Средство для профилактики и лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва


 


Владельцы патента RU 2491066:

САНТЕН ФАРМАСЬЮТИКАЛ КО., ЛТД. (JP)

Группа изобретений относится к области офтальмологии. Группа изобретений раскрывает фармацевтическое применение 2-фенил-1,2-бензизоселеназол-3(2Н)-она или его соли, которое применимо в качестве средства для профилактики или лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, представляющего собой глаукому, глаукоматозную нейропатию зрительного нерва или глаукоматозную констрикцию поля зрения. Средство представляет собой дозированную форму в виде глазных капель, офтальмической мази, вставки, повязки, инъекции, таблетки, гранулы замедленного действия или капсулы. Путь введения представляет собой введение в стекловидное тело, в конъюнктивальный мешок, инстилляционное, подконъюнктивальное, субтеноновое или пероральное введение. Группа изобретений обеспечивает подавляющий эффект в отношении защиты ганглиозных клеток сетчатки. 3 н. и 9 з.п. ф-лы, 3 табл., 4 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к средству для профилактики и лечения глазных заболеваний, сопровождающихся нарушением деятельности зрительного нерва, содержащему в качестве активного ингредиента 2-фенил-1,2-бензизоселеназол-3(2Н)-он или его соль.

Предшествующий уровень техники

Сетчатка обладает функцией получения света из внешнего пространства и играет важную роль в зрительной функции. Сетчатка по структуре представляет собой ткань, имеющую толщину от 0,1 до 0,5 мм, которая состоит из 10 слоев, таких как слой пигментного эпителия сетчатки, внутренний плексиформный слой, слой ганглиозных клеток и слой нервных волокон. Во внутреннем плексиформном слое существуют нейроны, называемые амакринными клетками, которые соединяются попарно с аксонами ганглиозных клеток с образованием синапсов. Так как эти нейроны одновременно хорошо реагируют и в начале и в конце облучения светом, предполагается, что они работают в качестве детекторов интенсивности света. В слое ганглиозных клеток, существуют клетки, которые присутствуют в наиболее глубокой части сетчатки (в дальнейшем также обозначаются как «ГКС» - ганглиозные клетки сетчатки») и они являются в значительной степени вовлеченными в создание зрительного образа движения, периферического зрения, цветного зрения, зрительного образа формы, и так далее. Кроме того, в слое нервных волокон располагаются сосуды сетчатки, которые разветвляются на центральную артерию и вену сетчатки, и которые играют роль снабжения нейронов сетчатки кислородом и питательными веществами.

Когда сосуды сетчатки закупориваются или сужаются по таким причинам, как спазм, тромб или атеросклероз, представляющих собой расстройство, встречающееся при нарушении кровообращения сетчатки, то таким образом, блокируется снабжение сетчатки или зрительного нерва кислородом и питательными веществами. Таким образом, вызывается дегенерация или потеря нейронов сетчатки, и индуцируется нарушение деятельности зрительного нерва. Соответственно, расстройство кровообращения сетчатки занимает особенно важное положение в заболеваниях сетчатки. Примеры типичных симптомов, которыми сопровождается расстройство кровообращения сетчатки, включают окклюзию сосудов сетчатки, при которой артерия сетчатки или вена сетчатки закупоривается или сужается (как например, при окклюзии центральной артерии сетчатки или окклюзии ветви артерии сетчатки), диабетическую ретинопатию, которая является одной из причин отслоения сетчатки, и ишемическую нейропатию зрительного нерва, при которой происходит зрительная дисфункция. Кроме того, предполагается, что смерть ганглиозных клеток также в значительной степени связана с распространением макулярной дегенерации, пигментного ретинита, болезни Лебера, или им подобных.

Одним из серьезных глазных заболеваний, вызывающих серьезную зрительную дисфункцию, является глаукома, которая, при отсутствии соответствующего лечения, приводит к потере зрения. В случае глаукомы, среди нейронов сетчатки, в частности, селективно повреждаются ГКС, и вызывается нарушение деятельности зрительного нерва, которое приводит в результате к дефекту поля зрения. Таким образом, в настоящем документе обосновывается так называемая «Нейропротекция», т.е. идея того, что профилактика нарушений деятельности ГКС или терапия, при которой до минимума подавляются нарушения деятельности ГКС, приводят к максимально возможному лечению глаукомы (непатентный документ 1).

Подробный механизм глаукоматозного нарушения деятельности зрительного нерва до сих пор не ясен. Однако были предложены теория механического повреждения, по которой атрофия зрительного нерва вызывается повышением внутриглазного давления из-за непосредственного сжатия зрительного нерва, и теория нарушения кровообращения, по которой главной причиной атрофии зрительного нерва является нарушение кровообращения в диске зрительного нерва, и при этом считается, что оба этих механизма, основанных на механическом повреждении и на нарушении кровообращения, связаны сложным образом. Кроме того, как механическое повреждение, так и нарушение кровообращения, вызывают расстройство аксонального транспорта зрительного нерва, и предполагается, что нарушение снабжения нейротрофического фактора, сопровождающее это расстройство аксонального транспорта, является одной из причин нарушения деятельности ГКС (непатентный документ 2). Кроме того, глутамат является одним из нейромедиаторов в сетчатке, при этом предполагается, что вызванная любой причиной избыточная активация глутаматного сигнального каскада также является одной из причин нарушения деятельности ГКС (непатентный документ 3).

Соответственно, если существует лекарственное средство, которое обладает защитным эффектом по отношению к нейронам сетчатки, таким как ГКС, то ожидается, что оно применимо для профилактики или терапии глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, такого, как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения, глаукоматозная атрофия зрительного нерва, окклюзия сосудов сетчатки, пигментный ретинит или болезнь Лебера.

С другой стороны, 2-фенил-1,2-бензизоселеназол-3(2Н)-он (непатентованное наименование: Эбселен (Ebselen), в дальнейшем также обозначаемый как «Эбселен») обладает антиоксидантным эффектом и, согласно сообщениям, применяется для церебрального артериосклероза и хронической церебральной недостаточности кровообращения, а также для активации транспорта глутамата в двигательных нейронах (непатентный документ 4 и патентные документы 1 и 2). Кроме того, «Эбселен», согласно сообщениям, применяется для лечения кератоконъюктивального расстройства, такого как сухость глаз или поверхностная точечная кератопатия (патентный документ 3).

В непатентном документе 5, в докладе об исследовании фармакологического эффекта, оказываемого «Эбселеном» на клетки сетчатки, сообщается, что в кроличьей модели ишемии/реперфузии «Эбселен» ослаблял уменьшение b-волны электроретинограммы (ЭРГ) после ишемии/реперфузии. В этом докладе сообщается только об эффекте «Эбселена» на фоторецепторные клетки (зрительные клетки), локализованные на внешней стороне ткани сетчатки (со стороны ткани хороидальной мембраны), и в нем совсем нет описания или предположения о фармакологическом эффекте «Эбселена», оказываемом на ГКС, локализованных на внутренней стороне ткани сетчатки (со стороны стекловидного тела). ГКС составляют только небольшую часть ткани сетчатки, другими словами, они составляют только около 1% нейронов, составляющих сетчатку. Кроме того, ткань сетчатки снабжается кровью из двух систем сосудов. Фоторецепторные клетки снабжаются кровью из хороидальных капилляров, а ГКС снабжаются кровью из капилляров центральной артерии сетчатки. С этой точки зрения предполагается, что в непатентном документе 5 исследуется эффект «Эбселена» только на внешний слой ткани сетчатки, и не исследуется фармакологический эффект «Эбселена» на ГКС.

Далее, в непатентом документе 6 сообщается, что «Эбселен» ингибирует клеточную смерть, вызванную усиленной токсичностью глутамата в куриных клетках сетчатки при использовании клеток на эмбриональной стадии. Как описано выше, ГКС составляют только небольшую часть ткани сетчатки и, таким образом, вопрос о том, какой фармакологический эффект на ГКС на самом деле оказывает «Эбселен», остается открытым, хотя воздействие «Эбселена» на ткань сетчатки в целом было исследовано,

Как описано выше, нет данных о том, что эффект «Эбселена» на ГКС исследуется. Также в вышеупомянутых документах известного уровня техники не высказывается предположение о фармакологическом эффекте «Эбселена» для профилактики или терапии глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, такого, как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения, глаукоматозная атрофия зрительного нерва, окклюзия сосудов сетчатки, пигментный ретинит или пигментный ретинит или болезнь Лебера.

Патентный документ 1: JP-A-2001-261555

Патентный документ 2: WO 2004/071419

Патентный документ 3: WO 2006/123676

Непатентный документ 1: Ophthalmology, 40, 251-273, 1998

Непатентный документ 2: Ophthalmology, 44, 1413-1416, 2002

Непатентный документ 3: Surv. Ophthalmol., 48, S38-S46, 2003

Непатентный документ 4: Proc. Natl. Acad. Sci. USA, 100(13), 7919-7924 (2003)

Непатентный документ 5: Faseb Journal, 2004, 18, 4-5, abst. 429.13.

Непатентный документ 6: Brain Research, 2005, 1039, 146-152

Раскрытие изобретения

Задачи, решаемые изобретением

Задачей настоящего изобретения является поиск нового фармацевтического применения «Эбселена».

Средства для решения проблем

Авторы настоящего изобретения провели интенсивные исследования по поиску нового фармацевтического применения «Эбселена» и обнаружили, что, как описано ниже, «Эбселен» повышает уровень экспрессии гена ксенобиотик-метаболизирующего фермента фазы II или антиоксидантного фермента, который индуцируемо регулируется с помощью Nrf2 (Nf-E2 related factor 2 - Nf-E2 родственный фактор 2) в нейронах сетчатки и дозозависимым образом подавляет уменьшение количества клеток в слое ГКС в модели ишемии/реперфузии, которая широко используется в качестве модели глаукомы, что, тем самым, привело к осуществлению настоящего изобретения.

То есть настоящее изобретение относится к средству для профилактики или лечения глазных заболеваний, сопровождающихся нарушением деятельности зрительного нерва, такого, как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения, глаукоматозная атрофия зрительного нерва, нарушение деятельности зрительного нерва, вызванное недостаточностью кровообращения, ишемическая болезнь зрительного нерва, окклюзия сосудов сетчатки (такая как окклюзия центральной артерии сетчатки, окклюзия ветви артерии сетчатки, окклюзия центральной вены сетчатки или окклюзия ветви вены сетчатки), пигментный ретинит, болезнь Лебера, ретинопатию недоношенных, отслоение сетчатки, отслоение пигментного эпителия сетчатки, макулярная дегенерация или диабетическая ретинопатия, причем средство для профилактики или лечения содержит в качестве активного ингредиента «Эбселен» или его соль. В частности, настоящее изобретение применяется в качестве средства для профилактики или лечения глазных заболеваний, сопровождающихся нарушением деятельности ганглиозных клеток сетчатки, таких как глаукома, глаукоматозная нейропатию зрительного нерва, глаукоматозная констрикция поля зрения или глаукоматозная атрофия зрительного нерва, при которых селективно повреждаются ГКС, и вызывается нарушение деятельности зрительного нерва.

Далее, другое воплощение настоящего изобретения представляет собой средство для профилактики или лечения глазных заболеваний, сопровождающихся нарушением деятельности ганглиозных клеток сетчатки, таких как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения или глаукоматозная атрофия зрительного нерва, причем средство для профилактики или лечения содержит в качестве активного ингредиента «Эбселен» или его соль.

Далее, еще одно воплощение настоящего изобретения представляет собой средство для защиты нейронов сетчатки, содержащее в качестве активного ингредиента «Эбселен» или его соль.

Кроме того, еще одно воплощение настоящего изобретения представляет собой средство для защиты ганглиозных клеток сетчатки, содержащее в качестве активного ингредиента «Эбселен» или его соль.

Описание изобретения

При осуществлении описанного ниже теста было продемонстрировано, что «Эбселен» повышает уровень экспрессии регулируемых Nrf2 генов-мишеней, т.е., генов модифицирующей субъединицы глутумат-цистеин лигазы (в дальнейшем также обозначаемого как «GCLM»), тиоредоксин редуктазы (в дальнейшем также обозначаемого как «TRxR»), Гемоксигеназы 1 (в дальнейшем также обозначаемого как «HO1»), и NAD(P)H-хинон оксидоредуктазы 1 (в дальнейшем также обозначаемого как «NQO1»), у находящихся при смерти культивируемых крысиных эмбриональных нейронов сетчатки. То есть, «Эбселен» обладает способностью активации Nrf2 и индуцируемо регулирует экспрессию генов ксенобиотик-метаболизирующего фермента фазы II (например, NQO1) и антиоксидантного фермента (например, HO1) в культивируемых крысиных эмбриональных нейронах сетчатки. Далее, при исследовании описанного ниже эффекта «Эбселена» на индуцированную ишемией/реперфузией сетчатки смерть ГКС, было показано что «Эбселен» подавляет смерть ГКС.

Соответственно «Эбселен» обладает способностью к активации Nrf2 и снижает повреждение ГКС с помощью индуцируемого регулирования экспрессии генов ксенобиотик-метаболизирующего фермента фазы II и антиоксидантного фермента, и, таким образом, применим в качестве средства для профилактики или лечения заболевания, сопровождающегося нарушением деятельности зрительного нерва или ганглиозных клеток сетчатки.

Способ осуществления изобретения

«Эбселен», служащий в качестве активного ингредиента по настоящему изобретению, представляет собой конденсированное гетероциклическое соединение, представленное следующей химической структурной формулой [1].

Кроме того, соль «Эбселена» ничем конкретным не ограничена при условии, что она являются фармацевтически приемлемой солью, и ее примеры включают соль с неорганической кислотой, такой как соляная кислота, азотная кислота или серная кислота; и соль с органической кислотой, такой как уксусная кислота, фумаровая кислота, малеиновая кислота, янтарная кислота или винная кислота. «Эбселен» может быть представлен в форме сольвата.

В настоящем изобретении «глазное заболевание, сопровождающееся нарушением деятельности зрительного нерва» ничем конкретным не ограничено при условии, что оно представляет собой глазное заболевание, сопровождающееся нарушением деятельности зрительного нерва, и его примеры включают глаукому, глаукоматозную нейропатию зрительного нерва, глаукоматозную констрикцию поля зрения, глаукоматозную атрофию зрительного нерва, нарушение деятельности зрительного нерва, вызванное недостаточностью кровообращения, ишемическую болезнь зрительного нерва, окклюзию сосудов сетчатки (такую как окклюзию центральной артерии сетчатки, окклюзию ветви артерии сетчатки, окклюзию центральной вены сетчатки и окклюзию ветви вены сетчатки), пигментный ретинит, болезнь Лебера, ретинопатию недоношенных, отслоение сетчатки, отслоение пигментного эпителия сетчатки, макулярную дегенерацию или диабетическую ретинопатию, и в особенности включают глаукому, глаукоматозную нейропатию зрительного нерва, глаукоматозную констрикцию поля зрения и глаукоматозную атрофию зрительного нерва.

В настоящем изобретении «глазное заболевание, сопровождающееся нарушением деятельности ганглиозных клеток сетчатки» ничем конкретным не ограничено при условии, что оно представляет собой глазное заболевание, сопровождающееся нарушением деятельности ганглиозных клеток сетчатки, и его примеры включают глаукому, глаукоматозную нейропатию зрительного нерва, глаукоматозную констрикцию поля зрения, глаукоматозную атрофию зрительного нерва, окклюзию сосудов сетчатки (такую как окклюзию центральной артерии сетчатки, окклюзию ветви артерии сетчатки, окклюзию центральной вены сетчатки и окклюзию ветви вены сетчатки) и пигментный ретинит, и в особенности включают глаукому, глаукоматозную нейропатию зрительного нерва, глаукоматозную констрикцию поля зрения и глаукоматозную атрофию зрительного нерва, при которых селективно повреждаются ГКС и вызывается нарушение деятельности зрительного нерва.

В настоящем изобретении термин «нейроны сетчатки» обозначает нейроны, вовлеченные в передачу зрительных сигналов в мозг, и специфически обозначает зрительные клетки, горизонтальные клетки, биполярные клетки, ганглиозные клетки сетчатки, амакринные клетки и так далее.

В настоящем изобретении термин «защита нейронов сетчатки» обозначает не только подавление смерти нейронов сетчатки и/или гипофункции нейронов сетчатки, которые происходят по какой-либо причине, но также обозначает профилактику смерти нейронов сетчатки и/или гипофункции нейронов сетчатки, которые могут произойти в будущем.

В настоящем изобретении термин «защита ганглиозных клеток сетчатки» обозначает не только подавление смерти ганглиозных клеток сетчатки и/или гипофункции ганглиозных клеток сетчатки, происходящих по какой-либо причине, но также обозначает профилактику смерти ганглиозных клеток сетчатки и/или гипофункции ганглиозных клеток сетчатки, которые могут произойти в будущем.

В настоящем изобретении термин «смерть нейронов сетчатки» обозначает апоптоз и/или некроз нейронов сетчатки и, в особенности, обозначает апоптоз нейронов сетчатки.

В настоящем изобретении, термин «смерть ганглиозных клеток сетчатки» обозначает апоптоз и/или некроз ганглиозных клеток сетчатки и, в особенности, обозначает апоптоз ганглиозных клеток сетчатки.

«Эбселен» может быть включен в состав одного препарата или в комбинацию препаратов путем добавления по необходимости фармацевтически приемлемых добавок с использованием широко распространенного метода.

Когда «Эбселен» используется для профилактики или терапии вышеупомянутого глазного заболевания или используется для защиты нейронов сетчатки, таких как ганглиозные клетки сетчатки, то он может вводиться пациенту перорально или парентерально. Примеры пути введения включают пероральное введение, местное введение в глаза (такое как инстилляционное введение, введение в конъюнктивальный мешок, введение в стекловидное тело, подконъюктивальное введение и субтеноновое введение), внутривенное введение и чрескожное введение. Кроме того, «Эбселен» включается в состав в дозированной форме, подходящей для совместного введения, по необходимости с фармацевтически приемлемой добавкой. Примеры дозированной формы, подходящей для перорального введения, включают таблетку, капсулу, гранулу и порошок, и примеры дозированной формы, подходящей для парентерального введения, включают инъекции, глазные капли, офтальмическую мазь, повязку, гель и вставку. Они могут быть приготовлены с использованием обычного метода, широко распространенного в данной области. Кроме того, «Эбселен» также может быть включен в состав препарата для внутриглазного имплантата или препарата с системой доставки лекарственного средства, такого как микросфера.

Например, таблетка может быть приготовлена путем соответствующего выбора и применения разбавителя, такого как лактоза, глюкоза, D-маннит, безводный гидрофосфат кальция, крахмал или сахароза; дезинтегратора, такого как карбоксиметилцеллюлоза, карбоксиметилцеллюлоза кальция, кроскармелоза натрия, кросповидон, крахмал, частично желатинированный крахмал или гидроксипропилцеллюлоза с низкой степенью замещения; связующего вещества, такого как гидроксипропилцеллюлоза, этилцеллюлоза, аравийская камедь, крахмал, частично желатинированный крахмал, поливинилпирролидон или поливиниловый спирт; смазывающего вещества, такого как стеарат магния, стеарат кальция, тальк, водный диоксид кремния или гидрогенизированное масло; покровного вещества, такого как очищенная сахароза, гидроксипропилметилцеллюлоза, гидроксипропилцеллюлоза, метилцеллюлоза, этилцеллюлоза или поливинилпирролидон; вкусо-ароматической добавки, такой как лимонная кислота, аспартам, аскорбиновая кислота или ментол; или т.п.

Инъекция может быть приготовлена путем соответствующего выбора и применения вещества, регулирующего тоничность, такого как хлорид натрия; буфера, такого как фосфат натрия; поверхностно-активного вещества, такого как моноолеат полиоксиэтиленсорбитана; вещества, регулирующего вязкость, такого как метилцеллюлоза; или т.п.по необходимости.

Глазные капли могут быть приготовлены путем соответствующего выбора и применения вещества, регулирующего тоничность, такого как хлорид натрия или концентрированный глицерин; буфера, такого как фосфат натрия или ацетат натрия; поверхностно-активного вещества, такого как моноолеат полиоксиэтиленсорбитана, полиоксил 40 стеарат, или полиоксиэтиленовое гидрогенизированное касторовое масло; стабилизатора, такого как цитрат натрия или эдетат натрия; консерванта, такого как хлорид бензалкония или парабен; или т.п. по необходимости. pH глазных капель является допустимой при условии, если значение pH попадает в приемлемый для офтальмического препарата интервал, но, как, правило, предпочтительно, если значение pH находится в интервале от 4 до 8. Кроме того, офтальмическая мазь может быть приготовлена с помощью широко распространенной основы, такой как белый вазелин или жидкий парафин.

Вставка может быть приготовлена путем тонкого измельчения и смешивания биодеградируемого полимера, такого как гидроксипропилцеллюлоза, гидроксипропилметилцеллюлоза, карбоксивиниловый полимер или полиакриловая кислота, вместе с «Эбселеном», и путем компрессионного формования полученного в результате порошка. Если необходимо, могут использоваться вспомогательное вещество, связующее вещество, стабилизатор или вещество, регулирующее pH. Препарат для внутриглазного имплантата может быть приготовлен с использованием биодеградируемого полимера, такого как полимолочная кислота, полигликолевая кислота, сополимер молочной и гликолевой кислот или гидроксипропилцеллюлоза.

Доза «Эбселена» может подходящим образом изменяться в зависимости от дозированной формы, тяжести симптомов, возраста или массы тела пациента, нуждающегося во введении, врачебного заключения и так далее. В случае перорального введения, средство может, как правило, вводиться взрослому за один раз или поделенной на несколько раз дозой от 0,01 до 5000 мг, предпочтительно, от 0,1 до 2500 мг, более предпочтительно, от 0,5 до 1000 мг в день. В случае инъекции, средство, как правило, может вводиться взрослому за один раз или поделенной на несколько раз дозой от 0,0001 до 2000 мг в день. В случае глазных капель или вставки, как правило, препарат, содержащий активный ингредиент в количестве от 0,000001 до 10% (мас./об.), предпочтительно, от 0,00001 до 1% (мас./об.), более предпочтительно, от 0,0001 до 0,1% (мас./об.) может вводиться один раз или несколько раз в день. Кроме того, в случае повязки, содержащей активный ингредиент в количестве от 0,0001 до 2000 мг, то она может применяться для взрослого, и в случае препарата для внутриглазного имплантата, содержащей активный ингредиент в количестве от 0,0001 до 2000 мг, то он может быть имплантирован в глаз взрослого.

В дальнейшем будут представлены результаты тестов 1 и 2 и примеры препаратов. Однако эти примеры приведены для полного понимания настоящего изобретения, а не для ограничения рамок сущности настоящего изобретения.

Сведения, подтверждающие возможность осуществления изобретения

Тест 1. Исследование способности индуцирования экспрессии генов ксенобиотик-метаболизирующих ферментов фазы II и антиоксидантного фермента с использованием системы культуры эмбриональных крысиных нейронов сетчатки

Способность «Эбселена» индуцировать экспрессию генов ксенобиотик-метаболизирующего фермента фазы II и антиоксидантного фермента оценивали с помощью системы культуры эмбриональных крысиных нейронов сетчатки (Brain Res. 2003; 967: 257-66). В данном случае систему культуры эмбриональных крысиных нейронов сетчатки, активно и широко использовали в качестве метода культивирования нейронов сетчатки и в качестве одного из инструментов исследования заболеваний зрительного нерва, таких как глаукома.

Метод оценки

Эмбриональные крысиные нейроны сетчатки (Slc:Wistar/ST, возраст 18 дней) изолировали и высевали на пластиковое покровное стекло, покрытое полиэтиленимином. Затем клетки культивировали в течение 3 дней в минимальной необходимой среде «Eagle», содержащей 10% фетальной бычьей сыворотки. Затем добавляли туда растворитель (0,1% этанол) или «Эбселен» до конечной концентрации 25 мкМ, и клетки инкубировали в культуральной среде. В данном случае культивирование проводили при температуре 37°C и присутствии 5% CO2. Культуральную среду удаляли в каждый момент времени из 4, 8, или 12 часов после начала инкубации. Смешанный раствор готовили путем добавления 1% (об./об.) β-меркаптоэтанола (производство BioRad, Кат.No. 161-0710) к Буферу «RLT», прилагаемому к набору реагентов «RNeasy Mini Kit» (250) (производство QIAGEN, Кат. No. 74106), и нейроны сетчатки на пластиковом покровном стекле лизировали с помощью полученного таким образом раствора. Суммарную РНК экстрагировали из полученного в результате клеточного лизата согласно протоколу, прилагаемому к набору реагентов «RNeasy Mini Kit» (250), и кДНК синтезировали с использованием набора реагентов «ExScript™ RT reagent Kit» (производство TAKARA, Кат.No. RR035B). Согласно протоколу, прилагаемому к набору реагентов «SYBR Premix Ex Taq (Perfect Real Time)» (производство TAKARA, Кат. No. RR041B), смешивали «SYBR Premix Ex Taq (Perfect Real Time)», Эталонный краситель «ROX», синтезированную кДНК и каждую пару праймеров для глицеральдегид-3-фосфат дегидрогеназы (в дальнейшем также называемую как «GAPDH»), GCLM, TRxR, HO-1, или для NQO-1 (производство Nihon Gene Research Laboratories Inc.) и проводили реакцию ПЦР с использованием системы количественной реакции ПЦР (производство Applied Biosystems, название системы: ABI PRISM 7000), и измеряли уровень экспрессии каждого из генов GAPDH, GCLM, TRxR, HO-1 и NQO-1. Исходя из полученных результатов рассчитывали, согласно уравнению 1, относительный уровень экспрессии каждого гена-мишени путем нормализации уровня экспрессии каждого из генов-мишеней по отношению к уровню GAPDH, который является геном домашнего хозяйства. Кроме того, коэффициент индуцирования (%) каждого гена-мишени по отношению к группе носителя получали согласно уравнению 2 путем деления значения уровня экспрессии каждого гена в группе 25 мкМ «Эбселена» на среднее значение уровня экспрессии того же гена в группе носителя. Каждые данные представлены как среднее ± стандартное отклонение трех независимых экспериментов.

В данном случае представлены последовательности соответствующих праймеров, используемых в данной оценке.

Таблица 1
Название Нуклеотидная последовательность
Пара праймеров для GAPDH GGGCTCATGACCACAGTCCA
CACGCCACAGCTTTCCAGAG
Пара праймеров для GCLM GTGTGATGCCACCAGATTTGAC
CCTGGAAACTTGCCTCAGAGAG
Пара праймеров для TRxR AATTTCCGGCAGTGTGTGTCC
ACCCAAGAGCCATGCAATGAG
Пара праймеров для НО-1 GTGCTCGCATGAACACTCTGG
AGTGCCTGCAGCTCCTCAAAC
Пара праймеров для NQO-1 GGAAGCTGCAGACCTGGTGATA
GCATACGTGTAGGCGAATCCTG

Уравнение 1

Относительный уровень экспрессии каждого гена-мишени = (Уровень экспрессии каждого гена/Уровень экспрессии GAPDH)

Уравнение 2

Коэффициент индуцирования каждого гена-мишени по отношению к контрольной группе, получающей носитель (%) = (Уровень экспрессии каждого гена в группе 25 мкМ «Эбселена»/Уровень экспрессии каждого гена в контрольной группе, получающей носитель)

Результаты

Результаты представлены в Таблице 2. Из Таблицы 2 следует, что в системе культуры эмбриональных крысиных нейронов сетчатки, показано, что «Эбселен» повышает уровень экспрессии генов GCLM, TRxR, HO-1 и NQO-1, которые представляют собой ксенобиотик-метаболизирующие ферменты фазы II или антиоксидантные ферменты.

Таблица 2
Коэффициент индуцирования экспрессии каждого гена в группе 25 мкМ «Эбселена» по отношению к группе носителя (%: среднее ± стандартное отклонение)
Название каждого гена Через 4 часа Через 8 часов Через 12 часов
GCLM 198±18 194±14 172±13
TRxR 225±11 193±13 301±26
HO-1 1263±365 1458±307 1311±237
NQO-1 450±74 937±183 1266±212

Тест 2. Фармакологический тест с использованием крысиной модели повреждения сетчатки, индуцированного ишемией/реперфузией

Применимость «Эбселена» против ишемического/реперфузионного повреждения оценивали с использованием крысиной модели повреждения сетчатки, индуцированного ишемией/реперфузией (Ophthalmologica. 1991; 203:138-147) в качестве модели исследования эффекта, оказываемого на повреждение сетчатки, индуцированное ишемией/реперфузией. В данном случае, крысиная модель повреждения сетчатки, индуцированного ишемией/реперфузией представляет собой животную модель, в которой ишемия сетчатки индуцируется применением гидравлического давления к переднему сегменту глаза с последующей реперфузией кровотока после установленного периода времени путем снятия гидравлического давления, и широко используется в качестве одной из животных моделей нарушения деятельности зрительного нерва, главным образом вызываемого глаукомой.

Способ производства для крысиной модели повреждения сетчатки, индуцированного ишемией/реперфузией, и способ оценки)

1% (мас./об.) офтальмический раствор гидрата сульфата атропина (производство Ninon Tenganyaku, Co. Ltd., торговое название: «Nitten ATROPINE Ophthalmic solution 1%») закапывали в глаз крысы (Slc:SD, самец, возраст около 7 недель) для того, чтобы вызвать мидриаз, и индуцировали общую анестезию, давая крысе вдыхать газ, получаемый при испарении 3% (об./об.) галотана (производство Takeda Pharmaceutical Company Limited., торговое название: «Fluothane») с помощью смеси газов (2 Л/мин) 100% (об./об.) кислорода (0,5 Л/мин) и 100% (об./об.) оксида азота (1,5 Л/мин), и анестезию поддерживали 1% (об./об.) галотаном. Инфузионный контейнер, содержащий физиологический солевой раствор (производство Otsuka Pharmaceutical Co., Ltd., торговое название: «Otsuka Normal Saline») подвешивали к потолку и вставляли в переднюю камеру инъекционную иглу 30 G, соединенную с контейнером через трубку, и, таким образом, для индуцирования ишемии применяли гидравлическое давление 130 мм рт.ст. Через 45 минут инъекционную иглу удаляли и кровоток сетчатки реперфузировали. Через 7 дней после ишемической/реперфузионной обработки, крысе итраперитонально вводили инъекционный раствор пентобарбитала натрия (производство Dainippon Sumitomo Pharma Co., Ltd., торговое название: «Nembutal injection solution») дозой 100 мг/кг для достижения общей анестезии, и удаляли глазное яблоко. Удаленное глазное яблоко фиксировали с помощью смешанной жидкости 25% (мас./об.) глутаральдегида и 10% (мас./об.) формалина с нейтральным буфером (глутаральдегид:формалин с нейтральным буфером=1:9). Фиксированное глазное яблоко заливали в парафин и разрезали на секции, посредством чего готовили секции сетчатки (толщиной: 3 мкм). Секции окрашивали с помощью гематоксилина-эозина. 8 секций сетчатки готовили с интервалом 45 мкм на один глаз, так чтобы там содержался диск зрительного нерва. Из 8 секций произвольно выбирали 3 секции и по отношению к выбранным секциям делали фотографию сетчатки с интервалом от 1 до 1,5 мм с левой и с правой стороны от диска зрительного нерва, и измеряли количество клеток в слое ганглиозных клеток сетчатки. В дальнейшем, согласно уравнению 3, рассчитывали коэффициент подавления (%) «Эбселеном» уменьшения количества клеток в слое ганглиозных клеток сетчатки, вызванное ишемическим/реперфузионным повреждением, при этом количество клеток в необработанной группе принимали за 100%, а количество клеток в группе, в которой крысам, подвергнутым ишемической/реперфузионной обработке, перорально вводили носитель (1% (мас./об.) раствора метилцеллюлозы), принимали за 0%. В данном случае, количество животных в каждой группе составило 6-8 (6-8 глаз). Уравнение 3

Коэффициент подавления уменьшения количества клеток в слое ганглиозных клеток сетчатки (%)=(Nx-Nv)/(NU-Nv)×100

NU: Количество клеток в слое ганглиозных клеток сетчатки в группе без обработки

Nv: Количество клеток в слое ганглиозных клеток сетчатки в группе, в которой крысам, подвергнутым ишемической/реперфузионной обработке, перорально вводили носитель

Nx: Количество клеток в слое ганглиозных клеток сетчатки в группе, в которой крысам, подвергнутым ишемической/реперфузионной обработке, перорально вводили лекарственное средство.

Способ введения

Контрольная группа, получающая носитель:

1% (мас./об.) раствор метилцеллюлозы (приготовленный путем растворения метилцеллюлозы в очищенной воде) перорально многократно вводили дважды в день в течение 12 дней начиная за 5 дней перед до 6 дней после даты ишемической/реперфузионной обработки.

Группа, получающая «Эбселен»:

«Эбселен», суспендированный в 1% (мас./об.) растворе метилцеллюлозы, перорально многократно вводили дважды в день в течение 12 дней начиная за 5 дней перед до 6 дней после даты ишемической/реперфузионной обработки с дозой 3 или 30 мг/кг.

Результаты

Результаты представлены в Таблице 3. Как видно из Таблицы 3, в крысиной модели индуцированного ишемией/реперфузией повреждения сетчатки продемонстрировано, что «Эбселен» подавляет уменьшение количества клеток в слое ганглиозных клеток сетчатки дозо-зависимым образом.

Таблица 3
Состав группы Коэффициент подавления уменьшения количества клеток в слое ганглиозных клеток сетчатки (%)
«Эбселен» 3 мг/кг/день 38,0
30 мг/кг/день 59,7

Обсуждение

Как видно из представленных выше результатов, «Эбселен» повышал уровень экспрессии генов GCLM, TRxR, HO-1 и NQO-1, которые являются ксенобиотик-метаболизирующие ферментами фазы II или антиоксидантные ферментами и которые индуцируемо регулируются с помощью Nrf2 в нейронах сетчатки, а также «Эбселен» подавлял уменьшение клеток в слое ганглиозных клеток сетчатки дозо-зависимым образом в модели ишемии/реперфузии, которая широко используется в качестве модели глаукомы. То есть, показано, что «Эбселен» обладает заметным профилактическим или улучшающим эффектом, оказываемым на глазное заболевание, сопровождающееся нарушением деятельности зрительного нерва, такое как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения, глаукоматозная атрофия зрительного нерва, нарушение деятельности зрительного нерва, вызванное недостаточностью кровообращения, ишемическая болезнь зрительного нерва, окклюзия центральной артерии сетчатки, окклюзия ветви артерии сетчатки, окклюзия центральной вены сетчатки, окклюзия ветви вены сетчатки, пигментный ретинит, болезнь Лебера, ретинопатия недоношенных, отслоение сетчатки, отслоение пигментного эпителия сетчатки, макулярная дегенерация или диабетическая ретинопатия, в которых происходит смерть нейронов сетчатки. Кроме того, было показано, что поскольку «Эбселен» подавляет уменьшение количества клеток в слое ганглиозных клеток сетчатки дозо-зависимым образом, то он обладает особенно заметным профилактическим или улучшающим эффектом, оказываемым на глазное заболевание, сопровождающееся нарушением деятельности ганглиозных клеток сетчатки, такое как глаукома, глаукоматозная нейропатия зрительного нерва, глаукоматозная констрикция поля зрения или глаукоматозная атрофия зрительного нерва, в которых селективно повреждаются ГКС.

Примеры препаратов

Лекарственные средства по настоящему изобретению будут более конкретно описаны со ссылкой на примеры препаратов, однако настоящее изобретение не ограничено только этими примерами препаратов.

Пример 1. Глазные капли

в 100 мл

«Эбселен» 10 мг
Хлорид натрия 900 мг
Полисорбат 80 в достаточном количестве
Гидрофосфат натрия в достаточном количестве
Дигидрофосфат натрия в достаточном количестве
Стерильная очищенная вода в достаточном количестве

«Эбселен» и другие вышеупомянутые ингредиенты добавляют к стерильной воде и эти ингредиенты хорошо перемешивают, в результате чего получают готовые глазные капли. Путем изменения количества «Эбселена» могут быть приготовлены глазные капли содержащие «Эбселен» в концентрации 0,05% (мас./об.), 0,1% (мас./об.), 0,5% (мас./об.), или 1% (мас./об.).

Пример 2. Офтальмическая мазь

в 100 г

«Эбселен» 0,3 г
Жидкий парафин 10,0 г
Белый вазелин в достаточном количестве

«Эбселен» добавляют к однородно расплавленному белому вазелину и жидкому парафину, эти ингредиенты хорошо перемешивают, и полученную в результате смесь постепенно охлаждают, в результате чего получают готовую офтальмическую мазь. Путем изменения добавляемого количества «Эбселена», может быть приготовлена Офтальмическая мазь, содержащая «Эбселен» в концентрации 0,05% (мас./мас.), 0,1% (мас./мас.), 0,5% (мас./мас.), 1% (мас./мас.) или 3% (мас./мас.).

Пример 3. Таблетка

в 100 мг

«Эбселен» 1 мг
Лактоза 66,4 мг
Кукурузный крахмал 20 мг
Кальций-карбоксиметилцеллюлоза 6 мг
Гидроксипропилцеллюлоза 6 мг
Стеарат магния 0,6 мг

«Эбселен» и лактозу смешивают в миксере, туда добавляют кальций-карбоксиметилцеллюлозу и гидроксипропилцеллюлозу, и полученную в результате смесь гранулируют. Полученные гранулы сушат с последующим распределением по размеру. Затем, добавляют стеарат магния и смешивают с распределенными по размеру гранулами, и полученную в результате смесь таблетируют с помощью таблетирующей установки. Путем изменения добавляемого количества «Эбселена», может быть приготовлена таблетка, содержащая в 100 мг «Эбселен» в количестве 0,1 мг, 10 мг или 50 мг.

Пример 4. Инъекция

в 10 мл

«Эбселен» 10 мг
Хлорид натрия 90 мг
Полисорбат 80 q.s.
Стерильная очищенная вода q.s.

«Эбселен» и хлорид натрия растворяют в стерильной очищенной воде, в результате чего получают инъекцию. Путем изменения добавляемого количества «Эбселена», может быть приготовлена инъекция, содержащая «Эбселен» в количестве 0,1 мг, 10 мг или 50 мг в 10 мл инъекции.

Промышленная применимость

«Эбселен» обладает способностью активировать Nrf2 и индуцируемо регулировать гены ксенобиотик-метаболизирующих ферментов фазы II и антиоксидантных ферментов, исправляя, таким образом, нарушение деятельности ГКС. Таким образом, «Эбселен» применим в качестве средства для профилактики и лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва или ганглиозных клеток сетчатки.

1. Средство для профилактики и лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, содержащее в качестве активного ингредиента 2-фенил-1,2-бензизоселеназол-3(2Н)-он или его соль, где глазное заболевание представляет собой глаукому, глаукоматозную нейропатию зрительного нерва, глаукоматозную констрикцию поля зрения.

2. Средство по п.1, где глазное заболевание представляет собой глаукому.

3. Средство по п.1 или 2, где путь введения представляет собой инстилляционное введение, введение в стекловидное тело, подконъюктивальное введение, введение в конъюнктивальный мешок, субтеноновое введение или пероральное введение.

4. Средство по п.1 или 2, где дозированная форма представляет собой глазные капли, офтальмическую мазь, вставку, повязку, инъекцию, таблетку, гранулу замедленного действия или капсулу.

5. Способ профилактики или лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, включающий введение пациенту фармакологически эффективного количества 2-фенил-1,2-бензизоселеназол-3(2Н)-она или его соли, где глазное заболевание представляет собой глаукому, глаукоматозную нейропатию зрительного нерва.

6. Способ по п.5, где глазное заболевание представляет собой глаукому.

7. Способ по п.5 или 6, где путь введения представляет собой инстилляционное введение, введение в стекловидное тело, подконъюктивальное введение, введение в конъюнктивальный мешок, субтеноновое введение или пероральное введение.

8. Способ по п.5 или 6, где введение осуществляется с использованием глазных капель, офтальмической мази, вставки, повязки, инъекции, таблетки, гранулы замедленного действия или капсулы.

9. Применение 2-фенил-1,2-бензизоселеназол-3(2Н)-она или его соли для производства средства для профилактики или лечения глазного заболевания, сопровождающегося нарушением деятельности зрительного нерва, где глазное заболевание представляет собой глаукому, глаукоматозную нейропатию зрительного нерва.

10. Применение по п.9, где глазное заболевание представляет собой глаукому.

11. Применение по п.9 или 10, где путь введения представляет собой инстилляционное введение, введение в стекловидное тело, подконъюктивальное введение, введение в конъюнктивальный мешок, субтеноновое введение или пероральное введение.

12. Применение по п.9 или 10, где дозированная форма представляет собой глазные капли, офтальмическую мазь, вставку, повязку, инъекцию, таблетку, гранулу замедленного действия или капсулу.



 

Похожие патенты:

Изобретение относится к соединению формулы: где Y представляет собой -СО2 Н; А представляет собой -(СН2)n-Ar-(СН 2)o-, где Ar представляет собой тиофенил, сумма m и о равна 3, и где 1 группа -СН2- может быть замещена О; G и G' представляют собой -Н; и В представляет собой фенил, содержащий от 1 до 2 заместителей, независимо выбранных из -F, -О и -Br.

Изобретение относится к соединению формулы: где R представляет собой Н, или R состоит из: 1) C 1-6алкила и 2) от 0 до 1 -ОН групп; Y представляет собой -Cl или -F; и X состоит из: 1) линейного алкила или алкенила, имеющих от 4 до 10 атомов углерода, и 2) от 0 до 1 -ОН групп.

Изобретение относится к производным изоксазола формулы (I) и их фармацевтически приемлемым солям, где X-Y является N-O или O-N; R1 независимо выбирают из группы, включающей галоген и С1-4алкил; или два заместителя R1 вместе с атомами углерода, с которыми они связаны, образуют 6-членный ароматический цикл; R представляет собой гидрокси-С 1-8алкил; а равно 1, каждый из m и n независимо равен 0, 1 или 2.

Изобретение относится к применению замещенных сульфонамидов общей формулы (I), где R1 - это СО или SO2 , R2 - это NH или О, R включает третичную диC 1-4алкиламиновую группу, в которой алкиловые фрагменты являются одинаковыми или разными, или аминогруппу, алкиловые фрагменты которой вместе образуют 5, 6 или 7-членный цикл с насыщенными связями, или концы алкиловых фрагментов соединены с гетероатомом О, или R - это 4-(N,N-диэтиламиноэтокси)бензил, где R1 - это SO; и R2 - это NH; или R - это 4-[N-(морфолинопропил)сульфамоил]фенил, где R1 - это СО и R2 - это NH, n - это количество углеродов соединительной алифатической цепи, где n - это 0, 2 или 3; и/или их физиологически приемлемых солей в производстве лекарственного препарата для лечения глаукомы.
Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для лечения глаукомной оптической нейропатии. .
Изобретение относится к медицине, в частности к офтальмологии и фармации, и предназначено для снижения внутриглазного давления. .

Изобретение относится к производным индола или их фармацевтически приемлемым солям, общей формулы (1) где значения R1, R2 , m приведены в пункте 1 формулы. .

Изобретение относится к соединению 2H-хромена или его производному, которые обладают действием агониста S1P 1. .

Изобретение относится к соединению 2H-хромена или его производному, которые обладают действием агониста S1P 1. .

Изобретение относится к новым соединениям следующей общей формулы [Ia], в которой R1 представляет собой (1) атом водорода, (2) C1-C6алкильную группу, (3) C2-C6алкенильную группу, (4) C 2-C6алкинильную группу, (5) C1-C 6алкоксигруппу, (6) гидроксиC1-C6 алкильную группу, (7) C1-C6алкокси(C 1-C6)алкильную группу, (8) -CONR11 R12, в которой R11 и R12 являются одинаковыми или различными и каждый представляет атом водорода или C1-C6алкильную группу, (9) фенильную группу или (10) пятичленную гетероарильную группу, которая содержит по меньшей мере один гетероатом, выбранный из группы, состоящей из атома азота и атома кислорода и которая может быть замещена C1-C6алкильной группой; R2 представляет собой (1) атом галогена, (2) C1-C6алкильную группу, (3) гидроксигруппу или (4) C1-C6 алкоксигруппу; p равно 0, 1, 2 или 3; X представляет собой атом углерода или атом азота; m1 равно 0, 1 или 2; m2 равно 0 или 1; причем спирокольцо AB может быть замещено 1-5 одинаковыми или различными заместителями, выбранными из группы, состоящей из (1) гидроксигруппы, (2) C1-C6алкильной группы, (3) C1-C6алкоксигруппы и (4) оксогруппы; n1 равно 0, 1, 2, 3 или 4; n2 равно 1, 2, 3 или 4; n3 равно 0, 1 или 2, при условии, что n2+n3 равно 2, 3 или 4; и связь, представленная символом , обозначает одинарную связь или двойную связь при условии, что три соседних атома углерода не образуют алленовую связь, представленную формулой: , или его фармацевтически приемлемой соли.

Изобретение относится к фармацевтически дозированной лекарственной форме из множества частиц. .

Изобретение относится к производным аминопиразола формулы (I), где А, Е, R1 и R2 имеют значения, указанные в формуле изобретения, и к их фармацевтически приемлемым солям.

Изобретение относится к производным аминопиразола формулы (I), где А, Е, R1 и R2 имеют значения, указанные в формуле изобретения, и к их фармацевтически приемлемым солям.
Изобретение относится к области медицины и может применяться при лечении гнойных ран и ожогов. .

Изобретение относится к области органической химии, а именно к новым производным 2,5-диоксо-имидазолидина общей формулы Ib, или к его фармацевтически приемлемым солям и сольватам, или сольватам фармацевтически приемлемых солей, где X означает O; R1 представляет собой H; или R1 выбран из C1-C6 алкила и C3-C6 алкинила, где алкил необязательно может быть замещен цианогруппой; R2a выбран из H, P(O)(OH)2 и C(O)(CH 2)n1C(O)OH; или R2a выбран из -С(О)-C 1-C6 алкила, который замещен амино; n1 равно 1 или 2; каждый R2b и R2c независимо выбран из H и C1-C6 алкила; R3a представляет собой H, атом галогена или циано; каждый R3b независимо представляет собой атом галогена или циано; или каждый R 3b независимо представляет собой C1-C6 алкил, необязательно замещенный тремя атомами галогена; каждый R4a и R4b независимо представляет собой H или атом галогена; или каждый R4a и R4b выбран из C1-C6 алкила и C1 -C6 алкокси, где алкил замещен тремя атомами галогена; R4c означает атом галогена или циано; и m1 равно 0 или 1.

Изобретение относится к химии гетероциклических соединений, а именно к замещенным O-[ -(азол-1-ил)алкил]-N-фенилкарбаматам общей формулы I: где Z и Y означают атом азота или CH-группу, или одновременно являются цепью C-CH=CH-CH=CH-C составляющую вместе аннелированное кольцо; m означает целое число от 1 до 3; R одинаковые или разные означают атом водорода, галогена, алкильную группу с числом атомов углерода от 1 до 4, алкоксигруппу с числом атомов углерода от 1 до 4, перфторалкильную группу с числом атомов углерода от 1 до 4, нитрогруппу, алкоксикарбонильную группу, сульфамоилгруппу, n означает целое число атомов от 0 до 2;к их солям с фармацевтически подходящими кислотами, обладающим антиагрегационной активностью.

Изобретение относится к химии гетероциклических соединений, а именно к замещенным O-[ -(азол-1-ил)алкил]-N-фенилкарбаматам общей формулы I: где Z и Y означают атом азота или CH-группу, или одновременно являются цепью C-CH=CH-CH=CH-C составляющую вместе аннелированное кольцо; m означает целое число от 1 до 3; R одинаковые или разные означают атом водорода, галогена, алкильную группу с числом атомов углерода от 1 до 4, алкоксигруппу с числом атомов углерода от 1 до 4, перфторалкильную группу с числом атомов углерода от 1 до 4, нитрогруппу, алкоксикарбонильную группу, сульфамоилгруппу, n означает целое число атомов от 0 до 2;к их солям с фармацевтически подходящими кислотами, обладающим антиагрегационной активностью.
Наверх