Способ получения протеиназы ulp275


 


Владельцы патента RU 2451076:

Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП "ГосНИИгенетика") (RU)

Изобретение относится к области биохимии и биотехнологии. Штамм Escherichia coli ВКПМ В-10996 культивируют на питательной среде КС, содержащей, мас.%: пептон 2-4, дрожжевой экстракт 1-2 и вода - остальное в присутствии селективного антибиотика до стационарной фазы роста при температуре от 20 до 30°С. Разводят полученную культуру свежей порцией той же среды в соотношении от 1:1 до 1:3. Одновременно вносят индуктор и продолжают культивировать в течение не менее 4 часов. Проводят очистку синтезированной протеиназы. Это обеспечивает получение ферментативно активной протеиназы Ulp275 - варианта SUMO-протеиназы Ulp1 дрожжей Saccharomyces cerevisiae, которая включает в свой состав каталитический домен протеиназы Ulp1 и содержит на С-конце последовательность из 6 остатков гистидина. 9 пр.

 

Изобретение относится к области биотехнологии и касается способа получения биологически активной рекомбинантной протеиназы, составной частью которой является последовательность протеиназы Ulp1 дрожжей Saccharomyces cerevisiae.

Потребность в рекомбинантных белках, производимых биотехнологически, в ряде случаев требует применения нестандартных подходов. Способ продукции целевого белка в виде гибрида с белком-помощником иногда оказывается более эффективным по сравнению с традиционным способом экспрессии собственно целевого белка. (Shatzman and Rosenberg, 1987, Methods Enzynol., 152, 661-673); [Murby et al., 1991, Biotechnol. Appl. Biochem., 14, 336-346; Martinez et al., 1995, Biochem. J., 306, 589-597; Murby et al., 1996, Protein Express. Purif., 7, 129-136]; Chopra et al., 1994, Gene, 144, 81-85; Fox et al., 2001, Protein Sci., 10, 622-630]; [Belagaje et al., 1997, Protein Sci, 6, 1953-1962; Hosfield & Lu, 1999, Anal Biochem, 269, 10-6; Jenny et al., 2003, Protein Express Purif, 31, 1-11 [DiGuan et al., 1988, Gene, 67, 21-30; Sharma et al., 1991, Biotechnol. Appl. Biochem., 14, 69-81].

В большинстве случаев получение целевого белка методом гибридных белков, предполагает использование стадии обработки (процессинга) гибридного белка (состоящего из белка-помощника и целевого белка) для извлечения из его состава части, представляющей собой зрелый целевой белок. Процессинг обычно осуществляют с помощью протеиназ, позволяющих выщепить целевой белок из состава гибридного белка. Для того чтобы обеспечить процессинг, в область стыковки белка-помощника и целевого белка вводят специальную последовательность (сайт), распознаваемую протеиназой.

SUMO-система для получения целевого белка методом гибридных белков. предполагает использование белка-помощника SUMO и протеиназы Ulp1 дрожжей S. cerevisiae [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86].

Протеиназа Ulp1 дрожжей S. cerevisiae относится к семейству цистеиновых протеиназ и представляет собой белок размером 621 аминокислотный остаток, состоящий, минимум, из двух доменов, консервативного С-концевого собственно протеиназного (432-621) и менее консервативного регуляторного N-концевого домена (1-432). В клетках дрожжей Ulp1 процессирует С-концевую последовательность белка SUMO, кодируемого геном Smt3, (-GGATY) с образованием зрелой формы (-GG), а также осуществляет деконьюгацию SUMO от ε-аминогрупп лизина белков-мишеней. То есть, протеиназа способна осуществлять процессинг как пептидных, так и изопептидных связей, соединяющих белок SUMO и целевой белок. Для клеток дрожжей эти функции Ulp1 являются жизненно важными [Li & Hochstrasser, 1999, Nature, 398, 246-51].

Основным вариантом SUMO-протеиназы, широко используемым для процессинга гибридных белков, является вариант Ulp1 (403-621)р [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86; Butt et al., 2005, Protein Expr. Purif., 43, 1-9; Lee et al., 2008, Protein Sci., 17, 1241-1248].

Помимо способности к процессингу белков SUMO, протеиназа Ulp1 (403-621)р обладает дополнительными технологическими достоинствами, а именно: высокой удельной активностью (1:10000), проявляемой в широком диапазоне условий, включая рН (от 5.5 до 10.5), температуру (от 4°С до 37°С), ионную силу (свыше 0,15М NaCl), в присутствии 2М мочевины или 0,1М гуанидин хлорида и др. [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86; Butt et al., 2005, Protein Expr. Purif., 43, 1-9].

Отличительными особенностями большинства SUMO-систем, включающих SUMO-протеиназу (Ulp1 (403-621)р) и гибридный белок, в состав которого включена последовательность белка SUMO, являются: высокий уровень экспрессии и растворимости гибридного белка, наличие у гибридного белка биологической активности, высокая эффективность и специфичность процессинга, возможность произвольного изменения N-концевой последовательности целевого белка, значительное упрощение и удешевление процедуры очистки целевого белка [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86; Butt et al., 2005, Protein Expr. Purif., 43, 1-9].

Известен другой вариант SUMO-протеиназы, GST-Ulp1C275, представляющий собой гибридный белок, содержащий последовательность белка GST и последовательность 275 С-концевых аминокислотных остатков протеиназы Ulp1 [Li et al., 2005, eth Enzymol, 398, 457-467]. Такой вариант протеиназы Ulp1 обладает каталитической активностью in vivo и in vitro [Li & Hochstrasser, 2003, J. Cell Biol., 160, 1069-1081; Mossessova & Lima, 2000, Mol Cell, 5, 865-876]. В отличие от варианта Ulp1 (403-621)р (рассчетный рI=6.49) вариант Ulp1C275 имеет изоэлектрическую точку в щелочной области (рассчетный рI=9.06), что позволяет проводить очистку протеиназы с использованием сорбента CM-Sephadex (Amersham). Разработан способ биосинтеза и очистки протеиназы GST-Ulp1C275, позволяющий получать около 600 мкг очищенного белка с 1 л культуры штамма бактерий, экспрессирующих этот белок [Li et al., 2005, Meth Enzymol, 398, 457-467].

Задачей заявляемого изобретения является расширение арсенала способов получения каталитически активных вариантов протеиназы Ulp1.

Задачу решают путем:

- конструирования штамма Escherichia coli ВКПМ В-10996 - продуцента протеиназы Ulp275 - варианта SUMO-протеиназы, который включает каталитический домен протеиназы Ulp1 и содержит на С-конце последовательность из 6 остатков гистидина;

- разработки способа получения протеиназы Ulp275, включающего культивировние штамма Escherichia coli ВКПМ В-10996 при температуре от 20°С до 30°С в питательной среде КС, содержащей (мас.%): пептон - от 2 до 4, дрожжевой экстракт - от 1 до 2, вода -остальное, в присутствии селективного антибиотика до стационарной фазы роста, с последующим разведением полученной культуры свежей порцией той же среды в соотношении от 1:1 до 1:3 при одновременном внесении индуктора и продолжением культивирования в присутствии индуктора в течение не менее 4 часов с последующей очисткой синтезированной протеиназы методом металл-хелатной хроматографии.

Способ в общем виде

Посевной материал, представляющий собой клетки штамма бактерий Escherichia coli ВКПМ В-10996, выращенные при температуре 20°-30°C в течение от 8 до 18 ч на среде КС, содержащей (мас.%): пептон - от 2 до 4, дрожжевой экстракт - от 1 до 2, вода - остальное, в присутствии селективного антибиотика в необходимой концентрации, засевают в среду того же состава в количестве 1/200-1/500 от объема среды и культивируют в течение 16-20 ч. Затем выросшую культуру разводят свежей порцией той же среды в соотношении от 1:1 до 1:3 при одновременном внесении в качестве индуктора изопропил-β-D-1-тиогалактопиранозида (ИПТГ) до конечной концентрации 0,1-1,0 мМ или лактозы до конечной концентрации 0,5-1,5 мас.% и культивируют в течение не менее 4 часов. В результате получают не менее 100 мг протеиназы Ulp275 с 1 л культуры клеток штамма Escherichia coli ВКПМ В-10996.

Выросшие клетки отделяют от среды культивирования и разрушают с использованием подходящего дезинтегратора. Выделение и очистку протеиназы Ulp275 из клеточного лизата осуществляют методом металл-хелатной хроматографии с использованием сорбента Ni-NTA агарозы [Porath et al., 1975, Nature, 258: 598-599].

Получаемый препарат протеиназы Ulp275 имеет чистоту не менее 92% и при инкубации в течение 1 часа при температуре 30°С обеспечивает эффективность процессинга контрольного белка HSG не менее 93% при соотношении 1:100, не менее 90% - при соотношении 1:200 и не менее 87% при соотношении 1:500.

Пример 1. Конструирование плазмиды pUC18-ULP275

Последовательность ДНК, кодирующую протеиназу Ulp275, амплифицируют в ходе ПЦР с использованием в качестве матрицы хромосомной ДНК лабораторного штамма S. cerevisiae Y618 [Kartasheva et al., 1996, Yeast, 12, 1297-1300]. Праймерами для амплификации служат N447 (5'-atatggatcctctttggaaaggaaacataagga) и N448 (5'-attagaattctttaatgcatcggttaaaatcaaatgggcaat). Амплифицированный фрагмент ДНК размером 842 п.о. элюируют из агарозного геля с использованием кита Qiagen (саt. №28706), обрабатывают рестриктазами BamHI и EcoRI и клонируют в лабораторной плазмиде pUC18-His, производной от плазмиды pUC18, содержащей в составе модифицированного полилинкера последовательность уникальных сайтов рестрикции NcoI, BamHI, EcoRI и Xhol, а также последовательность ДНК, фланкированную сайтами EcoRI и Xhol, кодирующую аминокислотную последовательность из 6 остатков гистидина.

В результате получают плазмиду pUC18-ULP275, в составе которой с помощью секвенирования подтверждают нуклеотидную последовательность гена ULP275 [Zimmermann et al., 1988, FEBS Lett., 233, 432-436].

Плазмида pUC18-ULP275 содержит уникальный BamHI/XhoI фрагмент ДНК, кодирующий протеиназу Ulp275, которая включает каталитический домен протеиназы Ulp1 и С-концевую аминокислотную последовательность, содержащую 6 остатков гистидина, обеспечивающую очистку протеиназы Ulp275 с использованием металл-хелатной хроматографии.

Пример 2. Конструирование плазмиды pET-ULP275

Конструирование проводят в несколько этапов:

1) ДНК вектора pET-15b(+) (Novagen) расщепляют по уникальным сайтам MluI и NcoI, образовавшийся фрагмент ДНК размером 827 п.о. элюируют из агарозного геля и клонируют в плазмиде pET-22b(+) (Novagen), расщепленной по тем же сайтам. В результате клонирования получают плазмиду рЕТ-22-15.

2) Из состава плазмиды рЕТ-22-15 удаляют фрагмент ДНК, расположенный между сайтами рестрикции NcoI и BamHI. Для этого ДНК плазмиды рЕТ-22-15 расщепляют с помощью рестриктаз NcoI и BamHI, образовавшиеся липкие концы достраивают до тупых с использованием фрагмента Klenow ДНК-полимеразы I E.coli и лигируют с помощью ДНК-лигазы фага Т4. В результате получают плазмиду pET-NBl, в составе которой оказываются восстановлены оба вышеупомянутых сайта рестрикции.

3) В плазмиде pET-NBl изменяют рамку считывания полипептида, инициируемого с кодона ATG, входящего в последовательность сайта NcoI. Для этого ДНК плазмиды pET-NBl расщепляют с помощью рестриктазы NcoI, образовавшиеся липкие концы достраивают до тупых с использованием фрагмента Klenow ДНК-полимеразы I E.coli и лигируют с помощью ДНК-лигазы фага Т4. В результате получают плазмиду pET-NB2, которую далее используют для клонирования гена протеиназы Ulp275.

4) Плазмиду pUC18-ULP275 (пример 1) расщепляют с помощью рестриктаз BamHI и XhoI, образовавшийся фрагмент ДНК размером 855 п.о. элюируют из геля как в примере 1 и лигируют с ДНК плазмиды pET-NB2, расщепленной с помощью рестриктаз BamHI и XhoI. В результате получают плазмиду рЕТ-ULP275 размером 6262 п.о., содержащую нуклеотидную последовательность, кодирующую протеиназу Ulp275.

Плазмиду pET-ULP275 используют для биосинтеза протеиназы Ulp275.

Пример 3. Конструирование штамма E.coli В-10996

В качестве штамма-реципиента используют штамм E.coli BL21(DE3) - ВКПМ В-6954. Плазмиду pET28-ULP275 (пример 2) вводят в клетки реципиентного штамма с помощью процесса трансформации с применением реактива СаСl2 [Маниатис с соавт., 1984, Москва, Мир]. Трансформант отбирают на селективной среде, содержащей антибиотик ампициллин в концентрации 100 мкг/мл.

В результате трансформации получают штамм, который депонируют во Всероссийской Коллекции Промышленных Микроорганизмов как Escherichia coli ВКПМ В-10996.

Клетки этого штамма содержат экспрессионную плазмиду pET-ULP275 и в ответ на внесение в среду культивирования индуктора ИПТГ синтезируют протеиназу Ulp275.

Пример 4. Клонирование гена SMT3 дрожжей S.cerevisiae

Ген SMT3, кодирующий белок SUMO дрожжей S.cerevisiae, амплифицируют в ходе ПЦР с использованием в качестве матрицы хромосомной ДНК штамма S.cerevisiae как в примере 1. Амплификацию проводят в две стадии. Сначала амплифицируют два перекрывающихся фрагмента ДНК, для чего используют следующие пары праймеров:

Фрагмент 1 размером 130 п.о.:

N450 (5'-atatccatggaaaagagatctgactcagaagtcaatcaagaa)

N454 (5'-cttgaagaaaatctctgaa)

Фрагмент 2 размером 210 п.о.:

N453 (5'-ttcagagattttcttcaag)

N452 (5'-atatcaattggatccaccaatctgttctctgtga)

Амплифицированные фрагменты ДНК элюируют из агарозного геля, как в примере 1, и их смесь используют для ПЦР-лигирования. Для этого проводят ПЦР-амплификацию на смеси фрагментов 1 и 2 в качестве матрицы. Праймерами для амплификации служат N450 и N452. Полученный в результате ПЦР фрагмент ДНК размером 340 п.о. элюируют из агарозного геля, обрабатывают рестриктазами NcoI и MunI и клонируют в лабораторной плазмиде pUC18-His (пример 1), расщепленной по сайтам NcoI и EcoRI. В результате клонирования получают плазмиду pUC18-SUMO, содержащую последовательность ДНК, кодирующую белок SUMO дрожжей S.cerevisiae.

Далее клонированный ген SMT3 амплифицируют с применением ПЦР, используя в качестве матрицы ДНК плазмиды pUC18-SUMO. Праймерами для ПЦР служат N452 и N533 (5'-aaaagagatctcatcatcatcatcatcatcatcatcatcatggatccgactcagaagtcaatcaa). Полученный в результате ПЦР фрагмент ДНК размером 340 п.о. элюируют из агарозного геля как в примере 1, обрабатывают рестриктазами BglII и EcoRI и клонируют в плазмиде pUC18-SUMO, расщепленной по сайтам NcoI и EcoRI. Результирующая плазмида pUC18-HIS10-SUMO содержит последовательность ДНК, кодирующую белок SUMO дрожжей S.cerevisiae, N-конец которого соединен с последовательностью из 10 остатков гистидина.

Пример 5. Конструирование плазмиды pET28-HSG

Конструирование проводят в несколько этапов:

1) ДНК плазмиды pEGFP (CLONTECH Laboratories, Inc. GenBank Accession #: U76561) расщепляют с помощью рестриктазы NotI, образовавшиеся липкие концы достраивают до тупых с использованием фермента фрагмента Klenow ДНК-полимеразы I E.coli и лигируют с помощью ДНК-лигазы фага Т4 в присутствии линкера XhoI (5'-gctcgagc). В результате получают плазмиду pEGFP-XhoI, в составе которой структурный ген белка EGFP оказывается заключен внутри фрагмента ДНК, ограниченного сайтами рестрикции BamHI и XhoI.

2) ДНК плазмиды pEGFP-XhoI расщепляют по уникальным сайтам NcoI и XhoI, образовавшийся фрагмент ДНК, содержащий нуклеотидную последовательность структурного гена белка EGFP, элюируют из агарозного геля и клонируют в плазмиде pUC18-SUMO (пример 4), расщепленной по тем же сайтам. В результате клонирования получают вектор pUC18-SUMO-EGFP.

3) ДНК плазмиды pUC18-HIS10-SUMO расщепляют по уникальным сайтам NcoI и XhoI, образовавшийся фрагмент ДНК клонируют в плазмиде pET28b(+) (Novagen), расщепленной по тем же сайтам. В результате клонирования получают плазмиду рЕТ28-HIS10-SUMO.

4) ДНК плазмиды pUC18-SUMO-EGFP расщепляют по уникальным сайтам EcoRI и XhoI, образовавшийся фрагмент ДНК, содержащий нуклеотидную последовательность структурного гена белка EGFP, элюируют из агарозного геля и клонируют в плазмиде pET28-HIS10-SUMO, расщепленной по тем же сайтам. В результате клонирования получают плазмиду pET28-HSG.

Плазмиду pET28-HSG используют для получения штамма Escherichia coli, для биосинтеза контрольного гибридного белка HSG, который используют для определения ферментативной активности протеиназы Ulp275.

Пример 6. Конструирование штамма E.coli ECR-HSG

Конструирование штамма E.coli ECR-HSG проводят как описано в примере 3, за исключением того, что клетки реципиентного штамма E.coli BL21(DE3) трансформируют плазмидой pET28-HSG (пример 5), а трансформанты отбирают на селективной среде, содержащей антибиотик канамицина сульфат в концентрации 40 мкг/мл. В результате трансформации получают штамм E.coli ECR-HSG, клетки которого содержат плазмиду pET28-HSG и в ответ на внесение в среду культивирования индуктора ИПТГ синтезируют гибридный белок HSG, включающий в свой состав N-концевую последовательность из 10 остатков гистидина, слитую с последовательностью белка SUMO дрожжей S.cerevisiae, слитую с последовательностью белка EGFP.

Пример 7. Биосинтез, выделение, очистка и хранение протеиназы Ulp275

Три индивидуальные колонии штамма Escherichia coli ВКПМ В-10996 засевают в колбу, объемом 750 мл, содержащую 50 мл среды КС и 100 мкг/мл ампициллина, и выращивают в течение 18 часов на качалке со скоростью 250 об/мин при температуре 25°С. Затем в колбу вносят свежую порцию среды КС (100 мл) и индуктор ИПТГ (конечная концентрация 0,3 мМ) и инкубируют в прежних условиях в течение 6 ч.

Клетки собирают центрифугированием (15000 g) и суспендируют в 5 мл буфера для лизиса клеток (буфер LB) состава: 50 мМ NахН3-хРO4, рН 8,0; 300 мМ NaCl; 20 мМ имидазол, рН.8,0. К клеточной суспензии добавляют лизоцим до концентрации 1 мг/мл и выдерживают смесь в течение 30 минут во льду. Суспензию озвучивают во льду 6 раз по 30 секунд с перерывами в 0.5-1.0 мин при мощности ультразвукового устройства 200-300 Вт. Лизат осветляют с помощью центрифугирования в течение 30 минут при 10000 g при температуре 4°С.

Колонку, содержащую 1 мл Ni-NTA агарозы (Qiagen), промывают 5 мл буфера LB, после чего на колонку наносят осветленный лизат со скоростью 1 мл/мин. Затем колонку промывают последовательно 10 мл буфера LB, 10 мл промывочного буфера (50 мМ NaхН3-хРO4, рН 6,0, 300 мМ NaCl, 10% глицерина, имидазол в концентрации 20 мМ), и 5 мл промывочного буфера, содержащего имидазол в концентрации 150 мМ, рН 6.0. После этого белок элюируют с колонки с помощью 2 мл промывочного буфера, рН 6,0, содержащего имидазол в концентрации 450 мМ.

В полученный элюат вносят Твин-20 до концентрации 0,1% и подвергают диализу против буфера, содержащего 50 мМ Трис-HCl, рН 8.0, 150 мМ NaCl, 2 мМ дитиотрейтола и 0,1% Твин-20.

Концентрацию очищенного белка определяют спектрофотометрически, измеряя поглощение раствора белка при длине волны 280 нм. Для расчетов используют коэффициент экстинкции Кэкс=0.94, рассчитанный исходя из аминокислотного состава белка.

В результате получают 100 мг протеиназы Ulp275 с 1 л культуры клеток штамма Escherichia coli ВКПМ В-10996. Для определения чистоты полученного препарата протеиназы Ulp275 используют метод денатурирующего электрофореза в полиакриламидном геле (ПААГ-ДДС-Na) [Laemmli, 1970, Nature 227: 680-685]. Для анализа полученной электрофореграммы используют программу «Видеоденситометр Сорбфил 1.0», для чего окрашенные гели после электрофореза сканируют, полученное изображение вводят в компьютер и количество белка в пятне и на каждой дорожкке определяют с помощью указанной программы. В качестве стандартов сравнения используют высокоочищенные препараты исследуемых белков, известное количество которых наносят на соседние дорожки в том же геле. Чистота препарата протеиназы Ulp275, оцененная таким способом, составляет не менее 92%.

Диализованный препарат протеиназы Ulp275 разводят в 2 раза глицерином и хранят при -18°С.

Пример 8. Биосинтез, выделение и очистка гибридного белка HSG

Биосинтез, выделение и очистку гибридного белка HSG осуществляют как в примере 7, за исключением того, что культивируют штамм ECR-HSG, а среда для культивирования содержит антибиотик канамицина сульфат в концентрации 40 мкг/мл. В условиях индукции клетки лабораторного штамма ECR-HSG накапливают гибридный белок HSG в количестве не менее 10% от суммарного белка клеток. В результате выделения и очистки получают препарат гибридного белка HSG с концентрацией 5 мг/мл и чистотой не менее 95%.

Пример 9. Определение каталитических характеристик протеиназы Ulp275

Каталитические характеристики препарата протеиназы Ulp275 определяют путем ферментативной обработки препарата гибридного белка HSG протеиназой при различных соотношениях протеиназа/белок. Для этого к препарату ренатурированного гибридного белка HSG в концентрации 0,8 мг/мл добавляют аликвоты раствора протеиназы Ulp275 с таким расчетом, чтобы соотношение концентрации фермента и субстрата составляло 1:100, 1:200, 1:500. Реакцию проводят при 30°С в течение 1 часа при рН 8,0-9,0. Реакцию останавливают путем внесения ¼ объема дистиллированной воды, 1/200 объема 0,25 М ЭДТА, рН 8,0 и 1/160 объема раствора 2,5 М ацетата натрия, рН 4,5.

Эффективность протеолитического процессинга белка HSG оценивают по результатам электрофореза белка HSG в ПААГ-ДДС-Na, для анализа электрофореграммы используют программу «Видеоденситометр Сорбфил 1.0». Эффективность протеолитического процессинга белка HSG составляет не менее 93% при соотношении 1:100, не менее 90% при соотношении 1:200 и не менее 87% при соотношении 1:500.

Таким образом, разработан способ получения протеиназы Ulp275, уровень продукции которой составляет не менее 100 мг/л, что значительно превосходит уровень продукции протеиназы GST-Ulp1C275 (600 мкг/л). Протеиназа Ulp275 помимо каталитического домена протеиназы Ulp1 содержит в своем составе аминокислотную последовательность из 6 остатков гистидина, что позволяет осуществлять ее очистку методом металлохелатной хроматографии с использованием сорбента Ni-NTA агарозы и получать препарат протеиназы Ulp275 с чистотой не менее 92%.

Способ получения протеиназы Ulp275, включающий культивирование штамма Escherichia coli ВКПМ В-10996 при температуре от 20°С до 30°С в питательной среде КС, содержащей, мас.%: пептон от 2 до 4, дрожжевой экстракт от 1 до 2, вода остальное, в присутствии селективного антибиотика до стационарной фазы роста, с последующим разведением полученной культуры свежей порцией той же среды в соотношении от 1:1 до 1:3 при одновременном внесении индуктора и продолжением культивирования в присутствии индуктора в течение не менее 4 ч с последующей очисткой синтезированной протеиназы.



 

Похожие патенты:
Изобретение относится к области биохимии. .
Изобретение относится к пищевой промышленности, в частности к микробиологическому синтезу веществ с использованием иммобилизованных бактериальных клеток, и может быть использовано для ферментативного получения натурального сахарозаменителя изомальтулозы.
Изобретение относится к биотехнологии, а именно к производству физиологически активных соединений, и касается штамма-продуцента бактериородопсина. .
Изобретение относится к технологии производства диагностического препарата, необходимого для здравоохранения и ветеринарии при оценке напряженности противосибиреязвенного иммунитета и диагностики инфекции у лиц, привлекаемых к работам с возбудителем сибирской язвы.

Изобретение относится к области биотехнологии, конкретно к получению протеолитических фракций из прокариотических клеток, и может быть использовано при анализе молекулярно-генетических механизмов формирования структуры клетки прокариот и роли белковых компонентов в их организации, что необходимо для получения дополнительной информации в разработках и построении компьютерных моделей организации генных и эпигенных сетей управления.

Изобретение относится к биотехнологии и может быть использовано для получения внутреннего стандарта в аналитике, в исследованиях обмена веществ при проведении опытов по откармливанию животных, в метаболических исследованиях, при изучении цикла обмена веществ, путей и/или периодов распада, а также интеркаляций.
Изобретение относится к биотехнологии, в частности к получению мультиферментных препаратов, и может быть использовано на предприятиях пищевой промышленности в качестве получения препаратов, направленных на снижение токсического действия алкоголя и продуктов его метаболизма.

Изобретение относится к прикладной биохимии, медицине, ветеринарии и клинической лабораторной диагностике и касается способа определения активности тканевых, бактериальных, вирусных и грибковых протеиназ, расщепляющих иммуноглобулины различных классов.
Изобретение относится к биотехнологии и химико-фармацевтической промышленности. .
Изобретение относится к биотехнологии и может быть использовано в парфюмерно-косметической промышленности, кожевенном производстве, меховом производстве, химико-фармацевтической промышленности.
Изобретение относится к технологии получения ферментов. .

Изобретение относится к биотехнологии и может быть использовано в селекции организмов, например растений. .

Изобретение относится к борьбе с насекомыми-вредителями, в частности с нематодами. .
Наверх