Тест-система для количественного определения streptococcus agalactiae в биологическом материале



Тест-система для количественного определения streptococcus agalactiae в биологическом материале
Тест-система для количественного определения streptococcus agalactiae в биологическом материале

 


Владельцы патента RU 2435853:

Государственное образовательное учреждение высшего профессионального образования "Российский государственный медицинский университет Федерального агентства по здравоохранению и социальному развитию" (ГОУ ВПО РГМУ Росздрава) (RU)
Российская Федерация, от имени которой выступает Министерство образования и науки Российской Федерации (RU)

Изобретение относится к области биотехнологии. Предложенная тест-система для количественного определения Streptococcus agalactiae включает видоспецифичные праймеры, имеющие нуклеотидные последовательности 5'-CAGTTGAATCCAAATGTTACGG-3' и 5'-TAATGCTGTTTGAAGTGCTG-3', и зонд, имеющий нуклеотидную последовательность 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. ДНК-мишенью для специфической амплификации является фрагмент гена cfb Streptococcus agalactiae между 685 и 762 нуклеотидными остатками его полной последовательности. Предложенное изобретение позволяет быстро и высокоспецифично выявлять Streptococcus agalactiae в образцах биологического материала и определение его количественного содержания. 2 ил., 2 табл.

 

Изобретение относится к биотехнологии, в частности к лабораторной диагностике заболеваний, вызываемых болезнетворными микроорганизмами, может быть использовано для обнаружения и определения количественного содержания Streptococcus agalactiae в биологическом материале.

Streptococcus agalactiae относятся к β-гемолитическим стрептококкам и входят в серологическую группу В, часто колонизируют кишечник и урогенитальный тракт здоровых взрослых людей обоего пола. В частности, частота обнаружения Streptococcus agalactiae в вагинальном тракте здоровых женщин варьирует от 10% до 36%, при этом количество бактерий может достигать значений 104-105 КОЕ/мл вагинального секрета (Trijbels-Smeulders M.A., Kollee L.A., Adriaanse A.H., Kimpen J.L., Gerards L.J. Neonatal group В streptococcal infection: incidence and strategies for prevention in Europe. Pediatr. Infect. Dis. J. 2004; 23:172-173; Schuchat A. Epidemiology of group В streptococcal disease in the United States: shifting paradigms. Clin. Microbiol. Rev. 1998; 11:497-513).

В большинстве случаев колонизация этими микроорганизмами не вызывает заболевания у здоровых взрослых людей, однако Streptococcus agalactiae являются основной причиной сепсиса, менингитов и пневмоний у новорожденных детей, нередко приводящих к летальному исходу или к постинфекционным инвалидизирующим осложнениям. Неонатальные инфекции, возникающие в первые 3 дня жизни, в 40% случаев обусловлены Streptococcus agalactiae. Ребенок может быть инфицирован во время родов при прохождении через родовые пути матери, бессимптомно колонизированной Streptococcus agalactiae (Melchers W.J.G., Bakkers J.M.J.E., Toonen M., van Kuppeveld, F.J.M., Trijbels M., Hoogkamp-Korstanje J.A.A. Genetic analysis of Streptococcus agalactiae strains isolated from neonates and their mothers. FEMS Immunol. Med. Microbiol. 2003; 36:111-113).

В случае преждевременного разрыва плодных оболочек риск контаминации плода и развития инфекционной патологии повышается. Инфицирование новорожденных стрептококками этого вида может также происходить и после родов госпитальными штаммами бактерий, источниками которых могут быть предметы окружающей среды, включая медицинское оборудование. Кроме того, источником Streptococcus agalactiae может быть и персонал родовспомогательного учреждения.

Успешное решение проблемы перинатальных инфекций, вызываемых бактериями вида Streptococcus agalactiae, как в их предупреждении, так и в патогенетически оправданном и своевременном лечении, зависит от использования эффективных диагностических технологий.

В настоящее время основным методом, предназначенным для обнаружения и количественного определения Streptococcus agalactiae, остается бактериологическое исследование, включающее высев серийных разведении исследуемого материала на питательные среды с целью получения чистой культуры бактерий и установления их видовой принадлежности путем изучения их морфологических, культуральных, а также физиолого-биохимических свойств при помощи ряда дифференциально-диагностических питательных сред (Ruoff K.L. и соавторы, Streptococcus In: Murray P.R. (eds) Manual of Clinical Microbiology, 2003, стр.410).

Кроме того, для установления видовой принадлежности выделенных из исследуемого материала чистых культур бактерий, подозрительных на принадлежность к виду Streptococcus agalactiae, вместо дифференциально-диагностических питательных сред могут быть использованы тест-системы, основанные на использовании серологических реакций, например, реакции агглютинации латексных частиц, нагруженных специфическими к антигенам Streptococcus agalactiae антителами (Ruoff K.L. и соавторы, Streptococcus In: Murray P.R. (eds) Manual of Clinical Microbiology, 2003, стр.409).

Несмотря на эффективность такого подхода, основным недостатком традиционного бактериологического метода является его трудоемкость и длительность проведения исследований, составляющая в зависимости от исследуемого материала от 36 часов, например для проб слюны, мочи, испражнений, вагинального отделяемого, и до 5 суток в случаях, когда проводится исследование проб крови и спинномозговой жидкости.

Однако, принимая во внимание скорость развития инфекционного процесса у новорожденного ребенка, можно понять, насколько значимо использование в неонатальной клинике методов быстрого обнаружения возбудителя. Поэтому быстрое, чувствительное и высокоспецифичное исследование, позволяющее обнаруживать Streptococcus agalactiae непосредственно в клинических образцах и устанавливать их количественное содержание, позволило бы упростить и сделать более эффективной как реализацию программы профилактики инфицирования новорожденных детей от матерей носителей этих микроорганизмов, так и своевременное обнаружение этих бактерий в клиническом материале, полученном от новорожденных детей.

В настоящее время наиболее перспективными считаются молекулярные методы, основанные на обнаружении ДНК возбудителей в исследуемом материале, в частности методы, основанные на технологии ПЦР. Эти методы обладают высокой чувствительностью и специфичностью и позволяют обнаруживать присутствие очень малого количества копий генетических последовательностей микроорганизмов в микроколичествах исследуемого материала и за короткое время. Кроме того, современные модификации полимеразной цепной реакции, проводимой в режиме реального времени, также позволяют определять количественные значения микроорганизмов.

Известна технология обнаружения Streptococcus agalactiae в реакции ПЦР, протекающей в реальном времени, путем использования двух олигонуклеотидных праймеров, амплифицирующих область гена cfb между 59 и 212 парами оснований его нуклеотидной последовательности с одновременной детекцией получаемых продуктов (ампликонов) посредством специфически гибридизующихся с ними двух олигонуклеотидных зондов, меченных флуорофорами. Принцип метода заключается в резонансном переносе энергии возбуждения электронов от одного флуорофора, находящегося на 3′ конце одного зонда, ко второму флуорофору, находящемуся на 5′ конце второго зонда, который происходит в том случае, когда оба зонда одновременно гибридизуются с одним ампликоном и расстояние между флуорофорами составляет 1 нуклеотид. При одновременном связывании обоих зондов с ДНК матрицей энергия возбуждения первого флуорофора передается на второй флуорофор, а его излучение детектируется прибором (Bergeron M.G., Ke D., Ménard С., Picard F.J., Gagnon M., Bernier M., Ouellette M., Roy P.H., Marcoux S., Fraser W.D. (2000) Rapid detection of group В streptococci in pregnant women at delivery. N Engl J Med 343, 175-179).

В настоящее время существует только одна коммерциализованная диагностическая тест-система (Smart GBS, Cepheid) для обнаружения Streptococcus agalactiae в биологическом материале, работа которой основана на вышеприведенном подходе, разработанном группой Bergeron M.G и соавторов.

Однако описанная тест-система рекомендована производителем только для выявления возбудителя в ректальных и вагинальных мазках и не предназначена для обнаружения Streptococcus agalactiae в других видах биологического материала (слюне, бронхоальвеолярном и желудочном аспиратах, моче и крови).

Кроме того, высокая стоимость тест-системы и невозможность выполнения с ее помощью ПЦР на приборах российского производства ограничивают ее применение в отечественных лабораториях.

Проведенный поиск по патентным и научно-техническим источникам информации показал отсутствие сведений о тест-системах, предназначенных для выявления Streptococcus agalactiae методом ПЦР с гибридизационно-флуоресцентным учетом результатов, обеспечивающих количественное определение возбудителя в биологическом материале, а также доступных в лабораториях России. Таким образом, существует потребность в создании недорогого, чувствительного и специфичного набора, который нашел бы широкое применение в практическом здравоохранении.

Задачей настоящего изобретения является создание тест-системы для количественного определения Streptococcus agalactiae в пробах биологического материала, с возможностью ее использования в ПЦР в режиме реального времени с гибридизационно-флуоресцентным учетом результатов.

Технический результат заключается в повышении эффективности обнаружения Streptococcus agalactiae в образцах различных видов биологического материала, что выражается в возможности не только определять присутствие бактерий в исследуемом материале, но также с высокой точностью устанавливать и их количество. Кроме того, процесс обнаружения продукта ПЦР при помощи предлагаемой тест-системы проходит без вскрытия пробирки, что исключает рассеивание продуктов амплификации в окружающей среде, являющихся основным источником ложноположительных результатов ПЦР.

Технический результат достигается использованием тест-системы для количественного определения Streptococcus agalactiae. Заявляемая тест-система для обнаружения и количественного определения Streptococcus agalactiae в пробах биологического материала путем проведения полимеразной цепной реакции в реальном времени включает набор синтетических олигонуклеотидных праймеров, имеющих нуклеотидные последовательности 5′-CAGTTGAATCCAAATGTTACGG-3′ и 5′-TAATGCTGTTTGAAGTGCTG-3′, и зонд, имеющий нуклеотидную последовательность 5′-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3′.

Краткое описание графических материалов

Фиг.1. Выравнивание нуклеотидных последовательностей амплифицируемых предлагаемыми праймерами областей генов cfb четырех штаммов бактерий вида Streptococcus agalactiae (str1 - А909, str2 - 260 V/R, str3 - NEM316; str4 - №4). Вверху приведена консенсусная последовательность между сравниваемыми областями генов cfb. Позиции гибридизации праймеров и зонда между ними указаны рамками. Продукт амплификации соответствует отрезку нуклеотидной последовательности генома Streptococcus agalactiae длиной 78 п.о.

Фиг.2. Определение достоверности количественной детекции ДНК Streptococcus agalactiae и эффективности протекания ПЦР-реакции, проводимой при помощи разработанной тест-системы в серии реакций с использованием в качестве матрицы серийных десятикратных разведений (от 10 до 106 раз) геномной ДНК, выделенной из 1 мл культуры Streptococcus agalactiae N4.

Таблица 1. Результаты изучения специфичности тест-системы для детекции Streptococcus agalactiae.

Таблица 2. Результаты исследования симулированных клинических образцов бактериологическим методом и методом ПЦР в режиме реального времени с использованием предлагаемой тест-системы.

В качестве ДНК-мишени для разработки диагностической тест-системы для детекции Streptococcus agalactiae был избран фрагмент гена cfb.

Ген cfb отвечает за образование САМР-фактора, являющегося внеклеточным белком Streptococcus agalactiae, биологическая активность которого заключается в образовании совместно с β-гемолизином Staphylococcus aureus расширенной зоны гемолиза на кровяном агаре. Практически все изоляты бактерий, относящиеся к виду Streptococcus agalactiae, продуцируют САМР-фактор. Ген cfb Streptococcus agalactiae имеет уникальную для данного вида последовательность нуклеотидов, не встречающуюся у эволюционно родственных видов и родов микроорганизмов и не имеет близких гомологов в геномах бактерий других родов (Hassan AA, Abdulmawjood A, Yildirim АО, Fink К, Lämmler С, Schlenstedt R. Identification of streptococci isolated from various sources by determination of cfb gene and other CAMP-factor genes. Can J Microbiol 2000; 46(10):946-951).

Нуклеотидные последовательности гена cfb Streptococcus agalactiae были получены из базы данных GenBank NCBI, а также в результате секвенирования аналогичного участка у штаммов, выделенных на территории Российской Федерации. В результате выравнивания нуклеотидных последовательностей гена cfb референс-штаммов Streptococcus agalactiae A909, GDzl, NEM316, R268 и 260V/R (GenBank NCBI: CP000114.1, GU217532.1, AL766855.1, X72754.1, AE009948.1) и штаммов Streptococcus agalactiae, выделенных на территории Российской Федерации, нами была выведена его консенсусная последовательность SEQ ID NO 1:

5'-ATGAACGTTAMACATATGATGTATCTATCTGGAACTCTAGTGGCTGGTG

CATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGAC

AACTCCACAAGTGGTAAATCATGTAAAYAGTAATAATCAAGCCCAGCA

AATGGCTCAAAAGCTTGATCAAGATAGCATTCAGTTGAGAAATATCAA

AGATAATGTTCAGGGAACAGATTATGAAAAAMCGGTTAATGAGGCTAT

TACTAGYGTKGAAAAATTAAAGACTTCATTGCGTGCCAACCCTGAGAC

AGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGAT

GTGATTGAAGCAATCACTTTTTCAACTCAACATTTARCAAATAAGGTTA

GTCAAGCAAATATTGATATGGGATTTGGGATAACTAAGCTRGTTATTCG

CATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAAC

GATGTAAAGGCATTAGAACAAAARGTTTTAACTTATCCTGATTTAAAAC

CAACTGATAGAGCTACMATCTATACAAAATCAAAACTTGATAAGGAAA

TCTGGAATACACGCTTTACTAGAGRTAAAAAAGTACTTAACGTCAAAG

AATTTAAAGTTTACAATACTTTAAATAAAGCAATCACACATGCTGTTGG

AGTTCAGTTGAATCCAAATGTTACGGTACAACAAGTTGATCAAGAGAT

TGTAACATTACAAGCAGCACTTCAAACAGCATTA AAATAA-3'

На следующем этапе в результате тщательного изучения полученной консенсусной последовательности гена cfb нами был выявлен протяженный район 100%-ной идентичности нуклеотидных последовательностей у всех сравниваемых штаммов (с 685 по 762 нуклеотид), который и был избран в качестве мишени для отжига праймеров и зонда и имеющий последовательность SEQ ID NO 2:

5'-CAGTTGAATCCAAATGTTACGGTACAACAAGTTGATCAAGAGA TTGTAACATTACAAGCAGCACTTCAAACAGCATTA-3'

Нуклеотидные последовательности праймеров для амплификации последовательности SEQ ID NO 2 и зонда для детекции ампликонов были созданы при помощи программы PerlPrimer (Owen Marshall). Специфичность праймеров и зонда оценивали методом множественного сравнения последовательностей, используя программное обеспечение, например NCBI BlastN.

Специфичные к гену cfb праймеры и зонд имеют следующий состав: прямой праймер - 5′-CAGTTGAATCCAAATGTTACGG-3′; обратный праймер - 5′-TAATGCTGTTTGAAGTGCTG-3′; зонд - 5′-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3′. Локализация областей гибридизации праймеров и зонда на последовательности SEQ ID NO 2 представлена на фиг.1.

Олигонуклеотиды праймеров и зонда были синтезированы амидофосфитным методом, например, на автоматическом синтезаторе ДНК/РНК ASM-2000 (000 БИОССЕТ, Россия) и очищены при помощи препаративного электрофореза в ПААГ.

Для использования зонда в ПНР в режиме реального времени с гибридизационно-флуоресцентным учетом результатов, на этапе синтеза зонд был конъюгирован с флуоресцентным красителем R6G на 5′-конце олигонуклеотидной цепи, а также с тушителем флуоресценции RTQ1 по внутреннему остатку тимина. Кроме того, 3′-концевая гидроксильная группа зонда была блокирована сложноэфирной связью с остатком фосфорной кислоты. Таким образом, в дальнейшем использовался зонд следующей структуры: 5′-R6G-CAACAAGTTGAT(RTQ 1)CAAGAGATTGTAACATTACAAGCA-P-3′.

Подобраны оптимальные параметры реакции амплификации с олигонуклеотидными праймерами и зондом. В частности, реакционная смесь имеет следующий состав: от 15 до 25 мМ Трис-НСl буфер, рН 8.4; 50 мМ КСl; 2,5 мМ MgCl2; 0,2 мМ дезоксинуклеотидтрифосфаты; по 0,2 мМ прямой и обратный праймеры; 0,2 мМ меченный флуорофором и гасителем зонд; 0.04 ЕД/мкл полимеразы Taq.

ПЦР может быть проведена, например, в приборе АНК-32 (Синтол, Россия) с использованием следующей программы: первоначальная денатурация - 95°С, 5 мин; 42 цикла - 1) 94°С, 15 с; 2) 60°С 60 с.Флуоресценцию в пробирках детектируют в режиме реального времени на канале R6G. Значения пороговых циклов определяются автоматически прибором.

Оценку специфичности ПЦР в режиме реального времени проводили с использованием геномных ДНК выделенных из чистых культур 32 штаммов бактерий, изолированных из клинического материала (Табл. 1). Установлено, что сконструированные праймеры и зонд для детекции Streptococcus agalactiae обладают 100% специфичностью. Нарастание сигнала флуоресценции на канале R6G наблюдалось лишь в случае использования в качестве матрицы ДНК Streptococcus agalactiae. При внесении в реакцию ДНК других видов микроорганизмов нарастания флуоресцентного сигнала в ходе проведения ПЦР не наблюдалось.

Для определения достоверности количественной детекции ДНК, эффективности протекания ПЦР-реакций и аналитической чувствительности тест-системы были проведены серии реакций с использованием в качестве матрицы серийных десятикратных разведений (от 10 до 106 раз) препаратов геномной ДНК, выделенной из 1 мл культуры Streptococcus agalactiae N4, находившихся в экспоненциальной фазе роста в концентрации 3,0×109 КОЕ/мл.

Достоверность количественной детекции определяли путем построения калибровочных кривых и определения коэффициентов корреляции. Эффективность амплификации рассчитывали на основании крутизны калибровочной прямой, построенной через экспериментальные точки в полулогарифмической системе координат. При анализе достоверности количественной детекции ДНК была выявлена высокая эффективность амплификации (Е=2) и сильная корреляционная связь между значением концентрации калибровочных образцов ДНК и определяемым значением порогового цикла (R2=1) (Фиг.2). Аналитическая чувствительность полученной тест-системы была не ниже 300 геномэкв.

Для подтверждения возможности реализации заявленного назначения и достижения указанного технического результата приводим следующие данные.

Пример 1

Оценка диагностических характеристик разработанной тест-системы на модели симулированных клинических образцов

Для апробации предлагаемой тест-системы использовали препараты тотальной ДНК, выделенной из симулированных клинических образцов биологических жидкостей, в частности слюны, мочи и цельной крови с добавлением консерванта ЭДТА, взятых у здоровых взрослых добровольцев (Табл. 2).

Всего было подготовлено 15 образцов, в 4 из которых, в частности в образец слюны, мочи и два образца цельной крови, была добавлена чистая культура Streptococcus agalactiae, причем в образец слюны также была добавлена чистая культура К. pneumoniae. В следующие 6 образцов биологического материала были добавлены другие бактерии, в частности К. pneumoniae, К. oxytoca или Е. coli. Наконец, в оставшиеся 5 образцов биологического материала бактерии добавлены не были (Табл. 2).

ДНК из образцов клинического материала выделяют следующим способом: к 100 мкл клинического образца добавляют 100 мкл буфера для выделения ДНК (20 mM Tris-HCl (pH 8,0), 2 мМ ЭДТА, 10 мг/мл лизоцим) и перемешивают на вортексе 10 с. Полученную суспензию инкубируют 20 мин при 37°С. Затем к суспензии добавляют 20 мкл раствора протеиназы К (20 мг/мл) и продолжают инкубацию при температуре 55°С в течение 20 мин. Далее суспензию лизируют добавлением 600 мкл лизирующего буфера (6М гуанидин изотиоцианат, 40 г/л Triton Х-100 и 10 г/л DTT) с последующей инкубацией 5 мин при 55°С. Лизаты вносят в микроколонки для сорбции ДНК, например, Zymo-SpinТМ IC (Zymo Research, США) и производят их центрифугирование в течение 30 с при 10000 g. Элюат удаляют, а в колонки вносят 500 мкл отмывочного буфера (50 мМ NaCl, 10 мМ Tris-HCl pH 7.5, 2.5 мМ ЭДТА 50% этанол) и вновь центрифугируют 30 с при 10000 g. Отмывку повторяют еще один раз. После тщательного удаления остатков промывочного буфера проводят элюцию ДНК с сорбента добавлением 50 мкл элюирующего буфера (10 мМ Tris-HCl pH 8.0, 1 мМ ЭДТА) с последующим центрифугированием, как описано выше. Элюат, содержащий очищенную ДНК, используют в ПЦР из расчета, например, 10 мкл на 25 мкл реакционной смеси.

В качестве ДНК положительного контроля и калибраторного образца для количественного определения содержания ДНК Streptococcus agalactiae в исследуемых образцах используют рекомбинантную плазмидную ДНК, содержащую клонированный фрагмент гена-мишени для ПЦР с нуклеотидной последовательностью SEQ ID NO:2. Данную плазмиду используют для создания серии растворов калибраторных ДНК, соответствующих по концентрации 3×107; 3×106; 3×105; 3×104 и 3×103 копий/мл целевого гена cfb. Отрицательный контроль готовят путем внесения в реакционную смесь, например, 10 мкл ТЕ-буфера.

Диагностические характеристики разработанной тест-системы изучали в сравнении с классическим бактериологическим методом, заключавшимся в выделении чистой культуры Streptococcus agalactiae из каждого образца исследуемого материала с использованием питательных сред и последующую морфологическую и биохимическую идентификацию выделенных культур.

При изучении слепым методом симулированных образцов данные по качественному и количественному присутствию Streptococcus agalactiae, полученные методом ПЦР-РВ с использованием разработанной тест-системы, полностью соответствовали результатам бактериологического исследования (Табл.2).

Таким образом, чувствительность предлагаемой тест-системы и ее специфичность в сравнении с бактериологическим методом составила 100% и 100% соответственно.

Описанное изобретение не ограничивается указанными в таблице объектами, которые предназначены только для иллюстрирования. Любые типы образцов биологического материала находятся в сфере действия настоящего изобретения.

Таким образом, поставленная задача по созданию диагностической тест-системы для количественного определения Streptococcus agalactiae в образцах биологического материала путем проведения полимеразной цепной реакции в реальном времени с гибридизационно-флуоресцентным учетом результатов успешно решена. Составляющий тест-систему набор выбранных праймеров и зонд не дают перекрестных реакций с другими видами микроорганизмов, позволяют быстро и надежно определять наличие или отсутствие ДНК Streptococcus agalactiae, а также количество ее копий, позволяя тем самым устанавливать количественное содержание возбудителя на единицу объема исследуемого материала.

Таблица 1
№ п/п Название штамма Результат флуоресцентной детекции амплифицируемой области гена cfb при проведении ПЦР в режиме реального времени («+» - нарастание сигнала флуоресценции, «-» - отсутствие сигнала флуоресценции)
1 Streptococcus agalactiae N4 +
2 Streptococcus agalactiae F12 +
3 Streptococcus anginosus К3 -
4 Klebsiella oxytoca EL1 -
5 Klebsiella pneumoniae EK1 -
6 Acinetobacter sp.3 -
7 Acinetobacter sp.4 -
8 Proteus sp.XI -
9 Proteus sp.AV1 -
10 Proteus sp.AV2 -
11 Klebsiella sp.XI -
12 Klebsiella pneumoniae BA1 -
13 Klebsiella oxytoca BA2 -
14 Streptococcus sp.A4 -
15 Streptococcus sp.A9 -
16 Citrobacter sp.#11 -
17 Escherichia coli BA1 -
18 Lactococcus sp.EK1 -
19 Enterococcus sp.EK6 -
20 Enterococcus sp.EK2 -
21 Enterococcus sp.EK3 -
22 Escherichia coli BA1NT -
23 Escherichia coli BA2 -
24 Escherichia coli ВА3 -
25 Escherichia coli BA4 -
26 Escherichia coli BA5 -
27 Escherichia coli BA6 -
28 Escherichia coli BA7 -
29 Escherichia coli BA8 -
30 Escherichia coli BA9 -
31 Escherichia coli BA10 -
32 Escherichia coli BA11 -
33 Escherichia coli BA 12 -
34 Escherichia coli BA 13 -
35 Escherichia coli BA 14 -
36 Escherichia coli BA 15 -
37 Escherichia coli BA 16 -
38 Staphylococcus sp.AV1 -
39 Staphylococcus aureus BA1 -
40 Staphylococcus aureus BA2 -
41 Pseudomonas aeruginosa 1 -
42 Pseudomonas aeruginosa 2 -
43 Pseudomonas aeruginosa 3 -
44 Pseudomonas aeruginosa 4 -
45 Pseudomonas sp AV2. -
Таблица 2
№ п/п Характеристика исследуемого образца Количество колониеобразующих единиц S. agalactiae в 1 мл пробы симулированных клинических образцов, определенное бактериологическим методом Количество копий геномов S. agalactiae в 1 мл пробы биологического материала, определенное с использованием разработанной тест-системы
1 Слюна здорового добровольца с добавлением Е. coli Не обнаружено Не обнаружено
2 Слюна здорового добровольца с добавлением S. agalactiae и К. pneumoniae 1,0×105 КОЕ/мл 3,2×106 копий
3 Слюна здорового добровольца с добавлением Е. coli Не обнаружено Не обнаружено
4 Слюна здорового добровольца с добавлением К. oxytoca Не обнаружено Не обнаружено
5 Слюна здорового добровольца без добавления бактерий Не обнаружено Не обнаружено
6 Слюна здорового добровольца без добавления бактерий Не обнаружено Не обнаружено
7 Моча здорового добровольца с добавлением Е. coli Не обнаружено Не обнаружено
8 Моча здорового добровольца с добавлением Е. coli Не обнаружено Не обнаружено
9 Моча здорового добровольца с добавлением К. oxytoca Не обнаружено Не обнаружено
10 Моча здорового добровольца без добавления бактерий Не обнаружено Не обнаружено
11 Моча здорового добровольца без добавления бактерий Не обнаружено Не обнаружено
12 Моча здорового добровольца с добавлением S. agalactiae 3,0×105 КОЕ/мл 3,2×105 копий
13 Цельная кровь здорового добровольца с добавлением S. agalactiae 1,0×103 КОЕ/мл 2,0×103 копий
14 Цельная кровь здорового добровольца с добавлением S. agalactiae 1,0×105 КОЕ/мл 3,0×105 копий
15 Цельная кровь здорового добровольца без добавления бактерий Не обнаружено Не обнаружено

Тест-система, предназначенная для количественного определения Streptococcus agalactiae в биологическом материале путем проведения полимеразной цепной реакции в реальном времени, включающая праймер, имеющий нуклеотидную последовательность 5'-CAGTTGAATCCAAATGTTACGG-3', праймер, имеющий нуклеотидную последовательность 5'-TAATGCTGTTTGAAGTGCTG-3', и зонд, имеющий нуклеотидную последовательность 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'.



 

Похожие патенты:
Изобретение относится к области биотехнологии, а именно к способу измерения длины теломер клеток лейкоконцентрата пуповинной крови. .

Изобретение относится к области медицины, а именно к молекулярной генетике. .

Изобретение относится к биотехнологии и представляет собой наборы праймеров для проведения LIMP или ПЦР, используемые для детекции Saccharomyces pastorianus. .

Изобретение относится к биотехнологии. .

Изобретение относится к области медицины, в частности к области гематологии, онкологии и клинической лабораторной диагностики, кроме того, оно может быть использовано в ветеринарии и биологии.

Изобретение относится к области биотехнологии и медицины. .

Изобретение относится к области биотехнологии и молекулярной генетики. .
Изобретение относится к области биотехнологии, конкретно к способу дифференциации штаммов возбудителя чумы основного и неосновных подвидов и возбудителя псевдотуберкулеза.

Изобретение относится к выделенным полипептидам, обладающим антимикробной активностью, и выделенным полинуклеотидам, кодирующим эти полипептиды, а также к конструкциям нуклеиновой кислоты, векторам и клеткам-хозяевам, содержащим указанные полинуклеотиды.

Изобретение относится к области биотехнологии и здравоохранения. .

Изобретение относится к биотехнологии и представляет собой липолитический фермента, который получен из одного из Streptomyces. .

Изобретение относится к области микробиологии и молекулярной генетики и может быть использовано в медицинской промышленности при производстве вакцин против Streptococcus agalactiae.
Наверх