Композиции и способы выявления



Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления
Композиции и способы выявления

 


Владельцы патента RU 2480732:

ДЖЕНЕРА БАЙОСИСТЕМЗ ЛИМИТЕД (AU)

Группа изобретений относится к области диагностики, в частности к способам и реагентам, включая биочипы, для выявления присутствия для одного или нескольких анализируемых объектов в образце, основанным на использовании набора гранул, содержащего множество семейств или поднаборов гранул, в котором каждая из гранул внутри каждого семейства гранул поднабора может быть соединена с меченным зондом захвата нуклеиновой кислоты, способным связываться со специфической для штамма HPV областью генома HPV. Каждое из семейств гранул внутри каждого одиночного набора имеет различную интенсивность флуоресценции. Группа изобретений обеспечивает быстрые, легко применяемые в диагностике способы и реагенты. 4 н. и 9 з.п. ф-лы, 7 ил., 4 пр., 5 табл.

 

Перекрестная ссылка на родственную заявку

Настоящая заявка претендует на приоритет предварительных заявок на патенты США под № 60/910373, поданной 5 апреля 2007 года, и 60/910381, поданной 5 апреля 2007 года, каждая из которых включена в настоящее описание посредством ссылки.

Область, к которой относится изобретение

Настоящее изобретение относится в целом к области диагностики и анализов для выявления веществ. Конкретнее, настоящее изобретение относится к способам и реагентам, включая биочипы, для выявления присутствия или дифференцирования одного или нескольких анализируемых веществ в образце.

Предшествующий уровень техники

Список литературы представлен в конце описания.

Ссылка в настоящем описании на любой источник предшествующего уровня техники не является и не должна восприниматься как признание любой формы предположения, что этот предшествующий уровень техники формирует часть общеизвестной информации в любой стране.

Потребность в быстрых и надежных способах скрининга для выявления множественных анализируемых веществ в одном анализе жизненно важна в областях клинической диагностики, а также для применения при скрининге для выявления, например, токсинов в окружающей среде и скрининге лекарственных средств.

Одна из областей, которая крайне нуждается в усовершенствованных способах скрининга и реагентах, представляет собой область инфекционных заболеваний. Например, как минимум количество диагностических тестов для выявления заболеваний, передающихся половым путем, таких как вирус папилломы человека (HPV), во всем мире составляет приблизительно 20000000 тестов в год.

Многие из существующих тестов для выявления причин инфекционных заболеваний требуют много времени, являются трудоемкими, дорогими, часто специфичны только для одного специфического возбудителя заболевания и/или не могут дифференцировать различные штаммы возбудителей заболеваний.

HPV представляет собой основной возбудитель, вызывающий развитие рака шейки матки. Однако таксон HPV содержит много «штаммов» возбудителя, лишь некоторые из которых связаны с развитием рака шейки матки и других карцином. Соответственно, штаммы HPV обычно классифицируются или как штаммы «высокого риска», включающие 13 штаммов, с которыми грубо связано 98% случаев рака шейки матки, или штаммы «низкого риска», которые обычно не связаны с развитием рака шейки матки.

В настоящее время рак шейки матки выявляется с помощью мазка Pap. При этой методике клетки берут с шейки матки путем соскабливания или промывания. Затем эти клетки помещают на предметное стекло микроскопа для получения «мазка». Затем патологоанатом исследует предметное стекло, разыскивая аберрантные клетки. Однако мазок Pap является в некоторой степени неудовлетворительным анализом для однозначного определения риска рака шейки матки, так как эта методика имеет частоту ложноотрицательных результатов приблизительно 20%, и эта методика не может дифференцировать таксон «высокого риска» и «низкого риска».

Многие реагенты и/или способы выявления HPV являются дорогостоящими и/или требуют длительного времени для их выполнения. Требуются более быстрые и/или упрощенные анализы, связанные с меньшими общими затратами и легче применяемые. Настоящее изобретение направлено на достижение этих и других важных целей.

Краткое описание сущности изобретения

Настоящее изобретение относится к анализам, которые обеспечивают возможность выявления одного или нескольких анализируемых веществ и/или дифференцирования членов в пределах класса анализируемых веществ. В частности, для идентификации или дифференцирования анализируемых веществ используется анализ мультиплексирования на основе свойств анализируемых веществ и аналитических компонентов.

Соответственно, определенные аспекты настоящего изобретения относятся к наборам гранул для выявления одного или нескольких анализируемых веществ и/или дифференцирования двух или более членов в пределах класса анализируемых веществ, где набор гранул содержит множество семейств или поднаборов гранул, где

(а) гранулы каждого поднабора являются однородными в отношении размера;

(b) гранулы внутри каждого поднабора соединены с реагентом, который будет специфически взаимодействовать с данным представляющим интерес анализируемым веществом в подлежащем тестированию образце;

(с) реагент на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси поднаборов гранул на основании интенсивности флуоресценции; и

(d) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора и поэтому реагента, с которым была соединена гранула, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и определения анализируемого объекта.

В других аспектах настоящее изобретение предусматривает способы выявления и/или дифференцирования двух или более анализируемых веществ в образце, включающие стадии

(а) обеспечения контакта образца с поднабором гранул, специфичным для представляющего интерес анализируемого объекта;

(b) инкубации указанного набора гранул с указанным образцом в течение времени и в условиях, достаточных для обеспечения возможности специфического взаимодействия указанного анализируемого объекта (веществ) в указанном образце с реагентом на грануле внутри указанного набора гранул; и

(с) выявления и/или дифференцирования анализируемых веществ в образце, которые связаны с реагентом на указанной грануле.

В некоторых других аспектах реагенты могут быть меченными одним или несколькими флуорохромами, которые, кроме того, обеспечивают возможность дифференцирования членов внутри класса анализируемых веществ. В определенных предпочтительных аспектах настоящее изобретение относится к способам и наборам гранул, которые способны выявить и/или дифференцировать анализируемые вещества внутри биологического образца, где анализируемые вещества специфичны для инфекционного возбудителя.

Биологические образцы, предусмотренные в настоящем изобретении, включают кровь, сыворотку, слюну, фекалии, мочу, тканевую жидкость, семенную жидкость, экссудат, гной, жидкость и слизь дыхательных путей и тампоны, пропитанные раневым отделяемым, отделяемым раковых и других поражений.

Термин «возбудитель» относится к микроорганизму или вирусу, который инфицирует или образует колонии в образце. Иллюстративные возбудители включают вирусы, бактерии, грибы и эукариотические микроорганизмы. Вирус включает лентивирус (например, вирус СПИД, ВИЧ-I, ВИЧ-II, HTLV-IV, ретровирус и вирус птичьего гриппа. В некоторых предпочтительных вариантах осуществления «возбудитель» включает микроорганизм или вирус, который инфицирует многоклеточный организм, такой как животное или растение. Соответственно, в некоторых вариантах осуществления анализируемый объект может рассматриваться как возбудитель заболеваний животного или растения. Однако настоящее изобретение охватывает выявление и/или дифференцирование непатогенных этиологических факторов, которые образуют колонии в многоклеточных организмах, таких как симбионты, эндофиты, организмы, колонизирующие желудочно-кишечный тракт, и им подобные. Способы по настоящему изобретению можно также применять для выявления в образце анализируемых веществ, которые указывают на присутствие лекарственных средств или веществ, являющихся предметом злоупотребления. Способы и реагенты по настоящему изобретению могут также применяться при выявлении анализируемого объекта в образце, который не получен из биологического образца, выделенного у животного или растения. По существу, реагенты и способы по настоящему изобретению также применяют при выявлении одного или нескольких анализируемых веществ и/или дифференцировании анализируемых веществ в образцах из окружающей среды, включая образцы воздуха, воды и почвы, включая образцы внеземной почвы, пыли или т.п., промышленные образцы и т.п., в дополнение к перечисленным выше биологическим образцам.

В определенных вариантах осуществления настоящее изобретение относится к диагностическим способам и реагентам для выявления ВИЧ у людей и способно выявить и дифференцировать различные штаммы для дифференцирования таксона HPV «высокого риска» от таксона HPV «низкого риска». Соответственно, в некоторых предпочтительных вариантах осуществления настоящее изобретение относится к наборам гранул, которые способны дифференцировать множества различных штаммов HPV. По существу, в одном аспекте анализируемые вещества специфичны для множества таксонов HPV, а способы и/или реагенты специфичны для выявления нуклеиновой кислоты или антигенов или антител, которые специфичны для множества таксонов HPV.

Еще предпочтительнее праймеры или зонды нуклеиновых кислот, способные связываться со специфической для штамма части генома HPV, иммобилизованы на гранулах в каждом поднаборе гранул. Праймеры, направленные на консервативные области внутри генома HPV, фланкирующие специфическую для штамма область, затем используются для амплификации генома HPV. Семейства гранул или поднаборы гранул, каждый для любого одного штамма HPV, затем используются для выявления или дифференцирования штамма HPV.

Другие аспекты настоящего изобретения направлены на наборы гранул для выявления одного или нескольких штаммов HPV и/или для дифференцирования двух или более штаммов HPV, где набор гранул содержит множество семейств или поднабор гранул, где

(а) гранулы каждого поднабора являются однородными в отношении размера;

(b) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, который способен связываться с областью, специфической для штамма HPV, или, необязательно, контрольной последовательностью нуклеиновой кислоты;

(с) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси поднаборов гранул на основании интенсивности флуоресценции; и

(d) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательности.

В других аспектах настоящее изобретение предусматривает способы выявления и/или дифференцирования двух или более штаммов HPV в образце, включающие стадии

(а) обеспечения контакта образца с набором гранул, содержащим множество семейств или поднаборов гранул, где

(i) гранулы каждого поднабора являются однородными в отношении размера;

(ii) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, который способен связываться с областью генома HPV, специфичной для штамма HPV, или, необязательно, контрольной последовательностью нуклеиновой кислоты;

(iii) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси гранул на основании интенсивности флуоресценции; и

(iv) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательности;

(b) инкубации указанного набора гранул с указанным образцом в течение времени и в условиях, достаточных для обеспечения возможности связывания указанных зондов с геномом HPV, амплифицированным для генерирования репликона, содержащего специфическую для штамма область;

(с) выявления и/или дифференцирования ампликонов, генерированных в образце, которые связаны с указанными гранулами для идентификации или различения посредством этого двух или более штаммов HPV.

В некоторых предпочтительных аспектах гранулы внутри набора гранул различимы на основании размера, уровня интенсивности флуоресценции, типа флуорохрома и реагента, который способен взаимодействовать со специфическим анализируемым веществом.

В других аспектах настоящее изобретение направлено на наборы гранул для выявления штамма HPV и/или для дифференцирования между двумя или более штаммами HPV, где набор гранул содержит множество семейств или множество поднаборов гранул, имеющих

(а) по меньшей мере, два поднабора гранул, где каждый поднабор гранул можно с использованием физико-химических методов отличить от любого другого поднабора гранул на основании, по меньшей мере, размера; или

(b) по меньшей мере, один поднабор гранул, имеющий, по меньшей мере, два семейства, где гранулы в поднаборе гранул являются однородными по размеру относительно друг друга и различимы физико-химическими методами на два или более семейств гранул на основании уровня мечения, который содержит каждый образец, или

(с) комбинацию указанных семейств гранул и указанных поднаборов гранул; и где

каждая гранула внутри каждого семейства гранул поднабора соединена с необязательно меченным зондом захвата нуклеиновой кислоты, способным связываться со специфической для штамма HPV областью генома HPV, или, необязательно, по меньшей мере, с одной контрольной последовательностью нуклеиновой кислоты, при условии, что любой зонд захвата нуклеиновой кислоты или контрольная последовательность нуклеиновой кислоты мечены такой же меткой, как другие меченые зонды захвата нуклеиновых кислот или контрольная последовательность нуклеиновой кислоты в поднаборе гранул, и что внутри любого одиночного поднабора гранул каждое из семейств гранул имеет другую интенсивность флуоресценции; и

каждое семейство гранул специфично для выявления штамма HPV, отличающегося от любого другого семейства гранул в наборе гранул; где указанный набор гранул способен идентифицировать один или несколько специфических штаммов HPV посредством анализа размера гранул, интенсивности флуоресценции или различения последовательностей, по меньшей мере, одного семейства гранул или поднабора гранул, с использованием проточной цитометрии.

Изобретение также частично направлено на способы для получения набора гранул с целью различения двух или более штаммов HPV, причем способ включает выбор множества семейств или поднаборов гранул на основании размера, интенсивности флуоресценции или того и другого действия, включающие предоставление

(а) по меньшей мере, двух поднаборов гранул, где каждый поднабор гранул можно с использованием физико-химических методов отличить от любого другого поднабора гранул на основании, по меньшей мере, размера; или

(b) по меньшей мере, одного поднабора гранул, имеющего, по меньшей мере, два семейства, где гранулы в поднаборе гранул являются однородными по размеру относительно друг друга и различимы физико-химическими методами на два или более семейств гранул на основании уровня мечения, который содержит каждый образец, или

(с) комбинацию указанных семейств гранул и указанных поднаборов гранул; и где

гранула внутри каждого семейства гранул поднабора соединена с необязательно меченным зондом захвата нуклеиновой кислоты, способным связываться со специфической для штамма HPV областью генома HPV, или, необязательно, по меньшей мере, с одной контрольной последовательностью нуклеиновой кислоты, при условии, что любой зонд захвата нуклеиновой кислоты или контрольная последовательность нуклеиновой кислоты мечены такой же меткой, как другие меченые зонды захвата нуклеиновых кислот или контрольная последовательность нуклеиновой кислоты в поднаборе гранул, и что внутри каждого одиночного набора гранул каждое из семейств гранул имеет другую интенсивность флуоресценции; и

каждое семейство гранул, специфичное для выявления штамма HPV, отличается от любого другого семейства гранул в наборе гранул; где указанный набор гранул способен идентифицировать один или несколько специфических штаммов HPV посредством анализа размера гранул, интенсивности флуоресценции или различения последовательности, по меньшей мере, одного семейства гранул или поднабора гранул, с использованием проточной цитометрии.

Способы по настоящему изобретению в связи с выявлением HPV могут применяться для различения от 2 до 16 штаммов HPV, включая различение 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 и 16 штаммов. В связи с возможностью использования контроля в настоящем изобретении можно поэтому применять от 2 до 17 различных гранул или наборов гранул. В другом варианте осуществления набор гранул содержит, по меньшей мере, 16 поднаборов гранул для штаммов HPV 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 и 68 и обычно, контрольный набор гранул. Подходящие зонды захвата представляют собой те, которые перечислены в таблице 2.

Может быть желательным тестирование на наличие более чем 16 штаммов анализируемой пробы. Таким образом, настоящее изобретение также включает наборы гранул с 2-30 различными гранулами или наборами гранул, включающими 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 и 30 гранул или наборов гранул.

Настоящее изобретение частично направлено на определенные пары праймеров для использования в любой из многочисленных методик PCR для амплификации последовательностей нуклеиновых кислот, где прямые и обращенные праймеры необязательно имеют «пятки», конъюгированные с концом 5' праймера. В определенных вариантах осуществления изобретение направлено на пары праймеров амплификации олигонуклеотидов для нацеливания на онкогенный HPV, причем прямой праймер пары выбран из группы, состоящей из

TR TTT GTT ACT GTK GTD GAT ACY A;

CAR YTR TTT GTT ACT GTK GTD GAT A;

CAR YTR TTT GTT ACT GTK GTD GA;

AAY CAR YTR TTT GTT ACT GTK GT;

TTT GTT ACT GTK GTD GAT ACY AC HCG;

TTT GTT ACT GTK GTD GAT ACY AC HCG YAG;

GTK GTD GAT ACY AC HCG YAG TAC и

GTD GAT ACY AC HCG YAG TAC HAA;

а обратный праймер пары праймеров выбран из группы, состоящей из

TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG;

CAY ARY TGA AAA ATA AAY TGY AAA TC;

TR CAY ARY TGA AAA ATA AAY TG; и

TR CAY ARY TGA AAA ATA AA;

где каждый из прямого и обратного праймеров необязательно конъюгирован с «пяткой» на конце 5' праймера.

Определение того, произошло ли связывание между анализируемой пробой и реагентом, присутствующим на грануле, может быть произведено с использованием любой методологии, которая обеспечивает возможность дифференциации между различными гранулами внутри набора гранул. В определенных особенно предпочтительных вариантах осуществления в способах дифференциации между различными гранулами внутри наборов гранул используется проточная цитометрия.

Настоящее изобретение, кроме того, предусматривает диагностические наборы для применения в соответствии с реагентами и способами по настоящему изобретению. В частности, настоящее изобретение распространяется на биочипы и миниатюризацию твердофазных компонентов анализа для генерирования наноаналитических реагентов. В одном варианте осуществления набор гранул или его часть или другие реагенты иммобилизованы на твердой фазе, такой как биочип. Биочип может также рассматриваться как «биологическая лаборатория», на которой выполняется, по меньшей мере, часть анализа и/или регистрируются его результаты.

Список аббревиатур, используемых в настоящем описании, представлен в таблице 1.

Таблица 1
Аббревиатуры
Аббревиатура Описание
FITC Флуоресцеин изотиоцианат
HEX Гексахлорфлуоресцеин
HIV Вирус иммунодефицита человека (ВИЧ)
HPV Вирус папилломы человека
JOE 7'-диметоксифлуоресцеин
PCR Полимеразная реакция синтеза цепи
HT Фикоэритрин
PMT Фотоэлектронный умножитель (ФЭУ)
QD Квантовая точка
TAMRA Карбокситетраметилродамин
TET Тетрахлорфлуоресцеин
TMR Тетраметилродамин
VRE Устойчивые к ванкомицину энтерококки

Последовательности, используемые в настоящем изобретении, представлены в таблице 2.

В настоящем описании используются следующие переменные величины:

“K” представляет переменную величину для G или T;

“H” представляет переменную величину для T, A или C;

“M” представляет переменную величину для A или C;

“Y” представляет переменную величину для T или C;

“R” представляет переменную величину для A или G;

“W” представляет переменную величину для A или T;

“D” представляет переменную величину для A, T или G;

3Phos представляет группу фосфата 3';

5Phos представляет группу фосфата 5'; и

5AmMC6 представляет группу 5' H2N-(CH2)6-, присоединенную через группу фосфата.

Краткое описание чертежей

Фиг.1 представляет график, схематически показывающий пример протокола экстрагирования ДНК, использованного в способе диагностики инфекции HPV.

Фиг.2 представляет график, схематически показывающий протокол PCR, который можно использовать для амплификации HPV и человеческой ДНК из образца ДНК. GP5+ и GP6+ относятся к универсальным праймерам HPV, которые связываются с консервативными последовательностями (Y) в HPV и генерируют ампликон, содержащий область, которая является вариабельной между штаммами HPV (X1-16). Праймеры LCI_F и LCI_R амплифицируют область (Z) геномной ДНК, которая служит в качестве контроля на более поздних стадиях гибридизации. Праймеры GP6+ и LCI_R содержат флуоресцентную метку, которая включена в генерированный ампликон.

Фиг.3 представляет график, показывающий дифференциацию гранул на основе размера. Показаны шесть кластеров, соответствующих гранулам, имеющим диаметры 3,0 мкм, 3,5 мкм, 4,1 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм.

Фиг.4 представляет график, показывающий дифференциацию гранул одинакового размера на основе интенсивности флуоресцентной метки. Отчетливо различимы относительные величины интенсивности TMR 0%, 4%, 20% и 100%.

Фиг.5 представляет схематическую диаграмму, показывающую пример связывающего агента, который может быть применен в анализе. Чип включает микросферы диаметром 3,0 мкм, 4,1 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм, а также флуоресцентный сигнал от метки интенсивностью 0%, 4%, 20% и 100%. В случае меньших размеров гранул, т.е. 3,0 мкм, 3,5 мкм и 4,1 мкм, использовали величины интенсивности TMR 0% и 100%; для гранул 5,0 мкм, использовали величины интенсивности TMR 0%, 20% и 100%; и для самых крупных гранул диаметром 5,6 мкм и 6,8 мкм использовали все величины интенсивности сигнала.

На фиг.6 показан пример набора гранул по настоящему изобретению.

Фиг.7 представляет график, показывающий пример чипа связывающего агента, с которым связался ампликон. Результаты показывают связывание с вирусной консервативной последовательностью, Y, человеческой контрольной последовательностью, Z, и вирусной специфичной для штамма последовательностью X16.

Подробное описание изобретения

Настоящее изобретение относится к анализам и реагентам, включая биочипы, которые обеспечивают возможность выявления одного или нескольких анализируемых веществ и/или дифференцирования между членами внутри класса анализируемых веществ. В частности, анализируемые вещества идентифицируются или различаются способами анализа мультиплексирования на основе свойств анализируемых веществ и аналитических компонентов. Анализы и реагенты для диагностики и выявления по настоящему изобретению, в частности, применяются при диагностике инфекций возбудителями заболеваний у многоклеточных эукариотических субъектов. В одном конкретном варианте осуществления настоящее изобретение относится к диагностическому анализу HPV у людей и способно дифференцировать между таксонами HPV для различения инфекций HPV «высокого риска» и инфекций HPV «низкого риска». Кроме того, настоящее изобретение также относится к способам диагностики или оценки риска развития заболевания, связанного с инфекцией анализируемым возбудителем у многоклеточного эукариотического субъекта, включая, наряду с другими заболеваниями, рак шейки матки у женщин.

Следует понимать, что пока нет других указаний, настоящее изобретение не ограничивается определенными диагностическими или аналитическими протоколами, поскольку они могут варьироваться. Следует также понимать, что терминология, используемая в настоящем описании, используется с целью описания конкретных вариантов осуществления и не предназначена для ограничения.

Следует отметить, что, пока контекст не требует иного, используемые в настоящем описании формы единственного числа включают формы множественного числа. Так, например, ссылка на «анализируемый объект, или возбудитель» включает один анализируемый объект, или возбудитель, а также один, два или более субстрата; ссылка на «мишень» включает одну мишень, а также две и более мишеней; ссылка на «амплификацию» включает одну стадию амплификации, а также множественные стадии амплификации; ссылка на «ампликон» включает один или множественные или сложные ампликоны; и так далее.

Соответственно, в одном аспекте, настоящее изобретение относится к наборам гранул, которые способны выявлять и/или дифференцировать между двумя или более анализируемыми объектами в образце, причем указанные наборы гранул включают следующее:

(а) гранулы каждого поднабора являются однородными в отношении размера;

(b) гранулы внутри каждого поднабора соединены с реагентом, который будет специфически взаимодействовать с данным представляющим интерес анализируемым объектом в подлежащем тестированию образце;

(с) реагент на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси поднаборов гранул на основании интенсивности флуоресценции; и

(d) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому реагента, с которым была соединена гранула, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения анализируемого объекта.

В некоторых вариантах осуществления реагенты могут, кроме того, дифференциально метиться для создания дополнительных субпопуляций гранул на основе включения различных флуорохромов.

В других вариантах осуществления настоящее изобретение относится к способам или наборам гранул для выявления и/или дифференцирования анализируемого объекта.

В определенных предпочтительных аспектах способы или наборы гранул по настоящему изобретению способны выявлять и/или дифференцировать патогенные анализируемые возбудители.

Настоящее изобретение также относится к способам выявления и/или дифференцирования одного или нескольких анализируемых объектов в образце, включающим стадии

(а) обеспечения контакта образца с поднабором гранул, специфичным для представляющего интерес анализируемого объекта;

(b) инкубации указанного набора гранул с указанным образцом в течение времени и в условиях, достаточных для обеспечения возможности специфического взаимодействия указанного анализируемого объекта(ов) в указанном образце с реагентом на грануле внутри указанного набора гранул; и

(с) выявления и/или дифференцирования анализируемых объектов в образце, которые связаны с реагентом на указанной грануле.

Используемый в настоящем описании термин «патогенный анализируемый возбудитель» относится к микроорганизму или вирусу, который предположительно инфицирует, колонизирует или иным образом контаминирует образец. Иллюстративные анализируемые возбудители включают вирусы, бактерии, грибы и эукариотические микроорганизмы. В предпочтительном варианте осуществления «анализируемый возбудитель» включает микроорганизм или вирус, который инфицирует многоклеточный организм, такой как животное или растение. Соответственно, в некоторых вариантах осуществления патогенные анализируемые возбудители могут рассматриваться как возбудитель заболевания животного или растения. Однако настоящее изобретение охватывает выявление и различение не патогенного анализируемого возбудителя, который колонизирует многоклеточные организмы, такие как микробные симбионты животных (например, виды Lactobacillus, рубцовые бактерии), микробные симбионты насекомых (например, виды Streptomyces, виды Wolbachia), микробные симбионты губок (например, зеленые водоросли, диножгутиковые, цианобактерии) и т.п.; эндофиты растений (например, микоризы, виды Rhizobium, виды Frankia, виды Streptomyces) и т.п. Кроме того, анализируемый возбудитель может представлять собой анализируемый возбудитель, который не связан с многоклеточным организмом. Такие анализируемые возбудители включают бактерии, грибы, вирусы, одноклеточные организмы, нематоды и т.п., которые колонизируют определенные окружающие среды, включающие «естественные» окружающие среды, такие как почва, океаны, пресноводные водоемы, лед, скалы, гидротермальные выходные отверстия и потоки; окружающие среды медицинских учреждений, включая больницы, больничное оборудование, хирургическое оборудование, одежду медицинского персонала и т.п.; «промышленные» окружающие среды, включая производственное оборудование, фармацевтическое оборудование, пивоварни, винодельческие предприятия и т.п.; «лабораторные» окружающие среды, включая ферментеры, культуры, лабораторные столы, оборудование и т.п.

Соответственно, образцы, предусмотренные настоящим изобретением, включают промышленные образцы, такие как воздух, вода и почва и т.п., и биологические образцы, такие как кровь, сыворотка, слюна, фекалии, моча, тканевая жидкость, семенная жидкость, экссудат, гной, жидкость и слизь дыхательных путей и тампоны, пропитанные раневым отделяемым, отделяемым раковых и других поражений. Кроме того, образец может представлять собой внеземной образец, такой как из метеорита или из другой планеты. В отношении последнего, анализ по настоящему изобретению может быть адаптирован для применения на межпланетном отдаленном транспортном средстве для тестирования образцов почвы, пыли или льда или для тестирования материала на планете.

В некоторых предпочтительных вариантах осуществления анализируемый возбудитель включает бактерию, грибок, вирус и/или эукариотического паразита, который инфицирует животного субъекта. «Животные субъекты», предусмотренные в настоящем изобретении, включают любое животное, предпочтительно, млекопитающее, предпочтительнее, примата, включая низшего примата, а еще предпочтительнее, человека. Для удобства, «животное» также, в частности, включает виды сельскохозяйственного скота, такие как крупный рогатый скот, лошади, овцы, свиньи, козы и ослы, а также лабораторные животные, включая мышей, крыс, кроликов, морских свинок и хомячков.

Иллюстративные человеческие анализируемые возбудители, которые могут быть выявлены с использованием реагентов и способов по настоящему изобретению, включают вирусы, такие как вирус папилломы человека (HPV), коронавирусы, включая вирус SARS, вирусы гриппа, вирус птичьего гриппа, ВИЧ, включая ВИЧ-I, ВИЧ-II или HTLV-IV, лентивирусы в целом, вирусы гепатита и т.п., патогенные агенты заболеваний, передаваемых половым путем, такие как хламидии, возбудитель гонореи, виды Mycoplasma и возбудитель сифилиса; пищевые возбудители заболеваний, такие как виды Listeria, виды Salmonella, E.coli (в частности, E.coli НО 567), виды Shigella, виды Brucella, Staphylococcus aureus; возбудители внутрибольничных инфекций, такие как S. aureus, включая S. aureus, устойчивый к метициллину (MRSA) и энтерококки, включая энтерококки, устойчивые к ванкомицину (VRE); возбудители, приобретенные во внешней среде, такие как виды Legionella, виды Giardia, виды Crytospiiridium, Bacillus anthracis (сибирская язва) и т.п.

В других аспектах, образец, в котором выявляется анализируемый возбудитель, предпочтительно представляет образец, полученный у многоклеточного субъекта, который предположительно инфицирован или заселен колониями анализируемого возбудителя. Поэтому в одном аспекте образец представляет предпочтительно «биологический образец». Иллюстративные биологические образцы, которые никоим образом не ограничивают настоящее изобретение, включают тканевые или клеточные образцы, такие как соскобы, биопсии и т.п., и образцы биологических жидкостей, включая кровь, мочу, лимфу, амниотическую жидкость, спинномозговую жидкость и т.п.

В определенных других аспектах способы по настоящему изобретению могут также применяться для выявления «анализируемого возбудителя» в образце, который не получен исключительно из многоклеточного эукариотического организма. По существу, настоящее изобретение распространяется на выявление и/или дифференциацию одного или нескольких конкретных таксонов или штаммов анализируемых возбудителей в образцах, таких как образцы из окружающей среды (включая образцы воздуха, воды и почвы), промышленные образцы, лабораторные образцы и т.п. Например, способы по настоящему изобретению могут применяться для оценки прокариотической микрофлоры, эукариотической микрофлоры и/или вирусной нагрузки образцов почвы, воды или воздуха, или образца, полученного из изготовленного человеком объекта или поверхности.

В некоторых особенно предпочтительных вариантах осуществления настоящего изобретения подлежащий выявлению анализируемый возбудитель представляет собой ВИЧ или его штамм, а образец представляет предпочтительно биологический образец, полученный у человека. В еще одних предпочтительных вариантах осуществления биологический образец содержит одну или несколько клеток субъекта, кровь или мочу. Наиболее предпочтительно, биологический образец содержит клетки шейки матки, взятые у субъекта. HPV детально описан в документе Gearhart et al. (www.emedicine.com/MED/topic1037.htm, 2004), который частично воспроизведен ниже. HPV вызывает развитие эпителиальных опухолей кожи и слизистых оболочек. Было выявлено более 100 типов HPV, и была определена полная последовательность геномов почти 70 из них. Современная система классификации, которая основана на сходствах их геномных последовательностей, в целом коррелируется с 3 категориями, используемыми для клинического описания HPV: аногенитальный и/или слизистый, не генитальный кожный и бородавчатая эпидермодисплазия (EV). База данных геномных последовательностей HPV и филогенетическое дерево доступны через интернет на сайте HPV Sequence Database (база данных последовательностей HPV).

Инфекции слизистых оболочек HPV далее классифицируются как латентные (бессимптомные), субклинические или клинически выраженные. Клинически выраженные поражения очевидны макроскопически, тогда как латентные инфекции выявляются только тестами на вирусную ДНК. Субклинические поражения идентифицируются нанесением 5% уксусной кислоты и обследованием с увеличением. Большинство инфекций HPV являются латентными; клинически выраженные инфекции обычно приводят к появлению бородавок, а не злокачественных поражений.

Типы 6 и 11 HPV обычно отмечаются как типы с низким риском, потому что инфекция имеет низкий онкогенный потенциал и обычно приводит к образованию кондилом и предраковых поражений низких степеней. Типы 16 и 18 HPV появились как типы HPV с высоким риском, потому что они ответственны за большинство внутриэпителиальных поражений высоких степеней, которые могут прогрессировать в карциномы, в частности, поражения, относящиеся к аногенитальной и/или слизистой категории.

Одна инфекция HPV не вызывает злокачественной трансформации инфицированной ткани. В этот процесс были вовлечены кофакторы, такие как курение, ультрафиолетовое излучение, беременность, недостаточность фолата и подавление иммунитета. В таблице 3 перечислены разнообразные заболевания и связанные с ними подтипы HPV.

Таблица 3
Заболевания и связанные с ними подтипы HPV
Не генитальные кожные заболевания Тип HPV
Обычные бородавки (verrucae vulgaris) 1, 2, 4, 26, 27, 29, 41, 57, 65,
Подошвенные бородавки (myrmecias) 1, 2, 4, 63
Плоские бородавки (verrucae plana) 3, 10, 27, 28, 38, 41, 49
Бородавки Butcher (обычные бородавки людей, которые манипулируют с мясом, домашней птицей и рыбой) 1, 2, 3, 4, 7, 10, 28
Мозаичные бородавки 2, 27, 57
Ногтевая плоскоклеточная карцинома 16
Бородавчатая эпидермодисплазия (доброкачественная) 2, 3, 10, 12, 15, 19, 36, 46, 47, 50
Бородавчатая эпидермодисплазия (злокачественная или доброкачественная) 5, 8, 9, 10, 14, 17, 20, 21, 22, 23, 24, 25, 37, 38
Не бородавчатые кожные поражения 37, 38
Не генитальные заболевания слизистых оболочек Тип HPV
Папилломатоз дыхательных путей 6, 11
Плоскоклеточная карцинома легких 6, 11, 16, 18
Папиллома гортани 6, 11, 30
Карцинома гортани 16, 18
Папиллома верхнечелюстной пазухи 57
Плоскоклеточная карцинома придаточных пазух носовой полости 16, 18
Папилломы конъюнктивы 6, 11
Карцинома конъюнктивы 16
Очаговая эпителиальная гиперплазия ротовой полости (болезнь Heck) 13, 32
Карцинома ротовой полости 16, 18
Лейкоплакия ротовой полости 16, 18
Плоскоклеточная карцинома пищевода 16, 18
Аногенитальные заболевания Тип HPV
Остроконечные кандиломы 6, 11, 30, 42, 43, 44, 45, 51, 52, 54
Папулез, подобный болезни Bowen 16, 18, 34, 39, 42, 45
Болезнь Bowen 16, 18, 31, 34
Гигантские кандиломы (опухоли Buschke-Lowenstein) 6, 11
Неустановленная внутриэпителиальная неоплазия 30, 34, 39, 40, 53, 57, 59, 61, 62, 64, 66, 67, 68, 69
Внутриэпителиальная неоплазия низкой степени 6, 11, 43
Внутриэпителиальная неоплазия промежуточной степени 31, 33, 35, 42, 44, 45, 51, 52
Внутриэпителиальная неоплазия высокой степени 16, 18, 56, 58
Карцинома вульвы 6, 11, 16, 18
Карцинома влагалища 16
Карцинома шейки матки 16, 18, 31
Карцинома заднего прохода 16, 31, 32, 33
Карцинома in situ полового члена (эритроплазия Queyrat) 16
Карцинома полового члена 16, 18

Вирусы папилломы являются высокоспецифичными для вида и не инфицируют другой вид, даже в лабораторных условиях. Люди являются единственным известным резервуаром для HPV.

Вирусы папилломы представляют собой лишенные оболочки вирусы, имеющие двадцатигранную симметрию с 72 капсомерами, которые окружают геном, содержащий двухнитевую циркулярную ДНК приблизительно с 8000 пар оснований.

Считается, что вирусы папилломы имеют два типа репликации, т.е. устойчивую репликацию эписомального генома в базальных клетках и вышедшую из-под контроля, или вегетативную репликацию, в более дифференцированных клетках для генерирования потомства вируса. Хотя все клетки очага поражения содержат вирусный геном, экспрессия вирусных генов тесно связана с состоянием клеточной дифференциации. Большинство вирусных генов не активируются до тех пор, пока инфицированный кератиноцит не покинет базальный слой. Продукция частиц вируса может происходить только в высоко дифференцированных кератиноцитах; поэтому продукция вируса происходит только на эпителиальной поверхности, где клетки в конечном счете сбрасываются в окружающую среду.

Считается, что поражения, вызванные HPV, возникают в результате пролиферации инфицированных базальных кератиноцитов. Инфекция обычно происходит, когда на базальные клетки воздействует инфекционный вирус через нарушенный эпителиальный барьер, как могло бы произойти во время полового сношения или после небольших абразий кожи. Не было показано, что инфекции HPV являются цитолитическими, скорее, вирусные частицы высвобождаются в результате дегенерации слущивающихся клеток. Кроме того, вирус HPV может выживать в течение многих месяцев и при низких температурах без хозяина.

Размножение вируса в целом ограничено ядром. Следовательно, инфицированные клетки обычно проявляют высокую степень ядерной атипии. Койлоцитоз (от греческого koilos, означающего пустой) описывает комбинацию околоядерного просветления (зоны) с пикнотическим или сморщенным (расиноидным) ядром и является отличительным признаком продуктивной инфекции вирусом папилломы.

Геном HPV существует в виде циркулярной эписомальной ДНК, отдельно от ядра клетки-хозяина при доброкачественных или поражениях с низким риском, вызванных HPV, таких как поражения, обычно связанные с HPV типов 6 и 11. Геномы HPV типов 16 и 18 высокого риска обычно интегрированы в ДНК клетки-хозяина при злокачественных поражениях. Однако настоящее изобретение распространяется на любой штамм HPV, включая без ограничения штаммы 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 и 68. Интеграция вирусного генома в геном клетки-хозяина считается критерием злокачественной трансформации. Было показано, что белки HPV Е6 и Е7 серотипов высокого риска инактивируют белки-супрессоры опухолей р53 и Rb хозяина, посредством этого приводя к нерегулируемой пролиферации клеток хозяина и злокачественной трансформации.

Поэтому в других аспектах настоящее изобретение относится к способам выявления и/или дифференциации одного или нескольких определенных штаммов HPV в биологическом образце, включающим стадии

(i) получения биологического образца, который предположительно содержит HPV, у человека;

(ii) выделения нуклеиновой кислоты из указанного образца;

(iii) амплификации нуклеиновой кислоты из указанного образца с использованием праймеров, которые генерируют ампликон, который отличен для каждого штамма HPV;

(iv) необязательно, амплификации контрольной последовательности нуклеиновой кислоты;

(v) осуществления мечения ампликона(ов), указанных на стадиях (iii) и/или (iv);

(vi) гибридизации меченого ампликона(ов) в набор гранул, покрытых реагентами, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности определенного штамма HPV или контрольной последовательности нуклеиновой кислоты, связанной или иным образом ассоциированной с физико-химически различаемой гранулой; и

(vii) определения, с каким реагентом связался ампликон;

где ассоциация ампликона с определенным реагентом указывает на присутствие определенного штамма HPV в образце.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной сигнальной олигонуклеотидной последовательности.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной блокирующей олигонуклеотидной последовательности.

Настоящее изобретение обеспечивает возможность выявления ДНК амплифицированного HPV или, с применением обратной транскриптазы, соответствующей РНК. Следовательно, настоящее изобретение предусматривает гранулы с РНК или ДНК или их химическими аналогами.

Способы по настоящему изобретению частично предназначены для выявления и/или дифференциации одного или нескольких определенных штаммов обсуждаемого анализируемого возбудителя в образце. Ссылка в настоящем описании на «определенные штаммы обсуждаемого анализируемого возбудителя» включает любые варианты видов или таксона анализируемого возбудителя. Примеры «штаммов» анализируемого возбудителя включают подвиды анализируемого возбудителя, варианты анализируемого возбудителя с различными уровнями вирулентности, варианты анализируемого возбудителя, которые указывают на различные прогнозы при инфицировании или колонизации хозяина, биохимические варианты анализируемого возбудителя и т.п.

В некоторых вариантах осуществления способы по настоящему изобретению могут быть адаптированы для выявления и/или дифференциации определенных штаммов HPV, которые связаны с более высоким риском или более высоким онкогенным потенциалом у людей (штаммы высокого риска), и штаммов, которые связаны с более низким риском карциномы или низким онкогенным потенциалом (штаммы низкого риска). Соответственно, термин штамм HPV «высокого риска» включает любой штамм HPV, который связан с развитием карциномы, включая рак шейки матки у женщин. Как указано выше, иллюстративные штаммы HPV высокого риска, которые ни в коей мере не ограничивают изобретение, включают HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 и 68. Подходящие зонды захвата на гранулах для этих штаммов HPV показаны в таблице 2. Термин «зонд» и «праймер» могут использоваться взаимозаменяемо в данном контексте. Штаммы HPV «низкого риска» включают те, которые не связаны или слабо связаны с повышенным риском карциномы у людей. Обычно штаммы HPV низкого риска представляют собой штаммы, образующие бородавки, включая HPV 6 и HPV 11.

Гранулы по настоящему изобретению связаны с реагентами, которые специфически взаимодействуют с данным представляющим интерес анализируемым возбудителем внутри образца. В некоторых аспектах реагенты по настоящему изобретению представляют собой нуклеиновые кислоты и анализируемые возбудители внутри образца, которые специфически взаимодействуют с реагентом, который также представляет собой нуклеиновые кислоты.

Следовательно, в данном аспекте обсуждаемого изобретения используют праймеры, которые направлены на консервативные области штамма HPV, но которые фланкируют геномные последовательности, специфичные для штамма. Последовательности, специфичные для штамма, именуются «вариабельными» последовательностями, поскольку они варьируются между штаммами, по сравнению с консервативными последовательностями, которые являются константными между штаммами. После амплификации ампликоны вводятся в контакт с поднаборами гранул в наборе гранул, где каждая гранула каждого поднабора несет праймер захвата нуклеиновой кислоты или зонд, способный гибридизироваться со специфичными для штамма ампликонами. Мультиплексирование с использованием размера гранул, интенсивности флуоресценции и специфичности связывания ДНК обеспечивает возможность идентификации, сортировки и различения штаммов HPV.

Соответственно, другие аспекты настоящего изобретения предусматривают наборы гранул для выявления одного или нескольких штаммов HPV и/или дифференциации двух или более штаммов HPV, где набор гранул содержит множество семейств поднаборов гранул, где

(а) гранулы каждого поднабора являются однородными в отношении размера;

(b) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, который способен связываться с областью, специфичной для штамма HPV генома HPV, или, необязательно, с контрольной последовательностью нуклеиновой кислоты;

(с) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси поднаборов гранул на основании интенсивности флуоресценции; и

(d) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательности.

В еще одних аспектах настоящее изобретение предусматривает способы выявления и/или дифференцирования двух или более штаммов HPV в образце, включающие стадии

(а) обеспечения контакта образца с набором гранул, содержащим множество семейств или поднаборов гранул, где

(i) гранулы каждого поднабора являются однородными в отношении размера;

(ii) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, который способен связываться с областью генома HPV, специфичной для штамма HPV, или, необязательно, с контрольной последовательностью нуклеиновой кислоты;

(iii) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси гранул на основании интенсивности флуоресценции; и

(iv) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательностей;

(b) инкубации указанного набора гранул с указанным образцом в течение времени и в условиях, достаточных для обеспечения возможности связывания указанных праймеров с геномом HPV, амплифицированным для генерирования репликона, содержащего специфичную для штамма область;

(с) выявления и/или дифференцирования ампликонов, генерированных в образце, которые связаны с указанными гранулами, для идентификации или различения посредством этого двух или более штаммов HPV.

Ампликоны, к которым специфичны зонды захвата нуклеиновых кислот, могут быть также мечены молекулой флуоресцентного репортера.

Нуклеиновые кислоты могут быть выделены из обсуждаемого образца с использованием способа, который удобен в отношении природы самого образца и анализируемого возбудителя. Используемый в настоящем описании термин «нуклеиновая кислота» относится к ДНК и/или РНК. Обычно ДНК является выделенной, хотя в некоторых обстоятельствах, которые очевидны для специалиста в данной области, может быть предпочтительнее выделить РНК, когда представляющий интерес анализируемый возбудитель представляет собой РНК-вирус. Если РНК выделена, то РНК может быть амплифицирована, или РНК может быть подвергнута обратной транскрипции в кДНК с использованием стандартных способов, для последующей амплификации и анализа.

Предпочтительно, «нуклеиновая кислота» представляет собой ДНК. ДНК может быть выделена из образца с использованием любого пригодного средства. Например, в случае вируса, такого как HPV, в образце клетки человека, гуанидин или функционально эквивалентный агент может использоваться для лизиса клеток. В качестве иллюстративного способа лизиса клеток и экстракции ДНК на основе гуанидина можно указать способ Nelson и Krawetz (Anal. Biochem. 207(1): 97-201, 1992). Растворы для лизиса на основе гуанидина также имеются в продаже от таких поставщиков, как Qiagen, например, QIAamp, PAXgene и т.п. Однако способы лизиса могут изменяться, в зависимости от природы образца и анализируемого возбудителя. Например, для выявления анализируемого возбудителя в образце из окружающей среды, таком как образец почвы или осадка, может быть более целесообразной система лизиса клеток на основе стеклянных гранул, такая как способ Kuske et al. (Appl. Environ. Microbiol. 64(7): 2463-2472, 1998). В любом случае, целесообразный протокол лизиса для данного анализируемого возбудителя и образца может легко определить средний специалист в данной области без ненужного экспериментирования.

После лизиса клеток ДНК может быть очищена любым пригодным средством, которое вполне очевидно для специалиста в данной области (например, см. выпускаемые промышленностью наборы, указанные ниже в настоящем описании). В определенных вариантах осуществления изобретения ДНК очищается с использованием ограничивающего количества агента, связывающего ДНК, такого как, без ограничения, диоксид кремния. Путем использования ограничивающего количества агента, связывающего ДНК, может быть выделено однородное количество ДНК из различных образцов, поскольку количество ДНК, извлеченное в каждом случае, равно максимальному количеству ДНК, которое может быть связано ограничивающим количеством агента, связывающего ДНК. Затем ДНК, связанная с агентом, связывающим ДНК, может быть извлечена или элюирована из агента, связывающего ДНК, с использованием любого пригодного способа.

Хотя ДНК является предпочтительной нуклеиновой кислотой, РНК также может выделяться из образца с использованием любого стандартного протокола выделения РНК. Выделение РНК обычно включает стадию разрушения клетки и стадию выделения РНК. Иллюстративные методики разрушения клетки, которые подходят для выделения РНК, включают методики, представленные в Ambion Technical Bulletin #183 (www.ambion.com/techlib/tb/tb 183.html). Кроме того, диапазон иллюстративных наборов для выделения РНК, которые подходят для диапазона типов образцов, представлены на сайте www.ambion.com/techlib/basics/prooducts/maisol compchart.html. Однако следует понимать, что настоящее изобретение ни в коей мере не ограничивается этими определенными способами и наборами для выделения и очистки РНК, и настоящее изобретение совместимо с любыми способами выделения РНК, которые очевидны для специалиста в данной области.

Набор гранул может содержать в отношении выявления HPV столько поднаборов гранул, сколько штаммов HPV. Следовательно, в анализе может использоваться 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 и 16 поднаборов гранул, каждый для штаммов HPV 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 и 68. Дополнительные гранулы могут также использоваться для контролей. Подходящие зонды захвата представлены в таблице 2.

Следовательно, другие аспекты настоящего изобретения направлены на наборы гранул для выявления одного или нескольких штаммов HPV и/или для дифференциации двух или более штаммов HPV, где набор гранул содержит множество семейств или поднаборов гранул, где

(а) гранулы каждого поднабора являются однородными в отношении размера;

(b) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, выбранным из перечня в таблице 2, который способен связываться со специфичной для штамма HPV областью генома HPV, или, необязательно, с контрольной последовательностью нуклеиновой кислоты;

(с) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси гранул на основании интенсивности флуоресценции; и

(d) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательностей.

Еще один аспект настоящего изобретения предусматривает способы выявления и/или дифференцирования двух или более штаммов HPV в образце, включающие стадии

(а) обеспечения контакта образца с набором гранул, содержащим множество семейств или поднаборов гранул, где

(i) гранулы каждого поднабора являются однородными в отношении размера;

(ii) гранулы внутри каждого поднабора соединены с зондом захвата нуклеиновой кислоты, который выбран из перечня в таблице 2, который способен связываться с областью генома HPV, специфичной для штамма HPV, или, необязательно, с контрольной последовательностью нуклеиновой кислоты;

(iii) зонд захвата на каждой грануле мечен одинаковой меткой с каждым поднабором гранул, имеющих различную интенсивность флуоресценции, для создания гетерогенной смеси гранул на основании интенсивности флуоресценции; и

(iv) по меньшей мере, два поднабора гранул смешиваются вместе для получения набора гранул, где идентичность поднабора, и поэтому штамма HPV, может идентифицироваться проточной цитометрией на основании размера, интенсивности флуоресценции и различения последовательностей;

(b) инкубации указанного набора гранул с указанным образцом в течение времени и в условиях, достаточных для обеспечения возможности связывания указанных зондов с геномом HPV, амплифицированным для генерирования репликона, содержащего специфическую для штамма область; и

(с) выявления и/или дифференцирования ампликонов, генерированных в образце, которые связаны с указанными гранулами для идентификации или различения посредством этого двух или более штаммов HPV.

Соответственно, наборы гранул могут содержать 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16 поднаборов гранул, каждый с одной из молекул нуклеиновой кислоты, выбранной из перечня в таблице 2. Ссылка на эти специфичные для штамма HPV последовательности в таблице 2 включает молекулы нуклеиновых кислот, имеющие идентичность, по меньшей мере, 90% с этими последовательностями, или способные гибридизироваться с ними, или их комплементарность формируется в условиях низкой строгости их соблюдения. Ссылка на идентичность, по меньшей мере, 90% включает 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 и 100%.

Способы по настоящему изобретению могут частично основываться на амплификации нуклеиновой кислоты из образца с использованием праймеров, которые связываются с консервативными последовательностями среди различных штаммов обсуждаемого анализируемого возбудителя, но которые генерируют ампликон, содержащий нуклеотидную последовательность, специфичную для каждого штамма анализируемого возбудителя. При воздействии праймеры, используемые в настоящем изобретении, связываются с последовательностями, которые являются консервативными среди штаммов обсуждаемого анализируемого возбудителя, и которые фланкируют области, являющиеся, по меньшей мере, частично неконсервативной или полиморфной между штаммами. Схематически амплифицированная область в анализируемом возбудителе имеет общую структуру:

C-X-C'

где

С представляет нуклеотидную последовательность, которая является консервативной среди двух или более штаммов анализируемого возбудителя и является участком связывания «прямого» праймера;

X представляет нуклеотидную последовательность, которая частично или полностью содержит изменение между различными штаммами анализируемого возбудителя;

C' представляет нуклеотидную последовательность, которая является консервативной среди двух или более штаммов анализируемого возбудителя и является участком связывания «обратного» праймера.

В определенных вариантах осуществления желательно включить «пятки» в один или несколько праймеров для модификации процесса амплификации нуклеиновой кислоты. Предпочтительно, эти «пятки» конъюгированы с концом 5' праймера. Предпочтительнее, одна или несколько «пяток» необязательно, кроме того, конъюгированы с 5 Phos или с фрагментом 5AmMC6 конца 5' «пятки». В определенных предпочтительных вариантах осуществления «пятки», конъюгированные с прямым праймером, выбраны из caatcagc, acaat, ggaac, cagctt, attacc и ctgtt, предпочтительнее, acaat и ctgtt. В других предпочтительных вариантах осуществления «пятки», конъюгированные с обратным праймером, выбраны из actcactatagg, aatacgactcactatagg, tctaatacgactcactatagg и aattctaatacgactcactatagg, более предпочтительно actcactatagg и tctaatacgactcactatagg.

В определенных вариантах осуществления, относящихся к парам праймеров амплификации олигонуклеотидов для нацеливания на онкогенный HPV, прямой праймер пары праймеров выбран из группы, состоящей из

/5Phos/caatcagc TR TTT GTT ACT GTK GTD GAT ACY A;

/5Phos/acaat CAR YTR TTT GTT ACT GTK GTD GAT A;

/5Phos/acaat CAR YTR TTT GTT ACT GTK GTD GA;

/5Phos/ggaac AAY CAR YTR TTT GTT ACT GTK GT;

/5Phos/cagctt TTT GTT ACT GTK GTD GAT ACY AC HCG;

/5Phos/cagctt TTT GTT ACT GTK GTD GAT ACY AC HCG YAG;

/5Phos/attacc GTK GTD GAT ACY AC HCG YAG TAC; и

/5Phos/ctgtt GTD GAT ACY AC HCG YAG TAC HAA;

а обратный праймер пары праймеров выбран из группы, состоящей из

/5AmMC6/actcactatagg TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG;

/5AmMC6/aatacgactcactatagg CAY ARY TGA AAA ATA AAY TGY AAA TC;

/5AmMC6/tctaatacgactcactatagg TR CAY ARY TGA AAA ATA AAY TG; и

/5AmMC6/aattctaatacgactcactatagg TR CAY ARY TGA AAA ATA AA.

Как показано, праймер указан заглавными буквами, а необязательная «пятка» в каждом случае показана подчеркнутыми строчными буквами. Предпочтительно, прямой праймер пары праймеров выбран из /5Phos/acaat CAR YTR TTT GTT ACT GTK GTD GA и /5Phos/ctgtt GTD GAT ACY AC HCG YAG TAC HAA. В других предпочтительных вариантах осуществления обратный праймер пары праймеров выбран из /5AmMC6/actcactatagg TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG и /5AmMC6/tctaatacgactcactatagg TR CAY ARY TGA AAA ATA AAY TG.

В определенных аспектах изобретения праймеры включают периферическую нуклеотидную последовательность 5' несвязывающей области праймера, конъюгированную с концом 5', связывающей матрицу 3' области праймера. Периферическая нуклеотидная последовательность 5' может именоваться в настоящем описании «пяткой», «пяточным зажимом», «пяточной последовательностью» или «периферической пяточной последовательностью», но это никоим образом не предназначено для ограничения обсуждаемого изобретения.

В определенных вариантах осуществления, по меньшей мере, один из прямого и обратного праймеров конъюгирован с «пяткой» на конце 5' праймера. Предпочтительно, когда прямой праймер конъюгирован с «пяткой» на конце 5' прямого праймера, «пятка» прямого праймера выбрана из группы, состоящей из

CAATCAGC, ACAAT, GGAACAAT, GGAAC, CAGCTT, ATTACC, CTGTT, /5Phos/CAATCAGC, /5Phos/ACAAT, /5Phos/GGAACAAT, /5Phos/GGAAC, /5Phos/CAGCTT, 5Phos/ATTACC и /5Phos/CTGTT. Предпочтительно, когда обратный праймер конъюгирован с «пяткой» на конце 5' обратного праймера, «пятка» обратного праймера выбрана из группы, состоящей из

ACTCACTATAGG, AATACGACTCACTATAGG,

TCTAATACGACTCACTATAGG, AATTCTAATACGACTCACTATAGG, /5AmMC6/ACTCACTATAGG, /5AmMC6/AATACGACTCACTATAGG, /5AmMC6/TCTAATACGACTCACTATAGG и

/5AmMC6/AATTCTAATACGACTCACTATAGG. В некоторых более предпочтительных вариантах осуществления пар праймеров амплификации олигонуклеотида, содержащих необязательную «пяточную» последовательность нуклеиновой кислоты, прямой праймер пары праймеров выбран из группы, состоящей из

CAR YTR TTT GTT ACT GTK GTD GA, необязательно имеющую ACAAT, /5Phos/ACAAT, GGAACAAT, или /5Phos/GGAACAAT, конъюгированную с концом 5' праймера; и

GTD GAT ACY AC HCG YAG TAC HAA, необязательно имеющую CTGTT или /5Phos/CTGTT, конъюгированную с концом 5' праймера. В некоторых более предпочтительных вариантах осуществления пар праймеров амплификации олигонуклеотида, содержащих необязательную «пяточную» последовательность нуклеиновой кислоты, обратный праймер пары праймеров выбран из группы, состоящей из

TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG, необязательно имеющую ACTCACTATAGG или /5AmMC6/ACTCACTATAGG, конъюгированную с концом 5' праймера; TR CAY ARY TGA AAA ATA AAY TG, необязательно имеющую TCTAATACGACTCACTATAGG или /5AmMC6/TCTAATACGACTCACTATAGG, конъюгированную с концом 5' праймера; и TR CAY ARY TGA AAA ATA AAY TG, необязательно имеющую TCTAATACGACTCACTATAGG или /5AmMC6/TCTAATACGACTCACTATAGG, конъюгированную с концом 5' праймера.

Связывающая матрицу 3' область праймера относится к праймеру, часть 3' которого связывается с матрицей (например, во время первой стадии гибридизации для праймера полимеризации). Указанная выше конструкция праймера приводит к включению «пяточной» последовательности в продукты амплификации после получения результата от первоначального праймера. В последующем, «пяточная» последовательность 5' действует в качестве зажима для равномерной эффективности амплификации по гомологам ампликона.

Периферическая «пяточная» последовательность может находиться или на прямом праймере, или на обратном праймере, или на них обоих.

Следовательно, в определенных аспектах настоящее изобретение предусматривает способы амплификации молекулы-мишени нуклеиновой кислоты, причем указанные способы включали обеспечение воздействия амплификации на матрицу нуклеиновой кислоты указанной нуклеиновой кислоты-мишени с использованием прямого или обратного праймера, где, по меньшей мере, один праймер содержит несвязывающую область периферической нуклеотидной последовательности 5' праймера, конъюгированную с областью праймера, связывающего матрицу 3', где указанная периферическая нуклеотидная последовательность включена в продукт амплификации после первоначального примирования.

Как указано выше, или прямой, или обратный праймер могут содержать периферическую последовательность, или они оба могут нести последовательность. Когда оба праймера несут периферическую последовательность, «пятка» может быть одинаковой или различной.

Настоящее изобретение, в частности, применимо к праймерам, которые потенциально могут примировать набор целевых гомологов нуклеиновых кислот.

Настоящее изобретение, кроме того, предусматривает усовершенствованные способы амплификации молекулы нуклеиновой кислоты, включенной в пределы популяции связанных молекул нуклеиновых кислот, путем амплификации прямого и обратного праймеров, включающие выбор одного или обоих из прямого или обратного праймеров с тем, чтобы один или оба содержали несвязывающую область периферической нуклеотидной последовательности 5' праймера, конъюгированную с областью праймера, связывающего матрицу 3', где указанная периферическая нуклеотидная последовательность включена в продукт амплификации после первоначального примирования.

Следовательно, ссылка на «молекулу нуклеиновой кислоты» включает семейство связанных молекул нуклеиновых кислот, таких как группа молекул гомологов нуклеиновых кислот.

Наборы для уменьшения смещения также составляют часть настоящего изобретения.

Все приведенные выдержки из научных публикаций, патенты, патентные заявки и технические спецификации изготовителя, указанные в качестве ссылки или описанные в настоящем документе, полностью включены в него путем ссылки.

Понятно, что, пока нет иных указаний, обсуждаемое изобретение не ограничивается определенными реагентами, стадиями способов или типов применения или т.п., поскольку они могут варьироваться. Следует также понимать, что терминология, используемая в настоящем описании, предназначена только для цели описания определенных вариантов осуществления, а не предназначена для ограничения.

Термины и обозначения химии, биохимии, генетики и молекулярной биологии нуклеиновых кислот, используемые в настоящем описании, соответствуют стандартным представлениям и описаниям в данной области, например Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein Ed, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait Ed, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); и т.п.

«Ампликон» означает продукт реакции амплификации полинуклеотида. То есть, он представляет собой популяцию полинуклеотидов, обычно, но необязательно, двухнитевых, которые реплицированы от одной или нескольких исходных последовательностей. Одна или несколько исходных последовательностей могут представлять собой одну или несколько копий одной и той же последовательности, или они могут представлять собой смесь различных последовательностей. Ампликоны могут быть получены множественными реакциями амплификации, продукты которых представляют собой множественные репликаты одной или нескольких нуклеиновых кислот-мишеней. В целом, реакции амплификации, продуцирующие ампликоны, являются «запускаемые матрицей» при том, что спаривание пар реагентов, нуклеотидов или олигонуклеотидов имеют хромосомные наборы в полинуклеотиде матрицы, которые требуются для создания продуктов взаимодействия. В одном аспекте, запускаемые матрицей реакции представляют собой удлинения праймера полимеразой нуклеиновой кислоты или лигированиями олигонуклеотидов лигазой нуклеиновых кислот. Такие реакции включают без ограничения реакции PCR линейной полимеразы, NASBA, амплификации репликаций по типу разматывающегося рулона и т.п., описанные в следующих источниках, которые включены в настоящее описание путем ссылки: Mullis et al., патенты США № 4683195; 4965188; 4683202; 4800159 (PCR); Gelfand et al., патент США № 5210015 (PCR в реальном масштабе времени с зондами “Taqman” или “Taq” [зарегистрированные торговые марки]); Wittwer et al., патент США № 6174670; Kacian et al., патент США № 5399491 (“NASBA”); Lizardi, патент США № 5854033; Aono et al., японская патентная публикация № JP 4-262799 (амплификации репликаций по типу разматывающегося рулона) и т.п.

Реакция амплификации может представлять собой амплификацию в «реальном масштабе времени», где химизм выявления обеспечивает возможность измерения продукта взаимодействия в ходе реакции амплификации.

Настоящее изобретение, в частности, относится к уменьшению смещения амплификации по диапазону гомологичных или родственных молекул нуклеиновых кислот. Примеры гомологичных молекул нуклеиновых кислот включают среди многих других вирусные гомологи, полиморфизмы, родственные раковые клетки, бактериальные гомологи, гомологи стволовых клеток. Один аспект настоящего изобретения представляет собой выбор праймеров в потенциальных точках различия между гомологами. Предлагается, чтобы праймеры несли периферическую нуклеотидную последовательность несвязывающей области 5' праймера, конъюгированную со связывающей областью 3' матрицы праймера, которая включена в продукт амплификации после первоначального примирования.

«Пятка», или периферическая последовательность 5', может иметь длину от примерно 1 до примерно 400 оснований, включая все их комбинации и субкомбинации. Предпочтительно, «пятка» имеет длину от примерно 3 до примерно 100, предпочтительнее, от примерно 4 до примерно 50 оснований, еще предпочтительнее, от примерно 5 до примерно 40, еще предпочтительнее, от примерно 5 до примерно 25, при более предпочтительной длине от примерно 10 до примерно 20 оснований.

При воздействии периферическая последовательность 5' необязательно имеет уровень комплементарности к последовательности-мишени и не вносит существенного вклада в первоначальные стадии связывания праймера. Желательно, чтобы «пятка» имела комплементарность к коровому праймеру менее чем 95%. Дополнительные уровни комплементарности могут включать менее чем 90%, 85%, 80%, 75%, 70%, 65% и 60%. Комплементарность определяется с использованием стандартных алгоритмов.

Используемый в настоящем описании термин «амплифицирование» означает выполнение реакции амплификации. «Реакционная смесь» или «реакционный сосуд» означает раствор или отсек, содержащий все необходимые реагенты для выполнения реакции, которые могут включать, без ограничения, буферные агенты для поддержания рН на выбранном уровне во время реакции, соли, ко-факторы, акцепторы и т.п.

«Комплементарная или по существу комплементарная» относится к гибридизации или спариванию оснований или к образованию дуплекса между нуклеотидами или нуклеиновыми кислотами, такого как, например, между двумя нитями молекулы двухнитевой ДНК, или между олигонуклеотидным праймером и участком связывания праймера на однонитевой нуклеиновой кислоте. Комплементарные нуклеотиды представляют собой в целом А и Т (или A и U), или C и G. Считается, что две молекулы однонитевой РНК или ДНК по существу комплементарны, когда нуклеотиды одной нити, оптимально совмещенные и сравненные с соответствующими нуклеотидными вставками или делециями, спариваются, по меньшей мере, с 80% нуклеотидов другой нити, обычно, по меньшей мере, с 90-95%, а предпочтительнее, от примерно 98 до 100%. Альтернативно, существенная комплементарность происходит, когда, например, нить ДНК гибиридизируется в условиях селективной гибридизации с ее комплементом. Обычно селективная гибридизация происходит, когда имеется комплементарность, по меньшей мере, примерно 65% по отрезку, по меньшей мере, из 14-25 нуклеотидов, предпочтительно, по меньшей мере, примерно 75%, предпочтительнее, комплементарность, по меньшей мере, примерно 90%. См. Kanehisa Nucleic Acids Res. 12: 203, 1984, полностью включенную в настоящее описание путем ссылки.

«Дуплекс» означает, по меньшей мере, два олигонуклеотида и/или полинуклеотида, которые полностью или частично комплементарно подвергаются спариванию оснований типа Watson-Crick среди всех или большинства их нуклеотидов, так что образуется устойчивый комплекс. Термин «отжиг» и «гибридизация» используются взаимозаменяемо для обозначения образования устойчивого дуплекса. «Отлично подобранная пара» в отношении дуплекса означает, что нити поли- или олигонуклеотида, составляющие дуплекс, образуют двухнитевую структуру друг с другом, так что каждый нуклеотид в каждой нити подвергается спариванию оснований Watson-Crick с нуклеотидом в другой нити.

«Генетический локус», или «локус», в отношении генома или полинуклеотида-мишени означает смежную подобласть или сегмент генома или полинуклеотида-мишени. Используемый в настоящем описании термин «генетический локус», или «локус», может относиться к положению гена или части гена в геноме, или он может относиться к любой смежной части геномной последовательности, независимо от того, находится ли она в пределах гена или связана с геном или нет. Предпочтительно, генетический локус относится к любой части геномной последовательности от нескольких десятков нуклеотидов, например, длиной 10-30 или 10-100, до нескольких сотен нуклеотидов, например, длиной 100-1000 или 100-500, до длины в несколько тысяч нуклеотидов, например, длиной 1000-10000 или 1000-3000. В некоторых контекстах генетические локусы могут относиться к локализации нуклеотида в пределах генома.

«Набор» относится к любой системе подачи для доставки материалов или регентов с целью осуществления способа по настоящему изобретению. В контексте анализов реакции такие системы доставки включают системы, которые обеспечивают возможность хранения, транспортировки или доставки реакционных реагентов (например, зондов, ферментов и т.д., в соответствующих контейнерах) и/или поддерживающих материалов (например, буферы, письменные инструкции по выполнению анализов и т.д.) из одного участка в другой. Например, наборы включают одно или несколько вложений (например, коробок), содержащих релевантные реакционные реагенты и/или поддерживающие материалы. Такие содержащиеся в наборе материалы могут доставляться предназначенному реципиенту вместе или отдельно. Например, первый контейнер может содержать фермент для применения в анализе, тогда как второй контейнер содержит зонды. Наборы могут также содержать отсеки, приспособленные для содержания реагентов. В одном примере отсек содержит твердую матрицу, имеющую олигонуклеотиды или праймеры, или полинуклеотиды, иммобилизованные на ней, которые участвуют в реакции амплификации. Примером твердой матрицы является микрочип. Поэтому набор может быть частью всей системы амплификации, имеющей компонент реагента, компонент нуклеиновой кислоты, компонент аппаратного обеспечения и инструкционный компонент.

«Микрочип» относится к твердофазным подложкам, имеющим плоскостную поверхность, которая несет матрицу нуклеиновых кислот, причем каждый член матрицы содержит идентичные копии олигонуклеотида или полинуклеотида, иммобилизованных на пространственно ограниченной области или участке, которые не перекрываются олигонуклеотидами или полинуклеотидами других членов матрицы; т.е. области участков являются пространственно дискретными. Пространственно ограниченные участки гибридизации могут, кроме того, быть «адресуемыми» в том, что их локализация и идентичность их иммобилизованного олигонуклеотида известны или заданы, например, перед их использованием. Обычно олигонуклеотиды или полинуклеотиды являются однонитевыми и ковалентно прикреплены к твердофазной подложке, обычно 5'-концом или 3'-концом. Плотность не перекрывающихся областей, содержащих нуклеиновые кислоты в микрочипе, составляет обычно более чем 100 на 1 см2, а предпочтительнее, более чем 1000 на 1 см2. Технология микрочипов описана в следующих источниках, которые полностью включены в настоящее описание путем ссылки: Schena, Ed, Microarrays: A Practical Approach (IRL Press, Oxford, 2000); Southern, Current Opin. Chem. Biol., 2: 404-410, 1998.

«Произвольный микрочип» относится к микрочипу, пространственно дискретные области олигонуклеотидов или полинуклеотидов которого пространственно не адресуются. То есть, идентичность прикрепленных олигонуклеотидов или полинуклеотидов по их локализации, по меньшей мере, исходно неразличима. В одном аспекте произвольные микрочипы представляют собой плоскостные матрицы микрогранул, где каждая микрогранула имеет один вид прикрепленного комплемента метки гибридизации, такого как из минимально перекрестно гибридизирующего набора олигонуклеотидов. Аналогичным образом после образования гранулы или их олигонуклеотиды в произвольном микрочипе могут быть идентифицированы разнообразными способами, включая оптические метки, например, соотношения флуоресцентных красителей, или квантовых точек, анализ формы, последовательности или им подобные.

Используемый в настоящем описании термин «нуклеозид» включает натуральные нуклеозиды, включая 2'-деокси Т-гидроксильные формы, например как описано Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).

«Полимеразная реакция синтеза цепи» или «PCR» означает реакцию для амплификации in vitro специфических последовательностей ДНК путем одновременного удлинения праймерами комплементарных нитей ДНК. Другими словами, PCR представляет собой реакцию для получения множественных копий или репликатов нуклеиновой кислоты-мишени, фланкированной участками связывания праймера, причем такая реакция включает одно или несколько повторений следующих стадий: (i) денатурация нуклеиновой кислоты-мишени, (ii) отжиг праймеров к участкам связывания праймеров и (iii) удлинение праймеров полимеразой нуклеиновой кислоты в присутствии нуклеозид-трифосфатов. Обычно реакция циклически повторяется при различных температурах, оптимизированных для каждой стадии в приборе регистрации термических циклов. Конкретные температуры, длительность каждой стадии и частоты смены стадий зависят от многих факторов, хорошо известных средним специалистам в данной области, например, иллюстрируемых ссылками: McPherson et al., (Eds), PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, соответственно 1991 и 1995). Например, при обычной PCR с использованием ДНК полимеразы Taq, двухнитевая нуклеиновая кислота-мишень может быть денатурирована при температуре >90ºC, праймеры могут подвергаться отжигу при температуре в диапазоне 35-90ºC. Термин «PCR» охватывает производные формы реакции, включая, без ограничения, RT-PCR, PCR в реальном масштабе времени, интрогенную PCR, количественную PCR, мультиплексированную PCR, усиленную твердофазную PCR и т.п. Дополнительные детали усиленной твердофазной PCR можно найти, например, в документе Park, et al., Analytical Biochemistry, 375 (2008), pp. 391-393, полное содержание которого включено в настоящее описание путем ссылки. Применение усиленной твердофазной PCR предпочтительно в определенных вариантах осуществления для генерации и/или амплификации молекул нуклеиновых кислот, связанных, например, со штаммами HPV. Еще предпочтительнее применение отмеченных в настоящем описании одной или нескольких пар прямого/обратного праймеров при усиленной твердофазной PCR амплификации молекул нуклеиновых кислот, связанных со штаммами HPV.

При использовании формата ESP-PCR 5-примфосфаты являются необязательными, поскольку однонитевой ампликон не требуется в качестве конечного продукта PCR. 5-примаминные функциональные группы также необязательны в этом формате и могут использоваться в качестве предпочтительного средства мечения флуорофором для генерирования сигнала. Однако могут также использоваться многие альтернативные средства генерирования сигнала, где нет потребности в какой-либо функциональной группе или альтернативной функциональной группе. Например, праймеры PCR могут быть мечены не флуоресцентной меткой и могут использоваться отдельные «сигнальные олигонуклеотиды», которые конъюгированы с сигналом. В другом примере при использовании формата ESP-PCR все «водные» праймеры PCR могут применяться без функциональных групп и сигнал может быть альтернативно введен посредством включения меченого аналога нуклеотида. В других вариантах осуществления при использовании формата ESP-PCR, все «водные» праймеры PCR могут применяться без функциональных групп и сигнал может вводиться посредством меченого праймера на твердой подложке, так что сигнал увеличивается в контексте двухнитевого продукта.

Альтернативные средства для генерирования однонитевого ампликона включают превращение двухнитевой ДНК в однонитевую ДНК отделением нитей или удалением одной нити дуплекса. Нити дуплекса могут разделяться термическими или химическими средствами разрыва межнитевых связей. Удаление одной нити обеспечивает возможность извлечения желательной нити и устранения ее комплемента (см., например, Nikiforov et al. (патент США № 5518900), которые описали модификацию одного из двух праймеров, используемых для амплификации, включением фосфортиоатных нуклеотидных производных в конец 5' модифицированного праймера, придавая ему устойчивость к перевариванию экзонуклеазой). После амплификации последовательностей-мишеней с использованием полимеразной реакции синтеза цепи (PCR), двухнитевая ДНК подвергается перевариванию экзонуклеазой. Незащищенная нить предпочтительно переваривается 5'-3' экзонуклеазой, оставляя однонитевой продукт, состоящий из другой нити. В аналогичных стратегиях использовались устойчивые к экзонуклеазе разветвленные праймеры (Shchepinov et al., Nuc. Acids. Res. 25: 4447-4454, 1997) или предпочтительно экзонуклеаза лямбда, на несущей 5' фосфат подложке (Higuchi et al., Nucl. Acids Res. 25: 5685, 1989).

Асимметричная PCR (Gyllensten and Erlich, Proc. Natl. Acad. Sci. USA 85: 7652-7656, 1998; патент США № 5066584) генерирует однонитевую ДНК во время термического циклического воздействия путем использования не сбалансированной концентрации пар праймеров, так что один праймер находится на уровне ограничивающей концентрации. Это благоприятствует продукту однонитевой ДНК, примированному содержащимся в избытке праймером.

При асимметричной PCR с конкурентным праймером (Gillespie, 1997; заявка на патент США № 08/628417) используется отдельное добавление конкурентного праймера после термических циклов PCR и перед дальнейшим термическим циклическим воздействием для генерирования однонитевой ДНК. Kaltenboeck et al., Biotechniques 12: 164-171, 1992, описали способ получения однонитевой ДНК путем первоначального выполнения PCR для генерирования двухнитевой ДНК с последующей отдельной реакцией с использованием продукта первой PCR в качестве матрицы для второй линейной амплификации с использованием одного праймера. Примеры асинхронной PCR содержатся также в патенте США № 6887664.

Реакционные объемы имеют диапазон от нескольких сотен нанолитров, например, 200 нл, до нескольких сотен мкл, например, 200 мкл. «Обратная транскрипция-PCR», или “RT-PCR”, означает PCR, которой предшествует реакция обратной транскрипции, которая превращает РНК-мишень в комплементарную однонитевую ДНК, которая затем амплифицируется (см., например, Tecott et al., патент США № 5168038, который полностью включен в настоящее описание путем ссылки). «PCR в реальном масштабе времени» означает PCR, для которой количество продукта реакции, т.е. ампликона, контролируется по ходу реакции. Существует много форм PCR в реальном масштабе времени, которые отличаются главным образом химизмом выявления, используемым для контроля продукта реакции, например, Gelfand et al., патент США № 5210015 (“taqman”); Wittwer et al., патенты США № 6174670 и 6569627 (интеркалирующие красители) Tyagi et al., патент США № 5925517 (молекулярные маяки); указанные патенты полностью включены в настоящее описание путем ссылки. Обзор химических способов выявления для PCR в реальном масштабе времени представлен в документе Mackay et al., Nucleic Acids Research, 30: 1292-1305, 2002, который также полностью включен в настоящее описание путем ссылки. «Интрогенная PCR» означает двухэтапную PCR, где ампликон первой PCR становится образцом для второй PCR при использовании нового набора праймеров, по меньшей мере, один из которых связывается с внутренней локализацией первого ампликона.

Предлагается, чтобы первоначальные проявления примирования проводились от прямого и обратного праймеров, где один или оба несут несвязывающую область периферической нуклеотидной последовательности 5' праймера, конъюгированную с областью праймера, связывающей матрицу 3', где периферическая нуклеотидная последовательность включена в продукт амплификации после первоначального примирования.

Использование несвязывающей области «пяточной» последовательности 5' праймера, конъюгированной с областью праймера, связывающей матрицу 3', в качестве конструкции праймера, приводит к включению «пяточной» последовательности в продукты амплификации после первоначального проявления связывания праймера. В последующем «пяточная» последовательность 5' действует в качестве зажима для выравнивания эффективности амплификации по гомологам. По существу, смещение амплификации ограничивается явлениями первоначального связывания праймера. В зависимости от требования, «пяточный зажим» может быть помещен на один или оба из прямого и обратного праймеров. Имеется большая свобода конструкции в отношении того, какую последовательность содержит «пяточный зажим» для соответствия конкретному применению. Матрица 3', связывающая последовательность праймера, может принимать форму вырожденной последовательности, согласованной последовательности или гибрида согласованной последовательности и вырожденной последовательности. Можно также использовать совокупность представляющих интерес точно совпадающих последовательностей. Во всех этих случаях может использоваться принцип «пяточный зажим» 5'.

«Полинуклеотид» и «олигонуклеотид» используются взаимозаменяемо, и каждый термин означает линейный полимер нуклеотидных мономеров. Мономеры, составляющие полинуклеотиды и олигонуклеотиды, способны специфически связываться с натуральным полинуклеотидом путем регулярного типа взаимодействий между мономерами, таких как спаривание оснований типа Watson-Crick, стэкинг оснований, спаривание оснований типа Hoogsteen или обратного Hoogsteen или т.п.

Когда полинуклеотид иди олигонуклеотид представлен последовательностью букв (заглавных или строчных), такой как “ATGCCTG”, то следует понимать, что, пока нет других указаний или это не очевидно из контекста, нуклеотиды расположены в порядке 5'→3' слева направо и что «А» обозначает деоксиаденозин, «С» обозначает деоксицитидин, «G» обозначает деоксигуанозин и «Т» обозначает тимидин, «I» обозначает деоксиинозин, «U» обозначает уридин.

«Праймер» означает олигонуклеотид, или натуральный, или синтетический, который способен, после образования дуплекса с полинуклеотидной матрицей, действовать в качестве точки инициации синтеза нуклеиновой кислоты, и простирающийся от его конца 3' вдоль матрицы с тем, чтобы образовался удлиненный дуплекс.

Удлинение праймера обычно проводится полимеразой нуклеиновой кислоты, такой как ДНК- или РНК-полимераза. Последовательность нуклеотидов, добавляемых в процессе удлинения, определяется последовательностью полинуклеотида матрицы. Обычно праймеры удлиняются за счет ДНК-полимеразы. Праймеры обычно имеют длину в диапазоне от 14 до 49 нуклеотидов, или в диапазоне от 18 до 36 нуклеотидов. Праймеры используются в разнообразных нуклеиновых реакциях амплификации, например реакциях линейной амплификации, с использованием одного праймера, или PCR, использующих два или более праймеров. Руководство по выбору величин длины и последовательностей праймеров для конкретных видов применения хорошо известно средним специалистам в данной области, о чем свидетельствуют следующие источники, которые полностью включены в настоящее описание путем ссылки: Dieffenbach (Ed), PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

«Проба» означает некоторое количество материала из биологического, полученного из внешней среды, медицинского или взятого у пациентов источника, в котором желательно выявление или измерение нуклеиновых кислот-мишеней. С одной стороны, подразумевается, что он включает образец или культуру (например, микробиологические культуры). С другой стороны, подразумевается, что он включает образцы биологического и полученного из внешней среды источника. Проба может включать образец синтетического происхождения. Биологические пробы могут представлять собой полученную у животного, включая человека, жидкость, твердое вещество (например, фекалии) или ткань, а также жидкие и твердые пищевые продукты и корма, и ингредиенты, такие как молочные продукты, овощи, мясо и мясные побочные продукты, и отходы. Биологические пробы могут включать материалы, взятые у пациента, включая, без ограничения, культуры, кровь, слюну, спинномозговую жидкость, плевральную жидкость, грудное молоко, лимфу, мокроту, семенную жидкость, игольные аспираты, и т.п. Биологические пробы могут быть получены от различных семейств домашних животных, а также одичавших или диких животных, включая без ограничения, таких животных, как копытные животные, медведи, рыбы, грызуны и т.д. Пробы, полученные из окружающей среды, включают такой материал окружающей среды, как материал, полученный с поверхностей, почву, воду и промышленные пробы, а также пробы, полученные с инструментов, приборов, оборудования, расходных материалов, одноразовых деталей и деталей многоразового применения для переработки пищевых продуктов и молока. Эти примеры не следует рассматривать как ограничивающие типы проб, подходящих для настоящего изобретения.

Следовательно, неоторые аспекты настоящего изобретения относятся к способам амплификации молекулы-мишени нуклеиновой кислоты, включающим воздействие амплификации на однонитевую матрицу указанной мишени нуклеиновой кислоты с использованием прямых и обратных праймеров, где, по меньшей мере, один праймер содержит несвязывающую область периферической нуклеотидной последовательности 5' праймера, конъюгированную с областью праймера, связывающей матрицу 3', где указанная периферическая нуклеотидная последовательность включена в продукт амплификации после первоначального примирования.

Другие аспекты настоящего изобретения предусматривают усовершенствованные способы амплификации молекулы нуклеиновой кислоты, входящей в популяцию родственных молекул нуклеиновых кислот, путем амплификации прямым и обратным праймерами, включающие выбор одного или обоих из прямого или обратного праймера с тем, чтобы один или оба содержали несвязывающую область периферической нуклеотидной последовательности 5' праймера, конъюгированную с областью праймера, связывающей матрицу 3', где указанная периферическая нуклеотидная последовательность включена в продукт амплификации после первоначального примирования.

Примеры «пяточных» последовательностей включают

Амплификация из участков праймера, таких как описанные выше, обеспечивает возможность эффективного применения «универсального» набора праймеров, которые связываются на С и C' для амплификации Х из диапазона штаммов анализируемого возбудителя. Кроме того, следовало бы отметить, что ампликон, амплифицированный с использованием универсальных праймеров, содержит и консервативную, и вариабельную области.

В некоторых вариантах осуществления используются праймеры, которые амплифицируют последовательности HPV. Предпочтительнее, этими праймерами являются: GP5+ представляет 5' TTT GTT ACT GTG GTA GAT ACT AC 3', и GP6+ представляет 5' GAA AAA TAA ACT GTA AAT CAT ATT C 3'. Эти праймеры генерируют ампликон из HPV, который содержит и консервативную область (определенную как Y на фиг.2), и область, которая является вариабельной среди различных штаммов HPV (определенной как Х на фиг.2).

В других вариантах осуществления этими праймерами являются: GP5d2+ представляет 5' TTT KTT ACH GTK GTD GAT ACH AC 3' и T7aGP6d+ представляет 5' AAT TCT AAT ACG ACT CAC TAT AGG GGA AAH ATA AAY TGY AAD TCA TAY TC 3'.

В других вариантах осуществления этими праймерами являются: GP5d3+ представляет 5' 5Phos TTT GTT ACH GTD GTD GAY ACH AC 3' и T7aGP6d+* представляет 5' /5AmMC6/AAT TCT AAT ACG ACT CAC TAT AGG GGA AAH ATA AAY TGY ARD TCA WAY TC 3'.

В других вариантах осуществления прямые праймеры пары праймеров выбраны из группы, состоящей из

TR TTT GTT ACT GTK GTD GAT ACY A, необязательно имеющей caatcagc или /5Phos/caatcagc, конъюгированную с концом 5' праймера;

CAR YTR TTT GTT ACT GTK GTD GAT A, необязательно имеющей acaat или /5Phos/acaat, конъюгированную с концом 5' праймера;

CAR YTR TTT GTT ACT GTK GTD GA, необязательно имеющей acaat или /5Phos/acaat, конъюгированную с концом 5' праймера;

AAY CAR YTR TTT GTT ACT GTK GT, необязательно имеющей ggaac или /5Phos/ggaac, конъюгированную с концом 5' праймера;

TTT GTT ACT GTK GTD GAT ACY AC HCG, необязательно имеющей cagctt или /5Phos/cagctt, конъюгированную с концом 5' праймера;

TTT GTT ACT GTK GTD GAT ACY AC HCG YAG, необязательно имеющей cagctt /5Phos/cagctt, конъюгированную с концом 5' праймера;

GTK GTD GAT ACY AC HCG YAG TAC, необязательно имеющей /5Phos/attacc, конъюгированную с концом 5' праймера; и

GTD GAT ACY AC HCG YAG TAC HAA, необязательно имеющей attacc или /5Phos/ctgtt, конъюгированную с концом 5' праймера, и

обратный праймер пары праймеров выбран из группы, состоящей из

TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG, необязательно имеющей actcactatagg или /5AmMC6/actcactatagg, конъюгированную с концом 5' праймера;

CAY ARY TGA AAA ATA AAY TGY AAA TC, необязательно имеющей aatacgactcactatagg или /5AmMC6/aatacgactcactatagg, конъюгированную с концом 5' праймера;

TR CAY ARY TGA AAA ATA AAY TG, необязательно имеющей tctaatacgactcactatagg или /5AmMC6/tctaatacgactcactatagg, конъюгированную с концом 5' праймера; и

TR CAY ARY TGA AAA ATA AA, необязательно имеющей aattctaatacgactcactatagg или /5AmMC6/aattctaatacgactcactatagg, конъюгированную с концом 5' праймера.

Альтернативно, прямой и обратный праймеры выбраны из группы праймеров, аналогичных праймерам, описанным выше в настоящей заявке, но которые могут отличаться от прямого и обратного праймеров, описанных выше в настоящей заявке, от 0 до примерно 5 нуклеотидными замещениями, предпочтительно, от 0 до примерно 2 замещениями, в участках, где нуклеотидные замещения происходят между различными штаммами HPV, но при исключении замещений последних двух нуклеотидов на конце 3'. Изобретение также предусматривает замещения в необязательных «пяточных» последовательностях, аналогичные замещениям для прямых или обратных праймеров, описанным выше в настоящей заявке, причем указанные необязательные «пятки» конъюгированы с концом 5' любого из описанных выше прямого и обратного праймеров. В определенных предпочтительных вариантах осуществления прямой праймер выбран из CAR YTR TTT GTT ACT GTK GTD GA, необязательно имеющей acaat или /5Phos/acaat, конъюгированные с концом 5' праймера, и GTD GAT ACY AC HCG YAG TAC HAA, необязательно имеющей ctgtt или /5Phos/ctgtt, конъюгированные с концом 5' праймера. В некоторых других предпочтительных вариантах осуществления обратный праймер выбран из TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG, необязательно имеющей actcactatagg или /5AmMC6/actcactatagg, конъюгированные с концом 5' праймера, и TR CAY ARY TGA AAA ATA AAY TG, необязательно имеющей tctaatacgactcactatagg или /5AmMC6/tctaatacgactcactatagg, конъюгированные с концом 5' праймера.

В представленном выше описании показаны примеры пар праймеров, используемых в настоящем изобретении. Дополнительные пары праймеров могут быть образованы спариванием различных прямых (например, GP5+, GP5d2+ и т.д.) и обратных праймеров (например, GP6+, T7aGP6d+) друг с другом.

Определенные варианты осуществления изобретения направлены на фрагменты любых из описанных в настоящей заявке праймеров, включая все комбинации и субкомбинации указанных фрагментов праймеров, до нижнего предела коровых фрагментов примерно 20-мер 3-прим любой из описанных праймеров. Используемый в настоящем описании термин «фрагмент» относится к усеченной олигомерной последовательности нуклеиновой кислоты праймера или зонда, образованной делецией одного или нескольких нуклеотидов из первоначального праймера.

Настоящее изобретение также предусматривает амплификацию контрольных последовательностей. В одном варианте осуществления контрольная последовательность может включать область генома субъекта, у которого получена биологическая проба. Однако настоящее изобретение ни в коей мере не ограничивается этими конкретными контрольными последовательностями, и предусматриваются другие контрольные последовательности, которые были бы очевидны для специалиста в данной области. Кроме того, способы по настоящему изобретению могут также выполняться без амплификации контрольной последовательности.

В некоторых вариантах осуществления контрольная последовательность амплифицируется из генома человека с использованием праймеров MLCI_F, которая включает нуклеотидную последовательность 5' TAC ACA CAG GTG TAC ACA GA 3' и MLCI_R, который включает последовательность 5' ACC AAG TAC TCT ACG TGT TG 3'.

В других вариантах осуществления контрольная последовательность амплифицируется из генома человека с использованием праймеров mlcI_95f, который включает нуклеотидную последовательность 5' GGC ACC CAG ACA TAC AC 3' и T7amlcI_275r(HeelMLCR), который включает нуклеотидную последовательность 5' AAT TCT AAT ACG ACT CAC TAT AGG GGA AAH ATA AAY TGY AAD TCA TAY TC 3'.

Изолированная ДНК может амплифицироваться с использованием любого протокола амплификации ДНК. Диапазон иллюстративных способов амплификации ДНК, которые ни в коей мере не ограничивают изобретение, представлен в "DNA Amplification: Current Technologies and Applications" (Demidov and Broude Eds., Horizon Bioscience, 2004).

Изолированная РНК может амплифицироваться с использованием любых способов, известных в данной области, и был разработан ряд технологий амплификации РНК. Две основные их категории представляют собой (i) те, которые используют термическое циклическое воздействие, такие как RT-PCR, и (ii) изотермические анализы, такие как аплификация, основанная на последовательности нуклеиновой кислоты (NASBA) (Compton, Nature 350: 91-92, 1991; Kievits et al., J. Virol. Methods 35: 273-286, 1991), и амплификация, опосредованная транскрипцией (TMA) (Hill, J. Clin. Ligand Assay 19: 43-51, 1996). Изотермические анализы могут быть подразделены, на основании того, что (i) копируют и амплифицируют ли они последовательность-мишень, такую как TMA, NASBA и самоподкрепляющую репликацию последовательности (3SR) (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874-1878, 1990; Chadwick et al., J. Virol. Methods 70: 59-70, 1998; обзор см. в документе Chan and Fox, Rev. Med. Microbiol. 10: 185-196, 1999), или (ii) генерируют ли они зависимый от мишени сигнал, который может быть далее амплифицирован, например анализы «захватчика» (Lyamichev et al., Nat. Biotechnol. 17: 292-296, 1999; Ryan et al., Mol. Diagn. 4: 135-144, 1999). Существуют различные другие технологии амплификации, которые не совсем подпадают под эти категории, такие как Q бета репликаза (Lizardi et al., Biotechnology 6: 1197-1202, 1988) и разветвленная ДНК (Todd et al., J. AIDS Hum. Retrovirol. 10: S35-S44, 1995; Pawlotsky et al., J. Virol. Methods 79: 227-235, 1999). Однако следует понимать, что настоящее изобретение предусматривает любой способ амплификации ДНК, который был бы очевиден для специалиста в данной области. Кроме того, следует понимать, что настоящее изобретение также предусматривает применение обратной транскриптазы или ее функционального эквивалента для превращения РНК в ДНК, которая может быть затем в последующем амплифицирована.

В соответствии с настоящим изобретением ампликоны, указанные на стадии (iii) и/или (iv) описанных выше способов, являются мечеными. Ампликоны по настоящему изобретению могут быть мечены с использованием любых пригодных средств. Иллюстративные способы включают и пре-, и постсинтетические способы. Способы пресинтетического мечения включают мечение праймера PCR, который в последующем используется для амплификации и, посредством этого, включается в ампликон через PCR. В этом способе метка обычно присоединяется к концу праймера, подходящего для амплификации ампликона, хотя предусмотрено также мечение в других положениях внутри праймера, такое как мечение по 3'-концу или неконцевое мечение.

Химический линкер может также использоваться между меткой и полинуклеотидом, который метится. Специалисты в данной области легко установят соответствующие линкерные последовательности, и они, вероятно, включают такие линкеры, как С6, С7 и С12 аминомодификаторы и линкеры, содержащие тиольные группы. Как будет легко установлено, праймер может содержать линкер и метку или один линкер, к которому может быть присоединена метка на более поздней стадии.

Способы мечения после амплификации включают системы «ник»-мечения, где меченый полинуклеотид синтезируется из ампликона с использованием полимеразы Klenow, или ее функционального эквивалента, из произвольных праймеров. Меченые нуклеотиды или нуклеотиды, содержащие линкерную группу, могут быть включены в синтезированный полимеразой Klenow полинуклеотид во время синтеза.

В любом случае, другие способы мечения должны быть совершенно очевидны специалисту в данной области, и следует понимать, что настоящее изобретение никоим образом не определяется или не ограничивается выбором способа мечения.

Предпочтительно, используемая метка представляет собой «флуоресцентную метку» или «флуорофор». Множество различных флуоресцентных меток знакомы специалистам в данной области, и выбор флуоресцентной метки никоим образом не ограничивает изобретение. В других предпочтительных вариантах осуществления настоящего изобретения флуоресцентные метки по настоящему изобретению содержат любую флуоресцентную метку, которая может быть присоединена к полинуклеотиду и которая возбудима при использовании источника света, выбранного из представленной ниже группы:

(i) Аргоновые ионные лазеры: содержат синюю спектральную линию 488 нм, которая подходит для возбуждения многих красителей и флуоресцентных меток, которые флуоресцируют в области от зеленого до красного спектра. Имеются также настраиваемые аргоновые лазеры, которые излучают в диапазоне длин волн (458 нм, 488 нм, 496 нм, 515 нм и других).

(ii) Диодные лазеры имеют длину волны излучения 635 нм. Другие диодные лазеры, которые имеются в настоящее время, работают при 532 нм. Интересно, что эта длина волны оптимально возбуждает пропидий йодид (PI). Окрашивание PI широко используется для анализа ДНК, подсчета живых/мертвых клеток и определения плоидии. Имеются также синие диодные лазеры, испускающие свет примерно при 476 нм.

(iii) HeNe газовые лазеры: работают при красной спектральной линии 633 нм.

(iv) HeCd лазеры: работают при 325 нм.

(v) ртутная дуговая лампа 100 Вт; самый эффективный источник света для возбуждения УФ красителей, подобных Hoechst и DAPI.

В более предпочтительных вариантах осуществления настоящего изобретения флуоресцентные маркеры выбраны из гидроксикумарина, аминокумарина, метоксикумарина, каскадного синего, люцифера желтого, NBD (нейтрального синего красителя), фикцэритрина (РЕ), PerCP, аллофикоцианина, Hoechst 33342, DAPI, SYTOX синего, Hoechst 33258, хромомицина А3, митрамицина, YOYO-1, SYTOX зеленого, SYTOX оранжевого, 7-AAD, акридина оранжевого, TOTO-1, To-PRO-1, тиазола оранжевого, TOTO-3, TO-PRO-3, LDS 751, красителей Alexa Fluor, включая Alexa Fluor-350, -430, -488, -532, -546, -555, -556, -594, -633, -647, -660, -680, -700 и -750; красителей BoDipy, включая BoDipy 630/650 и BoDipy 650/665; красителей CY, в частности, Cy2, Cy3, Cy3.5, Cy5, Cy5.5 и Cy7; 6-FAM (флуоресцеин), PE-Cy5, PE-Cy7, флуоресцеина dT; гексахлорфлуоресцеина (Hex); 6-карбокси-4',5'-дихлор-2',7'-диметоксифлуоресцеина (JOE); красителей Орегона зеленого, включая 488-Х и 514; родаминовых красителей, включая Х-родамин, лиссамин родамин В, родамин зеленый, родамин красный и ROX; TRITC, тетраметилродамина (TMR); карбокситетраметилродамина (TAMRA); тетрахлорфлуоресцеина (ТЕТ); красного 6В, FluorX, BODIPY-FL, красителя SYBR зеленый I и техасского красного. В особенно предпочтительных вариантах осуществления настоящего изобретения меткой является Cy5, который особенно пригоден для осуществления настоящего изобретения.

Однако в альтернативных вариантах осуществления изобретения для мечения ампликона могут использоваться радиоактивные или нерадиоактивные метки. Пригодные радиоактивные метки включают 32Р и 3Н. Эти метки могут быть включены в ампликон и/или праймер с использованием любого подходящего средства. Может также использоваться диапазон способов нерадиоактивного мечения. Иллюстративные способы нерадиоактивного мечения, которые никоим образом не ограничивают настоящее изобретение, представлены в документе Speel (Histochem. Cell Biol. 112: 89-113, 1999).

Используемый в настоящем описании термин «реагент» следует понимать как охватывающий полинуклеотид, иммобилизованный на грануле. Конкретнее, каждый реагент содержит полинуклеотид, включающий последовательность, которая комплементарна ампликону, генерированному в соответствии со способами, раскрытыми в настоящем описании, который связан или иным образом ассоциирован с гранулой, отличаемой физическими и химическими способами. Реагент может также содержать последовательность, которая комплементарна контрольной последовательности, как определено выше в настоящем описании, т.е. последовательности, амплифицированной из генома многоклеточного организма (Z), или ампликону нуклеотидной последовательности, которая является консервативной среди штаммов анализируемого возбудителя (Y).

Соответственно, набор гранул реагента может содержать

[B1-cX1, B2-cX2, B3-cX3... Bπ-cXn, By-cY, Bz-cZ]

где

каждая из B1...Bn, By, Bz представляет гранулы, отличаемые физическими и химическими способами;

cXn представляет полинуклеотид, иммобилизованный на грануле, где указанный полинуклеотид содержит нуклеотидную последовательность, которая является комплементарной определенной последовательности нуклеиновой кислоты, которая специфична для анализируемого возбудителя или конкретного штамма обсуждаемого анализируемого возбудителя, и где n представляет количество анализируемых возбудителей или конкретных штаммов обсуждаемого анализируемого возбудителя, подлежащего выявлению с использованием набора гранул;

cY обозначает необязательного члена набора гранул и представляет полинуклеотид, иммобилизованный на грануле, где указанный полинуклеотид содержит нуклеотидную последовательность, которая комплементарна последовательности, которая является консервативной среди анализируемых возбудителей или штаммов обсуждаемого анализируемого возбудителя;

cZ обозначает необязательного члена набора гранул и представляет полинуклеотид, иммобилизованный на грануле, где указанный полинуклеотид содержит нуклеотидную последовательность, которая комплементарна контрольной последовательности, которая амплифицирована от многоклеточного субъекта.

Предпочтительно, обсуждаемый анализируемый возбудитель представляет собой HPV, а контрольная последовательность ДНК представляет собой последовательность геномной ДНК человека.

Под термином «комплементарный» следует понимать, что иммобилизованный полинуклеотид реагента должен гибридизироваться с ампликоном, генерированным в соответствии со способами, раскрытыми в настоящем описании, в условиях низкой строгости их соблюдения. Предпочтительно, иммобилизованный полинуклеотид должен связываться с образцом и стандартом в условиях средней строгости их соблюдения, а наиболее предпочтительно, иммобилизованный полинуклеотид должен связываться с образцом и стандартом в условиях высокой строгости их соблюдения.

Ссылка в настоящем описании на условия низкой строгости их соблюдения включает и охватывает, по меньшей мере, от примерно 0 до, по меньшей мере, примерно 15% об./об. формамида (включая 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% и 14% об./об. формамида) и, по меньшей мере, от примерно 1 М до, по меньшей мере, примерно 2 М соли для гибридизации, и, по меньшей мере, от примерно 1 М до, по меньшей мере, примерно 2 М соли для условий промывания. В целом условия низкой строгости их соблюдения представляют собой температуру от примерно 25-30ºС примерно до 52 С, например, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 и 52ºС. Температура может быть изменена и более высокая температура использована для замещения формальдегида или для обеспечения альтернативных условий строгости их соблюдения. При необходимости могут применяться альтернативные условия строгости их соблюдения, такие как средняя строгость соблюдения этих условий, которая включает и охватывает, по меньшей мере, от примерно 16% об./об. до, по меньшей мере, примерно 30% об./об. формамида (включая 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29% и 30% об./об. формамида) и, по меньшей мере, от примерно 0,5 М до, по меньшей мере, примерно 0,9 М соли для гибридизации, и, по меньшей мере, от примерно 0,5 М до, по меньшей мере, примерно 0,9 М соли для условий промывания, или условий высокой строгости, которые включают и охватывают, по меньшей мере, от примерно 31% об./об. до, по меньшей мере, примерно 50% об./об. формамида и, по меньшей мере, от примерно 0,01 М до, по меньшей мере, примерно 0,15 М соли для гибридизации, и, по меньшей мере, от примерно 0,01 М до, по меньшей мере, примерно 0,15 М соли для условий промывания. В целом промывание проводится при Tm = 69,3+0,41 (G+C)% (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). Однако Tm дуплексной ДНК уменьшается на 1ºС при каждом увеличении на 1% числа ошибочных спариваний оснований (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974). При этих условиях гибридизации формамид необязателен. Соответственно, особенно предпочтительные уровни строгости соблюдения условий определяются следующим образом: низкая строгость представляет 6 × буфер SSC, 0,1% масс./об. SDS при 25-42ºС; умеренная строгость представляет 2 × буфер SSC, 0,1% мас./об. SDS при температуре в диапазоне от 20ºС до менее чем 65ºС; высокая строгость представляет 0,1 × буфер SSC, 0,1% мас./об. SDS при температуре, по меньшей мере, 65ºС.

Каждая из B1...Bn, By, Bz наборов гранул реагента представляет гранулы, различаемые физическими и химическими способами. Термин «различаемые физическими и химическими способами» относятся к любой физической или химической характеристике, которая обеспечивает возможность различения одной гранулы, например В1, и другой гранулы, например В2. Соответственно, гранулы, различаемые физическими и химическими способам, обеспечивают возможность различения конкретных реагентов.

В определенных предпочтительных вариантах осуществления гранула содержит «микрочастицу». Как будет очевидно для специалистов в данной области, для микрочастицы может использоваться почти любой материал, однородный или иной. Микрочастицы, предусмотренные в настоящем изобретении, могут также содержать несколько веществ и, по существу, могут включать оболочки, сплавы или смеси органических и/или неорганических веществ. Особенно полезные материалы, которые могут использоваться в соответствии с настоящим изобретением, и которые представляют предпочтительные варианты осуществления настоящего изобретения, включают материалы, выбранные из перечня, состоящего из диоксида кремния (например, кварца или стекла), латекса, титана, диоксида олова, иттрия, алюминия, и других бинарных оксидов металлов (таких как ZnO), перовскитов и других пьезоэлектрических оксидов металлов (таких как BaTiO3), ZnS, сахарозы, агарозы и других полимерных гранул. В особенно предпочтительном варианте осуществления микрочастица содержит диоксид кремния.

В некоторых предпочтительных вариантах осуществления термин «различаемые физическими и химическими способами» относится к измеряемому различию размера любой из гранул, присутствию или отсутствию определенной оптически выявляемой метки и/или интенсивности оптически выявляемой метки.

Гранулы, предусмотренные настоящим изобретением, могут быть получены любой подходящей правильной или неправильной трехмерной формы. Однако в целом можно синтезировать небольшие сферы или сфероидные частицы. Такие сферы или сфероидные частицы также именуются в настоящем описании «гранулами». Соответственно, в предпочтительных вариантах осуществления настоящего изобретения «микрочастицы» по настоящему изобретению являются по существу сферическими или сфероидными или содержат «микросферу».

Хотя гранулы по настоящему изобретению могут именоваться «микросредами», действительный размер частиц зависит от разнообразных факторов, и частицы могут в действительности иметь размеры в микрометрическом диапазоне. В некоторых предпочтительных вариантах осуществления гранула имеет диаметр (или эквивалентное измерение у несфероидной частицы) от примерно 300 нм до примерно 30 мкм, включая 300 нм, 350 нм, 400 нм, 450 нм, 500 нм, 550 нм, 600 нм, 650 нм, 700 нм, 750 нм, 800 нм, 850 нм, 900 нм, 950 нм, 1,0 мкм, 1,1 мкм, 1,2 мкм, 1,3 мкм, 1,4 мкм, 1,5 мкм, 1,6 мкм, 1,7 мкм, 1,8 мкм, 1,9 мкм, 2,0 мкм, 2,1 мкм, 2,2 мкм, 2,3 мкм, 2,4 мкм, 2,5 мкм, 2,6 мкм, 2,7 мкм, 2,8 мкм, 2,9 мкм, 3,0 мкм, 3,1 мкм, 3,2 мкм, 3,3 мкм, 3,4 мкм, 3,5 мкм, 3,6 мкм, 3,7 мкм, 3,8 мкм, 3,9 мкм, 4,0 мкм, 4,1 мкм, 4,2 мкм, 4,3 мкм, 4,4 мкм, 4,5 мкм, 4,6 мкм, 4,7 мкм, 4,8 мкм, 4,9 мкм, 5,0 мкм, 5,1 мкм, 5,2 мкм, 5,3 мкм, 5,4 мкм, 5,5 мкм, 5,6 мкм, 5,7 мкм, 5,8 мкм, 5,9 мкм, 6,0 мкм, 6,1 мкм, 6,2 мкм, 6,3 мкм, 6,4 мкм, 6,5 мкм, 6,6 мкм, 6,7 мкм, 6,8 мкм, 6,9 мкм, 7,0 мкм, 7,1 мкм, 7,2 мкм, 7,3 мкм, 7,4 мкм, 7,5 мкм, 7,6 мкм, 7,7 мкм, 7,8 мкм, 7,9 мкм, 8,0 мкм, 8,1 мкм, 8,2 мкм, 8,3 мкм, 8,4 мкм, 8,5 мкм, 8,6 мкм, 8,7 мкм, 8,8 мкм, 8,9 мкм, 9,0 мкм, 9,1 мкм, 9,2 мкм, 9,3 мкм, 9,4 мкм, 9,5 мкм, 9,6 мкм, 9,7 мкм, 9,8 мкм, 9.9 мкм, 10 мкм, 11 мкм, 12 мкм, 13 мкм, 14 мкм, 15 мкм, 16 мкм, 17 мкм, 18 мкм, 19 мкм, 20 мкм, 21 мкм, 22 мкм, 23 мкм, 24 мкм, 25 мкм, 26 мкм, 27 мкм, 28 мкм, 29 мкм, 30 мкм. Предпочтительнее, гранула имеет диаметр (или эквивалентное измерение у несфероидной частицы) от 1 мкм до 10 мкм.

В одном особенно предпочтительном варианте осуществления гранулы представляют собой AmpaSand (торговая марка: Genera Biosystems), выпускаемые Genera Biosystems. Эти гранулы имеются в продаже и описаны на сайте www.generabiosystems.com/generabiosystems/technology/AmpaSandBeads/. Однако настоящее изобретение ни в коей мере не следует рассматривать как ограничивающееся применением конкретно этих гранул.

Гранулы могут различаться на основании присутствия или отсутствия одной или нескольких «оптически выявляемых меток». Обычно конкретная гранула может содержать 0, 1, 2, 3, 4, 5 оптически выявляемых меток. Используемый в настоящем описании термин «оптически выявляемая метка» относится к любой молекуле, атому или иону, который испускает флуоресценцию, фосфоресцирование и/или температурное свечение. Подходящие оптически выявляемые метки включают метки, которые испускают излучение в диапазонах длины волны: в ультрафиолетовом спектре (диапазон длины волны от примерно 350 нм до примерно 3 нм), видимом спектре (диапазон длины волны от примерно 350 нм до примерно 800 нм), почти в инфракрасном спектре (NIR) (диапазон длины волны от примерно 800 нм до примерно 1500 нм) и/или в инфракрасном спектре (IR) (диапазон длины волны от примерно 1500 нм до примерно 10 мкм). Однако, ввиду легкости выявления, в одном особенно предпочтительном варианте осуществления оптически выявляемая метка может быть выявлена в диапазоне видимого спектра длины волны.

В других предпочтительных вариантах осуществления обсуждаемого изобретения оптически выявляемая метка содержит одну или несколько меток, выбранных из перечня, состоящего из флуорофора, частицы полупроводника, частицы люминофора, частицы с присадкой или нанокристаллической или квантовой точки.

В некоторых особенно предпочтительных вариантах осуществления обсуждаемого изобретения оптически выявляемая метка представляет собой флуорофор. Используемый в настоящем описании термин «флуорофор» относится к любой молекуле, которая проявляет свойство флуоресценции. В целях настоящего изобретения термин «флуоресценция» может быть определен как свойство молекулы абсорбировать световое излучение определенной длины волны и повторно испускать свет с большей длиной волны. Изменение длины волны относится к потере энергии, которая происходит в этом процессе. Термин «флуорофор» может охватывать диапазон оптически выявляемых меток, таких как химические флуорофоры и красители, а также квантовые точки.

Особенно подходящие оптически выявляемые метки, которые могут использоваться в соответствии с настоящим изобретением, представляют собой залитые флуоресцентные частицы полупроводников. Эти частицы оптически выявляемой метки могут быть настолько маленькими, чтобы их свойства и эмиссия становились зависимыми от размера. Такие мелкие частицы оптически выявляемой метки именуются в данной области наночастицами полупроводника, квантовыми точками, квантовыми проводами, квантовыми стержнями или нанокристаллами или Q-частицами. Однако используемый в настоящем описании термин «квантовая точка», или QD, следует понимать как охватывающий все такие частицы. Кроме того, оптически выявляемые метки, содержащие QD, могут содержать приблизительно сферические или сфероидные частицы, или покрытые сферические или сфероидные частицы. Однако не следует считать, что термин «QD» каким-то образом ограничивается сферической, сфероидальной, круговой, цилиндрической или любой другой морфологией «точки». Например, используемый в настоящей описании термин «QD» может также включать другие морфологии, включая, наряду с другими, подобные стержню, эллипсоидные или покрытые подобные стержню или эллипсоидные частицы.

QD состоят из кристаллической сердцевины нанометрической шкалы полупроводникового материала; биологически активные варианты обычно окружены защитной оболочкой и наружным покрытием. Например, QD могут содержать кристаллиты полупроводника, которые имеют диаметр от примерно 2 нм до примерно 30 нм и могут содержать приблизительно 50-500000 атомов внутри кристалла, включая люминесцентные кристаллы, содержащие такие материалы, как ZnS, ZnSe, ZnTe, CdS, CdSe, CdTe, PbS, PbSe, PbTe, HgS, HgSe, HgTe, Si, ZnO.

QD флюоресцируют с широким спектром поглощения и узким спектром эмиссии. В отличие от некоторых других флуорофоров, которые имеют различимые спектры поглощения, QD поглощают свет по широкому спектральному диапазону, что обеспечивает возможность возбуждения квантовых точек диапазоном источников света, таких как лазеры, дуговые лампы или LED. Кроме того, коллекция различных QD может использоваться при мультиплексных видах применения с использованием только одного источника возбуждения. Однако спектры эмиссии для каждой точки являются обычно очень узкими, порядка примерно 30 нм, причем точный цвет зависит от диаметра и состава частицы. Кроме того, узкий спектр эмиссии QD обеспечивает возможность спектрального разрешения соседних точек. В дополнение к описанным выше преимуществам QD также являются относительно фотостойкими, даже во время интенсивного возбуждения и являются более яркими, чем флуорофоры.

В свете изложенного выше следует понимать, что настоящее изобретение охватывает применение QD различных размеров.

Кроме того, настоящее изобретение предусматривает QD, которые обработаны такими процедурами, как термическая обработка, модификация поверхности, сплавление, пассивация или кэппинг поверхности покрытиями поверхности для обеспечения QD возможности испускания с высоким квантовым выходом и для увеличения световой устойчивости в течение длительных периодов времени.

QD также выпускаются такими компаниями, как Quantum Dot Corp. (QDC), которая производит такие QD, как конъюгат стрептовидина Qdot [торговая марка] 605, содержащий кадмиево-селенидную сердцевину, которая излучает при 605 нм. Имеются также конъюгаты Qdot, которые излучают при 525, 565, 585 и 655 нм. Однако следует понимать, что настоящее изобретение никоим образом не ограничивается определенным составом QD (или любой оптически выявляемой метки), и с настоящим изобретением может быть совместима любая QD (выпускаемая промышленностью или из других источников).

В данной области имеется также много флуоресцентных красителей, которые могут использоваться в качестве флуорофоров в соответствии с настоящим изобретением. Важным свойством флуоресцентного красителя или другого флуорофора, которое определяет возможность его применения, является длина волны возбуждения флуорофора; она должна подходить для доступных длин волн источника света. Однако специалистам в данной области будут известны многие другие флуоресцентные красители и другие флуорофоры, и выбор флуоресцентного маркера ни в коей мере не ограничивает обсуждаемое изобретение. Особенно подходящие флуоресцентные красители, которые могут применяться для мечения подложки, включают те, которые обсуждены выше, в отношении мечения ампликона PCR. Однако при выборе флуоресцентных меток спектр излучения флуоресцентной метки, используемой для связывания агента(ов), должен отличаться от спектра излучения метки, используемой для ампликона(ов).

Для флуоресцентной метки гранул и микросфер обычно используются две методики окрашивания - внутреннее окрашивание и наружное окрашивание (мечение поверхности). Эти две методики дают гранулы с необычными свойствами, каждое из которых благоприятно для различных видов применения. Внутреннее окрашивание дает крайне устойчивые частицы с обычно узкими спектрами флюоресцентного излучения. Эти гранулы часто проявляют более выраженную устойчивость к фотоотбеливанию. Поскольку флуорофор находится внутри гранул, поверхностные группы доступны для использования при конъюгировании лигандов (белков, антител, нуклеиновых кислот и т.д.) с поверхностью гранулы. По этой причине внутренне меченные гранулы обычно используются при выявлении анализируемых веществ и иммуноанализе. Поверхностное мечение включает конъюгирование флуорофора с поверхностью гранулы. Ввиду того, что флуорофоры находятся на поверхности гранулы, они способны взаимодействовать со своей средой именно как флуорофоры на окрашенной клетке. В результате получается стандарт гранулы, который проявляет такие же свойства возбуждения и излучения как образцы окрашенных клеток, в разнообразных различных условиях, таких как присутствие загрязнителей или изменения рН. «Реагирующая на окружающую среду» природа поверхностно меченных гранул делает их идеально подходящими для имитации биологических образцов. Внешне меченные гранулы часто используются в качестве контролей и стандартов при ряде видов применения с использованием выявления флуоресценции. Однако настоящее изобретение предусматривает связь гранулы с флуоресцентной меткой через любое средство.

В настоящем описании термины «фосфоресцирующие гранулы», «люминофорные гранулы» и «люминофоры» используются взаимозаменяемо. То, что составляет фосфоресцирующую оптически выявляемую метку должно быть вполне понятно специалисту в данной области. Однако, в качестве примера, который ни в коей мере не ограничивает изобретение, подходящие люминофоры включают мелкие частицы ZnS, ZnS:Cu, оксида Eu и другие люминофоры, используемые в дисплеях.

Оптически выявляемая метка, содержащая «гранулу с присадкой», может включать частицу, которая содержит поглощенные количества одного или нескольких ионов редкоземельных металлов, таких как Eu, Y, Yb, Sm и т.п.

Следует понимать, что используемый в настоящем описании термин «оптически выявляемая метка» охватывает множественные оптически выявляемые метки, смеси оптически выявляемых меток, покрытые нанокристаллы, сплавы и другие сложные смеси, которые должны быть очевидны для специалиста в данной области. Использование всех таких оптически выявляемых меток должно считаться включенным в пределы объема описанных в настоящей заявке способов и агентов.

Кроме того, оптически выявляемая метка реагента может содержать оптически выявляемую метку, включенную в иммобилизованную полинуклеотидную последовательность, которая связана или иным образом ассоциирована с гранулой, а не является меткой, непосредственно ассоциированной с самой гранулой.

Гранулы в целом мечены иммобилизованным «ярлыком» или олигонуклеотидом зонда. Этот ярлык несет внутренний амин (NH2), который затем модифицируется конъюгированием со сложным сукцинимидильным эфиром красителя. В текущем наборе используемый краситель представляет собой BODIPY-TMR. Путем смешивания меченых и немеченых ярлыков и затем конъюгирования этой смеси с гранулами можно получить классы гранул с различными уровнями флуоресцентных маркеров. Обычно используемые соотношения находятся в ряду 1:5х; т.е. различные классы получаются использованием отношения немеченых к меченым ярлыкам. Это генерически иллюстрируется ниже в таблице 4.

Таблица 4
Отношение немеченых к меченым ярлыкам
Класс Относительное количество немеченых ярлыков Относительное количество меченых ярлыков
Все 0 Все
Нет Все 0
1/5 5 1
1/25 25 1
1/125 125 1

Оптически выявляемая метка может наноситься на гранулы в диапазоне концентраций или интенсивностей, посредством этого обеспечивая другую основу, на которой определенные гранулы могут быть «различаемы физическими и химическими способами». Например, если максимальная выявляемая интенсивность сигнала определенной оптически выявляемой метки считается составляющей 100%, то метка может наноситься на диапазоне гранул для получения величин интенсивности 0%, 2%, 4%, 6%, 8%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%.

В одном варианте осуществления набор гранул реагентов содержит гранулы диаметром 3,0 мкм, 3,5 мкм, 4,1 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм, где гранулы диаметром 3,0 мкм, 3,5 мкм и 4,1 мкм являются мечеными на 0% и 100%, гранулы диаметром 5,0 мкм являются мечеными на 0%, 100% и 20% и гранулы диаметром 5,6 мкм и 6,8 мкм являются мечеными на 0%, 100%, 20% и 4%.

В другом варианте осуществления набор гранул реагента содержит гранулы диаметром 3,0 мкм, 3,5 мкм, 3,77 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм. Все размеры гранул (за исключением 3,0 мкм, который делится на нулевой уровень и высокий уровень TMR), делятся в соответствии с их соответствующим нулевым уровнем, средним уровнем и высоким уровнем TMR.

В других вариантах осуществления уровни TMR устанавливаются так, что во время конъюгирования гранулы с олигонуклеотидом используются олигонуклеотиды с определенными отношениями общего количества олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам для определения дискретных группировок TMR. Например, нулевые уровни TMR имеют немеченые олигонуклеотиды, включенные в конъюгаты; высокие уровни TMR имеют отношение общего количества олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам 3:1 олигонуклеотидов, включенных в конъюгаты; и средние уровни TMR имеют отношение общего количества олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам от 150:1 до 80:1 олигонуклеотидов, включенных в конъюгаты, в зависимости от размера гранул.

Компонент иммобилизованного полинуклеотида реагента, например, cXn, cY и/или cZ, может быть связан с гранулами с использованием любого подходящего средства.

Иммобилизованный полинуклеотид может быть инкапсулирован в гранулы во время их получения или может быть прикреплен к их поверхности после получения. Способ выбора, используемый для ассоциации полинуклеотида к гранулам, будет зависеть от используемого материала, как вполне понятно специалисту в данной области. Кроме того, на гранулах перед прикреплением полинуклеотида могут выполняться другие виды обработки, включая силанизацию (покрытие подложки силанами) для увеличения связывания указанного полинуклеотида с гранулами.

В целом гранулы могут быть покрыты любым соединением, которое ковалентно присоединяется или иным образом адсорбируется к поверхности гранулы, и, кроме того, реагент должен также иметь химическую часть для присоединения полинуклеотида, такую часть, как тиол, амин или карбоксильную группу. Неограничивающие примеры соединений с этими характеристиками включают силаны с аминоконцами, такие как аминопропилтриметоксисилан и аминопропилтриэтоксисилан, а также силаны с тиоловыми концами, такие как тиопропилтриметоксисилан и тиопропилтриэтоксисилан. В дополнение к силанам, соединения, такие как поли-L-лизин, которые нековалентно присоединяются к стеклянной поверхности и электростатически адсорбируют фосфатные группы полинуклеотида, также входят в объем настоящего изобретения. Поэтому специалист в данной области может легко идентифицировать другие соединения, включая другие силаны, подходящие для присоединения полинуклеотида к поверхности, и настоящее изобретение не ограничивается выбором соединения.

Полинуклеотид может быть прикреплен к грануле с использованием любого подходящего средства; обычно это осуществляется физической адсорбцией или химическим связыванием. Кроме того, гранулы могут быть покрыты агентом, который содействует или увеличивает адсорбцию или связывание полинуклеотида к поверхности гранулы, таким как аминосиланы. Однако специалисты в данной области легко идентифицируют другие агенты, которые выполняют эту функцию. В некоторых других вариантах осуществления полинуклеотид ковалентно конъюгирован с гранулами олигоакрилитной группой, взаимодействующей с тиольной группой гранулы.

В другом варианте осуществления молекула нуклеиновой кислоты связана с гранулам и через систему Universal Anchoring System (UAS) (торговая марка: Genera Biosystems). Вкратце, эта система включает применение «мостиковой» молекулы нуклеиновой кислоты для лигирования последовательности-«ярлыка» нуклеиновой кислоты на подложке с последовательностью-мишенью. «Мостиковая» последовательность частично комплементарна последовательности-ярлыку и частично комплементарна последовательности-мишени, так что мостиковая последовательность может связываться и с последовательностью-ярлыком, и с последовательностью-мишенью и удерживать их в совмещении с тем, чтобы последовательность-ярлык и последовательность-мишень могли лигироваться с использованием лигазы. UAS также выпускается промышленностью и описан в деталях на сайте Интернета www.generabiosystems.com/generabiosystems/technology/UAS/. Однако настоящее изобретение ни в коей мере не следует рассматривать как ограниченное этим конкретным способом связывания молекулы нуклеиновой кислоты с подложкой.

Определение того, произошло ли связывание между ампликоном и реагентом, можно осуществить с использованием любой методологии, которая обеспечивает возможность определения локализации связанной метки ампликона в определенном различаемом физическими и химическими методами реагенте. В особенно предпочтительном варианте осуществления используется проточная цитометрия.

Проточная цитометрия может быть определена как технология измерения свойств частиц или клеток во время их движения или потока в жидкой суспензии. Для дополнительного описания этой технологии аналогия может быть проведена с более знакомым предметом лабораторного оборудования, микроскопом. Большинство микроскопов имеют следующие компоненты:

Источник света

В типичном микроскопе используется электрическая лампочка для освещения объекта. В проточном цитометре источником света часто является лазер. Лазеры используются потому, что они обеспечивают очень концентрированный и интенсивный луч монохроматического света. Монохроматический характер света особенно важен при осуществлении измерений флуоресценции.

Предметный столик

В микроскопе предметный столик подвижен для обеспечения возможности продвижения объекта через поле зрения линзы объектива. В проточном цитометре клетки или частицы существуют в жидкой суспензии. В ответ на давление воздуха жидкость течет мимо линзы объектива, таким образом пронося клетки или частицы через поле зрения.

Линза

И в микроскопе, и в проточном цитометре линза собирает свет от объекта.

Фильтры

В некоторых микроскопах имеются фильтры для выбора тех характеристик света, которые наиболее важны для наблюдателя. Это особенно справедливо для флуоресцентных микроскопов. При флуоресценции молекулы красителя возбуждаются светом характерной длины волны, которые затем продуцируют испускаемый свет с большей длиной волны. Фильтры удаляют возбуждающий свет для обеспечения возможности излучения видимого или измеряемого света.

Детекторы

В микроскопе детектором света является наблюдатель. В проточном цитометре используются высокочувствительные детекторы света, называемые фотоэлектронными умножителями (РМТ). Детекторы могут быть способны измерять кратковременные вспышки испускаемого света от клеток или частиц, которые движутся по одной через поле зрения линзы объектива со скоростями до нескольких тысяч в секунду.

Большинство проточных цитометров могут измерять и рассеивание света, и флуоресценцию.

В определенных предпочтительных вариантах осуществления гранулы выявляются и/или сортируются в соответствии со способами по настоящему изобретению с использованием проточной цитометрии. Однако настоящее изобретение никоим образом не ограничивается описанным выше в настоящей заявке конкретным способом или прибором проточной цитометрии. Этот пример был представлен только в целях иллюстрации, и настоящее изобретение не должно ограничиваться прибором или способом в соответствии с представленным примером.

При использовании проточной цитометрии рассеиванием света объектом можно определить размер данной гранулы.

Рассеивание света представляет собой взаимодействие света и вещества. Все материалы, включая гранулы, рассеивают свет. Он состоит в основном из света, который отражается или преломляется. Положение, с которого осматривается объект, часто определяет то, что можно о нем сказать. В проточном цитометре детекторы рассеивания света обычно располагаются напротив лазера (относительно клетки или частицы) и к одной стороне лазера, в линию с пересечением потока жидкости/лазерного луча. Измерения, произведенные этими детекторами, называются соответственно прямым рассеиванием света и боковым рассеиванием света.

Прямое рассеивание света предоставляет некоторую информацию об относительном размере отдельных клеток или частиц, тогда как боковое рассеивание света предоставляет некоторую информацию об относительной зернистости отдельных гранул. Они часто используются в комбинации для дифференциации различных основных категорий лейкоцитов в несепарированной крови млекопитающих, но их можно также применять в широком разнообразии других анализов, таких как определение размера микрочастицы.

Заявители определили, что проточная цитометрия способна различать гранулы диаметром примерно 3,0 мкм, примерно 3,5 мкм, примерно 4,1 мкм, примерно 5,0 мкм, примерно 5,6 мкм и примерно 6,8 мкм. Заявители также определили, что проточная цитометрия способна различать гранулы диаметром примерно 3,0 мкм, примерно 3,5 мкм, примерно 3,77 мкм, примерно 5,0 мкм, примерно 5,6 мкм и примерно 6,8 мкм. Могут различаться еще одни классы гранул, такие как 5,9 и 5,6; и 5,6 и 6,8. Соответственно, заявители идентифицировали, что проточная цитометрия может дифференцировать до 6 различных размеров гранул.

В дополнение к выявлению размера проточные цитометры обычно имеют один или несколько лазеров и детекторов для выявления флуоресценции в образце. Флуоресценция представляет собой свойство молекулы для поглощения света определенной длины волны и повторного излучения света большей длины волны. Изменение длины волны относится к потере энергии, которая имеет место в процессе. Это характеристика, которая делает флуоресценцию очень полезной: фильтры могут использоваться для исключения света от детектора света или наблюдателя. Таким образом, единственный измеряемый или видимый свет исходит от флуорофора. Интерференция от фонового или рассеянного светового излучения, попадающих в детектор, крайне низка.

Имеется много флуоресцентных красителей, которые используются для проточной цитометрии. Они связываются с разнообразными цитохимическими компонентами, такими как нуклеиновые кислоты; белки; специфические рецепторы клеточной мембраны, ядра и цитоплазмы; внутриклеточные ионные молекулы и многие другие. Ключевое свойство флуоресцентного красителя, которое определяет возможность его применения в проточном цитометрическом анализе, представляет собой длину волны возбуждения, т.е. она должна подбирать имеющиеся длины волны источника света.

В других аспектах настоящее изобретение относится к способам диагностики инфекции патогенным анализируемым возбудителем у субъекта, причем указанный способ включает стадии

(i) получения биологического образца у субъекта, который предположительно содержит указанный патогенный анализируемый возбудитель;

(ii) выделения нуклеиновой кислоты из указанного образца;

(iii) амплификации нуклеиновой кислоты из указанного образца с использованием праймеров, которые генерируют ампликон, который отличен от указанного анализируемого возбудителя или определенного штамма указанного анализируемого возбудителя;

(iv) необязательно, амплификации контрольной последовательности нуклеиновой кислоты от субъекта;

(v) необязательного осуществления мечения ампликона(ов), указанных на стадиях (iii) и/или (iv);

(vi) гибридизации меченого ампликона(ов) в набор гранул, покрытых реагентами, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности анализируемого возбудителя или определенного штамма анализируемого возбудителя или контрольной нуклеотидной последовательности, связанной или иным образом ассоциированной с физико-химически различаемыми гранулами; и

(vii) определения, с каким из реагентов связался ампликон;

где ассоциация ампликона с определенным реагентом указывает на инфекцию анализируемым возбудителем у субъекта.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной сигнальной олигонуклеотидной последовательности.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной блокирующей олигонуклеотидной последовательности.

Используемый в настоящем описании термин «субъект» относится к любому организму, который может быть восприимчивым к инфекции другим анализируемым возбудителем. По существу, «субъект» включает, без ограничения, животных, растения, грибы и бактерии (которые могут быть инфицированы бактериофагом). Используемый в настоящем описании термин «животное» предпочтительно включает млекопитающее, а предпочтительнее, примата, включая низшего примата, а еще предпочтительнее, человека. Однако термин «животное» также, в частности, включает виды скота, такие как крупный рогатый скот, лошади, овцы, свиньи, козы и ослы, а также лабораторных животных. Примеры лабораторных тестируемых животных включают мышей, крыс, кроликов, морских свинок и хомячков. Кролики и грызуны, такие как крысы и мыши, обеспечивают удобную систему тестирования или экспериментальную модель, какой являются приматы и низшие приматы. Предусматриваются также животные, не являющиеся млекопитающими, такие как виды птиц, вид рыбы полосатая перцина, земноводные (включая камышовых жаб) и вид насекомых Drosophila melanogaster.

«Субъект» может также представлять собой не животное, например растение. Термин «растение», в частности, включает растения сельскохозяйственного значения, такие как злаковые растения (например, пшеницу, ячмень, овес, рожь, гибрид пшеницы и ржи и маис), рис, фруктовые деревья (например, яблони, бананы, манго и апельсины), сахарный тростник, огородные культуры (например, картофель, морковь и лук) и т.п.

Однако в определенных предпочтительных вариантах осуществления настоящее изобретение относится к способам диагностики инфекции HPV у человека, причем указанный способ включает стадии

(i) получения биологического образца, который предположительно содержит HPV, у человека;

(ii) выделения нуклеиновой кислоты из указанного образца;

(iii) амплификации нуклеиновой кислоты из указанного образца с использованием праймеров, которые генерируют ампликон, который отличен для указанного анализируемого возбудителя или определенного штамма указанного анализируемого возбудителя;

(iv) необязательно, амплификации контрольной последовательности нуклеиновой кислоты из геномной ДНК человека;

(v) необязательно осуществления мечения ампликона(ов), указанных на стадиях (iii) и/или (iv);

(vi) гибридизации меченого ампликона(ов) в набор гранул реагентов, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности HPV или контрольной последовательности нуклеиновой кислоты, связанной или иным образом ассоциированной с различаемыми физико-химическими методами гранулами; и

(vii) определения, с каким реагентом связался ампликон;

где ассоциация ампликона с определенным реагентом указывает на инфекцию HPV у человека.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной сигнальной олигонуклеотидной последовательности.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной блокирующей олигонуклеотидной последовательности.

В некоторых аспектах настоящее изобретение также предусматривает способы определения риска развития у человека заболевания, связанного с одним или несколькими штаммами HPV, причем указанный способ включает стадии

(i) получения биологического образца, который предположительно содержит HPV, у человека;

(ii) выделения нуклеиновой кислоты из указанного образца;

(iii) амплификации нуклеиновой кислоты из указанного образца с использованием праймеров, которые генерируют ампликон, который отличен для указанного анализируемого возбудителя или определенного штамма указанного анализируемого возбудителя;

(iv) необязательно, амплификации контрольной последовательности нуклеиновой кислоты из геномной ДНК человека;

(v) необязательно осуществления мечения ампликона(ов), указанных на стадиях (iii) и/или (iv);

(vi) гибридизации меченого ампликона(ов) в набор гранул реагентов, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности HPV или конкретного штамма HPV или контрольной нуклеотидной последовательности, связанной или иным образом ассоциированной с различаемыми физическими или химическими методами подложкой; и

(vii) определения, с каким реагентом связался ампликон;

где ассоциация ампликона с определенным реагентом, содержащим полинуклеотид, который комплементарен штамму HPV, ассоциированному с определенным заболеванием, указывает на повышенный риск развития указанного заболевания у субъекта.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной сигнальной олигонуклеотидной последовательности.

В других аспектах гибридизация происходит в присутствии, по меньшей мере, одной блокирующей олигонуклеотидной последовательности.

Когда мечение ампликонов происходит, как указано в части (v), то метятся и ампликоны, и гранулы.

Иллюстративные заболевания, связанные с одним или несколькими определенными штаммами HPV, включают те, которые представлены в таблице 3. Соответственно, в некоторых аспектах настоящее изобретение относится к способам диагностики повышенного риска развития определенного заболевания у субъекта специфической идентификацией того, какой штамм HPV инфицирует субъекта. В определенных особенно предпочтительных вариантах осуществления способы адаптированы для определения риска развития рака шейки матки у человека.

Настоящее изобретение, кроме того, предусматривает диагностические наборы для применения в соответствии со способами, описанными в настоящей заявке, включая диагностику инфекции HPV у человека и/или оценку риска развития у человека заболевания, связанного с HPV, включая рак шейки матки. Наборы включают набор гранул реагентов, каждый из которых содержит полинуклеотид, который комплементарен нуклеотидной последовательности определенного штамма HPV, связанной или другим образом ассоциированной с различаемой физическими и химическими методами подложкой. Необязательно, наборы могут также содержать праймеры, которые связываются с консервативными последовательностями среди различных штаммов HPV, но генерируют ампликон, который содержит отличительную нуклеотидную последовательность для каждого штамма HPV, где генерированный ампликон предположительно комплементарен полинуклеотиду, связанному или иным образом ассоциированному с одним или несколькими различаемыми физически и химическими методами гранулами набора.

В некоторых вариантах осуществления наборы гранул реагентов содержат, по меньшей мере, группу гранул, каждая из которых имеет любой диаметр из примерно 3,0 мкм, примерно 3,5 мкм, примерно 4,1 мкм, примерно 5,0 мкм, примерно 5,6 мкм и примерно 6,8 мкм. В еще одном предпочтительном варианте осуществления группа гранул каждого размера содержит одну или несколько подгрупп микрогранул, каждую с флуоресцентной меткой в диапазоне различных интенсивностей. Флуоресцентная метка представляет собой TMR и может наноситься при интенсивностях примерно 0%, примерно 4%, примерно 20% и примерно 100%.

В других вариантах осуществления наборы гранул реагентов содержат, по меньшей мере, группу гранул, каждая из которых имеет любой диаметр из примерно 3,0 мкм, примерно 3,5 мкм, примерно 3,77 мкм, примерно 5,0 мкм, примерно 5,6 мкм и примерно 6,8 мкм. Уровни TMR установлены так, чтобы во время конъюгации гранулы с олигонуклеотидом, использовались олигонуклеотиды с определенными отношениями общего содержания олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам для определения дискретных группировок TMR. Например, нулевые уровни TMR имеют немеченые олигонуклеотиды, включенные в конъюгаты; высокие уровни TMR имеют отношение общего количества олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам 3:1 олигонуклеотидов, включенных в конъюгаты; и средние уровни TMR имеют отношение общего количества олигонуклеотидов к меченным флуоресцентной меткой олигонуклеотидам от 150:1 до 80:1 олигонуклеотидов, включенных в конъюгаты, в зависимости от размера гранул.

В других вариантах осуществления наборы содержат праймеры GP5+ и GP6+ и, необязательно, праймеры MLCI_F MLCI_R.

В других вариантах осуществления наборы содержат праймеры GP5d2+ и T7aGP6d+ и, необязательно, праймеры mlcI_95f и T7amlcI_275r.

В еще одних вариантах осуществления наборы содержат праймеры GP5d3+ и T7aGP6d+* и, необязательно, праймеры mlcI_95f и T7amlcI_275r.

Настоящее изобретение включает дополнительные варианты осуществления пар праймеров, где описанные в настоящей заявке отдельные прямые (например, GP5+, GP5d2+ и т.д.) и обратные праймеры (например, GP6+, T7aGP6d+) комбинируются друг с другом.

Наборы могут также быть представлены в форме твердофазных чипов или подложек, совместно именуемых биочипами. Все или часть реагентов, используемых в обсуждаемом анализе, могут быть включены в биочип или миниатюризированы в наноанализ. Хотя проточная цитометрия особенно применима при измерении выходов обсуждаемого анализа, биочипы могут использоваться для измерения или автоматизации других сигналов, таких как сигналы, связанные с анализами типа «шепчущей галереи».

Несмотря на интенсивности флуоресцентности в предпочтительном аспекте способа мультиплексирования, настоящим изобретением охватываются другие формы идентификации. Один такой альтернативный способ включает выявление типа «шепчущей галереи» (WGM). В этом варианте осуществления флуоресцентный маркер включен в гранулы поднабора или включены в или связаны с ДНК на поверхности гранул. Этот флуоресцентный маркер может возбуждать WGM лазером или источником несфокусированного белого света или источником фильтрованного несфокусированного белого света.

WGM обеспечивает возможность светового излучения частицей только определенной длины волны. Результат этого феномена состоит в том, что обычные широкие полосы излучения (шириной 10-100 нм), например, от флуорофора, становятся ограниченными и появляются в виде серии острых пиков, эффективно соответствующих типам режима стоячих световых волн внутри частицы. В соответствии с настоящим изобретением было определено, что профиль WGM крайне чувствителен к изменениям на поверхности микросфероидной частицы, и что профиль WGM изменяется, когда микросфероидная частица взаимодействует с анализируемыми веществами или молекулами внутри их среды.

Соответственно, другие аспекты настоящего изобретения предусматривают способы выявления анализируемого объекта, такого как ампликон, из штамма HPV, содержащего специфическую для штамма последовательность, причем указанный способ включает обеспечение контакта, по меньшей мере, одного набора микросфероидных частиц с образцом, предположительно содержащим указанный анализируемый объект, где каждая частица внутри набора микросфероидных частиц включает оптически выявляемую метку и иммобилизованный предполагаемый контрагент связывания указанного анализируемого объекта (например, праймера или зонда, способного связывать, захватывать или другим образом иммобилизовать ампликон из штамма HPV), где каждый набор частиц имеет определенный профиль WGM, где связывание указанного анализируемого объекта с указанным иммобилизованным контрагентом связывания приводит к изменению указанного профиля WGM указанного, по меньшей мере, одного набора микросфероидных частиц, которое указывает на присутствие указанного анализируемого объекта.

Способы по настоящему изобретению могут применяться для выявления модуляции в профиле WGM микросфероидной частицы, где указанная модуляция происходит в результате выявления связывания или другой ассоциации молекул в образце с потенциальным связыванием частиц, иммобилизованных на поверхности сфероидных частиц. Выявление реакций связывания между анализируемым объектом и его контрагентом связывания на основании чувствительных изменений профилей WGM обеспечивает возможность идентификации и выделения анализируемых объектов.

Признак настоящего изобретения состоит в том, что микросфероидные частицы могут возбуждаться широким диапазоном источников света, способствуя измерению при многих различных профилях WGM.

«Оптически выявляемая метка» может представлять собой любую молекулу, атом или ион, который испускает флуоресценцию, фосфоресценцию и/или температурное свечение. В некоторых других предпочтительных вариантах осуществления настоящего изобретения оптически выявляемая метка представляет собой флуорофор, который может охватывать диапазон оптически выявляемых меток, таких как химические флуорофоры и красители, а также квантовые точки.

В некоторых вариантах осуществления настоящее изобретение относится, по меньшей мере, к одной микросфероидной частице, содержащей частицу из латекса или диоксида кремния, которая имеет диаметр от 1 мкм до 100 мкм, мечена оптически выявляемой меткой, такой как флуорофор или квантовая точка, причем частица, кроме того, содержит предполагаемый контрагент связывания подлежащего выявлению анализируемого объекта. Примером является молекула нуклеиновой кислоты захвата, способная связываться с ампликоном HPV, генерированным амплификацией с использованием двух праймеров в консервативной области генома HPV, которые фланкируют специфичную для штамма область. Оптически выявляемая метка может выявляться при видимых длинах волны, и микросфероидная частица проявляет один или несколько профилей WGM. Один или несколько профилей WGM микросфероидной частицы выявляемо модулируется, когда анализируемый объект взаимодействует с иммобилизованным контрагентом связывания на частице. Любое такое изменение профиля WGM указывает на присутствие анализируемого объекта, который связался со своим контрагентом связывания.

Блокирующие олигонуклеотиды могут быть включены в гранулы во время гибридизации однонитевого ампликона в гранулы. Блокирующие олигонуклеотиды имеют запланированные точки отличия от соответствующих областей связывания гранулы-зонда однонитевых ампликонов. Может быть отдельный блокирующий олигонуклеотид для каждой гранулы-зонда в смеси. Блокирующие олигонуклеотиды предназначены действовать в качестве соответствующим образом подготовленных фильтров. В контексте термической денатурации с последующим медленным снижением температуры сначала происходят наиболее эффективные явления гибридизации. Специфические для типа ампликоны связываются с подходящей гранулой-зондом в соответствии с более ранним типом. Блокирующие олигонуклеотиды могут связываться и насыщать гранулы-зонды ниже по термическому профилю. Это может предотвратить возникновение явления перекрестно-типовой гибридизации (где между типами имеется больше точек различия в областях связывания зонда, по сравнению с блокирующими олигонуклеотидами) или других видов неспецифической гибридизации, таких как другие ампликоны, включая продукты праймера-димера. Блокирующие олигонуклеотиды могут присутствовать для контроля человеком, а также в качестве типов HPV. Примеры блокирующих олигонуклеотидов описаны выше в таблице 2. Уровень подобия между блокирующими олигонуклеотидами и комплементарной последовательностью специфической для типа области гранулы-зонда (для которой она предназначена блокировать) может составлять от 40% до 95%. Другим примером уровня подобия является от 75% до 85%.

Сигнальные олигонуклеотиды могут использоваться в качестве альтернатив применению праймеров PCR с непосредственной флуоресцирующей меткой для генерирования сигнала. Сигнальные олигонуклеотиды представляют собой меченные флуоресцирующей меткой зонды, которые связываются с продуктами ампликона в участке, отличном от области гранулы-зонда, для получения после гибридизации комплекса гранула-зонд/ампликон/сигнальный олигонуклеотид. Преимуществами их применения являются предупреждение потребности в мечении флуоресцентной меткой (и чрезмерного манипулирования) праймера PCR во время получения, применение гораздо меньшего количества меченного флуоресцентной меткой олигонуклеотида для эквивалентной чувствительности (и выгод в отношении затрат), снижение флуоресцентного фона, так что может быть достигнута повышенная чувствительность без стадий промывания (выгоды облегчения манипулирования и снижения риска), повышение чувствительности в отсутствие блокирующих олигонуклеотидов вследствие избыточного уровня «гнездования» в комплексе гибридизации и потенциальное применение большего количества продукта PCR на стадиях «выявления». Все эти преимущества способствовали бы подходу типа «одной трубки». Примеры сигнальных олигонуклеотидов описаны выше в таблице 2.

Альтернативно, краситель, специфичный для двухнитевой ДНК, такой как SYBR зеленый I, может применяться в качестве средства прикрепления сигнального элемента к ампликону на грануле наряду или вместо сигнальных олигонуклеотидов.

Настоящее изобретение далее описывается следующими неограничивающими примерами.

Пример 1

Диагностика HPV - выделение и амплификация ДНК

Обзор протокола экстракции ДНК, использованный для выделения ДНК для способа диагностики HPV, показан на фиг.1.

Как показано на фиг.2, PCR использовали для амплификации образца ДНК. Праймеры GP5d2+ и T7aGP6d+ использовали для генерирования ампликона для любого штамма HPV, который присутствовал в образце ДНК. Праймер T7aGP6d+ содержал флуоресцентную метку, конкретно А647, для обеспечения возможности последующей визуализации связывания ампликона со связывающими агентами. Генерированные вирусные ампликоны содержали и консервативную область (Y), которая сохранна среди всех исследованных штаммов HPV, и область, которая является вариабельной (т.е. специфической для штамма) между штаммами HPV, Hn, где n представляет вариабельную область, ассоциированную с каждым штаммом HPV. Иммобилизованные контрагенты связывания на гранулах специфически связываются с геномом, специфичным для штамма HPV.

Также был генерирован ампликон из геномной ДНК человека с использованием праймеров mlcI_95f и T7amlcI_275r для службы в качестве контроля. В этом случае праймер T7amlcI_275r также нес метку А647.

Пример 2

Диагностика HPV - выявление мультиплекса

Ампликоны, генерированные в примере 1, гибридизировали в серию связывающих агентов, каждый из которых нес полинуклеотид, являющийся комплементарным вариабельной области предполагаемого вирусного ампликона, генерированного из каждого штамма HPV 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 67 и 68 (с Х1 по Х16). Нуклеотидные последовательности нуклеиновых кислот захвата, иммобилизованных на гранулах, показаны в таблице 2. Кроме того, чип может необязательно содержать связывающий агент, который содержит полинуклеотид, являющийся комплементарным консервативной области вирусных ампликонов HPV (Y). Наконец, включен связывающий агент, содержащий полинуклеотид, который комплементарен последовательности человеческого контрольного ампликона. Нуклеиновая кислота захвата может представлять собой ДНК или РНК. Если используется РНК, то обратная транскриптаза может потребоваться для генерирования РНК из ампликона ДНК.

Каждый из связывающих агентов в чипе содержит микросферу или гранулу с определенным размером и определенной интенсивностью флуоресцентной (TMR) метки. Гранулы, имеющие диаметр 3,0 мкм, 3,5 мкм, 3,77 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм, могут дифференцироваться друг от друга с использованием проточной цитометрии, как показано на фиг.4.

Для каждого данного размера гранулы флуоресцентная метка (TMR) была включена при относительных интенсивностях 0%, приблизительно 150-80:1 (средней) и приблизительно 3:1 (высокой). Эти интенсивности метки могли четко различаться с использованием проточной цитометрии.

Пример 3

Сравнение способа выявления мультиплекса традиционной диагностикой HPV

Ниже в таблице 5 представлен обзор, сравнивающий способ выявления мультиплекса HPV по настоящему изобретению с современным гистологическим способом диагностики HPV.

Таблица 5
Сравнение способов диагностики HPV
Способ диагностики HPV Пропускная способность Сообщение Контроли
Настоящее изобретение 1600 в сутки, на прибор Отдельно идентифицированы все 13 штаммов «высокого риска» Внутренний контроль, положительный контроль, контроль человеческой гДНК
Способ на гистологической основе 350 в сутки В целом идентифицирован класс «высокого риска» Без внутреннего контроля, положительный контроль «низкого риска», положительный контроль «высокого риска

Пример 4

Тестирование чувствительности для методологии зондов

Электрофоретический анализ на агарозном геле продуктов PCR после амплификации из специфических для типа HPV, содержащих вставку плазмид с использованием различных комбинаций праймеров .

5 мкл каждого продукта загружали рядом с полосами, содержащих 5 мкл «лестницы» ДНК HyperladderIV. Реакции копировали 40000 копий специфических для типа плазмид (номера в полосах указывают тип) и подвергали 40 циклам амплификации с использованием температуры отжига 44ºС. Обозначение “x” на полосах указывает на реакции, не проанализированные вследствие испарительной потери во время PCR. Обозначение “-” на полосах указывает на отсутствие матричных контролей. 200 или 100 копий специфичных для типа плазмид наряду с 10 нг человеческой геномной ДНК Jurkat использовали для копирования PCR с применением GBHPVf3+ и GBHPVr1, мультиплексированных с mlcI_95f и T7amLCI_275r. Выполняли 48 циклов амплификации с использованием температуры отжига 44ºС. Анализ выполняли проточной цитометрией после переваривания лямбда экзонуклеазы и гибридизации с гранулами зонда PapType. Матричные контроли не дали отрицательных результатов по типам. Все тестированные типы: 6, 11, 16, 18, 31, 45, 51, 52, 56, 58, 59, 66 и 68 дали положительные результаты при использовании 200 копий специфичных для типа плазмид. Все указанные выше типы, за исключением типов 51 и 59, дали положительные результаты при использовании 100 копий специфичных для типа плазмид, включая очень чувствительную и относительно беспристрастную систему.

Когда в настоящем описании используются диапазоны для физических свойств, таких как температура или число нуклеотидов в последовательности, то предполагается, что в них включены все входящие в них комбинации и субкомбинации диапазонов и определенных вариантов осуществления.

Специалистам в данной области будет понятно, что в описанное в настоящей заявке изобретение могут быть внесены изменения и модификации, отличные от конкретно описанных в ней. Следует понимать, что изобретение включает все такие изменения и модификации. Изобретение также включает все стадии, признаки, композиции и соединения, упомянутые или указанные в настоящем описании, отдельно или совместно, и любые и все комбинации любого одного или нескольких из указанных стадий или признаков.

СПИСОК ЛИТЕРАТУРЫ

Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974.

Chadwick et al., J. Virol. Methods 70: 59-70, 1998.

Chan and Fox, Rev. Med. Microbiol. 70: 185-196, 1999.

Compton, Nature 350: 91-92, 1991.

Demidov and Broude (Eds.), "DNA Amplification: Current Technologies and Applications", Horizon Bioscience, 2004.

Gearhart et al., www.emedicine.com/MED/topic1037.htm, 2004.

Guatelli et al., Proc. Natl Acad. Sci. USA 87: 1874-1878, 1990.

Hill, J. Clin. Ligand Assay 19: 43-51, 1996.

Kievits et al., J. Virol. Methods 35: 273-286, 1991.

Kuske et al., Appl. Environ. Microbiol. 64(7): 2463-2472, 1998.

Lizardi et al., Biotechnology 6: 1197-1202, 1988.

Lyamichev et al., Nat. Biotechnol. 17: 292-296, 1999.

Marmur and Doty, J. Mol. Biol. 5: 109, 1962.

Nelson and Krawetz, Anal. Biochem. 207(1): 97-20l, 1992.

Pawlotsky et al., J. Virol. Methods 79: 227-235, 1999.

Ryan et al., Mol. Diagn. 4: 135-144, 1999.

Speel, Histochem. Cell Biol. 112: 89-113, 1999.

Todd et al., J. AIDS Hum. Retrovirol. 10: S35-S44, 1995.6

1. Набор гранул для выявления штамма HPV и/или для дифференцирования двух или более штаммов HPV, где набор гранул содержит множество семейств или множество поднаборов гранул, имеющих
(a) по меньшей мере, два поднабора гранул, где каждый поднабор гранул можно с использованием физико-химических методов отличить от любого другого поднабора гранул на основании, по меньшей мере, размера; или
(b) по меньшей мере, один поднабор гранул, имеющий, по меньшей мере, два семейства, где гранулы в поднаборе гранул являются однородными по размеру относительно друг друга и различимы физико-химическими методами на два или более семейств гранул на основании уровня мечения, который содержит каждый образец, или
(c) комбинацию указанных семейств гранул и указанных поднаборов гранул; и где
каждая из гранул внутри каждого семейства гранул поднабора соединена с необязательно меченым зондом захвата нуклеиновой кислоты, способным связываться со специфической для штамма HPV областью генома HPV, или, необязательно, по меньшей мере, с одной контрольной последовательностью нуклеиновой кислоты, при условии, что любой зонд захвата нуклеиновой кислоты или контрольная последовательность нуклеиновой кислоты мечены такой же меткой, как другие меченые зонды захвата нуклеиновых кислот или контрольная последовательность нуклеиновой кислоты в поднаборе гранул, и что внутри каждого одиночного набора гранул каждое из семейств гранул имеет различную интенсивность флуоресценции, где зонд захвата нуклеиновой кислоты выбран из SEQ ID No: 46-63; и
где специфическая для штамма HPV область генома HPV представляет собой ампликон, образованный амплификацией нуклеиновых кислот из биологической пробы, которая была получена от пациента-человека и которая предположительно содержит HPV, при этом ампликон отличен для указанного HPV или конкретного штамма указанного HPV, и где ампликон образован с использованием пары праймеров из прямого и обратного праймеров, где прямой праймер пары праймеров выбран из группы, состоящей из SEQ ID No: 1-8, и обратный праймер пары праймеров выбран из группы, состоящей из SEQ ID No: 9-12, и где, по меньшей мере, один из прямого и обратного праймеров конъюгирован с 5'-концом праймера; и
где каждое семейство гранул специфично для выявления штамма HPV, отличается от любого другого семейства гранул в наборе гранул; где указанный набор гранул способен идентифицировать один или несколько специфических штаммов HPV посредством анализа размера гранул, интенсивности флуоресценции или различения последовательностей, по меньшей мере, одного семейства гранул или поднабора гранул, с использованием проточной цитометрии.

2. Набор гранул по п.1, где 5'-конец прямого праймера выбран из группы, состоящей из
CAATCAGC, АСААТ, GGAACAAT, GGAAC, CAGCTT, АТТАСС, CTGTT, /5Phos/CAATCAGC, /5Phos/ACAAT, /5Phos/GGAACAAT, /5Phos/GGAAC, /5Phos/CAGCTT, /5Phos/ATTACC и /5Phos/CTGTT.

3. Набор гранул по п.1, где размеры гранул выбраны из группы, состоящей из 3,0 мкм, 3,5 мкм, 3,77 мкм, 5,0 мкм, 5,6 мкм и 6,8 мкм.

4. Набор гранул по п.1, где наборы гранул мечены флуорохромом, выбранным из группы, состоящей из гидроксикумарина, аминокумарина, метоксикумарина, каскада синего, люцифера желтого, NBD, фикцэритрина (РЕ), РегСР, аллофикоцианина, Hoechst 33342, DAP1, SYTOX синего, Hoechst 33258, хромомицина A3, митрамицина, YOYO-1, SYTOX зеленого, SYTOX оранжевого, 7-ADD, акридина оранжевого, ТОТО-1, То-PRO-1, тиазола оранжевого, ТОТО-3, TO-PRO-3, LDS 751, Alexa Fluoro-350, Alexa Fluoro-430, Alexa Fluoro-488, Alexa Fluoro-532, Alexa Fluoro-546, Alexa Fluoro-555, Alexa Fluoro-556, Alexa Fluoro-594, Alexa Fluoro-633, Alexa Fluoro-647, Alexa Fluoro-660, Alexa Fluoro-680, Alexa Fluoro-700 и Alexa Fluoro-750, BoDipy 630/650 и BoDipy 650/665, красителей CY Cy2, Су3, Cy3.5, Cy5, Cy5.5 и Cy7, 6-FAM (флуоресцеин), PE-Cy5, PE-Cy7, флуоресцеина dT, гексахлорфлуоресцеина (Hex), 6-карбокси-4',5'-дихлор-2',7'-диметоксифлуоресцеина (JOE), красителей Орегон зеленый 488-Х и 514, родаминовых красителей Х-родамина, лиссамина родамина В, родамина зеленого, родамина красного и ROX, TRITC, триметилродамина (TMR), карбокситетраметилродамина (TAMRA), тетрахлорфлуоресцеина (ТЕТ), красного 6В, FluorX, BODIPY-FL, красителя SYBR зеленого 1 и техасского красного.

5. Набор гранул по п.4, где меченые гранулы мечены TMR.

6. Набор гранул по п.1, содержащий от 2 до 17 семейств гранул.

7. Набор гранул по п.6, где набор гранул содержит 17 семейств гранул.

8. Набор гранул по п.1, где два или более штаммов HPV выбраны из штаммов 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 и 68.

9. Способ получения набора гранул по п.1, где способ включает
выбор по меньшей мере двух семейств или поднаборов гранул на основании размера, интенсивности флуоресценции или того и другого; смешивание по меньшей мере двух семейств или по меньшей мере двух поднаборов гранул вместе для получения набора гранул, который обеспечивает возможность идентификации специфического штамма HPV посредством анализа размера гранул, интенсивности флуоресценции или различения последовательностей, по меньшей мере, одного семейства гранул или поднабора гранул, с использованием проточной цитометрии.

10. Способ по п.9, где 5'-конец прямого праймера выбран из группы, состоящей из
CAATCAGC, АСААТ, GGAACAAT, GGAAC, CAGCTT, АТТАСС, CTGTT, /5Phos/CAATCAGC, /5Phos/ACAAT, /5Phos/GGAACAAT, /5Phos/GGAAC, /5Phos/CAGCTT, /5Phos/ATTACC и /5Phos/CTGTT.

11. Способ выявления и/или дифференцирования одного или нескольких определенных штаммов HPV в биологическом образце in vitro, где указанный способ включает
(i) получение нуклеиновой кислоты из биологического образца, полученного от человека, который предположительно содержит HPV;
(ii) амплифицирование нуклеиновой кислоты из указанного образца с использованием праймеров, которые генерируют ампликон, который отличен для анализируемого вещества или для конкретного штамма указанного анализируемого вещества;
(iii) необязательное амплифицирование контрольной последовательности нуклеиновой кислоты;
(iv) необязательное мечение ампликона(ов), указанного(ых) на стадиях (ii) и/или (iii);
(v) гибридизацию меченого ампликона(ов) в набор гранул по любому из пп.1-8, включающих реагенты, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности определенного штамма HPV или контрольной последовательности нуклеиновой кислоты, связанной или иным образом ассоциированной с физико-химически различаемой гранулой; и
(vi) гибридизации меченого ампликона(ов) в набор гранул, покрытых реагентами, где каждый член набора гранул содержит молекулу нуклеиновой кислоты, имеющую комплементарность нуклеотидной последовательности определенного штамма HPV или контрольной последовательности нуклеиновой кислоты, связанной или иным образом ассоциированной с физико-химически различаемой гранулой, где гибридизация осуществляется в присутствии по меньшей мере одной блокирующей олигонуклеотидной последовательности; и
(vii) определения, с каким реагентом связался ампликон;
где ассоциация ампликона с определенным реагентом указывает на инфекцию HPV у пациента-человека;
где праймеры включают прямой и обратный праймер, где прямой праймер пары праймеров выбран из группы, состоящей из SEQ ID No: 1-8, и обратный праймер пары праймеров выбран из группы, состоящей из SEQ ID No: 9-12, и где, по меньшей мере, один из прямого и обратного праймеров конъюгирован с 5'-концом праймера.

12. Способ по п.11, где 5'-конец прямого праймера выбран из группы, состоящей из
CAATCAGC, АСААТ, GGAACAAT, GGAAC, CAGCTT, АТТАСС, CTGTT, /5Phos/CAATCAGC, /5Phos/ACAAT, /5Phos/GGAACAAT, /5Phos/GGAAC, /5Phos/CAGCTT, /5Phos/ATTACC и /5Phos/CTGTT.

13. Способ определения риска развития заболевания, связанного с одним или несколькими штаммами HPV, у пациента-человека, где указанный способ включает выполнение стадий способа по п.11, где ассоциация ампликона с определенным реагентом, содержащим полинуклеотид, который комплементарен штамму HPV, ассоциированному с определенным заболеванием, указывает на повышенный риск указанного заболевания у пациента.



 

Похожие патенты:

Изобретение относится к области медицины и может быть использовано для выявления влияния герпес-вирусной инфекции на активность сквалендегидрогеназы у беременных.

Изобретение относится к области медицины, а именно к способу определения отека мозговой ткани при опухоли головного мозга. .
Изобретение относится к медицине, а именно к эндокринологии и детской неврологии, и может быть использовано для лечения расстройств сна у мальчиков с ожирением. .
Изобретение относится к области медицины, а именно к лабораторной диагностике, пульмонологии и педиатрии. .
Изобретение относится к медицине, а именно к неврологии, и может быть использовано для диагностики степени атеросклеротического сужения магистральных артерий головы.

Изобретение относится к токсикологической химии, а именно к способу определения дельтаметрина и лямбда-цигалотрина в биологическом материале, и может быть использовано в практике различных лабораторий.
Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для прогнозирования прогрессирования диабетической ретинопатии в ранние сроки после выполнения ультразвуковой факоумульсификации у больных с сахарным диабетом.

Изобретение относится к области медицины и предназначено для прогнозирования возникновения гестоза у беременных женщин. .
Изобретение относится к медицине, а именно к гинекологии, и может быть применено для прогнозирования рецидива заболевания у пациенток с полипами эндометрия в постменопаузе после оперативного удаления полипа путем учета метаболических, гормональных нарушений, гинекологического статуса и профилактики рецидивов путем дополнительного назначения гормональных и метаболических препаратов в послеоперационный период.

Изобретение относится к устройствам для дисперсного анализа и одновременного измерения объемной активности аэрозольной и газовой фракций радиоактивных аэродисперсных систем, содержащих радиоактивный рутений, оно может быть использовано в промышленности и для санитарно-гигиенической оценки воздушной среды, а также для оценки эффективности работы пылеулавливающего оборудования и средств индивидуальной защиты (СИЗ) органов дыхания.

Изобретение относится к технологиям нефтедобычи, а именно к способам гидродинамического моделирования. .

Изобретение относится к области петрофизических исследований определения объема (количества) связанной воды породы и может быть использовано для определения важнейшего параметра - нефтегазонасыщенности пород - при оценке запасов месторождений.
Изобретение относится к медицине, биологии, гематологии, педиатрии. .

Изобретение относится к способу и устройству датчика для определения величины целевых частиц на контактной поверхности, прилегающей к пробоотборной камере, в которой могут обеспечиваться целевые частицы.

Изобретение относится к технологиям нефтедобычи, а именно к способам мониторинга добычи и разработки совместно эксплуатируемых нефтяных пластов. .

Изобретение относится к аналитическим методам измерения примесей в газе, основанным на превращении молекул примеси в аэрозольные частицы, и может быть использовано самостоятельно в таких задачах, как контроль изделий и аппаратуры с высочайшими требованиями к герметичности, например, теплообменников ядерных реакторов на быстрых нейтронах или контроль высокоэффективных фильтров (с применением в качестве индикаторного вещества пентакарбонила железа), а также в качестве хроматографического детектора для контроля загрязнения атмосферы токсичными металлоорганическими соединениями (МОС) типа тетраэтилсвинца или при решении задач по предотвращению несанкционированного перемещения опасных веществ и предметов (с использованием набора МОС в качестве маркеров).

Изобретение относится к технической диагностике агрегатов машин, имеющих замкнутую систему смазки, и предназначено для анализа содержания продуктов загрязнения в работающем масле и экспресс-диагностики технического состояния машин.
Наверх