Способ определения генотипа человека по полиморфизму в гене коллагена ii типа col2a1 c>a (rs1635529)


 


Владельцы патента RU 2518301:

Закрытое акционерное общество "Научно-производственная фирма ДНК-Технология" (RU)

Изобретение относится к биотехнологии и представляет собой способ определения генотипа человека по полиморфизму в гене коллагена II типа COL2A1 С>А (rs1635529). Данный способ может быть использован при диагностике заболеваний пародонта в ротовой полости. Способ включает снятие кривых плавления с флуоресцентно-меченными аллель-специфичными олигонуклеотидными пробами. Используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего нуклеотидного состава: COL2_29s TCTTGCCCAAAGGCTAGGCGGA, COL2_29a CCAGAGGGCGAGAAAGAAACGA, COL2_29p1 AAAAAGGAAAGTTTATC-FAM, COL2_29p2 AAAAAGGAACGTTTATC-HEX, COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции. Относят образец к гомозиготе или гетерозиготе по данному аллелю по анализу форм кривых плавления ДНК, а именно по максимуму первой производной графиков флуоресценции. Предложенное изобретение позволяет более доступно проводить исследования по определению полиморфизма в гене коллагена II типа COL2A1 С>А (rs1635529) генотипа человека. 1 ил., 2 табл.

 

1. Область техники

Предложенный способ относится к области медицины, биологии и биотехнологии и может быть использован при диагностике заболеваний пародонта в ротовой полости, прогнозирования тяжести и скорости прогрессии заболевания и алгоритма лечения заболевания в зависимости от индивидуального генетического профиля пациента.

На протяжении многих лет заболевания пародонта стабильно занимают по распространенности одно из ведущих мест в мире. Несмотря на широкое развитие инструментальных и лабораторных методов исследования ранняя и точная диагностика различных стоматологических заболеваний до сих пор остается крайне актуальным вопросом.

Известно, что развитие и течение любого заболевания бактериальной природы определяется силой ответной реакции организма, которая, в свою очередь, зависит не только от приобретенного иммунитета, но в значительной степени определяется генотипом человека. За последние 10-15 лет получены первые результаты по идентификации генетических маркеров пародонтита. Установлена ассоциация с пародонтитом полиморфных локусов генов цитокинов, коллагена 1 типа, антигенов HLA, рецептора витамина D, ряда ферментов и регуляторных молекул (Brett P.M. et al., 2005; Agrawal A.A. et al., 2006; Tervonen T. et al., 2007; Wagner J. et al., 2007; Pirhan D. et al., 2007; Scarel-Caminaga R.M. et al., 2011).

Коллагены составляют основу соединительной ткани организма и обеспечивают ее прочность и эластичность. Последние работы указывают на возможную взаимосвязь полиморфизма коллагенов с развитием заболеваний соединительной ткани, таких как остеопороз, остеоартрит, фиброз подслизистой и т.п. Kuivaniemi с соавторами проанализировали 278 полиморфных локусов в генах коллагена I, II, III, IX, X и XI типов у 317 пациентов. В результате было сделано заключение, что отдельные варианты коллагена способствуют развитию некоторых заболеваний костей, хрящей и кровеносных сосудов.

Статистически значимые отличия по частоте встречаемости генотипов были обнаружены для полиморфизма в гене коллагена COL2A1 С>A (rs1635529). Частота встречаемости аллеля С была достоверно выше в основной группе по сравнению с контролем. Гомозиготный вариант СС в исследованном локусе у пациентов с пародонтитом встречался в 1,5 раза чаще, чем в группе здоровых лиц (Зорина, 2011).

2. Уровень техники

Широко распространен способ определения типа нуклеотида, находящегося в определенном месте ДНК, основанный на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР по окончании реакции с помощью электрофореза. При использовании ПЦР с регистрацией результатов в ходе реакции известны различные способы определения генотипа исследуемого образца.

Существуют различные способы, позволяющие определить тип нуклеотида, находящегося в определенном месте ДНК, основанные на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР непосредственно в ходе реакции с помощью использования флуоресцентно-меченных проб (олигонуклеотидов) (Andreas R. Tobler at all, ″THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping″, Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).

Например, в наборах производства Applied Biosystems используют одну пару праймеров для каждого аллеля и два зонда с различными флуорецентными метками, в зависимости от генотипа аллеля фиксируют разгорание различных меток (″TaqMan SNP Genotyping Assays″, Applied Biosistems, Prodakt Bulletin, USA, 06/2006). Недостатком способа, используемого в данных наборах, является сравнительно невысокая достоверность результатов исследования из-за небольшой разницы между получаемыми кривыми флуоресценции для разных аллелей.

Предлагаемым подходом к детекции генетического полиморфизма является использование двух аллель-специфичных и меченных разными флуоресцентными метками олигонуклеотидов, а также олигонуклеотида, несущего гаситель флуоресценции и гибридизирующегося на матрицу рядом с аллель-специфичным олигонуклеотидом. Гибридизация аллель-специфичного олигонуклеотида на матрицу ведет к переносу энергии с находящегося на нем флуорофора-донора на гаситель флуоресценции расположенного рядом «гасящего» олигонуклеотида. Регистрацию результатов амплификации ведут по окончании ПНР путем снятия спектра флуоресценции при изменении температуры реакционной смеси в диапазоне от 25 до 80 градусов по Цельсию (так называемые «кривые плавления»). При получении графиков флуоресценции возможен как нагрев, так и охлаждение реакционной смеси в указанном интервале температур.

Предлагаемое изобретение делает определение вариабельных позиций в ДНК более надежным и удешевляет подобные исследования благодаря использованию стандартного оборудования.

3. Раскрытие изобретения

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является повышение доступности подобных исследований, поскольку способ может быть осуществлен на стандартном известном оборудовании. Также он обеспечивает возможность проводить исследование в одной пробирке, что снижает затраты на исследование.

Использованный нами способ генотипирования является вариантом классического метода «примыкающих проб». При определении замен одиночных нуклеотидов вначале проводили ПЦР с праймерами, общими для обоих вариантов последовательности, затем температуру реакционной смеси снижали для гибридизации полученной матрицы с олигонуклеотидными пробами. Для определения варианта последовательности использовали два типа олигонуклеотидов, гибридизирующихся на матрицу рядом. Один из олигонуклеотидов метили флуорофором, другой - гасителем флуоресценции.

В реакции использовали один общий олигонуклеотид с гасителем флуоресценции и пару аллель-специфичных (сиквенс-специфичных) олигонуклеотидов, несущих флуорофор. Олигонуклеотидные пробы, соответствующие тому или иному варианту последовательности, метили различными флуорофорами, что позволило определять оба варианта в одной пробирке. Определение генотипа проводили после ПЦР и гибридизации путем измерения уровня флуоресценции в ходе температурной денатурации дуплексов олигонуклеотидов и полученных матриц (или наоборот - гибридизации). Данное измерение проводили в режиме реального времени, его результатом являлись кривые плавления.

Условия реакции подбирали так, чтобы максимизировать разницу в температурах плавления совершенного и несовершенного дуплексов. Таким образом, если анализируемый образец содержал только один вариант последовательности, т.е. был гомозиготен по данному полиморфизму, температура плавления для пробы образующей совершенный дуплекс была существенно выше, нежели для пробы образующей несовершенный дуплекс. Если же анализировали гетерозиготный образец, температуры плавления были практически одинаковы.

Указанный результат достигается путем использования при постановке ПЦР флуоресцентно-меченных аллель-специфичных олигонуклеотидных проб и праймеров:

COL2J9s TCTTGCCCAAAGGCTAGGCGGA
COL2_29a CCAGAGGGCGAGAAAGAAACGA
COL2_29p1 AAAAAGGAAAGTTTATC-FAM
COL2_29p2 AAAAAGGAACGTTTATC-HEX
COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции.

Состав амплификационной смеси (на одну реакцию)
Компонент Концентрация Объем
ПЦР - буфер* 1,25 кратный 18 мкл
смесь dNTP 0,25 мМ (каждого) 0,24 мкл
Праймеры 100 пМ/мкл по 0,14 мкл
Олигонуклеотиды, меченные флуорофорами 100 пМ/мкл по 0,07 мкл
Олигонуклеотид, меченный гасителем флуоресценции 100 пМ/мкл 0,14 мкл
Тод-полимераза 10 ед.
активности/мкл
0,5 мкл
Н2O (деионизированная) - до 30 мкл
Геномная ДНК - 5 мкл
*Состав буфера для проведения ПЦР
84 mМ Трис-HCl рН 8,6
21 mM(NH4)2SO4
3,1 mМ MgCl2
0,003% Tween-20
0,003% NP-40
6,25% глицерин

4. Осуществление изобретения

В качестве материала для исследования рекомендуется использовать кровь, соскобы буккального эпителия, биоптаты мягких тканей человека или иной стандартный биологический материал. Выделение ДНК из биоматериала производится с использованием комплекта реагентов для выделения ДНК (не является предметом данного патента).

Полимеразную цепную реакцию и определение температуры плавления олигонуклеотидных проб проводили с помощью детектирующего амплификатора «ДТпрайм» (ООО «НПО ДНК-Технология», Россия). Использовали следующий температурный режим амплификации: 94°С - 10 с, 64°С - 30 с в течение 50 циклов. По завершении реакции амплификации реакционную смесь остужали до 25°С со скоростью 2°С/сек. Кривые плавления получали следующим образом: температуру реакционной смеси повышали с 25°С до 75°С с шагом 1°С, измеряя уровень флуоресценции на каждом шаге.

Результаты, т.е. отнесение образца к гомозиготе или гетерозиготе по данному аллелю, оцениваются по форме кривых плавления ДНК (рис 1).

Список литературы

1. Agrawal А.А., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006. - Vol.77. - P.1515-1521.

2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J. Dent. Res. - 2005. - Vol.84, №12. - P.1149-1153.

3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol.35, №10. - P.862-870.

4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003. - Vol.30. - P.341-345.

5. Tervonen Т., Raunio Т., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol.34. - P.377-383.

6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol.34. - P.823-827.

7. Зорина O.A. Взаимосвязь качественного и количественного состава биоценозов ротовой полости и индивидуального генетического профиля на фоне воспалительных заболеваний пародонта. // Автореферат диссертации - М., 2011.

Способ определения генотипа человека по полиморфизму в гене коллагена II типа COL2A1 С>А (rs1635529), основанный на снятии кривых плавления с флуоресцентно-меченными аллель-специфичными олигонуклеотидными пробами, отличающийся тем, что используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего нуклеотидного состава:

COL2_29s TCTTGCCCAAAGGCTAGGCGGA
COL2_29a CCAGAGGGCGAGAAAGAAACGA
COL2_29p1 AAAAAGGAAAGTTTATC-FAM
COL2_29p2 AAAAAGGAACGTTTATC-HEX
COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции;
отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК, по максимуму первой производной графиков флуоресценции.



 

Похожие патенты:

Изобретение относится к области биотехнологии и пищевой промышленности. Представлено растение ячменя, которое дает зерно и является гомозиготным, по меньшей мере, в двух локусах для введенных генетических вариаций, которые представляют собой: a) аллель, в которой удалена большая часть или все гены, кодирующие В-гордеин в локусе Hor2, и b) мутантную аллель в локусе Lys3 ячменя, так что зерно не содержит ни В-, ни С- гордеинов, и указанные генетические вариации присутствуют в ячмене линий Riso 56 и Riso 1508 соответственно, при этом отсутствие В-гордеинов является обнаружимым по отсутствию амплифицированной ДНК с использованием праймеров: 5'B1hor: 5'-CAACAATGAAGACCTTCCTC-3', 3'B1hor: 5'-TCGCAGGATCCTGTACAACG-3', а отсутствие С-гордеинов является обнаружимым по отсутствию 70 кДа полосы при исследовании спирторастворимого экстракта зерна посредством ДСН-ПААГ.

Изобретение относится к области ветеринарной вирусологии и касается тест-системы и способа для обнаружения РНК вируса болезни Шмалленберг. Предложенная тест-система включает праймер Schm U, имеющий нуклеотидную последовательность 5'-САА ССА GAA GAA GGC САА GA-3', праймер Schm L, имеющий нуклеотидную последовательность 5'-TCT GGC АСА GGA TTT GAG AC-3' и зонд Schm Z, имеющий последовательность 5'-[Hex] CCC CAC САА AAG TAA GAT CGA CAC [BHQ2]-3'.

Изобретение относится к области биотехнологии и касается набора праймеров для выявления генетического материала (РНК) и дифференциации вируса парагриппа человека 1, 2, 3 и 4 типов в клинических образцах.

Изобретение относится к области биотехнологии. Способ мультиплексной детекции представителей родов Aeromonas и Flavobacterium предусматривает постановку ПЦР в один этап с использованием двух пар синтезированных праймеров к участкам гена малой субъединицы рибосомальной РНК (16S rRNA) в режиме реального времени к участку гена малой субъединицы рРНК Aeromonas: А1 - 5'-TTCGGGCCTTGCGCGATTGG-3' и А2 - 5'-CGTGCTGGCAACAAAGGACAG-3', обеспечивающие амплификацию фрагмента размером 920 п.н.

Изобретение относится к области биохимии, в частности к способу дифференциации возбудителя сибирской язвы от других близкородственных видов рода Bacillus на основе определения различий в структуре хромосомных генов.

Изобретение относится к области хронобиологии. Способ определения циркадного цикла у субъекта на основе временных рядов данных по уровням экспрессии, полученных при измерении уровней экспрессии двух часовых генов в биологических образцах, которые берут у субъекта три раза в сутки.

Изобретение относится к области биотехнологии и касается способа количественного определения фиксированного вируса бешенства штамма «Москва 3253». Способ предусматривает обеззараживание и выделение РНК из вируссодержащего материала, постановку реакции обратной транскрипции и полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов в режиме «реального времени» с использованием специфичных праймеров RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' и зонда RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2.

Изобретение относится к области генной инженерии, конкретно к анализу нарушений, связанных с раком яичников, и может быть использовано в медицине. Способ включает определение геномного статуса метилирования CpG-динуклеотидов в каждой последовательности из группы последовательностей SEQ ID NO:1-10 с использованием набора зондов, специфичных для указанных последовательностей и способных гибридизоваться с последовательностью по всей длине.

Изобретение относится к области молекулярной биологии и фармакологии. Предложен способ для предсказания фармакологической эффективности адалимумаба для лечения ревматоидного артрита, где способ включает измерение уровня, по меньшей мере, одной из мРНК ADAMTS4 и мРНК ADAMTS5 в образце, полученном от субъекта, и определение того, эффективен ли адалимумаб против ревматоидного артрита у субъекта, на основе уровня, по меньшей мере, одной из мРНК ADAMTS4 и мРНК ADAMTS5, выступающего в качестве показателя.

Изобретение относится к области биотехнологии и касается набора, включающего олигодезоксирибонуклеотидные праймеры и флуоресцентно меченный зонд для идентификации ДНК аденовируса серотипов 3, 4, 7, 14, 21 методом гибридизационно-флуоресцентной полимеразной цепной реакции в режиме реального времени.

Изобретение относится к области биохимии, в частности к способу идентификации возбудителя чумы и оценки количества микробных клеток, идентифицируемых в качестве возбудителя чумы в исследуемых пробах посредством ПЦР с учетом результатов в режиме реального времени, включающий следующие стадии: выделение ДНК микроорганизма из исследуемых проб, подготовка калибровочной панели, исследование выделенной ДНК в ПЦР с использованием специфических праймеров и зондов с флуоресцентной меткой, идентификация исследуемой ДНК как ДНК микробного или немикробного штамма по наличию нарастания флуоресцентного свечения или его отсутствию соответственно, определение по калибровочной панели концентрации ДНК в пробе. Использование изобретения позволяет повысить эффективность идентификации исследуемой пробы и сократить сроки ее тестирования в режиме реального времени. 2 з.п. ф-лы, 2 ил., 2 табл., 2 пр.

Изобретение относится к области молекулярной биологии, биохимии и медицины. Предложена L-нуклеиновая кислота - антагонист MCP-1 и способ её детектирования. Изобретение может быть использовано в лечении заболеваний, обусловленных MCP-1-механизмом патогенеза. 2 н. и 14 з.п. ф-лы, 50 ил., 1 табл., 9 пр.

Предложенная группа изобретений относится к области ветеринарии. Предложена иммуногенная композиция для собак, содержащая эффективное количество вирионов парвовируса с белком типа VP-2, содержащим нуклеиновую кислоту, выбранную из группы, состоящей из SEQ ID NO:2 и SEQ ID NO:4. Предложен диагностический набор для обнаружения парвовируса у диких и домашних животных, в том числе животных в зоопарках, заповедниках и исследовательских центрах, содержащий гибридизируемые нуклеиновые кислоты, специфические для обнаружения у указанных животных последовательности SEQ ID NO:2 или SEQ ID NO:4. Предложенная группа изобретений обеспечивает эффективные средства иммунизации собак против парвовируса, а также диагностические средства для обнаружения парвовируса у животных. 2 н. и 5 з.п. ф-лы, 8 ил., 1 табл., 5 пр.

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию. Предложены способы получения вышеуказанного биокомпозита и набор для его приготовления. Предложены также способ обеспечения заживления повреждения у млекопитающего и способ доставки нуклеиновой кислоты. Предложенная группа изобретений обеспечивает эффективную регенерацию тканей после повреждения у млекопитающего за счет использования трехкомпонентного биокомпозита, состоящего из носителя, по меньшей мере одной нуклеиновой кислоты и клеток, обеспечивающих репаративную регенерацию. 7 н. и 9 з.п. ф-лы, 4 ил., 4 пр.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме. Способ включает получение биологического образца животного, причем образец содержит набор анализируемых веществ, включающий, по меньшей мере, цитокин, хемокин, гормон и адипокин. Проводят взаимодействие образца с коллекцией молекулярных зондов, иммобилизованных отдельно друг от друга к панели для мультипараметрического анализа, для определения присутствия каждого вещества из заданного набора анализируемых веществ. Для каждого анализируемого вещества в наборе коллекция молекулярных зондов включает, по меньшей мере, один зонд, подходящий для детектирования присутствия этого анализируемого вещества. Причем каждый зонд способен производить независимо детектируемый сигнал, если анализируемое вещество присутствует в образце. Детектируют независимо сигналы, полученные после взаимодействия образца с коллекцией. Устанавливают корреляцию между сигналами и присутствием вещества из набора анализируемых веществ в образце. Устанавливают корреляцию между присутствием вещества из набора анализируемых веществ в образце и известными параметрами состояния здоровья. Оценивают состояние здоровья животных в соответствии с полученными результатами. Изобретение позволяет сократить количество биологического материала, реактивов, время анализа при осуществлении способа оценки воспаления и/или резистентность к инсулину у животного. 10 з.п. ф-лы, 1 ил., 7 табл., 2 пр.

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности. При этом применение рестриктазы Нае III позволяет проводить дифференциацию авирулентных штаммов бластоцист на основе наличия фрагментов размером 850 п.н. и вирулентных на основе наличия фрагментов ДНК размером от 550 до 10000 п.н. При помощи рестриктазы Pst I выявляют бластоцисты с умеренно выраженной вирулентностью на основе наличия фрагментов ДНК размером около 900 п.н. Применение рестриктазы Hind III позволяет типировать бластоцисты со слабовыраженной вирулентностью на основе фрагментов ДНК, размером 700 п.н., а также высоковирулентные штаммы бластоцист на основе наличия фрагментов ДНК, размеров 380 и 600 п.н. Способ позволяет повысить эффективность определения вирулентности простейших. 6 ил.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы). Способ включает взятие у спортсмена контрольного образца до интенсивной тренировки и опытного образца после интенсивной тренировки. В качестве образца используется образец крови или соскоба или смыва с ротовой полости. Отбирают и промывают полученные клетки. Выделяют из клеток тотальную РНК. Проводят обратную транскрипцию, а затем амплификацию полученных кДНК. Оценивают экспрессии гена ТРСазы в опытном и контрольном образцах. Состояние утомления и состояние «перетренированности» определяется в случае значительного увеличения уровня экспрессии гена ТРСазы в опытном образце по сравнению с контрольным образцом, а именно более чем в 1,45 раза. Предложенное изобретение позволяет существенно повысить информативность, упростить и ускорить процедуру тестирования. 3 з.п. ф-лы, 1 табл., 3 ил.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum. Описан способ идентификации в гибридном растении Capsicum annuum локуса количественного признака («QTL»), который способствует устойчивости к Bemisia. Изобретение позволяет эффективно идентифицировать в гибридном растении Capsicum annuum QTL, который способствует устойчивости к Bemisia. 2 н.п. ф-лы, 11 табл., 3 пр.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта. Способ включает определение отношения экспрессии гена парного бокса 2 к экспрессии гена бета-дефензина-1 (PAX2-к-DEFB1) в клетках, полученных из молочной железы субъекта, при этом отношение экспрессии PAX2-к-DEFB1 коррелирует с состояниями молочной железы. Также предложен набор для мониторинга рака молочной железы. Изобретение может быть использовано в медицине при лечении и мониторинге рака. 3 н. и 7 з. п. ф-лы, 40 ил., 8 табл., 17 пр.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека. Разработан набор для количественного определения мРНК МСР1, включающий комбинации олигонуклеотидных праймеров и флюоресцентных зондов для ОТ-ПЦР в реальном времени, для определения количества кДНК гена МСР1 и нормировочных генов RPL32, АСТВ, PII. Использование группы изобретений позволяет уменьшить ошибки вычисления, вносимые при использовании одного нормировочного гена без увеличения числа амплификаций, а также уменьшить ошибки вычислений, возникающие при упрощенном предположении о равенстве эффективности реакций амплификации кДНК MCP1 и нормировачного гена, имеющего место в методе ∆∆Ct. 2 н.п. ф-лы, 2 ил., 3 табл., 1 пр.
Наверх