тракт. Бактерии культивировали согласно описанию в ***примере 14. Композиции предварительно получали в анаэробных условиях и суспендировали в ФСБ + 15% глицерина и хранили при ≥-70°С до использования.

[0406] Группы мышей (10 самок/группу; 5 на клетку) получали предварительное лечение на -14 - -5 дни коктейлем антибиотиков, состоящим из 10% глюкозы, канамицина (0,5 мг/мл), гентимицина (0,044 мг/мл), колистина (1062,5 ед/мл), метронидазола (0,269 мг/мл), ципрофлоксацина (0,156 мг/мл), ампициллина (0,1 мг/мл) и ванкомицина (0,056 мг/мл) в питьевой воде. На -3 день они получали 10 мг/кг клиндамицина через оральный зонд. На день -1 их дозировали композициями с микроорганизмами через оральный зонд и объеме 0,2 мл (таблица ZA). Композиции с микроорганизмами содержали приблизительно равные количества каждой OTU и вводились в дозах приблизительно 1×109, 1×108 и 1×107 на OTU для каждой композиции (например, композицию с микроорганизмами 1, содержащую 15 штаммов, вводили в дозах приблизительно 1×1010, 1,5×109 и 1,5×108 общих КОЕ). Образцы фекалий собирали из каждой клетки на -1 день (приблизительно за 1 час до дозирования) и на 2, 3 и 4 дни после дозирования. Экскременты хранили в замороженном виде до обработки и секвенирования. Изменения массы тела мышей, получавших лечение любыми композициями с микроорганизмами, были аналогичны наблюдаемым у нестимулированных контрольных мышей.

[0407] Параллельно группы животных, получавших лечение теми же композициями с микроорганизмами на день -1, стимулировали на 0 день приблизительно 104,5 споры Clostridium difficile (ATCC 43255) через оральный зонд. Смертность стимулированных С.difficile животных оценивали каждый день с дня 0 до дня 6; оценивали массу тела и последующее изменение массы тела у животного, считая снижение массы тела связанным с инфекцией C. difficile. Понижение смертности и снижения массы тела при применении тестируемого состава по сравнению с пустой основой использовали для оценки успешности применения тестируемого состава.

[0408] Образцы фекалий обрабатывали путем выделения и секвенирования ДНК в соответствии с ***примерами 11 и 12. Определение принадлежности OTU из образцов фекалий дней -1, 2, 3 и 4 проводили путем анализа прочтений последовательностей 16S-V4 и распределения OTU согласно описанию в ***примере 11. Клады распределяли согласно описанию в ***примере 11. Общее число прочтений определяли для каждой OTU или каждой клады путем суммирования результатов для клеток одной экспериментальной группы. Образцы с 10 или менее прочтениями последовательностей для определенной OTU или клады считали соответствующими уровню ниже фонового и не включали в процесс суммирования. Результаты представлены по OTU (Таблица TAB) и по кладам (Таблица ТАС).

[0409] При изучении данных по OTU в таблице TAB обнаруживается несколько паттернов. Во-первых, наблюдается группа OTU без прочтений последовательностей на -1 день, демонстрирующая впоследствии значительное число прочтений последовательностей на 2, 3 или 4 день; указанная группа включает Cl. butyricum, Cl. hylemonae, Cl. orbiscindens, Cl. symbiosum, и бактерию L._5_1_57FAA. Данные для Cl. disporicum сопоставимы с указанной группой, поскольку для нее число прочтений последовательностей на -1 день очень близко к фоновому (10 и 29 в композициях 1 и 2, соответственно), но затем оно возрастает до 1000-кратного на 2, 3 или 4 день. Во-вторых, наблюдаются OTU, например. Со. aerofaciens, C. comes, R. bromii, В. producta, Cl. bulteae, Cl. mayombei, Cl. innocuum, Cl. tertium и R. gnavus, которые не детектируются на уровне OTU ни в образце -1 дня, ни в последующих образцах. В композиции 2 Со. aerofaciens детектируют временно на 2 день в группах, получавших дозы 1×108 и 1×107; Е. rectale в той же экспериментальной группе детектируют на 3 день, что указывает на возможное наличие взаимосвязи между временным заселением Со. aerofaciens и последующим заселением Е. rectale в указанных группах мышей. Неожиданное наблюдение заключается в том, что наблюдаемое число прочтений последовательностей OTU не является в большой степени дозозависимым. В целом, указанные данные согласуются с моделью, согласно которой происходит быстрое заселение OTU после перорального введения.

[0410] Основанный на кладах анализ в таблице ТАС выполняли для более тщательной оценки популяции в ЖКТ. Основанный на кладах анализ не выявляет некоторые детали, которые позволяет обнаружить анализ OTU. Например, Cl. tertium и Cl. butyricum являются представителями одной и той же клады, и, соответственно, основанный на кладах анализ не позволяет различить динамику указанных индивидуальных OTU. Тем не менее, основанный на кладах анализ обеспечивает компенсирующее преимущество, поскольку он чувствителен в отношении измерения изменений популяции, которые может не учитывать анализ на основе OTU. Возможность с помощью 16S-V4-идентификации OTU определить принадлежность OTU к конкретному виду зависит отчасти от разрешающей способности области 16S-V4 область для конкретного вида или группы видов. Как плотность доступных референсных последовательностей 16S для разных областей указанного дерева, так и свойственная гену 16S вариабельность у разных видов определяют точность таксономической классификации. Таким образом, в некоторых случаях популяция видов может отслеживаться с применением основанного на кладах определения принадлежности, если детекция на основе OTU в сложной популяции недостаточно чувствительна. Например, основанный на кладах анализ в таблице 2В подтверждает, что R. bromii, В. producta, Cl. innocuum и R. gnavus были способны к заселению, поскольку каждая OTU представляет одного представителя клады в композиции с микроорганизмами, а число прочтений последовательностей от недетектируемого на -1 день увеличивалось до значительного отличия от фона на 2, 3 или 4 день. Секвенирование V4 16S и основанный на кладах анализ не позволили определить, происходило заселение Cl. tertium или Cl. bolteae, поскольку присутствовали другие представители их клад (Cl. butyricum и Cl. symbiosum, соответственно) и, как было показано на уровне OTU, они заселяли организм мышей.

[0411] Мыши, параллельно стимулированные C. difficile, были в значительно степени защищены, как видно из таблицы TAD. Среди мышей, которым вводили через зонд носитель (забуференный фосфатом солевой раствор), наблюдалась 100% смертность, тогда как композиции с микроорганизмами 1 и 2 оказывали защитное действие при всех уровнях доз, при смертности от 0 до 10% к 6 дню, последнему дню эксперимента. Кроме того, снижение массы тела у животных, получавших лечение композициями с микроорганизмами 1 и 2, было минимальным по сравнению с животными, получавшими через зонд основу. Указанные данные подтверждают, что заселение желудочно-кишечного тракта композициями с микроорганизмами оказывает благоприятный клинический эффект, устраняя состояние дисбиоза, так что животные способны противостоять инфекции патогеном.

Пример 36: Профилактическое использование и лечение колонизации устойчивым к ванкомицину энтерококком (VRE) в модели на мышах

[0412] Появление и распространение высокоустойчивых к антибиотикам бактерий представляет важную клиническую проблему (Snitkin et al Science Translational Medicine, 2012). В последние годы число инфекций, вызываемых такими организмами, как устойчивый к метициллину Staphylococcus aureus, устойчивые к карбапенему Enterobacteriaceae, устойчивые к ванкомицину Enterococcus (VRE) и Clostridium difficile, значительно выросло, и многие из указанных штаммов приобретают устойчивость к немногочисленным сохраняющим эффективность антибиотикам. Большинство инфекций, вызванных высокоустойчивыми к антибиотикам бактериями, приобретаются при госпитализации, и предотвращение передачи от пациента к пациенту указанных патогенов представляет собой одну из главных проблем, с которыми сталкиваются больницы и клиники. Большинство высокоустойчивых к антибиотикам бактериальных штаммов принадлежат родам, колонизирующим поверхности слизистых оболочек, обычно с низкой плотностью. Микробиота с весьма сложным составом, в норме колонизирующая поверхности слизистых оболочек, ингибирует размножение и доминирование таких бактерий, как Enterobacteriaceae и Enterococcaceae. Разрушение нормальной флоры в результате введения антибиотиков, тем не менее, приводит к прекращению ингибирования устойчивых к антибиотикам представителей указанных бактериальных семейств, приводя к их размножению до очень высокой численности (Ubeda et al Journal of Clinical Investigation 2010). Колонизация указанными организмами в высокой концентрации может быть губительной для восприимчивого пациента, приводя к бактериемии и сепсису (Taur et al, Clinical Infectious Disease, 2012).

[0413] Для тестирования применения тестируемого состава с бактериальной композицией, например, популяции спор, для профилактики и лечения инфекции VRE используют модель на мышах согласно вышеприведенному описанию (Ubeda et al, Infectious Immunity 2013, Ubeda et al. Journal of clinical investigation, 2010). Вкратце, эксперименты проводят на самках мышей C57BL/6J возрастом 7 недель, приобретаемых у Jackson Laboratory, размещали с доступом к обработанной облучением пище и представляли подкисленную воду. Мышей размещают в индивидуальных помещениях, чтобы избежать взаимного заражения в результате копрофагии. В случае экспериментальных инфекций VRE мыши получали лечение ампициллином (0,5 г/л) в питьевой воде, которую меняли каждые 3 дня.

[0414] В модели лечения на 1 день мышей инфицируют с использованием орального зонда 108 КОЕ устойчивого к ванкомицину штамма Enterococcus faecium, приобретенного у АТСС (АТСС 700221). Через день после инфицирования (день 1) лечение антибиотиками прекращают и определяют уровни VRE в разные моменты времени путем посева серийных разведении осажденных фекалий на планшеты с агаром Enterococcose1 (Difco) с ванкомицином (8 мкг/мл; Sigma). Колонии VRE идентифицируют по внешнему виду и подтверждают путем окрашивания по Граму или других ранее описанных способов (см., например, пример 1, 2 и 3). Кроме того, согласно вышеприведенному описанию (Ubeda et al Journal of Clinical Investigation 2010), ПЦР гена vanA, который придает устойчивость к ванкомицину, подтверждает присутствие VRE у инфицированных мышей. Тестируемый состав, например, бактериальную композицию или обработанный этанолом очищенный в градиенте состав со спорами (согласно описанию в настоящем документе), суспензию фекалий или антибиотики для лечения вводят в ФСБ на 1-3 день, при этом отрицательный контроль содержит только ФСБ и также вводится на 1-3 день через оральный зонд. Свежие осажденные фекалии получают ежедневно на протяжении эксперимента от -7 дня до 10 дня. Образцы немедленно замораживают и хранят при -80°С. ДНК экстрагировали с применением стандартных техник и анализировали с помощью 16S или сопоставимых способов (см., например, пример 2 и 3).

[0415] В модели колонизации ампициллин вводят согласно описанию выше для дня -7 - дня 1, лечение тестируемым составом или контролем-носителем проводят на день 0-2, и устойчивые бактерии VRE в концентрации 108 КОЕ вводят на 14 день. Образцы фекалий отбирают на протяжении всего эксперимента ежедневно от -7 дня до 21 дня и используют для 16S-секвенирования согласно вышеприведенному описанию (см., например, примеры 2 и 3).

[0416] В обеих моделях титры VRE в экскрементах используют для оценки успешности тестируемого состава относительно отрицательного контроля. Кроме того, оценивают состав микробиоты в отношении способности тестируемого состава индуцировать формирование здорового микробиома.

Пример 37: Профилактическое использование и лечение колонизации устойчивой к карбапенемам клебсиеллой (CRKB) в модели на мышах

[0417] Появление штаммов Klebsiella pneumoniae с пониженной восприимчивостью к карбапенемам представляет собой серьезную угрозу для госпитализированных пациентов;

Устойчивость к карбапенемам у указанных организмов чаще всего опосредует карбапенемаза K. pneumoniae (KPC), класс А бета-лактамаз, который также придает устойчивость к цефалоспоринам широкого спектра и коммерчески доступным комбинациям ингибиторов бета-лактамов/бета-лактамаз (Queenan et al. Clinical Microbiology Review, 2007). Продуцирующие KPC штаммы K. pneumoniae (KPC-Kp) часто несут детерминанты, придающие устойчивость против нескольких других классов противомикробных средств, в том числе аминогликозидов и фторхинолонов, что приводит к появлению обладающих действительно множественной лекарственной устойчивостью (MDR) организмов (Hirsch et al. Journal of Antimicrobial Chemotherapy, 2009). Учитывая ограниченные возможности противомикробной терапии, инфекции, вызываемые KPC-Kp, представляют огромную терапевтическую проблему и связаны с неблагоприятными клиническими исходами.

[0418] Протокол лечения в модели на мышах согласно вышеприведенному описанию (например, Perez et al, Antimicrobial Agents Chemotherapy, 2011) используют для оценки тестируемого состава, например, бактериальной композиции, лечить устойчивые к карбапенемам Klebsiella и уменьшать носительство в ЖКТ. Используют самок мышей CF1 (Harian Sprague-Dawley, Индианаполис, Индиана), которых содержат в отдельных помещениях, весом от 25 до 30 г.

[0419] Подробно описанный штамм K. pneumoniae, VA-367 (8, 9, 25), используют для указанного исследования. Указанный клинический изолят является генетически родственным штамму KPC-Kp, циркулирующему на востоке США. Определение механизмов устойчивости у K. pneumoniae VA-367 посредством анализа ПЦР и последовательностей ДНК показало присутствие blaKPC-3, blaTEM-1, blaSHV-11, и blaSHV-12, a также qnrB19 и аас(6')-lb. Кроме того, ПЦР и секвенирование ДНК показали наличие повреждений в кодирующих последовательностях следующих генов белков внешней мембраны: ompK35, ompK36 и ompK37. Тестирование на восприимчивость к антибиотикам (AST) выполняли методом разведении на агаре и интерпретировали в соответствии с текущими рекомендациями Института клинических и лабораторных стандартов (CLSI). Проводили модифицированный тест Ходжа в соответствии с описанным ранее способом (см., например, Anderson et al. Journal of Clinical Microbiology, 2007) с эртапенемом, меропенемом и имипенемом. Тигециклин и полимиксин E оценивали с помощью анализов на восприимчивость E-test (AB , Сольна, Швеция). Результаты для тигециклина интерпретировали в соответствии с рекомендациями Управления по контролю за пищевыми продуктами и лекарственными средствами США (FDA) и в соответствии с рекомендациями CLSI (критерии для Pseudomonas) для полимиксина Е.

[0420] Мышей (по 10 на группу) распределяют в группы для получения тестируемого состава, например, бактериальной композиции, обработанного этанолом состава со спорами (см., например, пример 6), антибиотика клиндамицина, пиперациллин-тазобактам, тигециклин, эртапенем, цефепим, ципрофлоксацина или их комбинации, или в контрольную группу, получающую только основу. Им вводят тестируемый состав ежедневно от -10 дня до 0 дня. На 0 день 103 КОЕ KPC-Kp VA-367, разведенного в 0,5 мл забуференного фосфатом солевого раствора (ФСБ) вводили через оральный зонд с применением питательной трубки из нержавеющей стали (Perfektum; Popper & Sons, Нью Гайд-парк, Нью-Йорк). Образцы стула собирали на 1, 4, 6, и 11 день после введения KPC-Kp для измерения концентрации устойчивой к карбапенему K. pneumoniae. Образцы стула (100 мг, разведенные в 800 мл ФСБ) высевают на агар Мак-Конки с 0,5 мкг/мл имипенема и без имипенема, и определяли число КОЕ на грамм стула. Как вариант, могут быть использованы другие способы измерения уровней устойчивой к карбапенему K. pneumonia, например, ПЦР, тестирование на антигены, которые может использовать специалист в данной области техники.

[0421] Образцы стула собирали через 5 дней лечения для оценки эффектов антибиотиков микрофлору стула и для измерения уровней антибиотика в стуле. Для оценки эффектов на микрофлору использовали свежие образцы стула согласно вышеприведенному описанию (см., например, примеры 2 и 3). Проводят дополнительные эксперименты для исследования того, приводило ли введение тестируемого состава, например, бактериальной композиции, к элиминированию или сохранению колонизации KPC-Kp VA-367.

[0422] Мыши получали лечение клиндамицином подкожно для уменьшения численности нормальной кишечной флоры за 1 день до получения 104 КОЕ KPC-Kp VA-367 через оральный зонд, и указанные мыши продолжали получать клиндамицин подкожно через день в течение 7 дней. Параллельно, в течение 7 дней после дозирования KPC-Kp через оральный зонд мыши получали через оральный зонд обычный солевой раствор (контрольная группа) или бактериальную композицию согласно описанию. Дополнительную дозу клиндамицина вводили подкожно через 20 дней после введения KPC-Kp VA-367 для оценки того, могли ли присутствовать низкие уровни устойчивого к карбапенему K. pneumoniae, который может стимулироваться при элиминировании анаэробной микрофлоры. Образцы стула собирали в исходный момент и на 3, 6, 8, 11, 16, и 21 день после введения KPC-Kp VA-367 через зонд. Бактериальную композицию оценивают по снижению уровня CRKB в экскрементах.

[0423] Если не указано иное, все численные значения, выражающие количества ингредиентов, реакционные условия и т.п., используемые в описании, в том числе формуле изобретения, следует во всех случаях понимать как модифицированные термином «приблизительно». Соответственно, если не указано иное, численные показатели являются приблизительными и могут варьировать в зависимости от требуемых свойств, которые необходимо получить. Как минимум, не в качестве попытки ограничения применения доктрины эквивалентов к объему формулы изобретения, каждый численный показатель должен рассматриваться в свете значащих цифр и обычных способов округления.

[0424] Если не указано иное, термин «по меньшей мере» перед группой элементов следует понимать как относящийся к каждому элементу в указанной группе.

[0425] Несмотря на то, что настоящее изобретение было конкретным образом продемонстрировано и описано с использованием ссылок на предпочтительные варианты реализации и различные альтернативные варианты реализации, специалисты в соответствующей области техники должны понимать, что различные изменения формы и деталей могут быть произведены без отступления от сущности и объем изобретения.

[0426] Все источники, выданные патенты и патентные заявки, цитируемые в тексте настоящего описания включены в настоящий документ посредством ссылки полностью и для любых целей.

ДОПОЛНИТЕЛЬНЫЕ ТАБЛИЦЫ

Таблица 1: Перечень функциональных таксономических единиц (OTU) с таксономической классификацией до рода, вида и филогенетической клады

[0427] Принадлежность клад бактериальных OTU основана на данных о последовательностях 16S. Клады определяют на основании топологии филогенетического дерева, сконструированного на основании полноразмерных последовательностей 16S с применением методов максимального правдоподобия, известных специалистам в области филогенетики. Клады конструируют для подтверждения того, что все OTU в определенной кладе: (i) расположены в пределах определенного числа узлов с бутстрен поддержкой друг от друга, и (ii) отличаются не более чем на 5% в отношении генетического сходства. OTU, принадлежащие одной кладе, можно определить как генетически и филогенетически отличные от OTU другой клады на основании данных секвенирования 16S-V4, тогда как OTU, попадающие в одну кладу, являются близкородственными. OTU, попадающие в одну кладу, являются эволюционно близкородственными и могут быть отличимы или неотличимы друг от друга на основании данных секвенирования 16S-V4. Представители одной клады, благодаря эволюционному родству, играют аналогичные функциональные роли в экогруппе микроорганизмов, например, обнаруживаемых в кишечнике человека. Композиции, где одни виды замещены другими из той же клады, предположительно сохраняют консервативную экологическую функцию и, соответственно, подходят для применения в настоящем изобретении. Для всех OTU обозначено наличие предполагаемой способности образовывать споры и то, являются ли они патогенными или патобионтными (см. определения для описания «патобионта»). Приоритетные патогены по классификации NIAID обозначены как «категория А», «категория В» или «категория С», а оппортунистические патогены обозначены как «ОП». OTU, которые не являются патогенными, или способность которых существовать в виде патогенов неизвестна, обозначены отметкой «НЕТ». «SEQ ID №» соответствует идентификатору OTU в Перечне последовательностей, а «№ доступа в общедоступной базе данных» соответствует идентификатору OTU в общедоступной базе последовательностей.

[0428] Клинический показатель основано на комбинированной фенотипической оценке состояния здоровья мыши по шкале от 0 до 4 по нескольким параметрам, в том числе внешнему виду (0-2 пункта на основании нормального внешнего вида, сгорбленность, пилоэрекция или летаргическое состояние), и клинические признаки (0-2 пункта на основании нормального внешнего вида, мокрого хвоста, пониженной на ощупь температуры или изоляции от других животных).

1. Применение очищенной популяции способных к прорастанию бактериальных спор для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит у реципиента, представляющего собой млекопитающее, при этом способные к прорастанию бактериальные споры получены путем осуществления следующих этапов: а) обеспечение фекального материала от донора, представляющего собой млекопитающее, и b) проведение обработки этанолом или термообработки фекального материала, в результате которой получают популяцию способных к прорастанию бактериальных спор, причем из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба, причем споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97% идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896.

2. Применение очищенной популяции способных к прорастанию бактериальных спор для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит, причем из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности, или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба, причем споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97% идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896.

3. Применение по любому из пп.1, 2, отличающееся тем, что реципиент-млекопитающее представляет собой человека.

4. Применение по п.1, отличающееся тем, что указанный этап обработки включает удаление по меньшей мере части бесклеточного компонента фекального материала с отделением тем самым способных к прорастанию бактериальных спор от бесклеточного материала.

5. Применение по п.1, отличающееся тем, что указанный этап обработки включает истощение или инактивацию патогенного материала.

6. Применение по любому из пп.1, 2, отличающееся тем, что указанная очищенная популяция по существу лишена остаточного продукта среды обитания, такого как бесклеточный материал, такой как остаточные волокна, ДНК, материал вирусной оболочки, или нежизнеспособный материал, или эукариотическую клетку донора-млекопитающего.

7. Применение по любому из пп.1, 2, отличающееся тем, что указанная очищенная популяция очищена из фекального материала, полученного от донора-млекопитающего.

8. Применение по любому из пп.1, 2, отличающееся тем, что у указанного донора-млекопитающего подтверждено отсутствие детектируемого уровня патогена или патобионта до получения фекального материала.

9. Применение по п.6, отличающееся тем, что количество указанного остаточного продукта среды обитания уменьшено по меньшей мере на 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% или более чем на 99% относительно фекального материала, полученного от донора-млекопитающего.

10. Применение по п.1, отличающееся тем, что обработка этанолом включает инкубирование в 50% этаноле при 37°С в течение 60 минут.

11. Применение по п.1, отличающееся тем, что термообработка включает инкубирование при 80°С в течение 30 минут.

12. Терапевтическая композиция, содержащая эффективное количество очищенной популяции способных к прорастанию бактериальных спор, полученных путем осуществления следующих этапов: а) обеспечение фекального материала от донора, представляющего собой млекопитающее, и b) проведение обработки этанолом или термообработки материала, в результате которой получают очищенную популяцию способных к прорастанию бактериальных спор, причем количество очищенной популяции является эффективным для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит у реципиента, представляющего собой млекопитающее, и i) размножения по меньшей мере одного типа бактерий, не присутствующих в указанной терапевтической композиции, у реципиента-млекопитающего, и/или ii) приживления по меньшей мере одного типа бактерий, присутствующих в терапевтической композиции, но не присутствующих у субъекта-млекопитающего до лечения; при этом из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба, причем споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97% идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896.

13. Терапевтическая композиция, содержащая эффективное количество очищенной популяции способных к прорастанию бактериальных спор для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит, и i) размножения по меньшей мере одного типа бактерий, не присутствующих в указанной терапевтической композиции, у реципиента-млекопитающего, и/или ii) приживления по меньшей мере одного типа бактерий, присутствующих в терапевтической композиции, но не присутствующих у субъекта-млекопитающего до лечения, причем из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности, или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба, причем споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97% идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896.

14. Терапевтическая композиция по любому из пп.12, 13, отличающаяся тем, что реципиент-млекопитающее представляет собой человека.

15. Терапевтическая композиция по п.12, отличающаяся тем, что указанный этап обработки включает удаление по меньшей мере части бесклеточного компонента фекального материала, тем самым отделяя способные к прорастанию бактериальные споры от бесклеточного материала.

16. Терапевтическая композиция по п.12, отличающаяся тем, что указанный этап обработки включает истощение или инактивацию патогенного материала.

17. Терапевтическая композиция по любому из пп.12, 13, отличающаяся тем, что из указанной очищенной популяции по существу удален остаточный продукт среды обитания, такой как бесклеточный материал, такой как остаточные волокна, ДНК, материал вирусной оболочки, или нежизнеспособный материал, или эукариотическая клетка донора-млекопитающего.

18. Терапевтическая композиция по любому из пп.12, 13, отличающаяся тем, что указанная очищенная популяция очищена из фекального материала, полученного от донора-млекопитающего.

19. Терапевтическая композиция по любому из пп.12, 13, отличающаяся тем, что у указанного донора-млекопитающего подтверждено отсутствие детектируемого уровня патогена или патобионта до получения фекального материала.

20. Терапевтическая композиция по п.17, отличающаяся тем, что количество указанного остаточного продукта среды обитания уменьшено по меньшей мере на 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% или более чем на 99% относительно фекального материала, полученного от донора-млекопитающего.

21. Терапевтическая композиция по любому из пп.12, 13, отличающаяся тем, что указанная композиция содержит по меньшей мере приблизительно 1×104 спор на грамм или на дозу, или указанная композиция содержит по меньшей мере приблизительно 1×103, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010 или более чем на 1×1010 спор на грамм или на дозу.

22. Композиция по п.12, отличающаяся тем, что обработка этанолом включает инкубирование в 50% этаноле при 37°С в течение 60 минут.

23. Композиция по п.12, отличающаяся тем, что термообработка включает инкубирование при 80°С в течение 30 минут.



 

Похожие патенты:
Изобретение относится к области биохимии. Предложен способ получения экзополисахарида (ЭПС) бактерий Xanthobacter xylophilus Z-0055.

Изобретение относится к получению химических элементов и их изотопов с помощью микроорганизмов. Способ получения химических элементов и их изотопов, в том числе сверхтяжелых заурановых элементов, предусматривает обработку водной суспензией бактерий рода Thiobacillus, адаптированных радиоактивным агентом, сырья, содержащего природные химические элементы и их природные изотопы, с получением целевого продукта.

Изобретение относится к промышленной и экологической микробиологии. Способ очистки сточных вод нефтеперерабатывающих и нефтехимических производств от бензола предусматривает внесение иммобилизованных клеток штамма бактерий Ochrobactrum pseudintermedium ВКПМ В-11713 в очищаемые стоки производств.

Изобретение относится к промышленной и экологической микробиологии. Способ очистки сточных вод от метанола предусматривает внесение штамма бактерий Bacillus siamensis ВКПМ В-11716 в очищаемые стоки.

Изобретение относится к промышленной и экологической микробиологии. Способ очистки сточных вод от нефтепродуктов предусматривает внесение штамма бактерий Rhodotorula mucilaginosa ВКПМ Y-4056 в очищаемые стоки.

Заявленная группа изобретений относится к области биотехнологии и может быть использована в производстве средств профилактики желудочно-кишечных инфекций и расстройств у сельскохозяйственных животных и птиц.

Предложены композиция среды и способ для получения ботулинического токсина. Данная группа изобретений относится к биотехнологии.
Изобретение относится к области биохимии и биотехнологии, в частности к продуцирующему L-лизин микроорганизму рода Corynebacterium. Указанный микроорганизм отличается тем, что в нем инактивирован по меньшей мере один секреторный белок, выбранный из группы, состоящей из аминокислотных последовательностей SEQ ID NOs: 1, 7 и 13.
Изобретение относится к биотехнологии и может быть использовано для приготовления бактериальных препаратов для применения в медицине, ветеринарии, косметологии. Штамм Halobacterium salinarum 353П-1, регистрационный номер ВКПМ В-12794, получен многоступенчатой селекцией исходного штамма Halobacterium halobium 353 Пущинский без использования методов генетической модификации и обработки химическими или физическими мутагенными агентами.

Изобретение относится к области биотехнологии и может быть использовано в растениеводстве для стимулирования роста и повышения урожайности сельскохозяйственных растений.

Изобретение относится к фармацевтической промышленности, а именно к антибактериальной фармацевтической композиции для перорального применения. Антибактериальная фармацевтическая композиция для перорального применения, содержащая бактериофаги: Секстафаг® (Пиобактериофаг поливалентный), или Интести-бактериофаг, или сальмонеллезный групп A, B, C, D, E, или дизентерийный поливалентный, с использованием в качестве целевых добавок метилцеллюлозу, сорбит, лактозу и кальция карбонат, кальция или магния стеарат, натрия альгинат, пектин, композиция расфасована в твердые капсулы при определенном соотношении компонентов.

Изобретение относится к новому соединению формулы I или его фармацевтически приемлемой соли, обладающим селективным действием в отношении PDE1. Соединения могут найти применение при лечении заболевания или нарушения, выбранного из группы, включающей множество заболеваний и нарушений, включая когнитивный дефицит, связанный с заболеваниями и нарушениями ЦНС, неврологические нарушения, сердечно-сосудистые нарушения, почечные нарушения, гематологические нарушения, нарушения желудочно-кишечного тракта и печени, раковые нарушения и нейродегенеративные нарушения.

Изобретение относится к новым полиморфным формам 4-{[4-({[4-(2,2,2-трифторэтокси)-1,2-бензизоксазол-3-ил]окси}метил)пиперидин-1-ил]метил}тетрагидро-2H-пиран-4-карбоновой кислоты.

Группа изобретений относится к области ветеринарии и может быть использована для лечения болезней органов пищеварения телят. Средство содержит экстрагированные из сухих почек тополя черного биологически активные сухие вещества 3±0,5 и 70%-ный спирт этиловый ректификованный 97±0,5 при соотношении к экстрагенту 1:5; экстрагируют при температуре 18-20°С в течение 14 сут и непосредственно перед применением разводят в кипяченой охлажденной воде.

Изобретение относится к фармацевтической промышленности, а именно к применению лекарственного средства традиционной китайской медицины для предупреждения или лечения болезни Крона.
Изобретение относится к области медицины, а именно к гастроэнтерологии, и может быть использовано для коррекции динамической кишечной непроходимости. Выполняют электроэнтерографию моторной функции каждого отдела пищеварительного тракта.

Группа изобретений относится к медицине и касается композиции для уменьшения симптомов токсичности пептида глиадина у субъекта, имеющего связанное с глютеном расстройство, содержащей пробиотический микроорганизм Lactobacillus paracasei СВА L74, номер международного депонирования LMG Р-24778, и/или супернатант культуры, продуцируемый ферментирующими Lactobacillus paracasei СВА L74, номер международного депонирования LMG Р-24778, в комбинации с одним или более физиологически приемлемым носителем.

Изобретение относится к медицине, оздоровлению, способствующему избавлению от различных болезней. Проводят закисление внутренней среды последовательно по этапам: «очищение желудочно-кишечного тракта» (ЖКТ), «очищение печени и желчного пузыря», «очищение почек».

Изобретение относится к соединениям формулы (I): где E1, E2 независимо друг от друга представляют собой –CO– или –SO2–, R* представляет собой один из следующих остатков: –H, -CH3, -C2H5, -C3H7, -CH(CH3)2 или -C4H9, R# представляет собой один из следующих остатков: –NYY’, -OH, -OY,–NH–CH(CH2CH(CH3)2)–CH2COOY’, , , , , , , , Y представляет собой один из следующих остатков: –CH2R1, –CHR1–CH2R2, –CHR1–CHR2–CH2R3, –CHR1–CHR2–CHR3–CH2R4 или –CHR1–CHR2–CHR3–CHR4–CH2R5; Y’, R17-R20 выбирают независимо друг от друга из: –H, -CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11, –CH2–C(CH3)3, –CH(C2H5)2 и –C2H4–CH(CH3)2; X представляет собой –CR7R8R9, –CH2R7, –CHR7–CH2R8, –O–CH2R7, –O–CR7R8R9, , , , , , , , , , , , , , , , , , , , Z представляет собой: –СН3, –С2Н5, -С3Н7, -СН(СН3)2, -С4Н9,–OCH3, –OC2H5, –OC3H7, –OCH(CH3)2, –OC4H9 или -OCH2-Ph; R1-R10 представляют собой независимо друг от друга следующие группы –H, –OН,–NO2, -F, –Cl, –Br, –I,–COOH,–COOCH3, –COOC2H5, –COOC3H7, COOCH(CH3)2, –COOC(CH3)3,–NHCOCH3, –NHCOC2H5, –NHCOC3H7,–NHCO–OC(CH3)3, –NH2, –NHCH3, –NHC2H5, –NHC3H7,–NHCH(CH3)2, –NHC(CH3)2, –N(CH3)2, –N(C2H5)2, –N(C3H7)2,–N[CH(CH3)2]2, –N[C(CH3)3]2,–SO2NH2,–NH–CO–NH2, -CF3, цикло-C3H5, цикло-C4H7, цикло-C5H9, цикло-C6H11, -Ph, -CH2-Ph, -CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11,–CH2–C(CH3)3, –CH(C2H5)2, -C6H13, , , , , , , , , , , , , остатки R11-R16 представляют собой независимо друг от друга следующие группы: –H, –NH2, –OH, –OCH3, –OC2H5, –OC3H7, –OCF3, -CF3, –F, –Cl, –Br, –I, -CH3, -C2H5, -C3H7 и -CH(CH3)2; их фармацевтически приемлемым солям и их применению для профилактики и лечения заболеваний, связанных с трансглутаминазой тканей.

Настоящее изобретение относится к пиразолопиридиновым производным формулы (I), в которой А представляет собой арил, выбранный из группы, состоящей из пиридила, фенила, пиразинила, пиридазинила, пиразола, триазола, индолила, бензимидазолила и изохинолинила; -В-С представляет собой -NR2-(C=O) или -(C=O)-NR2-, и остальные силволы и радикалы имеют значения, указанные в формуле изобретения.

Изобретение относится к области медицины, в частности к фармацевтической композиции для коррекции когнитивных и неврологических нарушений, вызванных острыми повреждениями мозгового кровообращения, содержащей 9-бутиламино-3,3-диметил-3,4-дигидроакридин-1(2Н)-она гидрохлорида и фармацевтически приемлемый носитель.

Предложены варианты применения очищенной популяции способных к прорастанию бактериальных спор для лечения или предотвращения или уменьшения тяжести по меньшей мере одного симптома дисбиоза ЖКТ, связанного с Clostridium difficile, включая рецидивирующую инфекцию С. difficile, или язвенный колит у реципиента, представляющего собой млекопитающее, а также варианты терапевтической композиции, содержащей эффективное количество очищенной популяции способных к прорастанию бактериальных спор. Способные к прорастанию бактериальные споры могут быть получены путем осуществления следующих этапов: а) обеспечение фекального материала от донора, представляющего собой млекопитающее, и b) проведение обработки этанолом или термообработки фекального материала, в результате которой получают популяцию способных к прорастанию бактериальных спор. Из указанной очищенной популяции по существу устранен на детектируемом уровне патогенный материал, или патогенный материал по существу не имеет патогенной активности или имеет сниженный уровень патогенной активности, где необязательно указанный патогенный материал выбран из группы, состоящей из вируса, бактерии, эукариотического паразита, гельминта, фага, микоплазмы, токсоплазмы и гриба. При этом споры содержат по меньшей мере два вида бактерий, содержащих последовательности нуклеиновых кислот, по меньшей мере на 97 идентичные последовательностям нуклеиновых кислот, выбранным из группы, состоящей из SEQ ID NO. 6, SEQ ID NO. 383, SEQ ID NO. 381, SEQ ID NO. 572, SEQ ID NO. 601, SEQ ID NO. 652, SEQ ID NO. 659, SEQ ID NO. 673, SEQ ID NO. 674, SEQ ID NO. 774, SEQ ID NO. 839, SEQ ID NO. 845, SEQ ID NO. 847, SEQ ID NO. 848, SEQ ID NO. 856, SEQ ID NO. 874, SEQ ID NO. 880, SEQ ID NO. 886, SEQ ID NO. 1049, SEQ ID NO. 1591, SEQ ID NO. 1655, SEQ ID NO. 1657, SEQ ID NO. 1670 и SEQ ID NO. 1896. Группа изобретений обеспечивает эффективное предотвращение, контроль и лечение заболеваний, расстройств и состояний ЖКТ, связанных с Clostridium difficile, и обеспечение здорового функционирования системы пищеварения в целом. 4 н. и 19 з.п. ф-лы, 21 ил., 33 табл., 37 пр.

Наверх