Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения



Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения
Антитела к рецептору конечных продуктов глубокого гликирования (rage) и их применения

 


Владельцы патента RU 2518351:

ЭББВИ ДОЙЧЛАНД ГМБХ УНД КО.КГ, (DE)
ЭББВИ ИНК (US)

Изобретение относится к области биотехнологии, конкретно к выделенным моноклональным антителам, в частности CDR-привитым гуманизированным антителам, которые связываются с эпитопом молекулы RAGE человека и, в частности обладают способностью ингибировать связывание RAGE с различными лигандами. Изобретение также относится к способу получения указанных антител, выделенной нуклеиновой кислоте, их кодирующей, вектору экспрессии, клетке-хозяину и фармацевтической композиции. Изобретение позволяет эффективно лечить заболевания или расстройства, ассоциированные с рецептором конечных продуктов глубокого гликирования (RAGE), в том числе болезнь Альцгеймера. 9 н. и 7 з. п. формулы, 13 ил., 10 табл., 19 пр.

 

2420-172588RU/011

АНТИТЕЛА К РЕЦЕПТОРУ КОНЕЧНЫХ ПРОДУКТОВ ГЛУБОКОГО ГЛИКИРОВАНИЯ (RAGE) И ИХ ПРИМЕНЕНИЯ

ОПИСАНИЕ

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящая заявка относится к антителам, в частности, к моноклональным антителам и, в частности к их CDR-привитым гуманизированным вариантам, которые можно применять для лечения и диагностики болезни Альцгеймера (AD), дегенерации клеток центральной нервной системы, нарушения обучения и памяти, аномального транспорта амилоида β и других нейровоспалительных состояний, ассоциированных с рецептором конечных продуктов глубокого гликирования (RAGE). В частности, настоящее изобретение относится к антителам и их фрагментам, которые связываются с RAGE.

УРОВЕНЬ ТЕХНИКИ

Болезнь Альцгеймера (AD) является наиболее частой причиной деменции у пожилых людей с частотой встречаемости около 10% в популяции людей в возрасте свыше 65 лет. С увеличением возраста вероятность заболевания также возрастает. В мире около 15 миллионов людей поражены заболеванием, и предполагается, что дальнейшее увеличение продолжительности жизни приведет к увеличению количества людей, пораженных заболеванием, примерно в три раза в течение следующих десятилетий. С точки зрения вышесказанного существует огромная и неотложная потребность в лечении AD. В случае такого лечения пораженные пациенты смогут поддерживать функциональный и активный образ жизни в течение многих лет, что невозможно без такого лечения. Таким образом, существуют не только финансовые последствия такого лечения, но также последствия для «качества жизни» пациентов, а также людей, осуществляющих уход за больными.

С молекулярной точки зрения AD характеризуется отложениями аномально агрегированных белков. В случае внеклеточных амилоидных бляшек такие отложения главным образом состоят из филаментов β-амилоидных пептидов (Aβ), и в случае внутриклеточных нейрофибриллярных клубков (NFT), главным образом, из белка tau. AD также характеризуется повышенной экспрессией RAGE в нейронах. RAGE является рецептором семейства иммуноглобулинов, имеющим много лигандов, который функционирует в качестве передающего сигнал акцептора Aβ на клеточной поверхности.

Несколькими группами показано, что инфузия Aβ40 у мышей приводит к вазоконстрикции сосудов головного мозга и ослаблению мозгового кровообращения (CBF). Пациенты, страдающие AD, также имеют ослабленное мозговое кровообращение. В мышиных моделях AD, в которых трансгенные животные сверхэкспрессируют белок амилоидного предшественника (APP), который приводит к заболеванию, вызывая образование бляшек, показано, что RAGE вовлечен в качестве патогенного фактора в прогрессирование заболевания (Deane et al. Nature Medicine, 9(7) pp. 907-913, 2003; Arancio et al. EMBO J, 1-10, 2004).

Показано, что RAGE связывается с Aβ-пептидами. Ингибирование такого взаимодействия подавляет накопление Aβ у трансгенных животных в модели; поэтому полагают, что RAGE вовлечен в AD. Показано, что лечение с использованием sRAGE (растворимого RAGE), а также анти-RAGE-антителами снижает количество бляшек (Deane et al, 2003). Блокирование взаимодействия RAGE с амилоидом с помощью антител может быть подходящим способом лечения пациентов с AD; однако, существующие поликлональные антитела, полученные из сыворотки животных, не подходят для хронического лечения человека.

Взаимодействие RAGE с Aβ раскрыто в заявке WO 2006/077101 A1, в которой описана конкуренция RAGE, в котором отсутствует v-домен, за связывание Aβ с RAGE, а также конкуренция пептидов, представляющих собой части C-концевого домена RAGE, главным образом, C1-домена. Взаимодействие анти-RAGE-антител с v-доменом RAGE описано в WO2007109749(A2); где также описано, что связывание различных лигандов (S100b, HMGB1 (белок 1 высокомобильной группы), амилоид aβ) с RAGE может осуществляться посредством связывания с указанным доменом.

В публикации WO 2008/137552 A2 описано связывание некоторых моноклональных анти-RAGE-антител с разными доменами RAGE. Большинство из указанных антител ингибируют взаимодействие RAGE человека и комплекса HMGB1 и CpG-ДНК.

Публикация WO2006/077101 относится к идентификации, функциональности и применению пептидов RAGE, названных AGER-RME и AGER-CDP. Указанные пептиды наряду с прочим применимы для идентификации и получения RAGE-связывающих лигандов, подобных анти-RAGE-антителам. В настоящем изобретении описаны новые моноклональные антитела, которые связываются с C-доменами RAGE, и специфичное взаимодействие и конкуренция за связывание с Aβ с моноклональными антителами к C1- и C2-домену RAGE.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к связывающим молекулам, в частности антителам, которые специфично связываются с RAGE; типичные анти-RAGE-антитела согласно изобретению могут содержать, по меньшей мере, одну из аминокислотных последовательностей вариабельной области антитела, показанных в SEQ ID NO: 1, 5, 9, 13, 17 и 21, или их отдельные CDR или родственные CDR последовательности, которые более подробно охарактеризованы ниже.

В частности, в настоящем изобретении предлагаются моноклональные антитела, которые связываются с RAGE, более конкретно, моноклональные антитела, которые связываются с C-доменом RAGE.

В настоящее изобретение включены анти-RAGE-антитела, которые специфично связываются с RAGE и содержат вариабельную область легкой цепи, имеющую аминокислотную последовательность, которая, по меньшей мере, на 90% идентичная любой из последовательностей SEQ ID NO: 5, 13 и 21, или представляет собой RAGE-связывающий фрагмент антитела в пределах указанных последовательностей.

Также предлагаются анти-RAGE-антитела, которые специфично связываются с RAGE и содержат вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, которая, по меньшей мере, на 90% идентична любой из последовательностей SEQ ID NO: 1, 9 и 17, или представляет собой RAGE-связывающий фрагмент антитела в пределах указанных последовательностей.

Конкретный вариант осуществления настоящего изобретения представлен несколькими моноклональными антителами, которые способны связываться с C-доменом RAGE и блокировать связывание Aβ-глобуломеров. Более конкретно настоящее изобретение относится к моноклональному антителу 11E6, которое связывается с C-2-доменом RAGE, не связывается с пептидами с аминокислотными последовательностями, используемыми для создания поликлональных антител, и способно нейтрализовать in vivo влияние Aβ1-40 на сосуды головного мозга у мышей.

К анти-RAGE-антителам согласно изобретению относятся антитела, которые специфично связываются с C-доменом RAGE.

Анти-RAGE-антитела согласно изобретению включают анти-RAGE-антитело или его RAGE-связывающий фрагмент, которое описано выше и которое выбрано из группы, состоящей из химерного антитела, CDR-привитого или гуманизированного антитела, одноцепочечного антитела, слитого белка и антитела человека.

В различных вариантах антитела согласно изобретению представляют собой рекомбинантные антитела или моноклональные антитела. Конкретные нейтрализующие антитела, описанные в настоящей заявке, названы mAb7F9 mAb11E6, и mAb4E5, и функциональные фрагменты таких антител и другие антитела и функциональные фрагменты антител со свойствами, эквивалентными свойствам mAb7F9, mAb11E6 и mAb4E5, такими как высокая аффинность связывания с RAGE с низкой кинетикой диссоциации и высокая нейтрализующая способность, считаются частью настоящего изобретения. Однако антитела человека согласно настоящему изобретению могут содержать аминокислотные остатки, которые не закодированы в иммуноглобулине зародышевой линии к иммуногенному полипептиду RAGE или его фрагменту, которые могут быть определены любым способом, известным в данной области. Например, аффинность связывания может быть измерена в конкурентных ELISA, РИА, с использованием методики BIAcore или KinExA. Скорость диссоциации также может быть измерена с использованием методики BIAcore или KinExA. Аффинность связывания и скорость диссоциации измеряют на основе резонанса поверхностного плазмона, используя, например, BIAcore.

Одно из моноклональных антител согласно настоящему изобретению, антитело mAb7F9, имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, включающей в себя вариабельную область тяжелой цепи (область VH), содержащую последовательность SEQ ID NO: 1 и последовательности SEQ ID NO: 2, 3, и 4, которые представляют собой остатки 31-35, 50-68 и 101-108 последовательности SEQ ID NO: 1, соответственно. Антитело mAb7F9 согласно настоящему изобретению имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, содержащей вариабельную область легкой цепи (область VL), содержащую последовательность SEQ ID NO: 5, и последовательности SEQ ID NO: 6, 7 и 8, которые представляют собой остатки 24-34, 50-56, 89-97 последовательности SEQ ID NO: 5, соответственно.

Другое из указанных моноклональных антител согласно настоящему изобретению, антитело mAb11E6, имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, включающей в себя вариабельную область тяжелой цепи (область VH), содержащую последовательность SEQ ID NO: 9 и последовательности SEQ ID NO: 10, 11 и 12, которые представляют собой остатки 31-35, 50-66 и 99-109 последовательности SEQ ID NO: 9, соответственно. Антитело mAb11E6 согласно настоящему изобретению имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, включающей в себя вариабельную область легкой цепи (область VL), содержащую последовательность SEQ ID NO: 13 и последовательности SEQ ID NO: 14, 15 и 16, которые представляют собой остатки 24-34, 50-56, 89-97 последовательности SEQ ID NO: 13, соответственно. mAb11E6 связывается с C-2-доменом RAGE, не связывается с пептидами с аминокислотными последовательностями, используемыми для создания поликлональных антител, и способно нейтрализовать in vivo влияние Aβ1-40 на сосуды головного мозга у мышей.

Другое из указанных моноклональных антител согласно настоящему изобретению, антитело mAb4E5, имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, содержащей вариабельную область тяжелой цепи (область VH), содержащую последовательность SEQ ID NO: 17 и последовательности SEQ ID NO: 18, 19 и 20, которые представляют собой остатки 31-35, 50-66 и 99-109 последовательности SEQ ID NO: 17, соответственно. Антитело mAb4E5 согласно настоящему изобретению имеет, по меньшей мере, 90% идентичность аминокислотной последовательности с последовательностью, включающей в себя вариабельную область легкой цепи (область VL), содержащую последовательность SEQ ID NO: 21 и последовательности SEQ ID NO: 22, 23 и 24, которые представляют собой остатки 24-34, 50-56, 89-97 последовательности SEQ ID NO: 21, соответственно.

Также предполагается, что выделенные моноклональные антитела, которые взаимодействуют с RAGE, согласно настоящему изобретению могут представлять собой гликозилированный связывающий белок, при этом антитело или его антигенсвязывающая часть содержит один или несколько углеводных остатков. Образуемый in vivo белковый продукт может подвергаться дальнейшему процессингу, известному как посттрансляционная модификация. В частности, могут быть ферментативно добавлены остатки сахара (гликозил) в ходе процесса, называемого гликозилированием. Получаемые в результате белки, несущие ковалентно связанные олигосахаридные боковые цепи, известны как гликозилированные белки или гликопротеиды. Гликозилирование белков зависит от аминокислотной последовательности представляющего интерес белка, а также клетки-хозяина, в которой белок экспрессируется. Разные организмы могут продуцировать разные ферменты гликозилирования (например, гликозилтрансферазы и гликозидазы) и имеют разные доступные субстраты (сахара нуклеотидов). Вследствие таких факторов картина гликозилирования белков и состав гликозильных остатков могут отличаться, в зависимости от системы хозяина, в которой экспрессируется конкретный белок. Остатки гликозила, применимые в настоящем изобретении, могут включать без ограничения глюкозу, галактозу, маннозу, фукозу, н-ацетилглюкозамин и сиаловую кислоту.

Антитела согласно настоящему изобретению содержат константную область тяжелой цепи, такую как константная область IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgM или IgD. Кроме того, антитело может содержать константную область легкой цепи, либо константную область легкой цепи каппа, либо константную область легкой цепи лямбда. В частности, антитело содержит константную область легкой цепи каппа. Альтернативно, часть антитела может представлять собой, например, Fab-фрагмент или одноцепочечный Fv-фрагмент. В данной области известны замены аминокислотных остатков в Fc-части для изменения эффекторной функции антитела (Winter, et al. Патенты США № 5648260, 5624821). Fc-часть антитела опосредует несколько важных эффекторных функций, например, индукцию цитокинов, ADCC, фагоцитоз, зависимую от комплемента цитотоксичность (CDC) и время полужизни/скорость клиренса антитела и комплексов антиген-антитело. В некоторых случаях такие эффекторные функции требуются для терапевтических антител, но в других случаях они могут быть необязательными или даже вредными, в зависимости от терапевтических целей. Некоторые изотипы IgG человека, в частности, IgG1 и IgG3, опосредуют ADCC и CDC в результате связывания с Fcγ R и C1q комплемента, соответственно. Неонатальные Fc-рецепторы (FcRn) являются важными компонентами, определяющими время полужизни антител в циркуляции. В еще одном варианте заменяют, по меньшей мере, один аминокислотный остаток в константной области антитела, например, Fc-области антитела, так что такие эффекторные функции антитела изменяются.

КРАТКОЕ ОПИСАНИЕ ФИГУР

На фиг. 1A-1C показан анализ ELISA связывания рекомбинантных и полученных из гибридом моноклональных антител против RAGE человека 7F9, 11E6 и 4E5 с рекомбинантным RAGE человека.

На фиг. 2 показана характеристика моноклональных антител 7F9, 11E6 и 4E5 с использованием дот-блот-связывания.

На фиг. 3A-3C показаны результаты анализа HTRF, показывающие конкуренцию sRAGE-Aβ-глобуломеры-моноклональные антитела.

На фиг. 4 показан анализ HTRF связывания sRAGE-Aβ-глобуломер.

На фиг. 5 показано связывание Aβ-глобуломера с sRAGE-Fc и с v-доменом RAGE.

На фиг. 6A-6C показаны эксперименты связывания в ELISA моноклональных антител согласно изобретению с разными фрагментами RAGE.

На фиг. 7A-7C показаны эксперименты связывания в ELISA моноклональных антител согласно изобретению с разными фрагментами RAGE.

На фиг. 8a-8f показаны изменения мозгового кровообращения, индуцированные разными дозами Aβ1-40.

На фиг. 9a-9c показано влияние 11E6 на Aβ1-40-индуцированные изменения мозгового кровообращения.

На фиг. 10 показаны изменения мозгового кровообращения, наблюдаемые у старых мышей Tg2576, которых лечили разными дозами 11E6 или контрольного антитела.

На фиг. 11 показано, что антитело 11E6 защищает нейроны гиппокампа от Aβ-индуцированного расщепления динамина. Верхняя панель: показаны образцы, представляющие повторяющиеся экспериментальные условия в одном эксперименте, концентрации обработки (в мкМ) указаны выше. В клетках без добавления Aβ главным образом наблюдали сигналы интактного (~100 кД) динамина I (1-ый столбик), количество которого уменьшалось, и который превращался в продукт расщепления ~90 кД в клетках, обработанных 5 мкМ Aβ (2-ой столбик). Обработка антителом 11E6 (3-ий столбик) предотвращает расщепление, тогда как контрольное Ig1-антитело (4-ый столбик) не оказывает выраженного защитного эффекта. Нижняя панель: количественная оценка сигнала динамина в трех независимых экспериментах (выраженная в виде % динамина +/- SEM после нормализации по отношению к обработке 0 мкМ Aβ) выявила статистически значимый защитный эффект 11E6 (однофакторный ANOVA, критерий Краскала-Уоллиса с последующим использованием критерия Данна; * означает p<0,05).

На фиг. 12 показано влияние 11E6 (A) или контрольного антитела (B) на индуцированное глобуломером сильное подавление синаптической передачи в культуре среза гиппокампа крыс. 0,1 мкМ 11E6 полностью обращал индуцированное глобуломером нарушение (смотри (A)).

На фиг. 13 показано влияние 12-недельной обработки антителом 11E6 на отложения амилоидных бляшек у мышей Tg2576. Показана площадь, покрытая бляшками (A, B) и количество бляшек (C, D), которые выявляли мечением анти-Aβ-антителом 6G1 после обработки 11E6 или контрольным IgG1-антителом (n=19/группу). Обработка 11E6 уменьшала площадь, покрытую отложениями, и количество отложений в неокортексе на 24,5% (A) и 26,8% (C), соответственно. Статистический анализ выявил сильную тенденцию (звездочки в квадратных скобках, p<0,06; U-критерий Манна-Уитни). Уменьшение было статистически значимым в лобной коре (звездочки, p<0,05; U-критерий Манна-Уитни), при этом площадь отложений уменьшалась на 23,5% (B), а их количество на 26,8% (D) после обработки 11E6.

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO: 1: аминокислотная последовательность VH мАт 7F9.

SEQ ID NO: 2: аминокислотная последовательность CDR-H1 VH мАт 7F9.

SEQ ID NO: 3: аминокислотная последовательность CDR-H2 VH мАт 7F9.

SEQ ID NO: 4: аминокислотная последовательность CDR-H3 VH мАт 7F9.

SEQ ID NO: 5: аминокислотная последовательность VL мАт 7F9.

SEQ ID NO: 6: аминокислотная последовательность CDR-L1 VL мАт 7F9.

SEQ ID NO: 7: аминокислотная последовательность CDR-L2 VL мАт 7F9.

SEQ ID NO: 8: аминокислотная последовательность CDR-L3 VL мАт 7F9.

SEQ ID NO: 9: аминокислотная последовательность VH мАт 11E6.

SEQ ID NO: 10: аминокислотная последовательность CDR-H1 VH мАт 11E6.

SEQ ID NO: 1: аминокислотная последовательность CDR-H2 VH мАт 11E6.

SEQ ID NO: 12: аминокислотная последовательность CDR-H3 VH мАт 11E6.

SEQ ID NO: 13: аминокислотная последовательность VL мАт 11E6.

SEQ ID NO: 14: аминокислотная последовательность CDR-L1 VL мАт 11E6.

SEQ ID NO: 15: аминокислотная последовательность CDR-L2 VL мАт 11E6.

SEQ ID NO: 16: аминокислотная последовательность CDR-L3 VL мАт 11E6.

SEQ ID NO: 17: аминокислотная последовательность VH мАт 4E5.

SEQ ID NO: 18: аминокислотная последовательность CDR-H1 VH мАт 4E5.

SEQ ID NO: 19: аминокислотная последовательность CDR-H2 VH мАт 4E5.

SEQ ID NO: 20: аминокислотная последовательность CDR-H3 VH мАт 4E5.

SEQ ID NO: 21: аминокислотная последовательность VL мАт 4E5.

SEQ ID NO: 22: аминокислотная последовательность CDR-L1 VL мАт 4E5.

SEQ ID NO: 23: аминокислотная последовательность CDR-L2 VL мАт 4E5.

SEQ ID NO: 24: аминокислотная последовательность CDR-L3 VL мАт 4E5.

SEQ ID NO: 25: аминокислотная последовательность константной области тяжелой цепи гамма Ig человека.

SEQ ID NO: 26: аминокислотная последовательность константной области легкой цепи каппа Ig человека.

SEQ ID NO: 27: полная плазмидная нуклеотидная последовательность конструкции №1 (жирным шрифтом), кодирующей OmpA-[RAGE (23-340)]-6His.

SEQ ID NO: 28: полная плазмидная нуклеотидная последовательность конструкции №2 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (24-129)].

SEQ ID NO: 29: полная плазмидная нуклеотидная последовательность конструкции №3 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (24-234)].

SEQ ID NO: 30: полная плазмидная нуклеотидная последовательность конструкции №4 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (24-336)].

SEQ ID NO: 31: полная плазмидная нуклеотидная последовательность конструкции №5 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (130-234)].

SEQ ID NO: 32: полная плазмидная нуклеотидная последовательность конструкции №6 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (130-336)].

SEQ ID NO: 33: полная плазмидная нуклеотидная последовательность конструкции №7 (жирным шрифтом), кодирующей 6His-(Thr)-[RAGE (235-336)].

SEQ ID NO: 34: кодируемая аминокислотная последовательность белка RAGE №1.

SEQ ID NO: 35: кодируемая аминокислотная последовательность белка RAGE №2.

SEQ ID NO: 36: кодируемая аминокислотная последовательность белка RAGE №3.

SEQ ID NO: 37: кодируемая аминокислотная последовательность белка RAGE №4.

SEQ ID NO: 38: кодируемая аминокислотная последовательность белка RAGE №5.

SEQ ID NO: 39: кодируемая аминокислотная последовательность белка RAGE №6.

SEQ ID NO: 40: кодируемая аминокислотная последовательность белка RAGE №7.

SEQ ID NO: 41: аминокислотная последовательность мутантной константной области гамма-1 Ig.

SEQ ID NO: 42: аминокислотная последовательность константной области гамма-2 Ig.

SEQ ID NO: 43: аминокислотная последовательность каркаса VH7-4.1/JH6 FR1.

SEQ ID NO: 44: аминокислотная последовательность каркаса VH7-4.1/JH6 FR2 и VH1-2/JH6 FR2.

SEQ ID NO: 45: аминокислотная последовательность каркаса VH7-4.1/JH6 FR3.

SEQ ID NO: 46: аминокислотная последовательность каркаса VH7-4.1/JH6 FR4 и VH1-2/JH6 FR4.

SEQ ID NO: 47: аминокислотная последовательность каркаса VH1-2/JH6 FR1.

SEQ ID NO: 48: аминокислотная последовательность каркаса VH1-2/JH6 FR3.

SEQ ID NO: 49: аминокислотная последовательность каркаса 1-12/L5/JK2 FR1.

SEQ ID NO: 50: аминокислотная последовательность каркаса 1-12/L5/JK2 FR2.

SEQ ID NO: 51: аминокислотная последовательность каркаса 1-12L5/JK2 FR3.

SEQ ID NO: 52: аминокислотная последовательность каркаса 1-12/L5/JK2 FR4 и 3-15/L2/JK2 FR4.

SEQ ID NO: 53: аминокислотная последовательность каркаса 3-15/L2/JK2 FR1.

SEQ ID NO: 54: аминокислотная последовательность каркаса 3-15/L2/JK2 FR2.

SEQ ID NO: 55: аминокислотная последовательность каркаса 3-15/L2/JK2 FR3.

SEQ ID NO: 56: CDR-привитая аминокислотная последовательность VH 11E6.1-GL.

SEQ ID NO: 57: CDR-привитая аминокислотная последовательность VH 11E6.2-GL.

SEQ ID NO: 58: CDR-привитая аминокислотная последовательность VL 11E6.1-GL.

SEQ ID NO: 59: CDR-привитая аминокислотная последовательность VL 11E6.2-GL.

SEQ ID NO: 60: аминокислотная последовательность hRAGE.

SEQ ID NO: 61: аминокислотная последовательность фрагмента husRAGE.

SEQ ID NO: 62: последовательность гуманизированного антитела VH h11E6.1.

SEQ ID NO: 63: последовательность гуманизированного антитела VL h11E6.1.

SEQ ID NO: 64: последовательность гуманизированного антитела VL h11E6.2.

SEQ ID NO: 65: последовательность гуманизированного антитела VL h11E6.3.

SEQ ID NO: 66: последовательность гуманизированного антитела VL h11E6.4.

SEQ ID NO: 67: последовательность гуманизированного антитела VH h11E6.5.

SEQ ID NO: 68: последовательность гуманизированного антитела VH h11E6.9.

SEQ ID NO: 69: последовательность гуманизированного антитела VH h11E6.16.

SEQ ID NO: 70: аминокислотная последовательность полученного из RAGE пептида NtermR31.

SEQ ID NO: 71: аминокислотная последовательность полученного из RAGE пептида 1.

SEQ ID NO: 72: аминокислотная последовательность полученного из RAGE пептида 2.

SEQ ID NO: 73: аминокислотная последовательность полученного из RAGE пептида 3.

SEQ ID NO: 74: аминокислотная последовательность полученного из RAGE пептида 4.

SEQ ID NO: 75: аминокислотная последовательность полученного из RAGE пептида 5.

SEQ ID NO: 76: аминокислотная последовательность полученного из RAGE пептида 6.

SEQ ID NO: 77: аминокислотная последовательность полученного из RAGE пептида 7.

SEQ ID NO: 78: аминокислотная последовательность полученного из RAGE пептида 8.

SEQ ID NO: 79: аминокислотная последовательность полученного из RAGE пептида 9.

SEQ ID NO: 80: аминокислотная последовательность полученного из RAGE пептида 10.

SEQ ID NO: 81: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 82: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 83: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 84: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 85: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 86: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 87: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 88: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 89: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 90: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 91: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 92: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 93: нуклеотидная последовательность олигонуклеотидных праймеров.

SEQ ID NO: 94: нуклеотидная последовательность олигонуклеотидных праймеров.

ПОДРОБНОЕ ОПИСАНИЕ

1. Общие определения

Если в настоящем описании не указано иное, научные и технические термины, используемые в связи с настоящим изобретением, будут иметь значения, которые обычно подразумевают специалисты в данной области. Значение и объем терминов должен быть ясен, однако, в случае какой-либо скрытой неясности, определения, приведенные в настоящем описании, принимают значения в соответствии с прецедентом любого словарного или внешнего определения. Кроме того, если контекст не требует иного, формы единственного числа будут включать формы множественного числа, и термины во множественном числе включают форму единственного числа. В настоящем описание использованием «или» означает «и/или», если не указано иное. Кроме того, использование термина «включающий в себя», а также других форм, таких как «включает в себя» и «включены», не ограничено. Также, такие термины, как «элемент» или «компонент», охватывают элементы и компоненты, содержащие одну единицу, и элементы и компоненты, которые содержат более одной субъединицы, если специально не указано иное.

В общем, используемые номенклатуры и методики культивирования клеток и тканей, молекулярной биологии, иммунологии, микробиологии, генетики и химии белков и нуклеиновых кислот и гибридизации, описанные в настоящей публикации, хорошо известны и широко используются в данной области. Способы и методики согласно настоящему изобретению обычно осуществляют согласно стандартным способам, хорошо известным в данной области, которые описаны в различных общих и более конкретных публикациях, которые цитированы и обсуждаются на протяжении настоящего описания, если не оговорено особо. Ферментативные реакции и способы очистки осуществляют согласно инструкциям производителя, которые обычно выполняют в данной области, или как описано в настоящей публикации. Номенклатура, используемая в связи с лабораторными способами и методиками аналитической химии, химии органического синтеза и медицинской и фармацевтической химии, описанными в настоящей публикации, хорошо известны и широко применяются в данной области. Для химических синтезов, химических анализов, получения фармацевтических препаратов, приготовления композиций и доставки и лечения пациентов применяют стандартные способы.

Чтобы было легче понять настоящее изобретение, ниже приведены определения выбранных терминов.

Термин «полипептид» в используемом в настоящем изобретении смысле относится к любой полимерной цепи аминокислот. Термины «пептид» и «белок» используют взаимозаменяемо с термином «полипептид», и они также относятся к полимерной цепи аминокислот. Термин «полипептид» охватывает нативные или искусственные белки, фрагменты белков и полипептидные аналоги последовательности белка. Полипептид может быть мономерным или полимерным.

Термин «выделенный белок» или «выделенный полипептид» представляет собой белок или полипептид, который в силу своего происхождения или источника получения не ассоциирован с компонентами, ассоциированными с ним в естественных условиях, которые сопровождают его в его нативном состоянии; который по существу не содержит других белков того же самого вида; который экспрессируется клеткой из другого вида; или который не встречается в природе. Таким образом, полипептид, который синтезирован химическим путем или синтезирован в клеточной системе, отличной от клетки, из которой он происходит в природе, будет «выделенным» от ассоциированных с ним в природе компонентов. Белок также можно сделать по существу не содержащим ассоциированных с ним в природе компонентов путем выделения с использованием способов очистки белка, хорошо известных в данной области.

Термин «извлечение» в используемом в настоящем изобретении смысле относится к способу, позволяющему получить химическую молекулу, такую как полипептид, по существу не содержащую ассоциированных с ней в природе компонентов, путем выделения, например, с использованием методик очистки белка, хорошо известных в данной области.

Термин «рецептор конечных продуктов глубокого гликирования (RAGE)» означает имеющий множество лигандов рецептор семейства иммуноглобулинов, который связывает наряду с другими лигандами растворимый пептид Aβ, S100b и HMGB1 (также известный как амфотерин). RAGE опосредует значимые с точки зрения патофизиологии клеточные изменения в ответ на связывание таких лигандов. У трансгенных животных, сверэкспрессирующих RAGE и APP человека, наблюдают ранние аномалии в пространственном обучении и памяти, что свидетельствует о том, что RAGE является кофактором для Aβ-индуцированного нарушения нейронов при патологиях типа болезни Альцгеймера, и свидетельствует о том, что RAGE является потенциальной терапевтической мишенью для ослабления клеточной дисфункции.

Структура RAGE не расшифрована. Гомология с другими белками приводит к модели, в которой RAGE имеет несколько доменов. Такие домены названы по аналогии с иммуноглобулинами: (i) V-подобный домен на N-конце: такой эквивалентный домен в иммуноглобулинах связывает антиген и представляет собой единственную связывающую область в таких белках. В RAGE такой домен связывается с некоторыми лигандами, подобными S100 (Ostendorp et al. EMBOJ. 26, 3875, 2007; Leclerc et al. JBC 282, 31317, 2007). Связывание моноклонального антитела с v-подобным доменом в RAGE конкурирует со связыванием различных лигандов S100b, HMGB1 и амилоида β (WO2007109749(A2)), что означает, что такие лиганды также могут связываться с RAGE посредством такого же домена. (ii) Первый C2-подобный домен: два домена в RAGE имеют гомологию с C2-доменами иммуноглобулинов; один из этих доменов был назван C1 (номенклатура также использована в Ostendorp et al. BBRC 2006). Описано несколько лигандов, связывающихся с таким доменом, например, S100A12 (также называемый ENRAGE или калгранулином C), который связывается с аффинностью Kd=90 нМ (Hofmann et al. Cell 97, 889, 1999; Xie et al. JBC, 282, 4218, 2007). Aβ конкурирует с S100A12 за такой домен, что свидетельствует о том, что Aβ также связывается с C1-домен. (iii) Второй C2-подобный домен: такой домен называют C2 (номенклатура также использована в Ostendorp et al. BBRC 2006). RAGE-лиганд S100A6 связывается с C2-доменом, и было показано, что антитело, созданное против пептида из C2-домена, конкурирует с S100A6 за такое связывание; антитело приводило к снижению трансдукции сигнала в SH-SY5Y (Leclerc et al. JBC 282, 31317, 2007).

«Домен RAGE» можно определить в соответствии с разными определениями, предлагаемыми в данной области:

Согласно Xie et al. 2007, J. Biol. Chem., Vol. 282: 4218-4231 применимо следующее определение доменов hRAGE:

- V домен (аминокислоты 24-129 SEQ ID NO: 60),

- C1-домен (аминокислоты 130-234 SEQ ID NO: 60),

- C2-домен (аминокислоты 235-336 SEQ ID NO: 60).

Согласно более позднему определению Hudson et al., The FASEB Journal. 2008; 22: 1572-1580, hRAGE (404 аминокислотных остатка согласно последовательности SEQ ID NO: 60) имеет внеклеточную область (аминокислоты 1-342 SEQ ID NO: 60), состоящую из

- сигнального пептида (аминокислоты 1-22 SEQ ID NO: 60), после которого следуют три подобных иммуноглобулину домена, включая

- Ig-подобный домен V-типа (аминокислоты 23-116 SEQ ID NO: 60) и

- двух Ig-подобных 1/2-доменов C2-типа (аминокислоты 124-221 SEQ ID NO: 60; также называемые C1-доменом; и аминокислоты 227-317 SEQ ID NO: 60; также называемые C2-доменом);

- одного трансмембранного домена (аминокислоты 343-363 SEQ ID NO: 60), и

- короткого цитоплазматического хвоста (аминокислоты 364-404 SEQ ID NO: 60).

С точки зрения высокой степени идентичности, в частности в отношении определения доменов V, C1 и C2, и если не оговорено особо, каждое из определений может быть применимо, чтобы определить характеристики связывания связывающих белков согласно настоящему изобретению.

Как указано выше, RAGE способен связывать разные лиганды посредством разных доменов. Результаты экспериментов по конкуренции с другими лигандами, по-видимому, свидетельствуют, что Aβ связывается с C1-доменом (Hofmann et al. Cell 97, 889, 1999 или Xie et al. JBC, 282, 4218, 2007). В качестве не ограничивающих примеров лигандов RAGE могут быть указаны:

- конечные продукты глубокого гликирования (AGE) (Baynes J. W., 1991, Diabetes. 1991, 40: 405-412; Ahmed K. A., 2007, J. Clin. Biochem. Nutr. 41 (2): 97-105);

- представители семейства S100/калгранулин (например, калгранулин C (также известный как ENRAGE и S100A12), S100A1, S100A4, S100A11, S100A13, S100B, и S100P);

- амилоидный-β-пептид (Aβ), как, например, пептид Aβ 1-40;

- глобуломеры амилоида-β; как, например, глобуломеры Aβ1-42, Aβ12-42, Aβ20-42 (смотри Barghorn et al., Globular amyloid β peptide 1-42 oligomer - a homogenous and stable neuropathological protein in Alzheimer's disease) Journal of Neurochemistry, 95(3): 834-847, November 2005; WO2007/062852; WO2008/150949; все публикации включены в виде ссылки);

- интегрины лейкоцитов (например, Mac-1).

Термин «RAGE» в используемом в настоящем изобретении смысле, в частности, относится к RAGE человека, также называемому «hRAGE» или «huRAGE». Если не указано иное, термин «RAGE» также охватывает молекулы RAGE, выделенные или полученные из других, отличных от человека, видов, например, грызунов, подобных мышам или крысам; или молекулы RAGE быка.

Термин «sRAGE» относится к растворимой форме RAGE, полученной из внеклеточного домена RAGE. Например, молекула sRAGE, полученная из RAGE человека, также называемая husRAGE, содержит аминокислотные остатки 1-331 (смотри SEQ ID NO: 61) RAGE человека (смотри SEQ ID NO: 60).

«Биологическая активность» в используемом в настоящем изобретении смысле относится ко всем биологическим свойствам, присущим RAGE, которые определены в настоящем описании.

Термины «специфичное связывание» или «специфично связывающийся» в используемом в настоящем изобретении смысле в отношении к взаимодействию антитела, белка или пептида со второй химической молекулой, означают, что взаимодействие зависит от наличия конкретной структуры (например, «антигенной детерминанты» или «эпитопа», которые определены ниже) на химической молекуле; например, антитело узнает и связывается с конкретной белковой структурой, а не с белками вообще. Если антитело является специфичным для эпитопа «A», то присутствие молекулы, содержащей эпитоп A (или свободного немеченого A), в реакционной смеси, содержащей меченый «A» и антитело, будет уменьшать количество меченого A, связанного с антителом.

Термин «антитело» в используемом в настоящем изобретении широком смысле относится к любой молекуле иммуноглобулина (Ig), состоящей из четырех полипептидных цепей, двух тяжелых (H) цепей и двух легких (L) цепей, или к его любому функциональному фрагменту, мутанту, варианту или производному, который сохраняет существенные свойства молекулы Ig в связывании эпитопа. Такие мутантные формы, варианты или производные формы антитела известны в данной области. Не ограничивающие варианты таких форм обсуждаются ниже. Говорят, что антитело «способно к связыванию» молекулы, если оно способно специфично взаимодействовать с молекулой, связывая тем самым молекулу с антителом.

Подразумевают, что «моноклональное антитело» в используемом в настоящем изобретении смысле относится к препарату молекул антител, которые имеют общую последовательность тяжелой цепи и легкой цепи, в отличие от препаратов «поликлональных» антител, которые содержат смесь разных антител. Моноклональные антитела могут быть получены несколькими новыми способами, подобными фаговому, бактериальному, дрожжевому или рибосомному дисплею, а также классическими способами, например, получаемые из гибридом антитела (например, антитело, секретируемое гибридомой, получаемой с использованием методики гибридом, такой как стандартная методика гибридом Колера и Мильштейна ((1975) Nature 256: 495-497).

В полноразмерном антителе каждая тяжелая цепь состоит из вариабельной области тяжелой цепи (сокращенно называемой в настоящем описании HCVR или VH) и константной области тяжелой цепи. Константная область тяжелой цепи состоит из трех доменов, CH1, CH2 и CH3. Каждая легкая цепь состоит из вариабельной области легкой цепи (сокращенно называемой в настоящем описании LCVR или VL) и константной области легкой цепи. Константная область легкой цепи состоит из одного домена CL. Области VH и VL могут быть дополнительно разделены на области гипервариабельности, называемые областями, определяющими комплементарность (CDR), между которыми находятся области, которые являются более консервативными и называются каркасными областями (FR). Каждая VH и VL состоят из трех CDR и четырех FR, расположенных от амино-конца к карбоксильному концу в следующем порядке: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Молекулы иммуноглобулина могут быть любого типа (например, IgG, IgE, IgM, IgD, IgA и IgY), класса (например, IgG1, IgG2, IgG3, IgG 4, IgA1 и IgA2) или подкласса.

Термин «антигенсвязывающая часть» или «антигенсвязывающий фрагмент» антитела (или просто «часть антитела» или «фрагмент антитела») в используемом в настоящем изобретении смысле относится к одному или нескольким фрагментам антитела, которые сохраняют способность специфично связываться с антигеном (например, RAGE). Было показано, что антигенсвязывающая функция антитела может быть осуществлена фрагментами полноразмерного антитела. Такие варианты антитела также могут представлять собой биспецифичные, двухспецифичные или полиспецифичные формы; специфично связывающиеся с двумя или более разными антигенами. Примерами связывающих фрагментов, охватываемых термином «антигенсвязывающая часть» антитела, являются (i) Fab-фрагмент, моновалентный фрагмент, состоящий из доменов VL, VH, CL и CH1; (ii) F(ab')2-фрагмент, бивалентный фрагмент, содержащий два Fab-фрагмента, связанных дисульфидным мостиком в шарнирной области; (iii) Fd-фрагмент, состоящий из доменов VH и CH1; (iv) Fv-фрагмент, состоящий из доменов VL и VH одного плеча антитела, (v) dAb-фрагмент (Ward et al., (1989) Nature 341: 544-546, Winter et al., публикация PCT WO 90/05144 A1, включенные в настоящее описание в виде ссылки), который содержит один вариабельный домен; и (vi) выделенная область, определяющая комплементарность (CDR). Кроме того, хотя два домена Fv-фрагмента, VL и VH, кодируются отдельными генами, они могут быть связаны с использованием способов рекомбинации синтетическим линкером, который позволяет получать их в виде одной белковой цепи, в которой области VL и VH спарены с образованием моновалентных молекул (известных как одноцепочечный Fv (scFv); смотри, например, Bird et al. (1988) Science 242: 423-426; и Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Также подразумевается, что такие одноцепочечные антитела входят в объем термина «антигенсвязывающая часть» антитела. Также в объем термина входят другие формы одноцепочечных антител, такие как диантитела. Диантитела представляют собой бивалентные, биспецифичные антитела, в которых домены VH и VL экспрессированы в виде одной полипептидной цепи, но с использованием линкера, который является слишком коротким, чтобы обеспечить спаривание между двумя доменами на одной и той же цепи, тем самым заставляя домены образовывать пары с комплементарными доменами другой цепи и образовывать два антигенсвязывающих участка (смотри, например, Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123). Такие связывающие части антител известны в данной области (Kontermann and Dubel eds., Antibody Engineering (2001) Springer-Verlag. New York. 790 pp. (ISBN 3-540-41354-5).

Термин «конструкция антитела» в используемом в настоящем изобретении смысле относится к полипептиду, содержащему одну или несколько антигенсвязывающих частей согласно изобретению, связанных с линкерным полипептидом или константным доменом иммуноглобулина. Линкерные полипептиды содержат два или более аминокислотных остатков, связанных пептидными связями, и используются для связывания одной или нескольких антигенсвязывающих частей. Такие линкерные полипептиды хорошо известны в данной области (смотри, например, Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123). Константный домен иммуноглобулина относится к константному домену тяжелой или легкой цепи. Аминокислотные последовательности константных доменов тяжелой и легкой цепей IgG человека известны в данной области и представлены в таблице 1.

Кроме того, антитело или его антигенсвязывающая часть может быть частью боле крупных молекул иммуноадгезии, образованных в результате ковалентной или нековалентной ассоциации антитела или части антитела с одним или несколькими другими белками или пептидами. Примеры таких молекул иммуноадгезии включают использование стрептавидиновой коровой области для получения тетрамерной молекулы scFv (Kipriyanov, S. M., et al. (1995) Human Antibodies and Hybridomas 6: 93-101) и использование остатка цистеина, маркерного пептида и C-концевой полигитидиновой метки для получения бивалентных и биотинилированных молекул scFv (Kipriyanov, S. M., et al. (1994) Mol. Immunol. 31: 1047-1058). Части антитела, такие как Fab- и F(ab')2-фрагменты, могут быть получены из целых антител обычными способами, такими как расщепление целых антител папаином или пепсином, соответственно. Кроме того, антитела, части антител и молекулы иммуноадгезии могут быть получены с использованием стандартных методик получения рекомбинантной ДНК, которые описаны в настоящей публикации.

Подразумевается, что «выделенное антитело» в используемом в настоящем изобретении смысле, относится к антителу, которое по существу не содержит других антител, имеющих другие антигенные специфичности (например, выделенное антитело, которое специфично связывает RAGE человека, по существу не содержит антител, которые специфично связывают другие антигены, отличные от RAGE человека). Однако выделенное антитело, которое специфично связывает RAGE человека, может обладать перекрестной реактивностью с другими антигенами, такими как молекулы RAGE других видов. Кроме того, выделенное антитело может по существу не содержать другого клеточного материала и/или химических веществ.

Предполагается, что термин «антитело человека» в используемом в настоящем изобретении смысле охватывает антитела, имеющие вариабельные и константные области, полученные из последовательностей иммуноглобулина зародышевой линии человека. Антитела человека согласно изобретению могут включать в себя аминокислотные остатки, не кодируемые последовательностями иммуноглобулина зародышевой линии человека (например, мутации, введенные в результате случайного или сайт-специфичного мутагенеза in vitro или в результате соматической мутации in vivo), например, в CDR, и в частности CDR3. Однако термин «антитело человека» в используемом в настоящем изобретении смысле не предназначен для определения антител, которых последовательности CDR, полученные из зародышевой линии другого вида млекопитающих, такого как мышь, были привиты в каркасные последовательности человека.

Предполагается, что термин «рекомбинантные антитело человека» в используемом в настоящем изобретении смысле охватывает все антитела человека, которые получены, экспрессированы, созданы или выделены основанными на рекомбинации способами, такие как антитела, экспрессированные с использованием рекомбинантного экспрессирующего вектора, которым трансфицировали клетку-хозяина (дополнительно описаны ниже), антитела, выделенные из рекомбинантной комбинаторной библиотеки антител человека (Hoogenboom H. R., (1997) TIB Tech. 15: 62-70; Azzazy H., and Highsmith W. E., (2002) Clin. Biochem. 35: 425-445; Gavilondo J. V., and Larrick J. W. (2002) BioTechniques 29: 128-145; Hoogenboom H., and Chames P. (2000) Immunology Today 21: 371-378), антитела, выделенные из организма животного (например, мыши), которое является трансгенным по генам иммуноглобулина человека (смотри, например, Taylor, L. D., et al. (1992) Nucl. Acids Res. 20: 6287-6295; Kellermann S-A., and Green L. L. (2002) Current Opinion in Biotechnology 13: 593-597; Little M. et al. (2000) Immunology Today 21: 364-370), или антитела, полученные, экспрессированные, созданные или выделенные любым другим способом, который включает в себя сплайсинг последовательностей генов иммуноглобулина человека с другими последовательностями ДНК. Такие рекомбинантные антитела человека имеют вариабельные и константные области, полученные из последовательностей иммуноглобулина зародышевой линии человека. Однако в некоторых вариантах такие рекомбинантные антитела человека подвергают мутагенезу in vitro (или, когда используют животное, трансгенное по последовательностям Ig человека, соматическому мутагенезу in vivo), и следовательно, аминокислотные последовательности областей VH и VL рекомбинантных антител представляют собой последовательности, которые получены из последовательностей VH и VL зародышевой линии человека и являются родственными таким последовательностям, могут не существовать в природе в репертуаре антител человека зародышевой линии in vivo.

Термин «химерное антитело» относится к антителам, которые содержат последовательности вариабельных областей тяжелой и легкой цепей одного вида и последовательности константных областей другого вида, такие как антитела, имеющие вариабельные области тяжелой и легкой цепи мыши, связанные с константными областями человека. Химерное антитело может быть получено основанными на рекомбинации молекулярно-биологическими способами или может быть получено с помощью физической конъюгации.

Термин «CDR-привитое антитело» относится к антителам, которые содержат последовательности вариабельных областей тяжелой и легкой цепей одного вида, но в которых последовательности одной или нескольких областей CDR VH и/или VL заменены последовательностями CDR другого вида, таким как антитела, имеющие вариабельные области тяжелой и легкой цепей мыши, в которых одна или несколько CDR мыши (например, CDR3) были заменены последовательностями CDR человека.

Термины «нумерация по Кабату», «определения по Кабату» и «маркировка по Кабату» используют в настоящем описании взаимозаменяемо. Такие термины, которые известны в данной области, относятся к системе нумерации аминокислотных остатков, которые являются более вариабельными (т.е., гипервариабельными), чем другие аминокислотные остатки в вариабельных областях тяжелой и легкой цепей антитела или его антигенсвязывающей части (Kabat et al. (1971) Ann. NY Acad, Sci. 190: 382-391, и Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). В случае вариабельной области тяжелой цепи гипервариабельная область находится между положениями аминокислот 31-35 в случае CDR1, между положениями аминокислот 50-65 в случае CDR2 и между положениями аминокислот 95-102 в случае CDR3. В случае вариабельной области легкой цепи гипервариабельная область находится между положениями аминокислот 24-34 в случае CDR1, между положениями аминокислот 50-56 в случае CDR2 и между положениями аминокислот 89-97 в случае CDR3.

В используемом в настоящем изобретении смысле термины «акцептор» и «акцепторное антитело» относятся к последовательности антитела или нуклеиновой кислоты, представляющей собой или кодирующей, по меньшей мере, 50, 55, 60, 65, 70, 75 или 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98% или 100% аминокислотных последовательностей одной или нескольких каркасных областей. В некоторых вариантах термин «акцептор» относится к аминокислотной последовательности или последовательности нуклеиновой кислоты антитела, представляющей собой или кодирующей константную область (области). В еще одном варианте термин «акцептор» относится к аминокислотной последовательности или последовательности нуклеиновой кислоты антитела, представляющей собой или кодирующей одну или несколько каркасных областей и константную область (области). В конкретном варианте термин «акцептор» относится к аминокислотной последовательности или последовательности нуклеиновой кислоты антитела человека, которая представляет собой или кодирует, по меньшей мере 50, 55, 60, 65, 70, 75 или 80%, в частности, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98% или 100% аминокислотных последовательностей одной или нескольких каркасных областей. Согласно указанному варианту акцептор может содержать, по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5 или по меньшей мере 10 аминокислотных остатков, которые не встречаются в одном или нескольких конкретных положениях в антителе человека. Акцепторная каркасная область и/или акцепторная константная область (области) могут быть, например, получены из гена антитела зародышевой линии, зрелого гена антитела, функционального антитела (например, антител, известных в данной области, разрабатываемых антител или коммерчески доступных антител).

В используемом в настоящем изобретении смысле термин «CDR» относится к определяющей комплементарность области в вариабельных последовательностях антител. Существует три CDR в каждой из вариабельных областей тяжелой цепи и легкой цепи, которые названы CDR1, CDR2 и CDR3 в случае каждой из вариабельных областей. Термин «набор CDR» в используемом в настоящем изобретении смысле относится к группе из трех CDR, которые находятся в одной вариабельной области, способной связывать антиген. Точные границы таких CDR определяют по разному согласно разным системам. Система, описанная Кабатом (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) и (1991)), не только обеспечивает четкую систему нумерации остатков, применимую к любой вариабельной области антитела, но также позволяет выявить точные границы остатков, определяющих три CDR. Такие CDR могут быть названы CDR согласно системе Кабата. Чотия с соавторами (Chothia and Lesk, J. Mol. Biol. 196: 901-917 (1987) и Chothia et al., Nature 342:8 77-883 (1989)) обнаружили, что некоторые субфрагменты в CDR согласно системе Кабата принимают почти идентичные конформации пептидного остова, несмотря на наличие большого разнообразия на уровне аминокислотной последовательности. Такие субфрагменты названы L1, L2 и L3 или H1, H2 и H3, где «L» и «H» означают области легкой цепи и тяжелой цепи, соответственно. Такие области могут быть названы CDR согласно системе Чотия, которые имеют границы, которые перекрываются с CDR согласно системе Кабата. Другие границы, определяющие CDR, перекрывающиеся с CDR согласно системе Кабата, описаны Padlan (FASEB J. 9: 133-139 (1995)) и MacCallum (J. Mol. Biol. 262(5): 732-45 (1996)). Другие определения границ CDR могут не строго следовать одной из указанных выше систем, однако будут перекрываться с CDR согласно Кабату, хотя они могут быть более короткими или более длинными в свете предварительных оценок или экспериментальных данных о том, что конкретные остатки или группы остатков, или даже полные CDR значимо не влияют на связывание антигена. В способах применяемых согласно настоящему изобретению, можно использовать CDR, определяемые согласно любой из указанных систем, хотя в конкретных вариантах использованы CDR, определяемые согласно Кабату и Чотия.

В используемом в настоящем изобретении смысле термин «канонический» остаток относится к остатку в CDR или каркасе, который определяет конкретную каноническую структуру CDR, которая описана Чотия с соавторами (J. Mol. Biol. 196: 901-907 (1987); Chothia et al., J. Mol. Biol. 227: 799 (1992), обе публикации включены в настоящее описание в виде ссылки). Согласно Чотия с соавторами особенно важные части CDR многих антител имеют почти идентичные конформации пептидного остова, несмотря на большое разнообразие на уровне аминокислотной последовательности. Каждая каноническая структура, главным образом, определяет набор торсионных углов для непрерывного участка аминокислотных остатков, образующих петлю.

В используемом в настоящем изобретении смысле термины «донор» и «донорное антитело» относятся к антителу, обеспечивающему одну или несколько CDR. В конкретном варианте донорное антитело представляет собой антитело вида, отличного от антитела, из которого происходят или из которого получают каркасные области. В контексте гуманизированного антитела термин «донорное антитело» относится к антителу животного, отличного от человека, обеспечивающему одну или несколько CDR.

В используемом в настоящем изобретении смысле, термин «каркас» или «каркасная последовательность» относится к остальным последовательностям вариабельной области за вычетом CDR. Так как точное определение последовательности CDR может быть осуществлено с использованием разных систем, значение каркасной последовательности может быть соответственно, интерпретировано различным образом. Шесть CDR (CDR-L1, -L2 и -L3 легкой цепи и CDR-H1, -H2 и -H3 тяжелой цепи) также делят каркасные области на легкой цепи и тяжелой цепи на четыре подобласти (FR1, FR2, FR3 и FR4) на каждой цепи, при этом CDR1 расположена между FR1 и FR2, CDR2 между FR2 и FR3, и CDR3 между FR3 и FR4. Без специальной характеристики конкретных подобластей FR1, FR2, FR3 или FR4, каркасная область, указываемая другими авторами, представляет собой объединенные области FR в вариабельной области одной встречающейся в природе цепи иммуноглобулина. В используемом в настоящем изобретении смысле «область FR» представляет собой одну из четырех подобластей, а «области FR» представляют собой две или более из четырех подобластей, составляющих каркасную область.

Акцепторные последовательности тяжелой цепи и легкой цепи человека известны в данной области. В одном варианте осуществления изобретения акцепторные последовательности тяжелой цепи и легкой цепи человека выбраны из последовательностей, описанных в таблице 2 и таблице 3. В указанных таблицах представлены разные сочетания каркасных последовательностей FR1-FR4 человека.

В используемом в настоящем изобретении смысле термин «ген антитела зародышевой линии» или «фрагмент гена» относится к последовательности иммуноглобулина, кодируемой нелимфоидными клетками, которые не были подвергнуты процессу созревания, который приводит к генетической перестройке и мутации для экспрессии конкретного иммуноглобулина. (Смотри, например, Shapiro et al., Crit. Rev. Immunol. 22(3): 183-200 (2002); Marchalonis et al., Adv. Exp Med. Biol. 484: 13-30 (2001)). Одно из преимуществ, предлагаемых различными вариантами осуществления настоящего изобретения, связано с известными данными о том, что гены антител зародышевой линии более вероятно, чем зрелые гены антител, сохраняют существенные структуры аминокислотной последовательности, характерные для особей данного вида, следовательно, антитела менее вероятно должны распознаваться как происходящие из чужеродного источника при терапевтическом применении у данного вида.

В используемом в настоящем изобретении смысле термин «ключевые» остатки относится к некоторым остаткам в вариабельной области, которые оказывают большее влияния на специфичность и/или аффинность связывания антитела, в частности, гуманизированного антитела. Ключевым остатком без ограничения может быть один или несколько из следующих остатков: остаток, который соседствует с CDR, потенциальный сайт гликозилирования (может быть сайт либо N-, либо O-гликозилирования), редкий остаток, остаток, способный взаимодействовать с антигеном, остаток, способный взаимодействовать с CDR, канонический остаток, остаток контакта между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, остаток в верниер-зоне и остаток в области, которая является областью перекрывания между CDR1 вариабельной области тяжелой цепи согласно определению Чотия и первой каркасной областью тяжелой цепи согласно определению Кабата.

Термин «гуманизированное антитело» в общем относится к антителам, которые содержат последовательности вариабельных областей тяжелой и легкой цепи вида животных, отличного от человека (например, мыши), но в которых, по меньшей мере, часть последовательности VH и/или VL была изменена до более «подобной человеческой», т.е. более сходной с вариабельными последовательностями зародышевой линии человека. Один тип гуманизированного антитела представляет собой CDR-привитое антитело, в котором последовательности CDR человека введены в последовательности VH и VL животного отличного от человека, чтобы заменить соответствующие последовательности CDR животного, отличного от человека.

В частности, термин «гуманизированное антитело» в используемом в настоящем изобретении смысле означает антитело или его вариант, производное, аналог или фрагмент, который иммуноспецифично связывается с представляющим интерес антигеном и который содержит каркасную область (FR), по существу имеющую аминокислотную последовательность антитела человека, и определяющую комплементарность область (CDR), по существу имеющую аминокислотную последовательность антитела животного, отличного от человека. В используемом в настоящем изобретении смысле термин «по существу» в контексте CDR относится к CDR, имеющей аминокислотную последовательность, по меньшей мере, на 50, 55, 60, 65, 70, 75 или 80%, в частности, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98% или по меньшей мере на 99% идентичную аминокислотной последовательности CDR антитела животного, отличного от человека. Гуманизированное антитело содержит по существу полностью, по меньшей мере, один и обычно два вариабельных домена (Fab, Fab', F(ab')2, FabC, Fv), в которых все или по существу все области CDR соответствуют областям CDR иммуноглобулина животного, отличного от человека (т.е., донорного антитела), и все или по существу все каркасные области представляют собой каркасные области консенсусной последовательности иммуноглобулина человека. В частности, гуманизированное антитело также содержит, по меньшей мере, часть константной области (Fc) иммуноглобулина, обычно константой области иммуноглобулина человека. В некоторых вариантах гуманизированное антитело содержит как легкую цепь, так и, по меньшей мере, вариабельный домен тяжелой цепи. Антитело также может включать в себя области CH1, шарнира, CH2, CH3 и CH4 тяжелой цепи. В некоторых вариантах гуманизированное антитело содержит только гуманизированную легкую цепь. В некоторых вариантах гуманизированное антитело содержит только гуманизированную тяжелую цепь. В конкретных вариантах гуманизированное антитело содержит только гуманизированный вариабельный домен легкой цепи и/или гуманизированную тяжелую цепь.

Гуманизированное антитело может быть выбрано из любого класса иммуноглобулинов, включая IgY, IgM, IgG, IgD, IgA и IgE, и любого изотипа, включая без ограничения IgA1, IgA2, IgG1, IgG2, IgG3 и IgG4. Гуманизированное антитело может содержать последовательности из более чем одного класса или изотипа, и в частности, константные домены могут быть выбраны для оптимизации требуемых эффекторных функций с использованием методик, хорошо известных в данной области.

Каркасные области и области CDR гуманизированного антитела не должны обязательно точно соответствовать исходным последовательностям, например, CDR донорного антитела или консенсусный каркас могут быть подвергнуты мутагенезу путем замены, инсерции и/или делеции, по меньшей мере, одного аминокислотного остатка, так чтобы остаток CDR или каркаса в данном сайте не соответствовал ни донорному антителу, ни консенсусному каркасу. Однако в конкретном варианте такие мутации не будут обширными. Обычно, по меньшей мере, 50, 55, 60, 65, 70, 75 или 80%, предпочтительно, по меньшей мере 85%, более предпочтительно, по меньшей мере 90%, и в частности, по меньшей мере 95% остатков гуманизированного антитела будут соответствовать остаткам исходных последовательностей FR и CDR. В используемом в настоящем изобретении смысле термин «консенсусный каркас» относится к каркасной области в консенсусной последовательности иммуноглобулина. В используемом в настоящем изобретении смысле термин «консенсусная последовательность иммуноглобулина» относится к последовательности, образованной из наиболее часто встречающихся аминокислот (или нуклеотидов) в семействе родственных последовательностей иммуноглобулина (смотри, например, Winnaker, From Genes to Clones (Verlagsgesellschaft, Weinheim, Germany 1987). В семействе иммуноглобулинов каждое положение в консенсусной последовательности занято аминокислотой, встречающейся наиболее часто в данном положении в семействе. Если две аминокислоты встречаются с одинаковой частотой, в консенсусную последовательность может быть включена любая из них.

В используемом в настоящем изобретении смысле «верниер-зона» относится к подгруппе каркасных остатков, которые могут корректировать структуру CDR и точную подгонку к антигену, как описано в Foote and Winter (1992, J. Mol. Biol. 224: 487-499, публикация включена в настоящее описание в виде ссылки). Остатки верниер-зоны образуют слой, лежащий под CDR, и могут влиять на структуру CDR и аффинность антитела.

Термин «ингибирование связывания» RAGE с одним из его лигандов в используемом в настоящем изобретении смысле охватывает частичное (например, примерно на 1-10% или больше, в частности, примерно на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% или 95%, или больше) или полное уменьшение активности связывания указанного лиганда. Указанное «ингибирование связывания» можно определять любым подходящим способом, доступным в данной области, предпочтительно любым способом, который приведен в качестве примера в настоящем описании, например, с использованием анализов HTRF, описанных в настоящей публикации.

В используемом в настоящем изобретении смысле термин «нейтрализация» относится к нейтрализации биологической активности белка-мишени, когда связывающий белок специфично связывает белок-мишень. Нейтрализация может быть результатом разных путей связывания указанного связывающего с мишенью. Например, нейтрализация может быть вызвана связыванием связывающего белка в области мишени, которая не влияет на связывание рецептора с молекулой-мишенью. Альтернативно связывание связывающего белка может приводить к блокаде связывания рецептора с мишенью, и такая блокада в конце концов нейтрализует активность белка-мишени. Каждый из различных указанных механизмов может иметь место согласно изобретению.

В частности, нейтрализующий связывающий белок представляет собой нейтрализующее антитело, связывание которого с RAGE приводит к нейтрализации биологической активности RAGE. В частности нейтрализующий связывающий белок связывает RAGE и снижает биологическую активность RAGE, по меньшей мере, примерно на 1-10%, по меньшей мере, примерно на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% или больше. Нейтрализацию биологической активности RAGE нейтрализующим связывающим белком можно оценить измерением одного или нескольких показателей биологической активности RAGE, хорошо известных в данной области и/или проиллюстрированных в экспериментальной части, в частности, в примерах 5, 6, 10 и 16-19. Например, нейтрализация RAGE нейтрализует связывание RAGE с Aβ-глобуломерами, как измерено в примерах 5 и 6 ниже.

«Ингибирование индуцированного растворимым пептидом Aβ1-40 уменьшения церебрального объема крови», определяемое in vivo в животной модели, относится к частичному или полному ингибированию, например, по меньшей мере, примерно на 1-10%, по меньшей мере, примерно на 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% или больше, по сравнению с необработанным контролем или, в частности, по сравнению с негативным, моноклональным или поликлональным контролем изотипа иммуноглобулина.

«Увеличение церебрального объема крови (CBV)», например, in vivo в модели на животных, сверхэкспрессирующих APP человека, относится к статистически значимому увеличению CBV по сравнению с необработанным контролем или, в частности, по сравнению с негативным, моноклональным или поликлональным контролем изотипа иммуноглобулина.

«Уменьшение количества амилоидных бляшек и/или площади амилоидных бляшек», которое измеряют in vivo в модели на животных, сверхэкспрессирующих APP человека, относится к частичному или полному снижению, например, по меньшей мере, примерно на 1-10%, по меньшей мере, примерно на 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% или больше, по сравнению с необработанным контролем или, в частности, по сравнению с негативным, моноклональным или поликлональным контролем изотипа иммуноглобулина.

«Ингибирование индуцированного агрегированным пептидом Aβ1-40 расщепления динамина нейронов гиппокампа in vitro» относится к частичному или полному ингибированию, например, по меньшей мере, примерно на 1-10%, по меньшей мере, примерно на 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% или больше, по сравнению с необработанным контролем или, в частности, по сравнению с негативным, моноклональным или поликлональным контролем изотипа иммуноглобулина.

«Отмена индуцированного глобуломером Aβ1-42 снижения синаптической передачи» in vitro относится к частичной или полой отмене, например, по меньшей мере, примерно 1-10%, по меньшей мере, примерно на 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% или больше, по сравнению с необработанным контролем или, в частности, по сравнению с негативным, моноклональным или поликлональным контролем изотипа иммуноглобулина.

Подразумевается, что «нейтрализующие моноклональное антитело» в используемом в настоящем изобретении смысле относится к препарату молекул антител, которые при связывании со специфичным антигеном способны конкурировать и ингибировать связывание природного лиганда для указанного антигена. В конкретном варианте осуществления настоящего изобретения нейтрализующие антитела согласно настоящему изобретению способны конкурировать с RAGE за связывание, по меньшей мере, с одним из его лигандов, в частности, с лигандом, выбранным из Aβ-пептидов, Aβ-глобуломеров, S100b и амфотерина, и предотвращать биологическую активность или функцию RAGE.

Термин «активность» охватывает такие активности, как специфичность/аффинность связывания антитела с антигеном, например, анти-RAGE-антитела, которое связывается с антигеном RAGE, и/или нейтрализующая способность антитела, например, анти-RAGE-антитела, связывание которого с RAGE нейтрализует биологическую активность RAGE.

«Биологическая функция» или «активность» RAGE может быть описана как активность Aβ-рецептора клеточной поверхности, передающего сигнал, или рецептора, который опосредует транспорт белков в клетку или по клетке.

Термин «эпитоп» или «антигенная детерминанта» включает в себя любую полипептидную детерминанту, способную специфично связываться с иммуноглобулином или T-клеточным рецептором. В некоторых вариантах, детерминанты эпитопа включают в себя химически активные поверхностные группы молекул, таких как аминокислоты, боковые цепи сахаров, фосфорил или сульфонил, и в некоторых вариантах могут иметь специфичные признаки трехмерной структуры и/или специфичные характеристики заряда. Эпитоп представляет собой область антигена, который связывается антителом. В некоторых вариантах говорят, что антитело специфично связывает антиген, когда оно преимущественно распознает свой антиген-мишень в сложной смеси белков и/или макромолекул.

Термин «резонанс поверхностного плазмона» в используемом в настоящем изобретении смысле относится к оптическому явлению, которое обеспечивает возможность анализа биспецифичных взаимодействий в режиме реального времени посредством выявления изменений концентраций белков на биосенсорной матрице, например, с использованием системы BIAcore (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.). Дополнительное описание смотри в Jönsson, U., et al. (1993) Ann. Biol. Clin. 51: 19-26; Jönsson, U., et al. (1991) Biotechniques 111: 620-627; Johnsson, B., et al. (1995) J. Mol. Recognit. 8: 125-131; и Johnnson, B., et al. (1991) Anal. Biochem. 198: 268-277.

Подразумевается, что термин «kon» в используемом в настоящем изобретении смысле относится к константе скорости ассоциации антитела с антигеном с образованием комплекса антитело/антиген, как известно в данной области.

Подразумевается, что термин «koff» в используемом в настоящем изобретении смысле относится к константе скорости диссоциации антитела из комплекса антитело/антиген, как известно в данной области.

Подразумевается, что термин «Kd» в используемом в настоящем изобретении смысле относится к константе диссоциации при конкретном взаимодействии антитело-антиген, как известно в данной области.

Термин «меченый связывающий белок» в используемом в настоящем изобретении смысле относится к белку с включенной меткой, которая обеспечивает идентификацию связывающего белка. В частности, метка представляет собой регистрируемый маркер, например, включение радиоактивно меченой аминокислоты или связывание с полипептидом остатков биотинила, которые могут быть выявлены с помощью меченого авидина (например, стрептавидином, содержащим флуоресцирующий маркер или ферментативную активность, которая может быть выявлена оптическими или калориметрическими способами). Примеры меток для полипептидов включают без ограничения следующие метки: радиоактивные изотопы или радионуклиды (например, 3H, 14C, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho или 153Sm); флуоресцирующие метки (например, ФИТЦ, родамин, лантанидные люминофоры), ферментативные метки (например, пероксидаза хрена, люцифераза, щелочная фосфатаза), хемилюминесцентные метки; биотинилированные группы; предварительно определяемые полипептидные эпитопы, узнаваемые вторым репортером (например, парные последовательности лейциновой молнии, сайты связывания для вторых антител, домены связывания металлов, эпитопные метки) и магнитные средства, такие как хелаты гадолиния.

Термин «конъюгат антитела» относится к связывающему белку, такому как антитело, химически связанному со вторым химическим компонентом, таким как терапевтическое или цитотоксическое средство. Термин «средство» использован в настоящем описании для обозначения химического соединения, смеси химических соединений, биологической макромолекулы или экстракта, полученного из биологических материалов. В частности, терапевтические или цитотоксические средства включают без ограничения коклюшный токсин, таксол, цитохалазин B, грамицидин D, бромид этидия, эметин, митомицин, этопозид, тенопозид, винкристин, винбластин, колхицин, доксорубицин, даунорубицин, дигидроксиантрациндион, митоксантрон, митрамицин, актиномицин D, 1-дегидротестостерон, глюкокортикоиды, прокаин, тетракаин, лидокаин, пропранолол и пуромицин и их аналоги или гомологи.

Термины «кристалл» и «кристаллизованное» в используемом в настоящем изобретении смысле относится к антителу или его антигенсвязывающей части, которые существуют в форме кристалла. Кристаллы представляют собой одну из форм твердого состояния вещества, которое отличается от других форм, таких как аморфное твердое состояние или жидкокристаллическое состояние. Кристаллы состоят из правильных повторяющихся трехмерных наборов атомов, ионов, молекул (например, белков, таких как антитела) или молекулярных ансамблей (например, комплексов антиген/антитело). Такие трехмерные ансамбли расположены согласно конкретным математическим взаимосвязям, которые хорошо известны в данной области. Фундаментальная единица или строительный блок, который повторяется в кристалле, называют ассиметричной единицей. Повторение ассиметричной единицы в структуре, которое подчиняется некоторой хорошо определенной кристаллографической симметрии, создает «элементарную ячейку» кристалла. Повторение элементарной ячейки в результате регулярных трансляций во всех трех направлениях создает кристалл. Смотри Giege, R. and Ducruix, A. Barrett, Crystallization of Nucleic Acids and Proteins, a Practical Approach, 2nd ed., pp. 201-16, Oxford University Press, New York, N.Y., (1999).

Термин «полинуклеотид», который использован в настоящем описании, означает полимерную форму двух или более нуклеотидов, либо рибонуклеотидов, либо дезоксирибонуклеотидов, либо модифицированной формы любого типа нуклеотида. Термин охватывает однонитевые и двунитевые формы ДНК, но особенно двунитевую ДНК.

Термин «выделенный полинуклеотид» в используемом в настоящем изобретении смысле будет означать полинуклеотид (например, геномный, кДНК или полинуклеотид синтетического происхождения или их определенные сочетания), который в силу своей природы как «выделенный полинуклеотид»: не ассоциирован с полным или частью полинуклеотида, с которым «выделенный полинуклеотид» встречается в природе; оперативно связан с полинуклеотидом, с которым он не связан в природе; или не встречается в природе в виде части более крупной последовательности.

Подразумевается, что термин «вектор» в используемом в настоящем изобретении смысле относится к молекуле нуклеиновой кислоты, способной к транспорту другой нуклеиновой кислоты, с которой она связана. Одним из типов векторов является «плазмида», которая представляет собой кольцевую двунитевую петлю ДНК, в которую могут быть лигированы дополнительные участки ДНК. Другим типом вектора является вирусный вектор, в случае которого дополнительные фрагменты ДНК могут быть лигированы в вирусный геном. Некоторые векторы способны к автономной репликации в клетке-хозяине, в которую они введены (например, бактериальные векторы, имеющие бактериальное начало репликации, и эписомные векторы млекопитающих). Другие векторы (например, неэписомные векторы млекопитающих) могут быть интегрированы в геном клетки-хозяина при введении в клетку-хозяина и при этом реплицируются вместе с геномом хозяина. Кроме того, некоторые векторы способны управлять экспрессией генов, с которыми они оперативно связаны. Такие векторы в настоящем описании называют «рекомбинантными экспрессирующими векторами» (или просто «экспрессирующими векторами»). В общем, экспрессирующие векторы, применимые в способах рекомбинации ДНК, часто имеют форму плазмид. В настоящем описании термины «плазмида» и «вектор» могут быть использованы взаимозаменяемо, так как плазмида является наиболее широко применяемой формой вектора. Однако подразумевается, что изобретение включает в себя и другие формы экспрессирующих векторов, такие как вирусные векторы (например, дефицитные по репликации ретровирусы, аденовирусы и аденоассоциированные вирусы), которые выполняют эквивалентные функции.

Термин «оперативно связанный» относится к связыванию, при котором описываемые компоненты находятся во взаимосвязи, позволяющей им функционировать таким образом, для которого они предназначены. Регуляторная последовательность, «оперативно связанная» с кодирующей последовательностью, лигирована таким образом, что достигается экспрессия кодирующей последовательности в условиях, совместимых с регуляторными последовательностями. «Оперативно связанными» последовательностями являются как последовательности регуляции экспрессии, которые граничат с представляющим интерес геном, и последовательности регуляции экспрессии, которые действуют в транс-положении или на расстоянии, регулируя представляющий интерес ген. Термин «последовательность регуляции экспрессии» в используемом в настоящем изобретении смысле относится к полинуклеотидным последовательностям, которые необходимы для осуществления экспрессии и процессинга кодирующих последовательностей, с которыми они лигированы. Последовательности регуляции экспрессии включают в себя соответствующий последовательности инициации транскрипции, терминации, промоторные и энхансерные последовательности; эффективные сигналы процессинга РНК, такие как сигналы сплайсинга и полиаденилирования; последовательности, которые стабилизируют цитоплазматическую мРНК; последовательности, которые повышают эффективность трансляции (т.е., консенсусная последовательность Козака); последовательности, которые повышают стабильность белка; и при необходимости, последовательности, которые усиливают секрецию белка. Природа таких регуляторных последовательностей различна, в зависимости от организма-хозяина; у прокариот такими регуляторными последовательностями являются промотор, сайт связывания рибосом и последовательность терминации транскрипции; у эукариот обычно такими регуляторными последовательностями являются промоторы и последовательность терминации транскрипции. Подразумевается, что термин «регуляторные последовательности» включает компоненты, присутствие которых необходимо для экспрессии и процессинга, и также может включать дополнительные компоненты, присутствие которых полезно, например, лидерные последовательности и последовательности партнеров для слияния.

«Трансформация», которая определена в настоящем описании, относится к любому процессу, в ходе которого экзогенная ДНК проникает в клетку-хозяина. Трансформация может быть осуществлена в природных или искусственных условиях с использованием различных способов, хорошо известных в данной области. Трансформация может быть основана на любом известном способе встраивания чужеродных последовательностей нуклеиновой кислоты в прокариотическую или эукариотическую клетку-хозяина. Способ выбирают в зависимости от трансформируемой клетки-хозяина, и способы могут включать в себя без ограничения вирусную инфекцию, электропорацию, липофекцию и бомбардировку частицами. Такие «трансформированные» клетки могут представлять собой стабильно трансформированные клетки, в которых встроенная ДНК способна реплицироваться, либо в виде автономно реплицирующейся плазмиды, либо в виде части хромосомы хозяина. Также они могут представлять собой клетки, в которых временно экспрессируются встроенные ДНК или РНК в течение ограниченных периодов времени.

Подразумевается, что термин «рекомбинантная клетка-хозяин» (или просто «клетка-хозяин») в используемом в настоящем изобретении смысле относится к клетке, в которую была введена экзогенная ДНК. Следует понимать, что такие термины предназначены для описания не только конкретной клетки субъекта, но и потомства такой клетки. Так как в последующих поколениях могут иметь место некоторые модификации либо вследствие мутации, либо вследствие влияния окружающей среды, такое потомство в действительности может быть не идентичным исходной клетке, но все еще будет входить в объем термина «клетка-хозяин» в используемом в настоящем изобретении смысле. В частности, клетки-хозяева включают прокариотические и эукариотические клетки, выбранные из любого царства живых организмов. Конкретные эукариотические клетки включают клетки простейших, грибов, растений и животных. В частности, клетки-хозяева включают без ограничения линию прокариотических клеток E. coli; линии клеток млекопитающих CHO, HEK 293 и COS; линию клеток насекомых Sf9; и клетки грибов Saccharomyces cerevisiae.

Можно использовать стандартные способы получения рекомбинантной ДНК, синтеза олигонуклеотидов и культивирования тканей и трансформации (например, электропорацию, липофекцию). Ферментативные реакции и способы очистки можно осуществлять согласно инструкциям производителей или как обычно осуществляют в данной области или как описано в настоящей публикации. Указанные выше методики и способы, в общем, можно осуществлять обычными способами, хорошо известными в данной области, и как описано в различных общих и более специализированных публикациях, которые цитированы и обсуждаются в настоящем описании. Смотри, например, публикацию Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), которая включена в настоящее описание в виде ссылки для любой цели.

«Трансгенный организм», как известно в данной области и в используемом в настоящем изобретении смысле, относится к организму, имеющему клетки, которые содержат трансген, при этом трансген, введенный в организм (или в предка данного организма) экспрессирует полипептид, не экспрессируемый в данном организме в природе. «Трансген» представляет собой конструкцию ДНК, которая стабильно и оперативно интегрирована в геном клетки, из которой развивается трансгенный организм, при этом трансген управляет экспрессией кодируемого генного продукта в одном или нескольких типах клеток или тканей трансгенного организма.

Термины «регулировать» и «модулировать» используют взаимозаменяемо, и в используемом в настоящем изобретении смысле они относятся к изменению или вариации активности представляющей интерес молекулы (например, биологической активности RAGE). Модулирование может представлять собой увеличение или уменьшение значения определенной активности или функции представляющей интерес молекулы. Примерами активностей и функций являются без ограничения характеристики связывания, ферментативная активность, активация клеточного рецептора и сигнальная трансдукция.

Соответственно, термин «модулятор» в используемом в настоящем изобретении смысле означает соединение, способное изменять активность или функцию представляющей интерес молекулы (например, биологическую активность RAGE). Например, модулятор может вызывать увеличение или уменьшение значения определенной активности или функции молекулы по сравнению со значением активности или функции, наблюдаемым в отсутствие модулятора.

Термин «агонист» в используемом в настоящем изобретении смысле относится к модулятору, который при контакте с представляющей интерес молекулой вызывает увеличение значения определенной активности или функции молекулы по сравнению со значением активности или функции, наблюдаемым в отсутствие агониста. Конкретные представляющие интерес агонисты могут включать без ограничения полипептиды RAGE или полипептиды, нуклеиновые кислоты, углеводы или любые другие молекулы, которые связываются с RAGE.

Термин «антагонист» в используемом в настоящем изобретении смысле относится к модулятору, который при контакте с представляющей интерес молекулой вызывает увеличение значения определенной активности или функции молекулы по сравнению со значением активности или функции, наблюдаемым в отсутствие антагониста. Примеры антагонистов включают без ограничения белки, пептиды, антитела, пептитела, углеводы или малые органические молекулы. Пептитела описаны, например, в WO01/83525.

Конкретные представляющие интерес антагонисты включают антагонисты, которые блокируют или модулируют биологическую или иммунологическую активность RAGE. Антагонисты RAGE могут включать без ограничения белки, нуклеиновые кислоты, углеводы или любые другие молекулы, которые связываются с RAGE, в частности, моноклональные антитела, которые взаимодействуют с молекулой RAGE. Следует отметить, что взаимодействие с RAGE может приводить к связыванию и нейтрализации других лигандов/компонентов клеточных мембран, и может быть полезным для аддитивного или синергетического функционирования против множества заболеваний.

В используемом в настоящем изобретении смысле термин «эффективное количество» относится к количеству терапевтического средства, которое является достаточным для уменьшения или ослабления тяжести и/или продолжительности расстройства или одного или нескольких его симптомов, чтобы предотвратить прогрессирование расстройства, вызвать регрессию расстройства, предотвратить рецидив, развитие, появление или прогрессирование одного или нескольких симптомов, ассоциированных с расстройством, выявить расстройство или усилить или улучшить профилактический или терапевтический эффект (эффекты) другого терапевтического средства (например, профилактического или терапевтического средства).

Термин «образец» в настоящем изобретении использован в самом широком смысле. «Биологический образец» в используемом в настоящем изобретении смысле включает без ограничения любое количество вещества из живого организма или ранее жившего организма. Такие живые организмы включают без ограничения человека, мышей, крыс, обезьян, собак, кроликов и других животных. Такими веществами без ограничения являются кровь, сыворотка, моча, синовиальная жидкость, клетки, органы, ткани, костный мозг, лимфатические узлы и селезенка.

2. Конкретные варианты

Конкретные варианты осуществления изобретения перечислены ниже:

1. Выделенный связывающий белок, который диссоциирует из комплекса с RAGE человека с KD, составляющей 1×10-7 М или меньше, и константой скорости koff 1×10-2 сек-1 или меньше, при этом обе константы определяют на основе резонанса поверхностного плазмона.

2. i) Связывающий белок по п. 1, который связывается с RAGE человека и модулирует, в частности, ингибирует способность RAGE связываться, по меньшей мере, с одним из его лигандов, что определяют в стандартном анализе in vitro, например, в анализе HTRF, как более подробно описано, например, в экспериментальной части, в частности, в примерах 4 и 5, и в публикациях, цитированных в настоящем описании.

ii) Связывающий белок по п. 1, способный ингибировать опосредованную RAGE биологическую активность.

iii) Связывающий белок, в частности, связывающий белок по любому из предшествующих пунктов, обладающий, по меньшей мере, одной из следующих биологических активностей:

a) ингибирование индуцированного растворимым пептидом Aβ1-40 уменьшения церебрального объема крови (CBV) in vivo в модели на животных, подобных самкам мышей C57BL/6, как, например, более подробно описано в экспериментальной части, в частности, в примере 10, и публикациях, цитированных в настоящем описании;

b) увеличение церебрального объема крови in vivo в модели на животных, сверхэкспрессирующих APP человека, подобной модели на трансгенных мышах Tg2576, как, например, более подробно описано в экспериментальной части, в частности, в примере 16, и в публикациях, цитированных в настоящем описании;

c) уменьшение количества амилоидных бляшек и/или площади амилоидных бляшек in vivo в модели на животных, сверхэкспрессирующих APP человека, подобной модели на трансгенных мышах Tg2576, как, например, более подробно описано в экспериментальной части, в частности, в примере 19, и в публикациях, цитированных в настоящем описании;

d) ингибирование индуцированного агрегированным пептидом Aβ1-40 расщепления динамина нейронов гиппокампа in vitro, подобных нейронам гиппокампа, которые получены от эмбриональных крыс, как, например, более подробно описано в экспериментальной части, в частности, в примере 17, и в публикациях, цитированных в настоящем описании;

e) отмена индуцированного глобуломером Aβ1-42 снижения синаптической передачи in vitro, определяемой в культурах срезов гиппокампа, как, например, более подробно описано в экспериментальной части, в частности, в примере 18, и в публикациях, цитированных в настоящем описании.

3. Связывающий белок по п. 1 или 2, в котором лиганд выбран из пептидов Aβ, глобуломеров Aβ, S100b и амфотерина.

4. Связывающий белок по любому из предшествующих пунктов, который представляет собой нейтрализующий связывающий белок.

5. Связывающий белок по любому из предшествующих пунктов, который способен блокировать, в частности, ингибировать связывание Aβ-глобуломера с RAGE человека.

6. Связывающий белок по любому из предшествующих пунктов, в котором указанный Aβ-глобуломер представляет собой Aβ1-42.

7. Связывающий белок по любому из предшествующих пунктов, в котором указанный связывающий белок взаимодействует, по меньшей мере, с одним, например 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12 аминокислотными остатками C1- и/или C2-домена RAGE человека.

8. Связывающий белок по любому из предшествующих пунктов, который представляет собой гуманизированное антитело.

9. Связывающий белок по любому из предшествующих пунктов, содержащий антигенсвязывающий домен, при этом указанный связывающий белок способен связывать эпитоп молекулы RAGE человека, и указанный антигенсвязывающий домен содержит, по меньшей мере, одну CDR, содержащую аминокислотную последовательность, выбранную из

группы аминокислотных последовательностей CDR-H3, состоящей из последовательностей SEQ ID NO: 4, 12 и 20; и модифицированных аминокислотных последовательностей CDR, имеющих идентичность последовательностей, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с одной из указанных последовательностей;

группы аминокислотных последовательностей CDR-L3, состоящей из последовательностей SEQ ID NO: 8, 16 и 24; и модифицированных аминокислотных последовательностей CDR, имеющих идентичность последовательностей, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с одной из указанных последовательностей.

10. Связывающий белок, содержащий антигенсвязывающий домен, при этом указанный связывающий белок способен связывать эпитоп молекулы RAGE человека, и указанный антигенсвязывающий домен содержит, по меньшей мере, одну CDR, содержащую аминокислотную последовательность, выбранную из:

группы аминокислотных последовательностей CDR-H3, состоящей из последовательностей SEQ ID NO: 4, 12 и 20; и модифицированных аминокислотных последовательностей CDR, имеющих идентичность последовательностей, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с одной из указанных последовательностей;

группы аминокислотных последовательностей CDR-L3, состоящей из последовательностей SEQ ID NO: 8, 16 и 24; и модифицированных аминокислотных последовательностей CDR, имеющих идентичность последовательностей, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с одной из указанных последовательностей.

11. Связывающий белок по любому из предшествующих пунктов, дополнительно содержащий, по меньшей мере, одну CDR, содержащую аминокислотную последовательность выбранную из группы CDR-H1, состоящей из последовательностей SEQ ID NO: 2, 10, 18; или выбранную из группы CDR-H2, состоящей из последовательностей SEQ ID NO: 3, 11, 19; или выбранную из группы CDR-L1, состоящей из последовательностей SEQ ID NO: 6, 14, 22; или выбранную из группы CDR-L2, состоящей из последовательностей SEQ ID NO: 7, 15, 23;

и модифицированных аминокислотных последовательностей CDR, имеющих идентичность последовательностей, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с одной из указанных последовательностей.

12. Связывающий белок по любому из предшествующих пунктов, в котором указанная, по меньшей мере, одна CDR содержит аминокислотную последовательность, выбранную из группы, состоящей из:

13. Связывающий белок по п. 12, содержащий, по меньшей мере, 3 CDR, которые выбраны из набора CDR вариабельных доменов, состоящего из:

или набора вариабельных доменов, в которых, по меньшей мере, одна из указанных 3 CDR представляет собой модифицированную аминокислотную последовательность CDR, имеющую идентичность последовательности, по меньшей мере, 50%, например, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90, 95% идентичность с исходной последовательностью.

14. Связывающий белок по п. 13, содержащий, по меньшей мере, два набора CDR вариабельных доменов.

15. Связывающий белок по п. 14, в котором указанные, по меньшей мере, два набора CDR вариабельных доменов выбраны из группы состоящей из:

набора VH 7F9 и набора VL 7F9;

набора VH 4E5 и набора VL 4E5; и

набора VH 11E6 и набора VL 11E6.

16. Связывающий белок по любому из предшествующих пунктов, дополнительно содержащий акцепторный каркас человека.

17. Связывающий белок по п. 16, в котором указанный акцепторный каркас человека содержит, по меньшей мере, одну аминокислотную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO: 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 и 55.

18. Связывающий белок по любому из предшествующих пунктов, содержащий, по меньшей мере, один вариабельный домен тяжелой цепи, выбранный из последовательностей SEQ ID NO: 56 и 57; и/или, по меньшей мере, один вариабельный домен легкой цепи, выбранный из последовательностей SEQ ID NO: 58 и 59.

19. Связывающий белок по п. 18, в котором указанный связывающий белок содержит два вариабельных домена, при этом указанные два вариабельных домена имеют аминокислотные последовательности, выбранные из:

SEQ ID NO: 56 и 58; 56 и 59;

SEQ ID NO: 57 и 58; 57 и 59.

20. Связывающий белок по любому из пп. 16-19, в котором указанный акцепторный каркас человека содержит, по меньшей мере, одну аминокислотную замену в каркасной области в ключевом остатке, при этом указанный ключевой остаток выбран из группы, состоящей из:

остатка, близлежащего к CDR;

остатка сайта гликозилирования;

редкого остатка;

остатка, способного взаимодействовать с эпитопом RAGE;

остатка, способного взаимодействовать с CDR;

канонического остатка;

остатка области контакта между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи;

остатка в верниер-зоне;

N-концевого остатка, способного к образованию пара-глутамата; и

остатка в области, которая является областью перекрывания между CDR1 вариабельной области тяжелой цепи согласно определению Чотия и первой каркасной областью тяжелой цепи согласно определению Кабата.

21. Связывающий белок по п. 20, в котором указанный ключевой остаток выбран из группы, состоящей из остатков

(положения в последовательности тяжелой цепи): 1, 2, 68, 70, 72, 76, 85, 89, 95

(положения в последовательности легкой цепи): 11, 13, 43, 49, 58, 70, 87.

22. Связывающий белок по любому из предшествующих пунктов, в котором связывающий белок представляет собой консенсусный вариабельный домен человека.

23. Связывающий белок по любому из пп. 16-22, в котором указанный акцепторный каркас человека содержит, по меньшей мере, одну аминокислотную замену в каркасной области, например 1-20, 1-15, 1-10 или 2, 3, 4, 5, 6, 7, 8 или 9 замен, при этом аминокислотная последовательность каркаса, по меньшей мере, на 65% идентична последовательности указанного акцепторного каркаса человека и содержит, по меньшей мере, 70 аминокислотных остатков, идентичных указанному акцепторному каркасу человека.

24. Связывающий белок по любому из предшествующих пунктов, при этом указанный связывающий белок содержит, по меньшей мере, один (мутантный каркас) вариабельный домен, имеющий аминокислотную последовательность, выбранную из группы, состоящей из:

(последовательности тяжелой цепи) SEQ ID NO: 62, 67, 68 и 69;

(последовательности легкой цепи) SEQ ID NO: 63, 64, 65 и 66.

25. Связывающий белок по п. 24, в котором указанный связывающий белок содержит два вариабельных домена, при этом указанные два вариабельных домена имеют аминокислотные последовательности, выбранные из групп, состоящих из:

SEQ ID NO: 62 и 63; 62 и 64; 62 и 65; 62 и 66;

SEQ ID NO: 67 и 63; 67 и 64; 67 и 65; 67 и 66;

SEQ ID NO: 68 и 63; 68 и 64; 68 и 65; 68 и 66.

26. Связывающий белок по любому из предшествующих пунктов, при этом указанный связывающий белок способен связывать мишень, выбранную из молекул RAGE.

27. Связывающий белок по любому из предшествующих пунктов, способный связываться с RAGE человека.

28. Связывающий белок по п. 27, имеющий, по меньшей мере, одно из следующих дополнительных функциональных свойств:

связывание с RAGE мыши и крысы.

29. Связывающий белок по любому из предшествующих пунктов, в котором связывающий белок способен модулировать, в частности, нейтрализовать биологическую функцию мишени, выбранной из молекул RAGE.

30. Связывающий белок по п. 29, в котором указанный связывающий белок модулирует, в частности, ингибирует способность RAGE связываться, по меньшей мере, с одним из его лигандов.

31. Связывающий белок по п. 30, в котором указанный связывающий белок модулирует, в частности, ингибирует, по меньшей мере, одно из следующих взаимодействий: связывание RAGE человека с Aβ-пептидами, Aβ-глобуломерами, S100b и амфотерином.

32. Связывающий белок по любому из предшествующих пунктов, при этом указанный связывающий белок способен нейтрализовать биологическую активность RAGE, например, индуцированное Aβ расщепление динамина в первичных нейронах, индуцированную глобуломерами синаптическую недостаточность в срезах гиппокампа, Aβ-индуцированное уменьшение CBV.

33. Связывающий белок по п. 32, в котором молекула RAGE представляет собой RAGE или фрагмент RAGE, подобный sRAGE.

34. Связывающий белок по п. 33, в котором RAGE выбран из RAGE человека, крысы и мыши.

35. Связывающий белок по любому из предшествующих пунктов, в котором указанный связывающий белок имеет константу скорости ассоциации (kon) с указанной мишенью, выбранную из группы, состоящей из: по меньшей мере, примерно 102 М-1сек-1; по меньшей мере, примерно 103 М-1сек-1; по меньшей мере, примерно 104 М-1сек-1; по меньшей мере, примерно 105 М-1сек-1; по меньшей мере, примерно 106 М-1сек-1 и, по меньшей мере, примерно 107 М-1сек-1, измеряемую на основе резонанса поверхностного плазмона.

36. Связывающий белок по любому из предшествующих пунктов, в котором указанный связывающий белок имеет константу скорости диссоциации (koff) комплекса с указанной мишенью, выбранную из группы, состоящей из: не более чем примерно 10-2 сек-1; не более чем примерно 10-3 сек-1; не более чем примерно 10-4 сек-1; не более чем примерно 10-5 сек-1; и не более чем примерно 10-6 сек-1, измеряемую на основе резонанса поверхностного плазмона.

37. Связывающий белок по любому из предшествующих пунктов, в котором указанный связывающий белок имеет константу диссоциации (KD) по отношению к указанной мишени, выбранную из группы, состоящей из: не более чем примерно 10-7 М; не более чем примерно 10-8 М; не более чем примерно 10-9 М; не более чем примерно 10-10 М; не более чем примерно 10-11 М; не более чем примерно 10-12 М; и не более чем 10-13 М.

38. Конструкция антитела, содержащая связывающий белок, описанный в любом из предшествующих пунктов, при этом указанная конструкция антитела дополнительно содержит линкерный полипептид или константный домен иммуноглобулина.

39. Конструкция антитела по п. 38, в котором указанный связывающий белок выбран из группы, состоящей из:

молекулы иммуноглобулина,

моноклонального антитела,

химерного антитела,

CDR-привитого антитела,

гуманизированного антитела,

Fab,

Fab',

F(ab')2,

Fv,

связанного дисульфидом Fv,

scFv,

однодоменного антитела,

диантитела,

полиспецифичного антитела,

антитела с двойной специфичностью,

иммуноглобулина с двойными вариабельными доменами, и

биспецифичного антитела.

40. Конструкция антитела по любому из пп. 38 и 39, в котором указанный связывающий белок содержит константный домен тяжелой цепи иммуноглобулина, выбранный из группы, состоящей из

константного домена IgM человека,

константного домена IgG1 человека,

константного домена IgG2 человека,

константного домена IgG3 человека,

константного домена IgG4 человека,

константного домена IgE человека,

константного домена IgD человека,

константного домена IgA1 человека,

константного домена IgA2 человека,

константного домена IgY человека и

соответствующих мутантных доменов.

41. Конструкция антитела по любому из пп. 38-40, содержащая константный домен иммуноглобулина, имеющий аминокислотную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO: 25, 41, 42 и 26.

42. Конъюгат антитела, содержащий конструкцию антитела, описанную в любом из пп. 38-41, при этом указанный конъюгат антитела дополнительно содержит средство, выбранное из группы, состоящей из молекулы иммуноадгезии, визуализирующего средства, терапевтического средства и цитотоксического средства.

43. Конъюгат антитела по п. 42, в котором указанное средство представляет собой визуализирующее средство, выбранное из группы, состоящей из радиоактивной метки, фермента, флуоресцирующей метки, люминесцентной метки, биолюминесцентной метки, магнитной метки и биотина.

44. Конъюгат антитела по п. 43, в котором указанным визуализирующим средством является радиоактивная метка, выбранная из группы, состоящей из: 3H, 14C, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho и 153Sm.

45. Конъюгат антитела по п. 42, в котором указанное средство представляет собой терапевтическое или цитотоксическое средство, выбранное из группы, состоящей из антиметаболита, алкилирующего средства, антибиотика, фактора роста, цитокина, антиангиогенного средства, антимитотического средства, антрациклина, токсина и апоптозного средства.

46. Конструкция антитела по любому из пп. 38-41, в котором указанный связывающий белок имеет картину гликозилирования человека.

47. Конъюгат антитела по любому из пп. 42-45, в котором указанный связывающий белок имеет картину гликозилирования человека.

48. Связывающий белок по любому из пп. 1-37, в котором указанный связывающий белок существует в виде кристалла.

49. Конструкция антитела по любому из пп. 38-41, в котором указанная конструкция антитела существует в виде кристалла.

50. Конъюгат антитела по любому из пп. 42-45, в котором указанная конструкция антитела существует в виде кристалла.

51. Связывающий белок по п. 48, в котором указанный кристалл представляет собой не содержащий носителя фармацевтический кристалл контролируемого высвобождения.

52. Конструкция антитела по п. 49, в которой указанный кристалл представляет собой не содержащий носителя фармацевтический кристалл контролируемого высвобождения.

53. Конъюгат антитела по п. 50, в котором указанный кристалл представляет собой не содержащий носителя фармацевтический кристалл контролируемого высвобождения.

54. Связывающий белок по п. 48, в котором указанный связывающий белок имеет большее время полужизни in vivo, чем растворимый эквивалент указанного связывающего белка.

55. Конструкция антитела по п. 49, в которой указанная конструкция антитела имеет большее время полужизни in vivo, чем растворимый эквивалент указанной конструкции антитела.

56. Конъюгат антитела по п. 50, в котором указанный конъюгат антитела имеет большее время полужизни in vivo, чем растворимый эквивалент указанного конъюгата антитела.

57. Связывающий белок по п. 48, в котором указанный связывающий белок сохраняет биологическую активность.

58. Конструкция антитела по п. 49, в которой указанная конструкция антитела сохраняет биологическую активность.

59. Конъюгат антитела по п. 50, в котором указанный конъюгат антитела сохраняет биологическую активность.

60. Выделенная нуклеиновая кислота, кодирующая аминокислотную последовательность связывающего белка по любому из пп. 1-37.

61. Выделенная нуклеиновая кислота, кодирующая аминокислотную последовательность конструкции антитела по любому из пп. 38-41.

62. Выделенная нуклеиновая кислота, кодирующая аминокислотную последовательность конъюгата антитела по любому из пп. 42-45.

63. Вектор, содержащий выделенную нуклеиновую кислоту по любому из пп 60-62.

64. Вектор по п. 63, в котором указанный вектор выбран из группы, состоящей из pcDNA, pTT, pTT3, pEFBOS, pBV, pJV, pHybE и pBJ.

65. Клетка-хозяин, содержащая вектор по любому из пп. 63 и 64.

66. Клетка-хозяин по п. 65, в которой указанная клетка-хозяин является прокариотической клеткой.

67. Клетка-хозяин по п. 66, в которой указанная клетка-хозяин представляет собой клетку E. coli.

68. Клетка-хозяин по п. 67, в которой указанная клетка-хозяин является эукариотической клеткой.

69. Клетка-хозяин по п. 68, в которой указанная эукариотическая клетка выбрана из группы, состоящей из клетки простейшего, клетки животного, клетки растения и клетки гриба.

70. Клетка-хозяин по п. 69, в которой указанная эукариотическая клетка является клеткой животного, выбранной из группы, состоящей из клетки млекопитающего, клетки птицы и клетки насекомого.

71. Клетка-хозяин по п. 69, в которой указанная клетка-хозяин выбрана из клеток HEK, клеток CHO, клеток COS и дрожжевых клеток.

72. Клетка-хозяин по п. 71, в которой указанной дрожжевой клеткой является клетка Saccharomyces cerevisiae.

73. Клетка-хозяин по п. 70, в которой указанной клеткой-хозяином является клетка насекомого Sf9.

74. Способ получения белка, способного связывать RAGE, включающий в себя культивирование клетки-хозяина по любому из пп. 65-73 в культуральной среде в условиях, достаточных для продуцирования связывающего белка, способного связывать RAGE.

75. Белок, полученный способом по п. 74.

76. Композиция для высвобождения связывающего белка, при этом указанная композиция включает в себя:

(a) препарат, при этом указанный препарат содержит белок по любому из пп. 48-50 в виде кристаллизованного продукта и определенный ингредиент; и

(b) по меньшей мере, один полимерный носитель.

77. Композиция по п. 76, в которой указанный полимерный носитель представляет собой полимер, выбранный из одного или нескольких полимеров из группы, состоящей из: поли(акриловой кислоты), поли(цианоакрилатов), поли(аминокислот), поли(ангидридов), поли(депсипептида), сложных поли(эфиров), поли(молочной кислоты), сополимера (молочной-гликолевой кислоты) или PLGA, поли(b-гидроксибутирата), поли(капролактона), поли(диоксанона); поли(этиленгликоля), поли((гидроксипропил)метакриламида), поли[(органо)фосфазена], сложных поли(ортоэфиров), поли(винилового спирта), поли(винилпирролидона), сополимеров малеиновый ангидрид-алкилвиниловый эфир, полиолов плюроников, альбумина, альгината, целлюлозы и производных целлюлозы, коллагена, фибрина, желатина, гиалуроновой кислоты, олигосахаридов, гликаминогликанов, сульфатированных полисахаридов, их смесей и сополимеров.

78. Композиция по п. 76, в которой указанный ингредиент выбран из группы, состоящей из альбумина, сахарозы, трегалозы, лактитола, желатина, гидроксипропил-β-циклодекстрина, метоксиполиэтиленгликоля и полиэтиленгликоля.

79. Способ лечения млекопитающего, включающий в себя стадию введения млекопитающему эффективного количества композиции по любому из пп. 77 и 78.

80. Фармацевтическая композиция, содержащая продукт по любому из пп. 1-59 и фармацевтически приемлемый носитель.

81. Фармацевтическая композиция по п. 80, в которой указанный фармацевтически приемлемый носитель функционирует в качестве адъюванта, применимого для увеличения всасывания или распределения указанного связывающего белка.

82. Фармацевтическая композиция по п. 81, в которой указанным адъювантом является гиалуронидаза.

83. Фармацевтическая композиция по п. 82, дополнительно содержащая, по меньшей мере, одно дополнительное терапевтическое средство для лечения расстройства, при котором активность RAGE является вредной.

84. Фармацевтическая композиция по п. 83, в которой указанное дополнительное средство выбрано из группы, состоящей из: терапевтического средства, визуализирующего средства, цитотоксического средства, ингибиторов ангиогенеза; ингибиторов киназ; блокаторов костимулирующих молекул; блокаторов молекул адгезии; антитела против цитокинов или его функционального фрагмента, метотрексата; циклоспорина; рапамицина; FK506; регистрируемой метки или репортера; антагониста TNF; противоревматического средства; мышечного релаксанта, наркотического средства, нестероидного противовоспалительного лекарственного средства (НПВС), анальгетика, анестетика, седативного средства, местного анестетика, нейромышечного блокатора, противомикробного средства, противопсориатического средства, кортикостероида, анаболического стероида, эритропоэтина, средства для иммунизации, иммуноглобулина, иммунодепрессанта, гормона роста, средства для гормонозаместительной терапии, радиоактивного фармацевтического средства, антидепрессанта, антипсихотического средства, стимулятора, лекарственного средства против астмы, бета-агониста, ингалируемого стероида, эпинефрина или его аналога, цитокина и антагониста цитокина. Дополнительными примерами являются: димебон, анти-Aβ-антитела, ингибиторы бета-секретазы, tau-модуляторы, усилители когнитивной функции, подобные, например, антагонистам 5-HT6, ингибитор холестериназы (например, тактрин, донепезил, ривастигмин или галантамин), частичный блокатор рецептора NMDA (например, мемантин), миметик гликозаминогликана (например, альцемед), ингибитор или аллостерический модулятор гамма-секретазы (например, R-флурбипрофен), агонист гонадотропин-рилизинг гормона, блокирующий лютеинизирующий гормон (например, лейпрорелин), антагонист рецептора серотонина 5-HT1A, хелатирующее средство, селективный для нейронов блокатор кальциевых каналов L-типа, иммуномодулятор, ингибитор амилоидного фибриллогенеза или ингибитор отложения амилоидного белка (например, M266), другое антитело (например, бапинейзумаб), антагонист рецептора 5-HT1a, ингибитор PDE4, агонист гистамина, белок-рецептор конечных продуктов глубокого гликирования, стимулятор PARP, антагонист рецептора серотонина 6, агонист рецептора 5-HT4, стероид человека, стимулятор захвата глюкозы, который усиливает метаболизм нейронов, селективный антагонист CB1, частичный агонист рецепторов бензодиазепина, антагонист или ингибитор продукции амилоида бета, ингибитор отложения амилоида бета, частичный антагонист NNR альфа-7, терапевтическое средство, нацеленное против PDE4, ингибитор трансляции РНК, мускариновый агонист, агонист рецептора фактора роста нервов, агонист рецептора NGF и модулятор генной терапии.

85. Способ снижения активности RAGE человека, включающий в себя осуществление контакта RAGE человека с продуктом по любому из пп. 1-59, так что активность RAGE человека снижается.

86. Способ уменьшения связывания hRAGE, по меньшей мере, с одним лигандом, выбранным из пептидов Aβ, глобуломеров, S100b и амфотерина, у субъекта, нуждающегося в таком снижении, включающий в себя стадию введения субъекту продукта по любому из пп. 1-59.

87. Способ лечения субъекта в случае расстройства, ассоциированного с активностью RAGE, включающий в себя стадию введения отдельно или в сочетании с другими терапевтическими средствами продукта по любому из пп. 1-59.

88. Способ снижения активности RAGE у субъекта, страдающего от расстройства, при котором активность RAGE вредная, включающий в себя введение субъекту продукта по любому из пп. 1-59 отдельно или в сочетании с другими терапевтическими средствами.

89. Способ по п. 88, в котором расстройство включает в себя неврологические заболевания, выбранные из группы, включающей боковой амиотрофический склероз, повреждение плечевого сплетения, повреждение головного мозга, включая травматическое повреждение головного мозга, церебральный паралич, атаксию Фридриха, синдром Гийена-Барре, лейкодистрофию, рассеянный склероз, постполиомиелитный синдром, расщепление позвоночника, повреждение спинного мозга, спинальную мышечную атрофию, опухоли спинного мозга, инсульт, поперечный миелит, деменцию, сенильную деменцию, умеренное когнитивное нарушение, деменцию, связанную с болезнью Альцгеймера, хорею Хантингтона, позднюю дискинезию, гиперкинезию, манию, болезнь Паркинсона, синдром Стила-Ричарда, синдром Дауна, бульбоспинальный паралич, травмы нервов, васкулярный амилоидоз, церебральную геморрагию I с амилоидозом, воспаление головного мозга, атаксию Фридриха, острую спутанность сознания, амиотрофический боковой склероз, глаукому, болезнь Альцгеймера, диабетическую нефропатию, сепсис, ревматоидный артрит и родственные воспалительные заболевания; диабет и осложнения в результате диабета, подобные диабетической ретинопатии, нефропатию, сосудистые осложнения; атеросклеротические осложнения, фиброз легкого, злокачественную опухоль, в частности меланому, другие амилоидозы.

90. Выделенная CDR связывающего белка, который определен в любом из пп. 1-51.

91. Выделенный связывающий белок, который специфично взаимодействует, по меньшей мере, с одним эпитопом рецептора белка конечных продуктов глубокого гликирования (RAGE).

92. Выделенный связывающий белок по п. 91, в котором выделенный белок представляет собой моноклональное антитело или его антигенсвязывающий фрагмент.

93. Моноклональное антитело или антигенсвязывающий фрагмент по п. 92, который содержит домен VH и VL.

94. Моноклональное антитело по п. 92, в котором указанное моноклональное антитело снижает способность RAGE связываться с его лигандами.

95. Лиганды по п. 94, в котором лиганды включают пептиды Aβ, глобуломеры, S100b и амфотерин.

96. Моноклональное антитело по п. 92, в котором указанное антитело способно блокировать связывание Aβ-глобуломера с RAGE.

97. Моноклональное антитело или его антигенсвязывающий фрагмент по п. 92 в котором антитело или антигенсвязывающий фрагмент содержит:

вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO. 1, SEQ ID NO. 9 и SEQ ID NO. 17;

вариабельную область легкой цепи, имеющую аминокислотную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO. 5, SEQ ID NO. 13 и SEQ ID NO. 21;

константную область тяжелой цепи гамма 1 иммуноглобулина человека с аминокислотной последовательностью SEQ ID NO. 25; и

константную область легкой цепи каппа иммуноглобулина человека с аминокислотной последовательностью SEQ ID NO. 26.

98. Моноклональное антитело по п. 93, в котором антигенсвязывающий домен содержит, по меньшей мере, одну определяющую комплементарность область (CDR), содержащую аминокислотную последовательность, по меньшей мере, на 90% гомологичную последовательности, выбранной из группы, состоящей из последовательностей SEQ ID NO: 2, 3, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18, 19 и 20.

99. Моноклональное антитело по п. 93, в котором указанный домен VH содержит вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, которая, по меньшей мере, на 90% гомологична последовательности, выбранной из группы, состоящей из последовательностей SEQ ID NO. 1, SEQ ID NO. 9 и SEQ ID NO. 17.

100. Моноклональное антитело по п. 99, в котором указанный домен VH содержит, по меньшей мере, одну область CDR, содержащую аминокислотную последовательность, по меньшей мере, на 90% гомологичную последовательности, выбранной из группы, состоящей из последовательностей SEQ ID NO: 2, 3, 4, 10, 11, 12, 18, 19 и 20.

101. Моноклональное антитело по п. 100, в котором указанный домен VH содержит, по меньшей мере, три области CDR, выбранных из набора последовательностей SEQ ID NO: 2, 3, 4; SEQ ID NO: 10, 11, 12; SEQ ID NO: 18, 19 и 20.

102. Моноклональное антитело по п. 93, в котором указанный домен VL содержит вариабельную область легкой цепи, имеющую аминокислотную последовательность которая, по меньшей мере, на 90% гомологична последовательности, выбранной из группы, состоящей из SEQ ID NO. 5, SEQ ID NO. 13 и SEQ ID NO. 21.

103. Моноклональное антитело по п. 102, в котором указанный домен VL содержит, по меньшей мере, одну область CDR, содержащую аминокислотную последовательность, по меньшей мере, на 90% гомологичную последовательности, выбранной из группы, состоящей из последовательностей SEQ ID NO: 6, 7, 8, 14, 15, 16, 22, 23 и 24.

104. Моноклональное антитело по п. 103, в котором указанный домен VL содержит, по меньшей мере, три области CDR, выбранных из набора последовательностей SEQ ID NO: 6, 7, 8; SEQ ID NO: 14, 15, 16; SEQ ID NO: 22, 23 и 24.

105. Антитело или антигенсвязывающий фрагмент по п. 92, в котором указанное антитело или антигенсвязывающий фрагмент представляет собой мышиное антитело, гуманизированное антитело, полностью человеческое, химерное антитело, антигенсвязывающий фрагмент гуманизированного антитела или антигенсвязывающий фрагмент химерного антитела.

106. Антитело или антигенсвязывающий фрагмент по п. 92, в котором указанное антитело или антигенсвязывающий фрагмент представляет собой антигенсвязывающий фрагмент, выбранный из группы, состоящей из Fab-фрагмента, Fab'-фрагмента, F(ab')2-фрагмента и Fv-фрагмента.

107. Линия клеток гибридомы, которая продуцирует моноклональное антитело или его антигенсвязывающий фрагмент по п. 96.

108. Линия клеток гибридомы по п. 107, в которой гибридома выбрана из группы, состоящей из гибридомы мыши, человека, крысы, овцы, свиньи, крупного рогатого скота, козы и лошади.

109. Линия клеток гибридомы, которая продуцирует моноклональное антитело, которое специфично связывается, по меньшей мере, с одним эпитопом белка RAGE.

110. Линия клеток гибридомы по п. 107, в которой гибридома выбрана из группы, состоящей из гибридомы мыши и человека.

111. Линия клеток гибридомы по п. 107, в которой гибридома выбрана из группы, состоящей из гибридомы крысы, овцы, свиньи, крупного рогатого скота, козы и лошади.

112. Вектор, содержащий выделенную нуклеиновую кислоту, которая кодирует любую из аминокислотных последовательностей по п. 97, при этом указанный вектор выбран из группы, состоящей из pcDNA, pTT, pTT3, pEFBOS, pBV, pJV и pBJ.

113. Клетка-хозяин, трансформированная вектором по п. 112, при этом клетка-хозяин выбрана из группы, состоящей из клетки простейшего, клетки животного, клетки растения и клетки гриба.

114. Клетка-хозяин по п. 113, в которой клетка животного представляет собой клетку млекопитающего, выбранную из группы, состоящей из клеток HEK293, CHO и COS.

115. Способ получения выделенного связывающего белка по п. 91, включающий в себя культивирование клетки-хозяина в культуральной среде в условиях, достаточных для продуцирования связывающего белка, сбор культуральной среды и очистку полученного выделенного связывающего белка.

116. Фармацевтическая композиция, содержащая моноклональное антитело или антигенсвязывающую часть по любому из пп. 99 или 102 и фармацевтически приемлемый носитель.

117. Способ лечения заболевания или расстройства, включающий в себя введение моноклональных антител по пп. 99 или 102, которые связываются с C2-доменом RAGE.

118. Способ по п. 117, в котором расстройство включает в себя неврологические заболевания, выбранные из группы, включающей боковой амиотрофический склероз, повреждение плечевого сплетения, повреждение головного мозга, включая травматическое повреждение головного мозга, церебральный паралич, атаксию Фридриха, синдром Гийена-Барре, лейкодистрофию, рассеянный склероз, постполиомиелитный синдром, расщепление позвоночника, повреждение спинного мозга, спинальную мышечную атрофию, опухоли спинного мозга, инсульт, поперечный миелит, деменцию, сенильную деменцию, умеренное когнитивное нарушение, деменцию, связанную с болезнью Альцгеймера, хорею Хантингтона, позднюю дискинезию, гиперкинезию, манию, болезнь Паркинсона, синдром Стила-Ричарда, синдром Дауна, бульбоспинальный паралич, травмы нервов, васкулярный амилоидоз, церебральную геморрагию I с амилоидозом, воспаление головного мозга, атаксию Фридриха, острую спутанность сознания, амиотрофический боковой склероз, глаукому, болезнь Альцгеймера, диабетическую нефропатию, сепсис, ревматоидный артрит и родственные воспалительные заболевания.

119. Антитело по п. 105, содержащее, по меньшей мере, одну область VH, содержащую аминокислотную последовательность, выбранную из последовательностей SEQ ID NO: 56 и 57.

120. Антитело по п. 105, содержащее, по меньшей мере, одну область VL, содержащую аминокислотную последовательность, выбранную из последовательностей SEQ ID NO: 58 и 59.

121. Антитело по п. 119 или 120, дополнительно модифицированное 1-10 мутациями в последовательности VH или VL.

122. Антитело по п. 121, в котором мутации выбраны из обратных мутаций каркаса и мутаций верниер-остатков и остатков на границе VH/VL.

123. Антитело или связывающий белок по любому из предшествующих пунктов, которые ингибируют связывание RAGE с комплексом HMGB1-CpG ДНК; или антитело или связывающий белок по любому из предшествующих пунктов, которые не ингибируют связывание RAGE с комплексом HMGB1-CpG ДНК.

3. Создание анти-RAGE-антител

3.1. Общее

Антитела согласно изобретению могут быть созданы в результате иммунизации подходящего хозяина (например, позвоночных, включая человека, мышей, крыс, овец, коз, свиней, крупного рогатого скота, лошадей, рептилий, рыб, амфибий и яйцеклеток птиц, рептилий и рыб). Чтобы создать антитела согласно настоящему изобретению, хозяина иммунизируют иммуногенным полипептидом RAGE или его фрагментом согласно изобретению. Термин «иммунизация» в настоящем описании относится к процессу презентации антигена иммунному репертуару, при этом такой репертуар существует в природном генетически не измененном организме или трансгенном организме, включая организмы, модифицированные так, чтобы они имели искусственный иммунный репертуар человека. Подобным образом «иммуногенный препарат» представляет собой препарат антигена, который содержит адъюванты или другие добавки, которые могут усиливать иммуногенность антигена.

Иммунизацию животных можно осуществлять любым способом, известным в данной области. Смотри, например, Harlow and Lane, Antibodies: A Laboratory Manual, New York: Cold Spring Harbor Press, 1990. Способы иммунизации животных, отличных от человека, таких как мыши, крысы, овцы, козы, свиньи, крупный рогатый скот и лошади, хорошо известны в данной области. Смотри, например, Harlow and Lane и патент США № 5994619. В конкретном варианте антиген RAGE водят с адъювантом, чтобы стимулировать иммунный ответ. Такие адъюванты включают полный или неполный адъювант Фрейнда, RIBI (мурамилдипептиды) или ISCOM (иммуностимулирующие комплексы). Такие адъюванты могут защищать полипептид от быстрого распространения благодаря образованию комплексов в виде локального отложения, или они могут содержать вещества, которые стимулируют у хозяина секрецию факторов, которые являются хемотаксическими для макрофагов и других компонентов иммунной системы. В частности, если вводят полипептид, то схема иммунизации будет включать в себя два или более введений полипептида с интервалами в несколько недель.

Предполагается иммунизация животного-хозяина антигеном, ассоциированным с клеточной мембраной интактной или разрушенной клетки, и антитела согласно настоящему изобретению идентифицируют на основании связывания с иммуногенным полипептидом согласно изобретению. После иммунизации животного-хозяина антигеном из организма животного могут быть получены антитела. Сыворотку, содержащую антитела, получают от животного посредством взятия крови или умерщвления животного. Сыворотку можно использовать в том виде, в котором она получена от животного, из сыворотки можно получать фракцию иммуноглобулинов, или из сыворотки можно очищать антитела. Сыворотка или иммуноглобулины, полученные таким образом, являются поликлональными, следовательно, обладающими рядом гетерогенных свойств.

3.2. Моноклональные анти-RAGE-антитела, полученные с использованием методики гибридом

Моноклональные антитела могут быть получены с использованием широкого множества способов, известных в данной области, включая использование гибридом, способов рекомбинации и фагового дисплея или их сочетания. Например, моноклональные антитела могут быть получены с использованием методики гибридом, включая методики, известные в данной области и описанные, например, в Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., в: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (указанные публикации включены в виде ссылки в полном объеме). Термин «моноклональное антитело» в используемом в настоящем изобретении смысле не ограничен антителами, полученными с использованием методики гибридом. Термин «моноклональное антитело» относится к антителу, которое получено из одного клона, включая любой эукариотический, прокариотический или фаговый клон, а не к способу, которым оно получено.

Способы получения и скрининга специфичных антител с использованием методики гибридом являются рутинными и хорошо известны в данной области. В одном варианте настоящее изобретение относится к способам создания моноклональных антител, а также антителам, полученным способом, включающим в себя культивирование гибридомной клетки, секретирующей антитело согласно изобретению, при этом гибридому, в частности, создают слиянием спленоцитов, выделенных из организма мыши, иммунизированной антигеном согласно изобретению, с клетками миеломы, и затем проводят скрининг гибридом, полученных в результате слияния, в отношении клонов гибридом, которые секретируют антитело, способное связывать полипептид согласно изобретению. Коротко, мыши могут быть иммунизированы антигеном RAGE. В конкретном варианте антиген RAGE вводят с адъювантом, чтобы стимулировать иммунный ответ. Такие адъюванты включают полный или неполный адъювант Фрейнда, RIBI (мурамилдипептиды) или ISCOM (иммуностимулирующие комплексы). Такие адъюванты могут защищать полипептид от быстрого распространения благодаря образованию комплексов в виде локального отложения или они могут содержать вещества, которые стимулируют у хозяина секрецию факторов, которые являются хемотаксическими для макрофагов и других компонентов иммунной системы. В частности, если вводят полипептид, то схема иммунизации будет включать в себя два или более введений полипептида с интервалами в несколько недель.

После выявления иммунного ответа, например, после выявления антител, специфичных для антигена RAGE, в сыворотке мышей, собирают селезенки мышей и выделяют спленоциты. Затем спленоциты сливают хорошо известными способами миеломы, например, с клетками из клеточной линии SP20, доступной из ATCC. Гибридомы отбирают и клонируют способом лимитирующего разведения. Затем клоны гибридом анализируют способами, известными в данной области для клеток, которые секретируют антитела, способные связывать RAGE. Может быть получена асцитная жидкость, которая обычно содержит высокие уровни антител, путем иммунизации мышей позитивными клонами гибридом.

В другом варианте иммортализованные гибридомы, продуцирующие антитела, могут быть получены от иммунизированного животного. После иммунизации животного умерщвляют и B-клетки селезенки сливают с иммортализованными клетками миеломы, которые хорошо известны в данной области. Смотри, например, Harlow and Lane, выше. В конкретном варианте клетки миеломы не секретируют полипептидов иммуноглобулина (линия не секретирующих клеток). После слияния и селекции с использованием антибиотиков проводят скрининг гибридом, используя RAGE или его часть, или клетку, экспрессирующую RAGE. В конкретном варианте начальный скрининг осуществляют, используя твердофазный иммуноферментный анализ (ELISA) или радиоиммуноанализ (РИА), в частности, ELISA. Примерный скрининг на основе ELISA описан в заявке WO 00/37504, включенной в настоящее описание в виде ссылки.

Гибридомы, продуцирующие анти-RAGE-антитело, отбирают, клонируют и подвергают дополнительному скринингу в отношении требуемых свойств, включая сильный рост гибридом, высокую продукцию антител и требуемые характеристики антитела, которые дополнительно обсуждаются ниже. Гибридомы можно культивировать и размножать in vivo в сингенных животных, в животных, у которых отсутствует иммунная система, например, в мышей nude, или в культуре клеток in vitro. Способы отбора, клонирования и размножения гибридом хорошо известны специалистам в данной области.

В конкретном варианте гибридомы представляют собой мышиные гибридомы, которые описаны выше. В другом конкретном варианте гибридомы получают для вида, отличного от человека и отличного от мыши, такого как крысы, овцы, свиньи, козы, крупный рогатый скот или лошади. В другом варианте гибридомы представляют собой гибридомы человека, в которых не секретирующая миелома человека слита с клеткой человека, экспрессирующей анти-RAGE-антитело.

Фрагменты антител, которые узнают специфичные эпитопы, могут быть созданы известными способами. Например, Fab- и F(ab')2-фрагменты согласно изобретению могут быть получены протеолитическим расщеплением молекул иммуноглобулина с использованием таких ферментов как папаин (чтобы получить Fab-фрагменты) или пепсин (чтобы получить F(ab')2-фрагменты). F(ab')2-фрагменты содержат вариабельную область, константную область легкой цепи и домен CH1 тяжелой цепи.

3.3. Моноклональные анти-RAGE-антитела, полученные с использованием SLAM

В другом аспекте изобретения рекомбинантные антитела получают из отдельных выделенных лимфоцитов, используя способ, называемый в данной области способом получения антител из отобранных лимфоцитов (SLAM), который описан в патенте США № 5627052, публикации PCT WO 92/02551 и в публикации Babcock, J. S. et al. (1996) Proc. Natl. Acad. Sci. USA 93: 7843-7848. В данном способе отдельные клетки, секретирующие представляющие интерес антитела, например, лимфоциты, полученные от одного из иммунизированных животных, описанных выше, подвергают скринингу, используя анализ антигенспецифичных гемолитических бляшек, в котором антиген RAGE, субъединицу RAGE или его фрагмент связывают с эритроцитами барана, используя линкер, такой как биотин, и используют для идентификации отдельных клеток, которые секретируют антитела, обладающие специфичностью по отношению к RAGE. После идентификации представляющих интерес клеток, секретирующих антитела, кДНК вариабельных областей тяжелой и легкой цепи «спасают» из клеток с помощью ПЦР с обратной транскриптазой, и такие вариабельные области затем можно экспрессировать в контексте подходящих константных областей иммуноглобулина (например, константных областей человека) в клетках-хозяевах млекопитающих, таких как клетки COS или CHO. Клетки-хозяева, трансфицированные амплифицированными последовательностями иммуноглобулина, полученными из отобранных in vivo лимфоцитов, затем могут быть подвергнуты дополнительному анализу и селекции in vitro, например, с помощью пэннинга трансфицированных клеток для того, чтобы выделить клетки, экспрессирующие антитела к RAGE. Амплифицированные последовательности иммуноглобулина могут быть дополнительно подвергнуты обработке in vitro, например, способами созревания аффинности in vitro, такими как способы, описанные в публикации PCT WO 97/29131 и публикации PCT WO 00/56772.

3.4. Моноклональные анти-RAGE-антитела, полученные с использованием трансгенных животных

В другом варианте осуществления настоящего изобретения антитела получают посредством иммунизации животного, отличного от человека, содержащего некоторые или все локусы иммуноглобулина человека, антигеном RAGE. В конкретном варианте животным, отличным от человека, является трансгенная мышь XENOMOUSE, сконструированная линия мышей, которые содержат крупные фрагменты локусов иммуноглобулинов человека и являются дефицитными по продукции мышиных антител. Смотри, например, Green et al. Nature Genetics 7: 13-21 (1994) и патенты США № 5916771, 5939598, 5985615, 5998209, 6075181, 6091001, 6114598 и 6130364. Смотри также WO 91/10741, опубликованную 25 июля 1991, WO 94/02602, опубликованную 3 февраля 1994, WO 96/34096 и WO 96/33735, опубликованные 31 октября 1996, WO 98/16654, опубликованную 23 апреля 1998, WO 98/24893, опубликованную 11 июня 1998, WO 98/50433, опубликованную 12 ноября 1998, WO 99/45031, опубликованную 10 сентября 1999, WO 99/53049, опубликованную 21 октября 1999, WO 00 09560, опубликованную 24 февраля 2000 и WO 00/037504, опубликованную 29 июня 2000. Трансгенная мышь XENOMOUSE продуцирует репертуар полностью человеческих антител человека, подобный репертуару взрослого человека, и создает специфичные для антигена мАт человека. Трансгенная мышь XENOMOUSE содержит примерно 80% репертуара антител человека благодаря введению YAC-фрагментов, имеющих конфигурацию зародышевой линии, размером в несколько мегабаз из локусов тяжелой цепи человека и локусов легкой цепи. Смотри публикации Mendez et al., Nature Genetics 15: 146-156 (1997), Green and Jakobovits J. Exp. Med. 188: 483-495 (1998), содержание которых включено в настоящее описание в виде ссылки.

3.5. Моноклональные анти-RAGE-антитела, полученные с использованием библиотек рекомбинантных антител

Способы in vitro также можно использовать для получения антител согласно изобретению, при этом проводят скрининг библиотеки антител, чтобы идентифицировать антитело, обладающее требуемой специфичностью связывания. Способы такого скрининга библиотек рекомбинантных антител хорошо известны в данной области и включают способы, описанные, например, Ladner с соавторами в патенте США № 5223409, Kang с соавторами в публикации PCT № WO 92/18619; Dower с соавторами в публикации PCT № WO 91/17271; Winter с соавторами в публикации PCT № WO 92/20791; Markland с соавторами в публикации PCT № WO 92/15679; Breitling с соавторами в публикации PCT № WO 93/01288; McCafferty с соавторами в публикации PCT № WO 92/01047; Garrard с соавторами в публикации PCT No. WO 92/09690; Fuchs et al. (1991) Bio/Technology 9: 1370-1372; Hay et al. (1992) Hum Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; McCafferty et al., Nature (1990) 348: 552-554; Griffiths et al. (1993) EMBO J. 12: 725-734; Hawkins et al. (1992) J. Mol. Biol. 226: 889-896; Clackson et al. (1991) Nature 352: 624-628; Gram et al. (1992) PNAS 89: 3576-3580; Garrad et al. (1991) Bio/Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc. Acid. Res 19: 4133-4137; и Barbas et al. (1991) PNAS 88: 7978-7982, публикации заявки на выдачу патента США 20030186374 и публикации PCT № WO 97/29131, содержание каждой из публикаций включено в настоящее описание в виде ссылки.

Библиотека рекомбинантных антител может быть от субъекта, иммунизированного RAGE или части RAGE. Альтернативно библиотека рекомбинантных антител может быть от нативного субъекта, т.е. субъекта, который не был иммунизирован RAGE, такая как библиотека антител человека, полученных от человека, который не был иммунизирован RAGE человека. Антитела согласно изобретению отбирают с помощью скрининга библиотеки рекомбинантных антител с использованием пептида, содержащего RAGE человека, чтобы таким образом отобрать такие антитела, которые узнают RAGE. Способы проведения такого скрининга и отбора хорошо известны в данной области, такие как способы описанные в публикациях, указанных в предыдущем абзаце. Чтобы отобрать антитела согласно изобретению, имеющие конкретные аффинности связывания с hRAGE, например, антитела, которые диссоциируют из комплекса с RAGE человека с конкретной константой скорости koff, можно использовать известный в данной области и способ резонанса поверхностного плазмона, чтобы отобрать антитела, имеющие требуемую константу скорости koff. Чтобы отобрать антитела согласно изобретению, обладающие конкретной нейтрализующей активностью по отношению к hRAGE, такие как антитела с конкретным значением IC50, можно использовать стандартные способы, известные в данной области для оценки ингибирования активности hRAGE.

В одном аспекте изобретение относится к выделенному антителу или его антигенсвязывающей части, которая связывает RAGE человека. В частности, антитело представляет собой нейтрализующие антитело. В различных вариантах антитело представляет собой рекомбинантное антитело или моноклональное антитело.

Например, антитела согласно настоящему изобретению также могут быть созданы с использованием различных способов фагового дисплея, известных в данной области. В способах фагового дисплея функциональные домены антител презентируют на поверхности фаговых частиц, которые несут полинуклеотидные последовательности, кодирующие такие домены. В частности, такой фаг может быть использован для презентации антигенсвязывающих доменов, экспрессированных из библиотеки репертуара антител или комбинаторной библиотеки антител (например, человека или мыши). Фаг, экспрессирующий антигенсвязывающий домен, который связывает представляющий интерес антиген, может быть отобран или идентифицирован с использованием антигена, например, с использованием меченого антигена или антигена, связанного или иммобилизованного на твердой поверхности или шарике. Фаг, используемый в таких способах, обычно является нитчатым фагом, включая fd и M13, при этом связывающие домены, экспрессированные с фага, имеют Fab-, Fv- или стабилизированные дисульфидом Fv-домены антител, рекомбинантно слитые с белком либо фагового гена III, либо фагового гена VIII. Примеры способов фагового дисплея, которые можно использовать для получения антител согласно настоящему изобретению, включают способы, описанные в Brinkman et al., J. Immunol. Methods 182: 41-50 (1995); Ames et al., J. Immunol. Methods 184: 177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); в заявке PCT № PCT/GB91/01134; в публикациях PCT WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO 95/20401 и в патентах США № 5698426, 5223409, 5403484, 5580717, 5427908, 5750753, 5821047, 5571698, 5427908, 5516637, 5780225, 5658727, 5733743 и 5969108; при этом каждая из публикаций включена в настоящее описание в виде ссылки в полном объеме.

Как описано в указанных выше публикациях, после отбора фага области, кодирующие антитела, из фага могут быть выделены и использованы для создания целых антител, антитела человека или любого другого требуемого антигенсвязывающего фрагмента, и экспрессированы в любом требуемом хозяине, включая клетки млекопитающих, клетки насекомых, клетки растений, дрожжи и бактерии, например, как подробно описано ниже. Например, методики рекомбинантного получения Fab-, Fab'- и F(ab')2-фрагментов, также можно применять с использованием способов, известных в данной области, таких как способы, описанные в публикации PCT WO 92/22324; Mullinax et al., BioTechniques 12(6): 864-869 (1992); Sawai et al., AJRI 34: 26-34 (1995); и Better et al., Science 240: 1041-1043 (1988) (указанные публикации включены в виде ссылки в полном объеме). Примерами способов, которые можно применять для получения одноцепочечных Fv и антител, являются способы, описанные в патентах США № 4946778 и 5258498; Huston et al., Methods in Enzymology 203: 46-88 (1991); Shu et al., PNAS 90: 7995-7999 (1993); и Skerra et al., Science 240: 1038-1040 (1988).

В качестве альтернативы скринингу рекомбинантных библиотек антител на основе фагового дисплея другие методики, известные в данной области для скрининга крупных комбинаторных библиотек, можно применять для идентификации антител с двойной специфичностью согласно изобретению. Одним из типов альтернативной системы экспрессии является система, в которой библиотеку рекомбинантных антител экспрессируют в виде слияний РНК-белок, как описано в публикации PCT № WO 98/31700, Szostak and Roberts, и в публикации Roberts, R. W. and Szostak, J. W. (1997) Proc. Natl. Acad. Sci. USA 94: 12297-12302. В такой системе создают ковалентное слияние между мРНК и пептидом или белком, который она кодирует, при трансляции in vitro синтетических мРНК, которые несут пуромицин, антибиотик, являющийся акцептором пептидила, на своем 3'-конце. Таким образом, можно обогатить популяцию специфичной мРНК, находящейся в сложной смеси мРНК (например, комбинаторной библиотеке) на основе свойств кодируемого пептида или белка, например, антитела или его части, таких как связывание антитела или его части с антигеном, имеющим двойную специфичность. Последовательности нуклеиновой кислоты, кодирующие антитела или их части, извлеченные в результате скрининга таких библиотек, могут быть экспрессированы с использованием основанных на рекомбинации способов, которые описаны выше (например, в клетках-хозяевах млекопитающих) и, кроме того, могут быть подвергнуты дополнительному созреванию аффинности либо в результате дополнительных раундов скрининга слияний мРНК-пептид, в которые были введены мутации в исходно отобранной последовательности (последовательностях), либо с использованием других способов созревания аффинности рекомбинантных антител in vitro, как описано выше.

В другом способе антитела согласно настоящему изобретению также могут быть созданы с использованием способов дрожжевого дисплея, известными в данной области. В способах дрожжевого дисплея применяют генетические способы, чтобы связать домены антител с клеточной стенкой дрожжей и презентировать их на поверхности дрожжей. В частности, такие дрожжи могут быть применимы для дисплея антигенсвязывающих доменов, экспрессированных из библиотеки репертуара антител или комбинаторной библиотеки антител (например, человека или мыши). Примерами способов дрожжевого дисплея, которые можно применять для получения антител согласно настоящему изобретению, являются способы, описанные Wittrup с соавторами в патенте США № 6699658, включенном в настоящее описание в виде ссылки.

4. Получение конкретных рекомбинантных RAGE-антител согласно изобретению

Антитела согласно настоящему изобретению могут быть получены любым из целого ряда способов, известных в данной области. Например, экспрессией в клетках-хозяевах, при этом клетку-хозяина трансфицируют экспрессирующим вектором(ами), кодирующим тяжелую и легкую цепи, стандартными способами. Подразумевается, что различные формы термина «трансфекция» охватывают широкое множество способов, обычно применяемых для введения экзогенной ДНК в прокариотическую или эукариотическую клетку-хозяина, например, электропорацию, преципитацию фосфатом кальция, трансфекцию с использованием DEAE-декстрана и тому подобные. Хотя можно экспрессировать антитела согласно изобретению в любых прокариотических или эукариотических клетках-хозяевах, предпочтительная экспрессия антител в эукариотических клетках и наиболее предпочтительная в клетках-хозяевах млекопитающих, поскольку в таких эукариотических клетках (и в частности клетках млекопитающих) более вероятно, чем в прокариотических клетках, происходит сборка и секреция подвергнутого правильному фолдингу и иммунологически активного антитела.

Конкретными клетками-хозяевами млекопитающих для экспрессии рекомбинантных антител согласно изобретению являются клетки яичника китайского хомячка (клетки CHO) (включая клетки dhfr-CHO, описанные в Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77: 4216-4220, используемые с селектируемым маркером DHFR, например, как описано в R. J. Kaufman and P. A. Sharp (1982) Mol. Biol. 159: 601-621), клетки миеломы NS0, клетки COS и клетки SP2. Когда рекомбинантные экспрессирующие векторы, кодирующие гены антител, вводят в клетки-хозяева млекопитающих, антитела получают посредством культивирования клеток-хозяев в течение периода времени, достаточного для того, чтобы обеспечить экспрессию антитела в клетках-хозяевах или, в частности, секрецию антитела в культуральную среду, в которой клетки-хозяева выращивают. Антитела могут быть извлечены из культуральной среды с использованием стандартных способов очистки белка.

Клетки-хозяева также можно использовать для получения функциональных фрагментов антител, таких как Fab-фрагменты или молекулы scFv. Будет понятно, что изменения указанного выше способа входят в объем настоящего изобретения. Например, может быть желательным трансфекция клетки-хозяина ДНК, кодирующей функциональные фрагменты легкой цепи и/или тяжелой цепи антитела согласно настоящему изобретению. Также можно использовать методику рекомбинантной ДНК для удаления некоторых или всех ДНК, кодирующих любую или обе легкую и тяжелую цепи, которые не являются необходимыми для связывания с представляющими интерес антигенами. Молекулы, экспрессированные с таких укороченных молекул ДНК, также относятся к антителам согласно изобретению. Кроме того, могут быть получены бифункциональные антитела, в которых одна тяжелая и одна легкая цепь представляют антитело согласно изобретению, а другие тяжелая и легкая цепи специфичны для другого антигена, отличного от представляющих интерес антигенов, посредством поперечного сшивания антитела согласно изобретению со вторым антителом стандартными химическими способами поперечного сшивания.

В конкретной системе рекомбинантной экспрессии антитела или его антигенсвязывающей части согласно изобретению, рекомбинантный экспрессирующий вектор, кодирующей и тяжелую цепь антитела и легкую цепь антитела, вводят в клетки dhfr-CHO путем опосредованной фосфатом кальция трансфекции. В рекомбинантном экспрессирующем векторе гены тяжелой и легкой цепей антитела оперативно связаны с регуляторными элементами энхансер CMV/промотор AdMLP, чтобы получать высокие уровни транскрипции генов. Рекомбинантный экспрессирующий вектор также несет ген DHFR, который обеспечивает возможность селекции клеток CHO, которые были трансфицированы вектором, с использованием селекции/амплификации в присутствии метотрексата. Отобранные трансформированные клетки-хозяева культивируют, обеспечивая возможность экспрессии тяжелой и легкой цепей антитела, и интактное антитело извлекают из культуральной среды. Используют стандартные способы молекулярной биологии для получения рекомбинантного экспрессирующего вектора, трансфекции клеток-хозяев, селекции трансформантов, культивирования клеток-хозяев и извлечения антитела из культуральной среды. Кроме того, изобретение относится к способу синтеза рекомбинантного антитела согласно изобретению посредством культивирования клетки-хозяина согласно изобретению в подходящей культуральной среде вплоть до синтеза рекомбинантного антитела согласно изобретению. Кроме того, способ может включать в себя выделение рекомбинантного антитела из культуральной среды.

4.1. Анти-RAGE-антитела

В таблице 4 приведен список аминокислотных последовательностей областей VH и VL конкретных анти-hRAGE-антител согласно изобретению.

Указанные выше выделенные последовательности CDR анти-RAGE-антител составляют новое семейство RAGE-связывающих белков, выделенных согласно настоящему изобретению. Чтобы создать и отобрать CDR согласно изобретению, имеющие определенную активность связывания и/или нейтрализации RAGE по отношению к hRAGE, можно использовать стандартные способы, известные в данной области, для создания связывающих белков согласно настоящему изобретению и оценки характеристик связывания и/или нейтрализации RAGE такого связывающего белка, включая без ограничения способы, конкретно описанные в настоящей публикации.

4.2. Химерные анти-RAGE-антитела

Химерное антитело представляет собой молекулу, в которой разные части антитела получены от разных видов животных, такую как антитела, имеющие вариабельная область, полученную из мышиного моноклонального антитела, и константную область иммуноглобулина человека. Способы получения химерных антител известны в данной области. Смотри, например, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Gillies et al., (1989) J. Immunol. Methods 125: 191-202; патенты США № 5807715, 4816567 и 4816397, которые включены в настоящее описание в виде ссылки в полном объеме. Кроме того, можно использовать способы, разработанные для получения «химерных антител» (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81: 851-855; Neuberger et al., 1984, Nature 312: 604-608; Takeda et al., 1985, Nature 314: 452-454, публикации включены в настоящее описание в виде ссылки в полном объеме) посредством сплайсинга генов молекулы антитела мыши с соответствующей антигенной специфичностью вместе с генами молекулы антитела человека с соответствующей биологической активностью.

В одном варианте химерные антитела согласно изобретению получают заменой константной области тяжелой цепи мышиных моноклональных антител против RAGE, описанных в настоящей публикации, константной областью IgG1 человека.

4.3. CDR-привитые анти-RAGE-антитела

CDR-привитые антитела согласно изобретению содержат последовательности вариабельных областей тяжелой и легкой цепи антитела человека, в которых одна или несколько областей CDR VH и/или VL заменяют последовательностями CDR животного, отличного от человека, например, мышиных антител согласно изобретению. Каркасная последовательность любого антитела человека может служить в качестве матрицы для прививки CDR. Однако прямая замена цепи в таком каркасе часто приводит к некоторой утрате аффинности связывания с антигеном. Чем больше гомология антитела человека с исходным мышиным антителом, тем менее вероятно, что комбинирование мышиных CDR с каркасом человека будет вносить искажения в CDR, которые могут уменьшать аффинность. Поэтому предпочтительно, чтобы вариабельные области каркаса человека, которые выбирают для замены вариабельными областями мышиного каркаса, кроме CDR, имели, по меньшей мере, 65% идентичность последовательности с вариабельной областью каркаса мышиного антитела. Более предпочтительно, чтобы вариабельные области человека и мыши кроме CDR имели, по меньшей мере, 70% идентичность последовательностей. Еще более предпочтительно, чтобы вариабельные области человека и мыши кроме CDR имели, по меньшей мере, 75% идентичность последовательностей. Наиболее предпочтительно, чтобы вариабельные области мыши и человека кроме CDR имели, по меньшей мере, 80% идентичность последовательностей. Способы получения CDR-привитых антител известны в данной области (Jones et al., Nature 321: 522-525 (1986); патенты США № 5225539).

В конкретном варианте изобретение относится к CDR-привитым антителам с цепями VH и/или VL, которые описаны в таблице 5.

CDR-последовательности, полученные из мАт 11E6, указаны жирным шрифтом. Также сделаны ссылки на конкретные каркасные последовательности (FR1-FR4) путем указания соответствующих SEQ ID NO (смотри также таблицы 2 и 3).

4.4. Гуманизированные анти-RAGE-антитела

Гуманизированные антитела представляют собой молекулы антител, полученные из антитела вида животного, отличного от человека, которое связывает требуемый антиген, имеющие одну или несколько определяющих комплементарность областей (CDR) вида животного, отличного от человека, и каркасные области из молекулы иммуноглобулина человека. Известные последовательности Ig человека описаны, например, в

каждая публикация включена в настоящее описание в виде ссылки. Такие импортируемые последовательности можно использовать для уменьшения иммуногенности или уменьшения, усиления или модификации связывания, аффинности, скорости образования комплекса, скорости распада комплекса, авидности, специфичности, времени полужизни или любых других применимых свойств, которые известны в данной области.

Каркасные остатки в каркасных областях человека могут быть заменены соответствующим остатком из антитела-донора CDR, чтобы изменить, в частности, улучшить связывание антигена. Такие замены в каркасе идентифицируют способами, хорошо известными в данной области, например, с помощью моделирования взаимодействий CDR и каркасных остатков, чтобы идентифицировать каркасные остатки, важные для связывания антигена, и сравнением последовательностей, чтобы идентифицировать необычные каркасные остатки в конкретных положениях. (Смотри, например, публикации Queen с соавторами, патент США № 5585089, Riechmann et al., Nature 332: 323 (1988), которые включены в настоящее описание в виде ссылки в полном объеме). Трехмерные модели иммуноглобулинов общедоступны и известны специалистам в данной области. Доступны компьютерные программы, которые иллюстрируют и показывают возможные трехмерные конформационные структуры выбранных последовательностей иммуноглобулинов. Просмотр таких изображений позволяет проанализировать вероятную роль остатков в функционировании выбранной для исследования последовательности иммуноглобулина, т.е. провести анализ остатков, которые влияют на способность выбранного для исследования иммуноглобулина связывать его антиген. Таким образом можно выбирать и комбинировать остатки FR из консенсусных и импортируемых последовательностей, так чтобы добиться требуемого свойства антитела, такого как аффинность по отношению к антигену-мишени (антигенам-мишеням). В общем, остатки CDR непосредственно и наиболее значимо оказывают влияние на связывание антигена. Антитела могут быть гуманизированы с использованием различных способов, известных в данной области, таких как без ограничения способы, описанные в

в публикации PCT WO 91/09967, PCT: US98/16280, US96/18978, US91/09630, US91/05939, US94/01234, GB89/01334, GB91/01134, GB92/01755; WO90/14443, WO90/14424, WO90/14430, EP 229246, EP 592106; EP 519596, EP 239400, в патента США № 5565332, 5723323, 5976862, 5824514, 5817483, 5814476, 5763192, 5723323, 5766886, 5714352, 6204023, 6180370, 5693762, 5530101, 5585089, 5225539, 4816567; каждая из публикаций включена в настоящее описание в виде ссылки, цитированной в настоящем описании.

5. Дополнительные варианты антител согласно изобретению

5.1. Слитые антитела и иммуноадгезины

В настоящей заявке также описано слитое антитело или иммуноадгезин, которые могут быть получены и которые включают в себя все или часть RAGE-антитела согласно настоящему изобретению, связанную с другим полипептидом. В некоторых вариантах только вариабельную область RAGE-антитело связывают с полипептидом. В других вариантах VH-домен RAGE-антитела согласно настоящему изобретению связывают с первым полипептидом, тогда как VL-домен антитела связывают со вторым полипептидом, который соединяется с первым полипептидом таким образом, который позволяет доменам VH и VL взаимодействовать друг с другом с образованием связывающего сайта антитела. В других вариантах домен VH отделен от домена VL линкером, который позволяет доменам VH и VL взаимодействовать друг с другом (смотри ниже в разделе «Одноцепочечные антитела»). Затем антитело VH-линкер-VL связывают с представляющим интерес полипептидом. Слитое антитело применимо для направления полипептида в клетку или ткань, которая экспрессирует RAGE. Представляющий интерес полипептид может представлять собой терапевтическое средство, такое как токсин, или может представлять собой диагностическое средство, такое как фермент; который можно легко визуализировать, например, пероксидаза хрена. Кроме того, могут быть созданы слитые антитела, в которых два (или более) одноцепочечных антитела связаны друг с другом. Это применимо в том случае, если хотят создать дивалентное или поливалентное антитело в одной полипептидной цепи, или если хотят создать биспецифичное антитело.

Один вариант относится к меченому связывающему белку, в котором антитело или часть антитела согласно настоящему изобретению дериватизована или связана с другой функциональной молекулой (например, другим пептидом или белком). Например, меченый связывающий белок согласно настоящему изобретению может быть дериватизован в результате функционального связывания антитела или части антитела согласно настоящему изобретению (посредством химического связывания, генетического слияния, нековалентной ассоциации или иным образом) с одним или несколькими другими молекулярными компонентами, такими как нуклеиновая кислота, другое антитело (например, биспецифичное антитело или диантитело), регистрируемое средство, цитотоксическое средство, фармацевтическое средство и/или белок или пептид, которые могут опосредовать ассоциацию антитела или части антитела с другой молекулой (такой как стрептавидиновая коровая область или полигистидиновая метка).

Применимые регистрируемые средства, которыми антитело или часть антитела согласно настоящему изобретению могут быть дериватизованы, включают флуоресцирующие соединения. Примерами флуоресцирующих регистрируемых средств являются флуоресцеин, изотиоцианат флуоресцеина, родамин, 5-диметиламин-1-нафталинсульфонилхлорид, фикоэритрин и тому подобные. Антитело также может быть дериватизовано регистрируемыми ферментами, такими как щелочная фосфатаза, пероксидаза хрена, глюкозооксидаза и тому подобные. Когда антитело дериватизовано регистрируемым ферментом, его выявляют, добавляя дополнительные реагенты, которые фермент использует с образованием регистрируемого продукта реакции. Например, в том случае, когда присутствует регистрируемое средство пероксидаза хрена, добавление пероксида водорода и диаминобензидина приводит к образованию окрашенного продукта реакции, который регистрируют. Антитело также может быть дериватизовано нуклеиновой кислотой, биотином и выявлено в результате непрямого измерения связывания авидина или стрептавидина.

5.2. Одноцепочечные антитела

Настоящее изобретение включает в себя одноцепочечное антитело (scFv), которое связывает иммуногенный RAGE согласно изобретению. Чтобы scFv, ДНК, кодирующую VH и VL, оперативно связывают с ДНК, кодирующей гибкий линкер, например, кодирующей аминокислотную последовательность (Gly4-Ser), так что последовательности VH и VL могли экспрессироваться в виде непрерывного одноцепочеченого белка, в котором области VL и VH связаны гибким линкером (смотри, например, Bird et al. (1988) Science 242: 423-42 6; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883; McCafferty et al., 30 Nature (1990) 34 8: 552-554). Одноцепочечное антитело может быть моновалентным, если используют только отдельные VH и VL, бивалентными, если используют два VH и VL, или поливалентными, если используют более двух VH и VL. Два указанных фрагмента scFv, связанных линкером, называют «диантителом», и такая форма также входит в объем изобретения.

5.3. Биспецифичные антитела

Настоящее изобретение, кроме того, относится к биспецифичному антителу или его антигенсвязывающему фрагменту, в котором одна специфичность представляет собой специфичность к иммуногенному полипептиду RAGE согласно настоящему изобретению. Например, может быть создано биспецифичное антитело, которое специфично связывается с иммуногенным полипептидом RAGE согласно изобретению посредством одного связывающего домена, а со второй молекулой посредством второго связывающего домена. Кроме того, может быть создано одноцепочечное антитело, содержащее более одной VH и VL, которое специфично связывается с иммуногенным полипептидом согласно изобретению и с другой молекулой, которая ассоциирована с ослаблением опосредованного миелином коллапса конуса роста и ингибирования отрастания и прорастания нейритов. Такие биспецифичные антитела могут быть созданы с использованием способов, которые хорошо известны, например, описаны в Fanger et al. Immunol. Methods 4: 72-81 (1994) и Wright and Harris, 20 (выше).

В некоторых вариантах биспецифичные антитела получают, используя одну или несколько вариабельных областей из антитела согласно изобретению. В другом варианте биспецифичное антитело получают, используя одну или несколько областей CDR из указанного антитела.

5.4. Дериватизованные и меченые антитела

Антитело или антигенсвязывающий фрагмент согласно настоящему изобретению могут быть дериватизованы или связаны с другой молекулой (например, другим пептидом или белком). В общем, антитело или антигенсвязывающий фрагмент подвергают дериватизации так, чтобы дериватизация или мечение не оказывало неблагоприятного влияния на связывание с иммуногенным полипептидом согласно изобретению.

Например, антитело или часть антитела согласно настоящему изобретению может быть функционально связано (посредством химического связывания, генетического слияния, нековалентной ассоциации или иным образом) с одним или несколькими другими молекулярными компонентами, такими как другое антитело (например, биспецифичное антитело или диантитело), реагент для регистрации, цитотоксическое средство, фармацевтическое средство и/или белок или пептид, который может опосредовать ассоциацию антитела или антигенсвязывающего фрагмента с другой молекулой (такой как стрептавидиновая коровая область или полигистидиновая метка). Кроме того, антитело или его антигенсвязывающая часть может представлять собой часть более крупной молекулы иммуноадгезии, образованной в результате ковалентной или нековалентной ассоциации антитела или части антитела с одним или несколькими другими или разными белками или пептидами. Примеры таких молекул иммуноадгезии включают применение стрептавидиновой коровой области, чтобы получить тетрамерную молекулу scFv (Kipriyanov et al. (1995) Human Antibodies and Hybridomas 6: 93-101) и применение остатка цистеина, маркерного пептида и C-концевой полигистидиновой метки для получения бивалентных и биотинилированных молекул scFv (Kipriyanov et al. (1994) Molecular Immunology 31: 1047-1058). Части антител, такие как Fab- и F(ab')2-фрагменты, могут быть получены из целых антител с использованием обычных способов, таких как расщепление целых антител папаином или пепсином, соответственно. Кроме того, антитела, части антител и молекулы иммуноадгезии могут быть получены с использованием стандартных методик получения рекомбинантной ДНК.

Дериватизованное антитело может быть получено поперечным сшиванием двух или более антител (одного и того же типа или разных типов, например, чтобы создать биспецифичные антитела). Подходящими поперечно сшивающими агентами являются агенты, которые являются гетеробифункциональными, имеющими две по разному реагирующие группы, разделенные подходящими спейсером (например, сложный м-малеимидобензоил-N-гидроксисукцинимидный эфир) или гомобифункциональными (например, дисукцинимидилсуберат). Такие линкеры доступны из Pierce Chemical Company, Rockford, III.

Дериватизованное антитело также может быть меченым антителом. Например, средствами для регистрации, которыми может быть дериватизовано антитело или часть антитела согласно изобретению, являются флуоресцирующие соединения, включая флуоресцеин, изотиоцианат флуоресцеина, родамин, 5-диметиламин-1-нафталинсульфонилхлорид, фикоэритрин, лантанидные люминофоры и тому подобные. Антитело также можно метить ферментами, которые применимы для регистрации, такими как пероксидаза хрена, галактозидаза, люцифераза, щелочная фосфатаза, глюкозооксидаза и тому подобные. В вариантах, которые метят регистрируемым ферментом, антитело выявляют при добавлении дополнительных реагентов, которые использует фермент для получения регистрируемого продукта реакции. Например, пероксидазу хрена с пероксидом водорода и диаминобензидином. Антитело также можно метить биотином и выявлять с использованием непрямого измерения связывания авидина или стрептавидина. Антитело также можно метить предварительно определяемым полипептидным эпитопом, узнаваемым вторым репортером (например, пары последовательностей лейциновой молнии, сайты связывания вторых антител, домены, связывающие металлы, эпитоп:метки). RAGE-антитело или его антигенсвязывающий фрагмент также можно метить радиоактивно меченой аминокислотой. Радиоактивную метку можно использовать как для диагностических, так и для терапевтических целей. Радиоактивно меченое RAGE-антитело можно использовать диагностически, например, для определения уровней рецептора RAGE у субъекта. Кроме того, радиоактивно меченое RAGE-антитело можно использовать терапевтически для лечения повреждения спинного мозга.

Примерами меток для полипептидов являются, без ограничения, следующие радиоактивные изотопы или радионуклеотиды 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho, 153Sm. RAGE-антитело или его антигенсвязывающий фрагмент также может быть дериватизовано химической группой, такой как полиэтиленгликоль (ПЭГ), метильная или этильная группа или углеводная группа. Такие группы могут быть применимы для улучшения биологических свойств антитела, например, для увеличения времени полужизни в сыворотке или для увеличения связывания в тканях. Также, меткой для полипептидов может быть нуклеиновая кислота, например, ДНК для выявления с помощью ПЦР или усиления экспрессии гена, или миРНК для подавления экспрессии гена в клетках или тканях, несущих RAGE.

Класс и подкласс RAGE-антител может быть определен любым способом, известным в данной области. В общем, класс и подкласс антитела может быть определен с использованием антител, которые являются специфичными для конкретного класса и подкласса антитела. Такие антитела являются коммерчески доступными. Класс и подкласс можно определить с помощью ELISA, Вестерн-блота, а также другими способами. Альтернативно класс и подкласс можно определить секвенированием всех или части константных доменов тяжелой и/или легкой цепей антител, сравнением их аминокислотных последовательностей с известными аминокислотными последовательностями различных классов и подклассов иммуноглобулинов и определением класса и подкласса антител.

5.5. Иммуноглобулины с двойными вариабельными доменами

Связывающие белки или иммуноглобулины с двойными вариабельными доменами (DVD) в используемом в настоящем изобретении смысле представляют собой связывающие белки, которые содержат два или более антигенсвязывающих участка и являются тетравалентными или поливалентными связывающими белками, например, дивалентными и тетравалентными. Термин «поливалентный связывающий белок» используют в настоящем описании для обозначения связывающего белка, содержащего два или более антигенсвязывающих участков. Поливалентный связывающий белок, в частности, конструируют так, чтобы он имел или более антигенсвязывающих участков, и обычно такой белок представляет собой не встречающееся в природе антитело. Термин «полиспецифичный связывающий белок» относится к связывающему белку, способному связывать две или более родственных или неродственных мишени. Такие DVD могут быть моноспецифичными, т.е. способными связывать один антиген, или полиспецифичными, т.е. способными связывать два или более антигенов. Связывающие белки с DVD, содержащие два DVD-полипептида тяжелой цепи и два DVD-полипептида легкой цепи, называют DVD-Ig. Каждая половина DVD-Ig содержит DVD-полипептид тяжелой цепи и DVD-полипептид легкой цепи и два антигенсвязывающих участка. Каждый участок связывания содержит вариабельный домен тяжелой цепи и вариабельный домен легкой цепи всего с 6 CDR, вовлеченными в связывание антигена, на один антигенсвязывающий участок. Связывающие DVD-белки и способы получения связывающих DVD-белков раскрыты в заявке на выдачу патента США с регистрационным № 11/507050, которая включена в настоящее описание в виде ссылки. Подразумевается, что настоящее изобретение включает в себя связывающий DVD-белок, включая связывающие белки, способные связывать RAGE. В частности, связывающий DVD-белок способен связывать RAGE и вторую мишень. Вторая мишень выбрана из группы, состоящей из противовоспалительных активностей MAB (IL-1, IL-6, IL-8, IL-11, IL-12, IL-17, IL-18, IL-23, TNF альфа/бета, IFN-бета, гамма, LIF, OSM, CNTF, PF-4, основной белок тромбоцитов (PBP), NAP-2, бета-TG, MIP-1, MCP2/3, RANTES, лимфотактин), белков, опосредующих транспорт (рецептор инсулина, рецептор трансферрина, рецептор тромбина, рецептор лептина, рецептор LDL), других нейрорегенеративных мАт (NgR, Lingo, p75, CSPG (например, NG-2, нейрокан, бревикан, версикан, аггрекан), гиалуроновая кислота, mAG, тенасцин, NI-35, NI-250, IMP, перлекан, нейрокан, фосфакан, ного-A, OMGP, Sema4D, Sema 3A, эфрин B3, эфрин A2, эфрин A5, MAG, EphA4, плексин B1, TROY, wnts, ryk rec., BMP-2, BMP-4, BMP-7), нейропротекторных активностей мАт (EGF, EGFR, Sema 3), мАт против амилоида бета (например, m266, 3D6 (бапинейзумаб), мАт против глобуломеров (7C6), расположенных в ЦНС рецепторов и переносчиков (рецепторы серотонина, рецепторы допамина, DAT, Asc-1, GlyT1).

5.6. Антитела с двойной специфичностью

В настоящей заявке также описана методика, основанная на «антителах с двойной специфичностью». Антитела с двойной специфичностью могут служить в качестве агонистов, антагонистов или и тех и других в разных сочетаниях. Антитела с двойной специфичностью представляют собой антитела, в которых VH-цепь связывается с первым антигеном и VL-цепь связывается с другим антигеном, как описано в WO2008082651.

5.7. Кристаллизованные антитела

Другой вариант осуществления настоящего изобертения относится к кристаллизованному связывающему белку. Термин «кристаллизованный» в используемом в настоящем изобретении смысле относится к антителу или его антигенсвязывающей части, которые существуют в форме кристалла. Кристаллы представляют собой одну из форм твердого состояния вещества, которое отличается от других форм, таких как аморфное твердое состояние или жидкокристаллическое состояние. Кристаллы состоят из правильных повторяющихся трехмерных наборов атомов, ионов, молекул (например, белков, таких как антитела) или молекулярных ансамблей (например, комплексов антиген/антитело). Такие трехмерные наборы расположены согласно конкретным математическим взаимосвязям, которые хорошо известны в данной области. Фундаментальная единица или строительный блок, который повторяется в кристалле, называют ассиметричной единицей. Повторение ассиметричной единицы в структуре, которое подчиняется некоторой хорошо определенной кристаллографической симметрии, создает «элементарную ячейку» кристалла. Повторение элементарной ячейки в результате регулярных трансляций во всех трех направлениях создает кристалл. Смотри Giege, R. and Ducruix, A. Barrett, Crystallization of Nucleic Acids and Proteins, a Practical Approach, 2nd ed., pp. 201-16, Oxford University Press, New York, N.Y., (1999).

В частности, в настоящей заявке описаны кристаллы целых RAGE-антител и их фрагментов, которые раскрыты в настоящем описании, и препараты и композиции, содержащие такие кристаллы. В одном варианте кристаллизованный связывающий белок имеет более длительное время полужизни in vivo, чем растворимый эквивалент связывающего белка. В другом варианте связывающий белок сохраняет биологическую активность после кристаллизации.

Кристаллизованный связывающий белок согласно изобретению может быть получен согласно способам, известным в данной области, и как описано в WO 02072636, включенной в настоящее описание в виде ссылки.

5.8. Гликозилированные антитела

Другой вариант осуществления изобретения относится к гликозилированному связывающему белку, в котором антитело или его антигенсвязывающая часть содержит один или несколько углеводных остатков. Появляющиеся in vivo белковые продукты могут подвергаться дальнейшему процессингу, известному как посттрансляционная модификация. В частности, остатки сахара (гликозила) могут быть добавлены ферментативно способом, известным как гликозилирование. Полученные белки, несущие ковалентно связанные олигосахаридные боковые цепи, известны как гликозилированные белки или гликопротеины. Антитела представляют собой гликопротеины с одним или несколькими углеводными остатками в домене Fc, а также вариабельном домене. Углеводные остатки в Fc-домене оказывают важное влияние на эффекторную функцию Fc-домена, при этом оказывая минимальное влияние на связывание антигена или время полужизни антитела (R. Jefferis, Biotechnol. Prog. 21 (2005), pp. 11-16). Напротив, гликозилирование вариабельного домена может оказывать влияние на антигенсвязывающую активность антитела. Гликозилирование в вариабельном домене может оказывать негативное влияние на аффинность связывания антитела, вероятно вследствие стерических помех (Co, M. S., et al., Mol. Immunol. (1993) 30: 1361-1367), или приводит к повышенной аффинности по отношению к антигену (Wallick, S. C., et al., Exp. Med. (1988) 168: 1099-1109; Wright, A., et al., EMBO J. (1991) 10: 2717 2723).

Один аспект настоящего изобретения направлен на создание мутантов по сайтам гликозилирования, в которых сайт O- или N-связанного гликозилирования связывающего белка был подвергнут мутации. Специалист в данной области может создать такие мутанты, используя стандартные хорошо известные методики. Мутанты по сайту гликозилирования, которые сохраняют биологическую активность, но имеют повышенную или пониженную активность связывания, являются другим объектом настоящего изобретения.

В еще одном варианте гликозилирование антитела или антигенсвязывающей части согласно изобретению модифицируют. Например, можно получить негликозилированное антитело (т.е., антитело, в котором гликозилирование отсутствует). Гликозилирование может быть изменено, например, чтобы повысить аффинность антитела по отношению к антигену. Такие углеводные модификации могут быть осуществлены, например, посредством изменения одного или нескольких сайтов гликозилирования в последовательности антитела. Например, может быть осуществлена одна или несколько аминокислотных замен, которые приводят к удалению одного или нескольких сайтов гликозилирования вариабельной области, тем самым исключая гликозилирование в таком сайте. Такое отсутствие гликозилирования может увеличивать аффинность антитела по отношению к антигену. Такой способ описан более подробно в публикации PCT WO2003016466A2 и в патентах США № 5714350 и 6350861, каждая из публикаций включена в настоящее описание в виде ссылки в полном объеме.

Дополнительно или альтернативно может быть получено модифицированное антитело согласно изобретению, которое имеет измененный тип гликозилирования, например, гипофукозилированное антитело, имеющее меньшие количества остатков фукозила, или антитело, имеющее увеличенные разветвленные структуры GlcNAc. Было показано, что такие измененные картины гликозилирования увеличивают ADCC-способность антител. Такие углеводные модификации могут быть осуществлены, например, в результате экспрессии антитела в клетке-хозяине с измененным аппаратом гликозилирования. Клетки с измененным аппаратом гликозилирования были описаны в данной области и могут быть использованы в качестве клеток-хозяев для экспрессии рекомбинантных антител согласно изобретению, чтобы таким образом получить антитело с измененным гликозилированием. Смотри, например, Shields, R. L. et al. (2002) J. Biol. Chem. 277: 26733-26740; Umana et al. (1999) Nat. Biotech. 17: 176-1, а также Европейский патент № EP 1176195; публикации PCT WO 03/035835, WO 99/5434280, каждая из которых включена в настоящее описание в виде ссылки в полном объеме.

Гликозилирование белка зависит от аминокислотной последовательности представляющего интерес белка, а также клетки-хозяина, в которой белок экспрессируется. Различные организмы могут продуцировать разные ферменты гликозилирования (например, гликозилтрансферазы и гликозидазы) и иметь разные доступные субстраты (сахара нуклеотидов). Вследствие таких факторов картина гликозилирования белка и состав остатков гликозила могут отличаться в зависимости от системы хозяина, в котором конкретный белок экспрессируется. Гликозильные остатки, применимые в настоящем изобретении, могут включать без ограничения глюкозу, галактозу, маннозу, фукозу, н-ацетилглюкозамин и сиаловую кислоту. В частности, гликозилированный связывающий белок содержит такие остатки гликозила, чтобы картина гликозилирования представляла собой картину гликозилирования человека.

Специалистам в данной области известно, что различия в гликозилировании белков может приводить к различию в свойствах белков. Например, эффективность терапевтического белка, продуцируемого в микроорганизме-хозяине, таком как дрожжи, и гликозилированного с использованием эндогенного пути дрожжей, может быть снижена по сравнению с эффективностью такого же белка, экспрессированного в клетке млекопитающего, такой как линия клеток CHO. Такие гликопротеины также могут быть иммуногенными у человека и имеют пониженное время полужизни in vivo после введения. Специфичные рецепторы у человека и других животных могут узнавать специфичные остатки гликозила и стимулировать быстрое выведение белка из кровообращения. Другими неблагоприятными эффектами могут быть изменения фолдинга, растворимости, чувствительности к протеазам, перемещения, транспорта, компартментализации, секреции, узнавания белка другими белками или факторами, антигенность или аллергенность. Соответственно, специалист может предпочитать терапевтический белок с конкретным составом и картиной гликозилирования, например, составом и картиной гликозилирования, идентичной или, по меньшей мере, сходной с составом и гликозилированием белка, продуцируемого в клетках человека или в специфичных для вида клетках предполагаемого субъекта животного.

Экспрессия гликозилированных белков, отличных от белков клетки-хозяина, может быть достигнута в результате генетической модификации клетки-хозяина так, чтобы она экспрессировала гетерологичные ферменты гликозилирования. Используя методики, известные в данной области, специалист может создать антитела или их антигенсвязывающие части, имеющие гликозилирование белка человека. Например, штаммы дрожжей были генетически модифицированы так, чтобы они экспрессировали не встречающиеся в природе ферменты гликозилирования, так что гликозилированные белки (гликопротеины), продуцируемые в таких штаммах дрожжей, имеют картину гликозилирования белка, идентичную картине гликозилирования в клетках животных, главным образом, в клетках человека (заявки на выдачу патента США 20040018590 и 20020137134 и публикации PCT WO2005100584 A2).

Кроме того, специалисту в данной области будет понятно, что представляющий интерес белок может быть экспрессирован с использованием библиотеки клеток-хозяев, генетически сконструированных для экспрессии различных ферментов гликозилирования, так что клетки-хозяева, представители библиотеки, продуцируют представляющий интерес белок с различными картинами гликозилирования. Затем специалист может отобрать и выделить представляющий интерес белок с конкретными новыми картинами гликозилирования. В частности, белок, имеющий конкретную новую отобранную картину гликозилирования, проявляет улучшенные или измененные биологические свойства.

5.9. Анти-идиотипические антитела

Кроме связывающих белков настоящее изобретение также относится к антиидиотипическому (анти-Id) антителу, специфичному по отношению к таким связывающим белкам согласно изобретению. Анти-Id-антитело представляет собой антитело, которое узнает уникальные детерминанты, как правило, ассоциированные с антигенсвязывающей областью другого антитела. Анти-Id могут быть получены иммунизацией животного связывающим белком или его областью, содержащей CDR. Иммунизированное животное будет узнавать и отвечать на идиотипические детерминанты иммунизирующего антитела и продуцировать анти-Id-антитело. Анти-Id-антитело также можно использовать в качестве «иммуногена», чтобы еще индуцировать иммунный ответ у другого животного, продуцирующего так называемое анти-анти-Id-антитело.

6. Применения антител

Принимая во внимание способность связываться с RAGE человека, нейтрализующие антитела согласно настоящему изобретению или их части можно применять для выявления RAGE человека (например, в биологическом образце, таком как сыворотка или плазма), используя обычный иммуноанализ, такой как твердофазный иммуноферментный анализ (ELISA), радиоиммуноанализ (РИА) или иммуногистохимию ткани. Настоящее изобретение относится к способу выявления RAGE человека в биологическом образце, включающему в себя приведение биологического образца в контакт с антителом или частью антитела согласно изобретению и выявление либо антитела (или части антитела), связанного с RAGE человека, либо несвязанного антитела (или части антитела), чтобы таким образом выявить RAGE человека в биологическом образце. Антитело прямо или опосредованно метят регистрируемым веществом, облегчающим выявление связанного или несвязанного антитела. Подходящими регистрируемыми веществами являются различные ферменты, простетические группы, флуоресцирующие вещества, люминесцентные вещества и радиоактивные вещества. Примерами подходящих ферментов являются пероксидаза хрена, щелочная фосфатаза, бета-галактозидаза или ацетилхолинэстераза; примерами подходящих комплексов простетических групп являются стрептавидин/биотин и авидин/биотин; примерами подходящих флуоресцирующих вещества являются умбеллиферон, флуоресцеин, изотиоцианат флуоресцеина, родамин, дихлортриазиниламин флуоресцеин, дансилхлорид или фикоэритрин; примером люминесцирующего вещества является люминол; и примерами подходящих радиоактивных веществ являются 3H, 14C, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho, 153Sm.

Антитела и части антител согласно настоящему изобретению, в частности, способны нейтрализовать активность RAGE человека как in vitro, так и in vivo. Соответственно такие антитела и части антител согласно изобретению могут быть использованы для ингибирования связывания RAGE с его лигандами и, следовательно, для нейтрализации получаемой активности.

В другом варианте настоящее изобретение относится к способу снижения активности RAGE у субъекта, преимущественно субъекта, страдающего от заболевания или расстройства, при котором активность RAGE является вредной. Настоящее изобретение относится к способам снижения активности RAGE у субъекта, страдающего от такого заболевания или расстройства, посредством предотвращения связывания RAGE, по меньшей мере, с одним из его лигандов, подобных Aβ-глобуломерам, благодаря применению моноклональных антител согласно настоящему изобретению. Антитела согласно настоящему изобретению, в частности, гуманизированные антитела, описанные в настоящей публикации, могут быть введены человеку в терапевтических целях. Кроме того, антитела согласно настоящему изобретению могут быть введены млекопитающему, отличному от человека, экспрессирующему RAGE, с которым антитело способно связываться, в ветеринарных целях или в качестве животной модели заболевания человека. Что касается последнего, то такие животные модели могут быть применимы для оценки терапевтической эффективности антител согласно изобретению (например, для испытания доз и временных курсов введения).

В используемом в настоящем изобретении смысле подразумевается, что термин «расстройство, при котором активность RAGE является вредной» охватывает заболевания и другие расстройства, при которых присутствие RAGE или его активность у субъекта, страдающего от расстройства, как было показано или как предполагается, либо ответственны за патофизиологию расстройства, либо представляют собой фактор, который вносит вклад в ухудшение расстройства. Соответственно, расстройство, при котором активность RAGE является вредной, представляет собой расстройство, при котором ожидается, что снижение активности RAGE ослабляет симптомы и/или прогрессирование расстройства. Не ограничивающими примерами расстройств, которые можно лечить антителами согласно изобретению, являются расстройства, которые обсуждаются в разделе ниже, относящемся к фармацевтическим композициям антител согласно изобретению.

Известно, что RAGE играет важную роль в патологии, ассоциированной с различными заболеваниями, включая неврологические заболевания, выбранные из группы состоящей из бокового амиотрофического склероза, повреждения плечевого сплетения, повреждения головного мозга, включая травматическое повреждение головного мозга, церебрального паралича, атаксии Фридриха, синдрома Гийена-Барре, лейкодистрофии, рассеянного склероза, постполиомиелитного синдрома, расщепления позвоночника, повреждения спинного мозга, спинальной мышечной атрофии, опухолей спинного мозга, инсульта, поперечного миелита, деменции, сенильной деменции, умеренного когнитивного нарушения, деменции, связанной с болезнью Альцгеймера, хореи Хантингтона, поздней дискинезии, гиперкинезии, мании, болезни Паркинсона, синдром Стила-Ричарда, синдрома Дауна, бульбоспинального паралича, травмы нервов, васкулярного амилоидоза, церебральной геморрагии I с амилоидозом, воспаления головного мозга, атаксии Фридриха, острой спутанности сознания, амиотрофического бокового склероза, глаукомы, болезни Альцгеймера, диабетической нефропатии, сепсиса, ревматоидного артрита и родственных воспалительных заболеваний; диабета и осложнений в результате диабета, подобных диабетической ретинопатии, нефропатии, сосудистым осложнениям; атеросклеротических осложнений, фиброза легкого, злокачественной опухоли, в частности меланом, других амилоидозов. (Смотри, например, следующие публикации: амилоидоз, злокачественная опухоль, артрит, болезнь Крона, хронические и острые воспалительные заболевания: Schmidt A.M. et al: J. Clin. Invest. 2001 October; 108(7): 949-55; сердечнососудистые заболевания, диабет, диабетические осложнения: Yan S.D. et al: Eur. J. Clin. Invest. 1997 March; 27(3): 179-81; ассоциированные с прионами заболевания: Sasaki N. et al: Neurosci. Lett. 2002 Jun. 28; 326(2): 117-20; васкулит, нефропатии, ретинопатии и нейропатии: Thornalley P.J.: Int. Rev. Neurobiol. 2002; 50: 37-57; болезнь Альцгеймера: Weldon D.T. et al: Geriatrics. 1997 September; 52 Suppl. 2:S13-6; Yan S.D. et al: Biochim. Biophys. Acta. 2000 Jul. 26; 1502(1): 145-57; ревматоидный артрит, остеоартрит: Drinda S. et al.: Rheumatol. Int. 2004 Mar. 26; болезнь кишечника: Foell D et al.: Gut. 2003 June; 52(6): 847-53; рассеянный склероз: Yan S.S. et al.: Nat. Med. 2003 March; 9(3): 287-93; псориаз: Foell D. et al.: Rheumatology (Oxford), 2003 November; 42(11): 1383-9: волчанка: Tanji N. et al.: J. Am. Soc. Nephrol. 2000 September; 11(9): 1656-66; генерализованные аутоиммунные заболевания, сепсис: Liliensiek B. et al.: J. Clin. Invest. 2004 June; 113(11): 1641-50; артериосклероз и рестеноз: Schmidt A.M. et al.: Circ Res. 1999 Mar. 19; 84(5): 489-97).

Также, как обсуждалось ранее, можно применять DVD-иммуноглобулины или антитела с двойной специфичностью к любым из партнеров, описанных выше. Такие препараты антител, которые описаны выше, можно использовать для лечения таких заболеваний.

Антитела согласно настоящему изобретению также можно сочетать с пептидами, обеспечивающими трансмембранный перенос, чтобы обеспечить целенаправленное влияние на внутриклеточные белки-мишени. Такие пептидные последовательности могут включать, без ограничения, tat, antennapedia, поли-arg, некоторые противомикробные пептиды. Такие пептиды могут обеспечивать возможность переноса через мембраны, включая клеточные плазматические мембраны, а также эпителиальные и эндотелиальные мембраны, включая гематоэнцефалический барьер, слизистую кишечника, оболочки мозга и другие.

Антитело или часть антитела согласно настоящему изобретению также можно вводить с одной или несколькими дополнительными низкомолекулярными терапевтическими средствами для лечения расстройств, в которые вовлечена активность RAGE, которые обсуждаются в предыдущих абзацах. Следует понимать, что антитела согласно настоящему изобретению или их антигенсвязывающую часть можно использовать отдельно или в сочетании с дополнительным средством, например, терапевтическим средством, при этом указанное дополнительное средство выбирает специалист в данной области в зависимости от предполагаемой цели. Например, дополнительное средство может представлять собой терапевтическое средство, известное в данной области как применимое для лечения заболевания или состояния, которое лечат антителом согласно настоящему изобретению. Дополнительное средство также может представлять собой средство, которое придает полезное свойство терапевтической композиции, например, средство, которое влияет на вязкость композиции.

7. Фармацевтические композиции

Изобретение также относится к фармацевтическим композициям, содержащим антитело или его антигенсвязывающую часть согласно изобретению и фармацевтически приемлемый носитель. Фармацевтические композиции, содержащие антитела согласно изобретению, применимы без ограничения для диагностики, выявления или мониторинга расстройства, для профилактики, лечения, оказания помощи или ослабления расстройства или одного или нескольких его симптомов и/или для исследования. В конкретном варианте композиция содержит одно или несколько антител согласно изобретению. В другом варианте фармацевтическая композиция содержит одно или несколько антител согласно изобретению и одно или несколько профилактических или терапевтических средств, отличных от антител согласно изобретению, для лечения расстройства, при котором активность RAGE является вредной. В частности, профилактические или терапевтические средства, известные как применимые, или средства, которые применялись или применяются в настоящее время для профилактики, лечения, оказания помощи или ослабления расстройства или одного или нескольких его симптомов. Согласно указанным вариантам композиция может дополнительно содержать носитель, разбавитель или эксципиент.

Антитела и части антител согласно изобретению могут быть включены в фармацевтические композиции, подходящие для введения субъекту. Обычно фармацевтическая композиция содержит антитело или часть антитела согласно изобретению и фармацевтически приемлемый носитель. В используемом в настоящем изобретении смысле «фармацевтически приемлемый носитель» включает любой или все растворители, дисперсионные среды, покрытия, антибактериальные и противогрибковые средства, средства для изотоничности и замедления всасывания и тому подобные, которые являются физиологически совместимыми. Примерами фармацевтически приемлемых носителей являются один или несколько из следующих носителей: вода, физиологический раствор соли, фосфатно-солевой буфер, декстроза, глицерин, этанол и тому подобные, а также их сочетания. Во многих случаях предпочтительно включение в композицию изотонических средств, например, сахаров, полиспиртов, таких как маннит, сорбит или хлорид натрия. Фармацевтически приемлемые носители дополнительно могут содержать минорные количества вспомогательных веществ, таких как увлажнители или эмульгирующие средства, консерванты или буферы, которые увеличивают срок хранения или эффективность антитела или части антитела.

Известны различные системы доставки, которые могут быть использованы для введения одного или нескольких антител согласно изобретению или сочетания одного или нескольких антител согласно изобретению и профилактического средства или терапевтического средства, применимого для профилактики, оказания помощи, лечения или ослабления расстройства или одного или нескольких его симптомов, например, инкапсулирование в липосомах, микрочастицы, микрокапсулы, рекомбинантные клетки, способные экспрессировать антитело или фрагмент антитела, опосредованный рецептором эндоцитоз (смотри, например, Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987)), конструирование нуклеиновой кислоты в виде части ретровирусного или другого вектора и т.д. Способы введения профилактического или терапевтического средства согласно изобретению включают без ограничения парентеральное введение (например, интрадермальное, внутримышечное, внутрибрюшинное, внутривенное и подкожное), эпидуральное введение, введение внутрь опухоли и введение в слизистую оболочку (например, интраназальный и пероральный пути). Кроме того, можно использовать легочное введение, например, с использованием ингалятора или распылителя, и препараты с аэрозольными средствами. Смотри, например, патенты США № 6019968, 5985320, 5985309, 5934272, 5874064, 5855913, 5290540 и 4880078 и публикации PCT № WO 92/19244, WO 97/32572, WO 97/44013, WO 98/31346 и WO 99/66903, каждая из которых включена в настоящее описание в виде ссылки в полном объеме. В одном варианте антитело согласно изобретению, комбинированную терапию или композицию согласно изобретению вводят, используя методику легочной доставки лекарственных средств Alkermes AIR® (Alkermes, Inc., Cambridge, Mass.). В конкретном варианте профилактические или терапевтические средства согласно изобретению вводят внутримышечно, внутривенно, внутрь опухоли, перорально, интраназально, в легкие или подкожно. Профилактические или терапевтические средства можно вводить любым обычным путем, например, посредством инфузии или болюсной инъекции, путем всасывания через эпителиальные или кожно-слизистые выстилки (например, слизистую ротовой полости, слизистые прямой кишки и тонкого кишечника и т.д.) и можно вводить вместе с другими биологически активными средствами. Введение может быть системным или местным.

В конкретном варианте может быть желательным введение профилактических или терапевтических средств согласно изобретению местно в область, в которой необходимо лечение; это может быть достигнуто, например, и без ограничения, посредством локальной инфузии, инъекции или с помощью имплантата, при этом указанный имплантат представляет собой пористый или непористый материал, включая мембраны и матрицы, такие как силастиковые мембраны, полимеры, волокнистые матрицы (например, Tissel®) или коллагеновые матрицы. В одном варианте эффективное количество одного или нескольких антител согласно изобретению вводят субъекту местно в пораженную область для профилактики, лечения, оказания помощи и/или ослабления расстройства или его симптома. В другом варианте эффективное количество одного или нескольких антител согласно изобретению вводят субъекту местно в пораженную область в сочетании с эффективным количеством одного или нескольких других терапевтических средств (например, одного или нескольких профилактических или терапевтических средств), отличных от антитела согласно изобретению для профилактики, лечения, оказания помощи и/или ослабления расстройства или одного или нескольких его симптомов.

В другом варианте профилактическое или терапевтическое средство может быть доставлено в системе контролируемого высвобождения или системе длительного высвобождения. В одном варианте можно использовать насос, чтобы добиться контролируемого или длительного высвобождения (смотри Langer, выше; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14: 20; Buchwald et al., 1980, Surgery 88: 507; Saudek et al., 1989, N. Engl. J. Med. 321: 574). В другом варианте можно использовать полимерные материалы, чтобы добиться контролируемого или длительного высвобождения терапевтических средств согласно изобретению (смотри, например, Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J., Macromol. Sci. Rev. Macromol. Chem. 23: 61; смотри также Levy et al., 1985, Science 228: 190; During et al., 1989, Ann. Neurol. 25: 351; Howard et al., 1989, J. Neurosurg. 71: 105); патент США № 5679377, патент США № 5916597, патент США № 5912015, патент США № 5989463, патент США № 5128326, публикацию PCT № WO 99/15154 и публикацию PCT № WO 99/20253. Примеры полимеров, используемых в препаратах длительного высвобождения, включают без ограничения, поли(2-гидроксиэтилметакрилат), поли(метилметакрилат), поли(акриловую кислоту), сополимер (этиленен-винилацетат), поли(метакриловую кислоту), полигликолиды (PLG), полиангидриды, поли(N-винилпирролидон), поли(виниловый спирт), полиакриламид, поли(этиленгликоль), полилактиды (PLA), сополимеры (лактид-гликолид) (PLGA) и сложные полиортоэфиры. В предпочтительном варианте полимер, используемый в препараты длительного высвобождения, является инертным, не содержащим выщелачиваемых примесей, стабильным при хранении, стерильным и биоразрушаемым. В еще одном варианте, система контролируемого или длительного высвобождения может быть помещена вблизи профилактической или терапевтической мишени, при этом требуется только часть системной дозы (смотри, например, Goodson, in Medical Applications of Controlled Release, выше, vol. 2, pp. 115-138 (1984)).

Системы контролируемого высвобождения обсуждаются в обзоре Langer (1990, Science 249: 1527-1533). Любой способ, известный специалисту в данной области, можно применять для получения препаратов длительного высвобождения, содержащих одно или несколько терапевтических средств согласно изобретению. Смотри, например, патент США № 4526938, публикацию PCT WO 91/05548, публикацию PCT WO 96/20698,

каждая из публикаций включена в настоящее описание в виде ссылки в полном объеме.

В конкретном варианте, в котором композиция согласно изобретению представлена нуклеиновой кислотой, кодирующей профилактическое или терапевтическое средство, нуклеиновую кислоту можно вводить in vivo, чтобы стимулировать экспрессию кодируемого ею профилактического или терапевтического средства, посредством конструирования ее в виде части соответствующего вектора, экспрессирующего нуклеиновую кислоту, и введения его так, чтобы был внутриклеточным, например, с использованием ретровирусного вектора (смотри патент США № 4980286) или путем прямой инъекции, или с использованием бомбардировки микрочастицами (например, генной пушки; Biolistic, Dupont), или путем покрывания липидами, или с использованием рецепторов клеточной поверхности или средств для трансфекции или путем его введения в связи с пептидом, подобным гомеобоксному пептиду, который, как известно, проникает в ядро (смотри, например, Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88: 1864-1868). Альтернативно, нуклеиновая кислота может быть введена внутрь клетки и включена в ДНК клетки-хозяина для экспрессии посредством гомологичной рекомбинации.

Фармацевтическую композицию согласно изобретению готовят так, чтобы она была совместима с предполагаемым путем введения. Примеры путей введения включают без ограничения парентеральное, например, внутривенное, интрадермальное, подкожное, пероральное, интраназальное (например, ингаляционное), трансдермальное (например, местное), трансмукозальное и ректальное введение. В конкретном варианте композицию готовят согласно обычным способам, так чтобы фармацевтическая композиция подходила для внутривенного, подкожного, внутримышечного, перорального, интраназального или местного введения человеку. Обычно композиции для внутривенного введения представляют собой растворы в стерильном изотоничном водном буфере. При необходимости композиция также может включать в себя солюбилизирующее средство и местный анестетик, такой как лигнокаин, чтобы облегчить боль в месте инъекции.

Если композиции согласно изобретению необходимо вводить местно, композиции могут быть приготовлены в форме мази, крема, трансдермального пластыря, лосьона, геля, шампуня, спрея, аэрозоля, раствора, эмульсии или другой формы, известной специалисту в данной области. Смотри, например, Remington's Pharmaceutical Sciences and Introduction to Pharmaceutical Dosage Forms, 19th ed., Mack Pub. Co., Easton, Pa. (1995). В случае нераспыляемых местных дозированных форм обычно используют разные формы от вязких до полутвердых или твердых форм, содержащих носитель или один или несколько эксципиентов, совместимых с местным применением и имеющих динамическую вязкость более высокую, чем у воды. Подходящие препараты включают, без ограничения, растворы, суспензии, эмульсии, кремы, натирки, порошки, линименты, мази и тому подобное, которые при необходимости стерилизуют или смешивают с вспомогательными средствами (например, консервантами, стабилизаторами, увлажнителями, буферами или солями), влияющими на различные свойства, такие как, например, осмотическое давление. Другие подходящие местные дозированные формы включают распыляемые аэрозольные препараты, в которых активный ингредиент, в частности, в сочетании с твердым или жидким инертным носителем упаковывают в смеси с летучим веществом под давлением (например, с газом-вытеснителем, таким как фреон) или в гибкой бутылке. Увлажнители или гигроскопичные вещества также могут быть добавлены к фармацевтическим композициям и дозированным формам, если это необходимо. Примеры таких дополнительных ингредиентов хорошо известны в данной области.

Если способ согласно изобретению включает в себя интраназальное введение композиции, композиция может быть приготовлена в аэрозольной форме, в виде спрея, аэрозоля или в форме капель. В частности, профилактические или терапевтические средства для применения согласно настоящему изобретению могут быть легко доставлены в форме подачи аэрозольного спрея из упаковок под давлением или распылителя с использованием подходящего пропеллента (например, дихлордифторметана, трихлорфторметана, дихлортетрафторэтана, диоксида углерода или другого подходящего газа). В случае аэрозоля под давлением стандартная доза может быть определена с помощью клапана, позволяющего доставлять дозированное количество. Могут быть приготовлены капсулы и картриджи (состоящие, например, из желатина) для применения в ингаляторе или инсуффляторе, содержащие порошкообразную смесь соединения и подходящей порошковой основы, такой как лактоза или крахмал.

Если способ согласно изобретению включает в себя пероральное введение, могут быть приготовлены пероральные композиции в форме таблеток, капсул, облаток, гелевых капсул, растворов, суспензий и тому подобного. Таблетки или капсулы могут быть приготовлены обычными способами с фармацевтически приемлемыми эксципиентами, такими как связывающие средства (например, пептизированный кукурузный крахмал, поливинилпирролидон или гидроксипропилметилцеллюлоза); наполнители (например, лактоза, микрокристаллическая целлюлоза или гидрофосфат кальция); скользящие вещества (например, стеарат магния, тальк или диоксид кремния); дезинтегрирующие средства (например, картофельный крахмал или гликолят крахмала натрия); или увлажнители (например, лаурилсульфат натрия). Таблетки могут быть покрыты способами, хорошо известными в данной области. Жидкие препараты для перорального введения могут иметь, без ограничения, форму растворов, сиропов или суспензий, или они могут быть представлены в виде сухого продукта для перерастворения в воде или другом подходящем наполнителе перед применением. Такие жидкие препараты могут быть приготовлены обычными способами с фармацевтически приемлемыми добавками, такими как суспендирующие средства (например, сорбитовый сироп, производные целлюлозы или гидрогенизированные съедобные жиры); эмульгаторы (например, лецитин или аравийская камедь); неводные наполнители (например, миндальное масло, маслянистые сложные эфиры, этиловый спирт или фракционированные растительные масла); и консерванты (например, метил- или пропил-п-гидроксибензоаты или сорбиновая кислота). Препараты также могут содержать подходящие соли для буферов, корригенты, красители и подсластители. Препараты для перорального введения могут быть соответствующим образом приготовлены для медленного высвобождения, контролируемого высвобождения или длительного высвобождения профилактического или терапевтического средства (средств).

Способ согласно изобретению может включать в себя легочное введение, например, с использованием ингалятора или распылителя, композиции, приготовленной вместе со средством для образования аэрозоля. Смотри, например, патенты США № 6019968, 5985320, 5985309, 5934272, 5874064, 5855913, 5290540 и 4880078; и публикации PCT № WO 92/19244, WO 97/32572, WO 97/44013, WO 98/31346, и WO 99/66903, каждая из которых включена в настоящее описание в виде ссылки в полном объеме. В конкретном варианте антитело согласно изобретению, комбинированную терапию и/или композицию согласно изобретению вводят, используя методику легочной доставки лекарственных средств Alkermes AIR® (Alkermes, Inc., Cambridge, Mass.).

Способ согласно изобретению может включать в себя введение композиции, приготовленной для парентерального введения посредством инъекции (например, болюсной инъекции или непрерывной инфузии). Препараты для инъекции могут быть представлены в виде стандартной лекарственной формы (например, в ампулах или в емкостях, содержащих множество доз) с добавленным консервантом. Композиции могут иметь такие формы, как суспензии, растворы или эмульсии в масляных или водных наполнителях, и могут содержать средства для приготовления препаратов, такие как суспендирующие, стабилизирующие и/или диспергирующие средства. Альтернативно активный ингредиент может быть в форме порошка для перерастворения в подходящем наполнителе (например, в стерильной апирогенной воде) перед применением. Способы согласно изобретению могут дополнительно включать в себя введение композиций, приготовленных в виде депонируемых препаратов. Такие длительно действующие препараты можно вводить путем имплантации (например, подкожно или внутримышечно) или путем внутримышечной инъекции. Таким образом, композиции могут быть приготовлены, например, с использованием подходящих полимерных или гидрофобных материалов (например, в виде эмульсии в приемлемом масле) или ионообменных смол, или в виде труднорастворимых производных (например, в виде труднорастворимой соли).

Способы согласно изобретению включают в себя введение композиций, приготовленных в нейтральной форме или в форме солей. Фармацевтически приемлемыми солями являются соли, образованные с такими анионами, как анионы, полученные из хлористоводородной, фосфорной, уксусной, щавелевой, винной кислот и т.д., и соли, образованные с такими катионами, как катионы, полученные из натрия, калия, аммония, кальция, гидроксидов железа, изопропиламина, триэтиламина, 2-этиламиноэтанола, гистидина, прокаина и т.д.

В общем, ингредиенты композиций поставляют либо по отдельности, либо смешанными вместе в стандартной лекарственной форме, например, в виде сухого лиофилизированного порошка или не содержащего воды концентрата в герметично запаянной емкости, такой как ампула или пакетик, с указанием количества активного средства. В случае, когда способом введения является инфузия, композиция может быть внесена во флакон для инфузии, содержащий стерильную фармацевтически чистую воду или физиологический раствор. Когда способом введения является инъекция может поставляться ампула со стерильной водой для инъекции или физиологическим раствором, так чтобы ингредиенты можно было смешать перед введением.

В частности, изобретение также предполагает, что одно или несколько профилактических или терапевтических средств или фармацевтических композиций согласно изобретению упаковывают в герметично закрытую емкость, такую как ампула или пакетик с указанием количества средства. В одном варианте одно или несколько профилактических или терапевтических средств или фармацевтических композиций согласно изобретению поставляют в виде сухого стерилизованного лиофилизированного порошка или не содержащего воды концентрата в герметично закрытой емкости, и их можно перерастворять (например, в воде или физиологическом растворе соли) до подходящей концентрации для введения субъекту. В частности, одно или несколько профилактических или терапевтических средств или фармацевтических композиций согласно изобретению поставляют в виде сухого стерильного лиофилизированного порошка в герметично закрытой емкости в стандартной дозе, составляющей, по меньшей мере, 5 мг, более предпочтительно, по меньшей мере 10 мг, по меньшей мере 15 мг, по меньшей мере 25 мг, по меньшей мере 35 мг, по меньшей мере 45 мг, по меньшей мере 50 мг, по меньшей мере 75 мг или по меньшей мере 100 мг. Лиофилизированные профилактические или терапевтические средства или фармацевтические композиции согласно изобретению следует хранить при температуре от 2°C до 8°C в исходной емкости, и профилактические или терапевтические средства или фармацевтические композиции согласно изобретению следует вводить в течение 1 недели, предпочтительно в течение 5 суток, в течение 72 часов, в течение 48 часов, в течение 24 часов, в течение 12 часов, в течение 6 часов, в течение 5 часов, в течение 3 часов или в течение 1 часа после перерастворения. В альтернативном варианте одно или несколько профилактических или терапевтических средств или фармацевтических композиций согласно изобретению поставляют в жидкой форме в герметично закрытой емкости с указанием количества и концентрации средства. Предпочтительно жидкую форму вводимой композиции поставляют в герметично закрытой емкости в концентрации, по меньшей мере, 0,25 мг/мл, более предпочтительно, по меньшей мере 0,5 мг/мл, по меньшей мере 1 мг/мл, по меньшей мере 2,5 мг/мл, по меньшей мере 5 мг/мл, по меньшей мере 8 мг/мл, по меньшей мере 10 мг/мл, по меньшей мере 15 мг/мл, по меньшей мере 25 мг/мл, по меньшей мере 50 мг/мл, по меньшей мере 75 мг/мл или по меньшей мере 100 мг/мл. Жидкую форму необходимо хранить при температуре от 2°C до 8°C в исходной емкости.

Антитела и части антител согласно изобретению могут быть включены в фармацевтическую композицию, подходящую для парентерального введения. В частности, антитело или части антитела могут быть приготовлены в виде инъекционного раствора, содержащего 0,1-250 мг/мл антитела. Инъекционный раствор может быть представлен либо в жидкой, либо в лиофилизированной дозированной форме в бесцветном или янтарного цвета флаконе, ампуле или в предварительно заполненном шприце. Буфером может быть L-гистидин (1-50 мМ), оптимально 5-10 мМ, с pH 5,0-7,0 (оптимально pH 6,0). Другие подходящие буферы включают без ограничения, сукцинат натрия, цитрат натрия, фосфат натрия или фосфат калия. Хлорид натрия можно использовать для модификации токсичности раствора в концентрации 0-300 мМ (оптимально 150 мМ в случае жидкой дозированной формы). Криопротекторы могут быть включены в случае лиофилизированной дозированной формы, в большинстве случаев 0-10% сахарозы (оптимально 0,5-1,0%). Другими подходящими криопротекторами являются трегалоза и лактоза. В случае лиофилизированной дозированной формы могут быть включены наполнители, в большинстве случаев 1-10% маннит (оптимально 2-4%). В жидких и лиофилизированных дозированных формах могут быть использованы стабилизаторы, в большинстве случаев 1-50 мМ L-метионин (оптимально 5-10 мМ). Другие подходящие наполнители включают глицерин, аргинин, и могут быть включены с 0-0,05% полисорбатом-80 (оптимально 0,005-0,01%). Дополнительные поверхностно-активные вещества включают без ограничения поверхностно-активные вещества полисорбат 20 и BRIJ. Фармацевтическая композиция, содержащая антитела и части антител согласно изобретению, приготовленная в виде инъекционного раствора для парентерального введения, может дополнительно содержать средство, применимое в качестве адъюванта, такое как средства, используемые для увеличения всасывания или распределения терапевтического белка (например, антитела). Особенно применимым адъювантом является гиалуронидаза, такая как Hylenex® (рекомбинантная гиалуронидаза человека). Добавление гиалуронидазы в инъекционный раствор улучшает биодоступность у человека после парентерального введения, особенно подкожного введения. Добавление гиалуронидазы также обеспечивает большие объемы в месте инъекции (т.е. больше 1 мл) с меньшим ощущением боли и дискомфортом и минимальным количеством случаев реакции в месте инъекции (смотри публикации WO2004078140, US2006104968, включенные в настоящее описание в виде ссылки).

Композиции согласно настоящему изобретению могут быть в разных формах. Таки формы включают, например, жидкие, полутвердые и твердые дозированные формы, такие как жидкие растворы (например, инъекционные и инфузионные растворы), дисперсии или суспензии, таблетки, пилюли, порошки, липосомы и суппозитории. Конкретная форма зависит от предполагаемого способа введения и терапевтического применения. Типичные конкретные композиции имеют форму инъекционных или инфузионных растворов, такие как композиции, сходные с композициями, используемыми для пассивной иммунизация человека другими антителами. Конкретным способом введения является парентеральное введение (например, внутривенное, подкожное, внутрибрюшинное, внутримышечное). В конкретном варианте антитело вводят путем внутривенной инфузии или инъекции. В другом конкретном варианте антитело вводят путем внутримышечной или подкожной инъекции.

Терапевтические композиции обычно должны быть стерильными и стабильными в условиях производства и хранения. Композиция может быть приготовлена в виде раствора, микроэмульсии, дисперсии, липосомы или другой упорядоченной структуры, подходящей для высокой концентрации лекарственного средства. Стерильные инъекционные растворы могут быть приготовлены в результате введения активного соединения (т.е., антитела или части антитела) в требуемом количестве в подходящий растворитель с одним или сочетанием ингредиентов, перечисленных выше, которые необходимы, с последующей стерилизацией фильтрованием. Как правило, дисперсии готовят введением активного соединения в стерильный наполнитель, который содержит основную дисперсионную среду и требуемые дополнительные ингредиенты из тех ингредиентов, которые перечислены выше. В случае стерильных, лиофилизированных порошков для приготовления стерильных инъекционных растворов конкретными способами приготовления являются вакуумная сушка и сушка распылением, которые дают порошок активного ингредиента плюс любого требуемого дополнительного ингредиента из предварительно простерилизованного фильтрованием раствора. Правильная текучесть раствора может поддерживаться, например, благодаря использованию покрытия, такого как лецитин, благодаря поддерживанию требуемого размера частиц в случае дисперсии и благодаря применению поверхностно-активных веществ. Длительное всасывание инъекционных композиций может быть достигнуто за счет включения в композицию средства, которое замедляет всасывание, например, моностеаратных солей и желатина.

Антитела и части антител согласно настоящему изобретению можно вводить различными способами, известными в данной области, хотя в случае многих терапевтических применения конкретный путь/способ введения представляет собой подкожную инъекцию, внутривенную инъекцию или инфузию. Как будет понятно специалисту в данной области, путь и/или способ введения будет варьировать в зависимости от требуемых результатов. В некоторых вариантах активное соединение может быть приготовлено с носителем, который будет защищать соединение от быстрого высвобождения, например, в виде препарата контролируемого высвобождения, включая имплантаты, трансдермальные пластыри и микроинкапсулированные системы доставки. Можно использовать биологически разрушаемые, биосовместимые полимеры, такие как этиленвинилацетат, полиангидриды, полигликолевая кислота, коллаген, сложные полиортоэфиры и полимолочная кислота. Многие способы получения таких препаратов запатентованы или, как правило, известны специалистам в данной области. Смотри, например, Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.

В некоторых вариантах антитело или часть антитела согласно изобретению можно вводить перорально, например, с инертным разбавителем или усваиваемым съедобным носителем. Соединение (и другие ингредиенты, если таковые необходимы) также может быть заключено в капсулу с твердой или мягкой оболочкой, спрессовано в таблетки или непосредственно включено в пищу пациента. В случае перорального терапевтического введения соединения могут быть включены в препарат с эксципиентами и использованы в форме принимаемых вовнутрь таблеток, буккальных таблеток, пастилок, капсул, эликсиров, суспензий, сиропов, облаток и тому подобного. Чтобы ввести соединение согласно изобретению другим путем, отличным от парентерального введения, может быть необходимо покрыть соединение определенным веществом или ввести соединение совместно с определенным веществом, чтобы предотвратить его инактивацию.

В композиции также могут быть включены дополнительные активные соединения. В некоторых вариантах антитело или часть антитела согласно изобретению готовят совместно и/или вводят совместно с одним или несколькими дополнительными терапевтическими средствами, которые применимы для лечения расстройств, при которых активность RAGE является вредной. Например, анти-RAGE-антитело или часть антитела согласно изобретению можно приготовить вместе и/или совместно ввести с одним или несколькими дополнительными антителами, которые связывают другие мишени (например, антителами, которые связывают цитокины или которые связывают молекулы на клеточной поверхности). Кроме того, одно или несколько антител согласно изобретению можно применять в сочетании с двумя или более вышеуказанными терапевтическими средствами. Такая комбинированная терапия имеет преимущество использования более низких доз вводимых терапевтических средств, таким образом позволяя избегать возможной токсичности или осложнений, ассоциированных с различными средствами, применяемыми в виде монотерапии.

В некоторых вариантах антитело к RAGE или его фрагмент связывают с наполнителем, продлевающим время полужизни, известным в данной области. Такие наполнители включают, без ограничения, Fc-домен, полиэтиленгликоль и декстран. Такие наполнители описаны, например, в заявке на выдачу патента США с регистрационным № 09/428082 и в опубликованной заявке PCT № WO 99/25044, которые включены в настоящее описание в виде ссылки для любой цели.

В конкретном варианте последовательности нуклеиновой кислоты, содержащие нуклеотидные последовательности, кодирующие антитело согласно изобретению или другое профилактическое или терапевтическое средство согласно изобретению, вводят для лечения, профилактики, оказания помощи или ослабления расстройства или одного или нескольких его симптомов посредством генной терапии. Генная терапия относится к терапии, осуществляемой путем введения субъекту экспрессированной или экспрессируемой нуклеиновой кислоты. В данном варианте осуществления изобретения нуклеиновые кислоты продуцируют кодируемое ими антитело или профилактическое или терапевтическое средство согласно изобретению, которое опосредует профилактический или терапевтический эффект.

Любой из способов генной терапии, имеющийся в данной области, можно использовать согласно настоящему изобретению. Общие обзоры способов генной терапии смотри в

Способы, широко известные в области методики получения рекомбинантной ДНК, которые могут быть использованы, описаны в Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley and Sons, NY (1993); и Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). Подробное описание различных способов генной терапии приведено в публикации US20050042664 A1, которая включена в настоящее описание в виде ссылки.

RAGE играет важную роль в патологии, ассоциированной с различными заболеваниями, которые определены в настоящем описании выше. Инфузия пептидов амилоида Aβ животным приводит к ответам, подобным воспалительным реакциям при артериосклерозе, уменьшению церебрального объема крови. Такие эффекты могут быть предотвращены антителами против RAGE (Rhodin, J. et al. World Congress for Microcirculation, submitted Papers, 7th, Sydney, Australia, Aug. 19-22, 2001, 543-547; Deane et al. Nature med. 2003). RAGE подвергается повышающей регуляции в микрососудах пациентов с AD и у трансгенных мышей, у которых был сверхэкспрессирован ген APP человека (Deane et al. Nature med. 2003). С использованием дважды трансгенных мышей, у которых экспрессируется ген APP человека, и сверхэкспрессируется RAGE, показано, что сверхэкспрессия нормального гена RAGE приводит к ухудшению обучения, увеличению бляшек, тогда как сверхэкспрессия доминантно-негативного дефектного по передаче сигнала варианта RAGE приводит к улучшению обучения и более низким уровням бляшек (Arancio et al. 2004 EMBO J. 2004). Эксперименты на животных моделях диабета типа 1 и типа 2 показали, что антагонизм оси лиганд-RAGE подавляет развитие и прогрессирование нарушений сосудов и воспалительных клеток при сахарном диабете, например, нокаутированных по RAGE мышей и анти-RAGE-антитела использовали, чтобы показать улучшение в модели на животных в случае, например, диабетической нефропатии

Позитивные долговременные почечные эффекты нейтрализующего RAGE антитела у страдающих ожирением мышей с диабетом типа 2 показаны Flyvbjerg с соавторами (Diabetes, 2004, 53, 1, p. 166-72). Нокаутированных по RAGE мышей использовали, чтобы показать, что RAGE вовлечен в сепсис (Birgit Liliensiek et al. J. Clin. Invest. 2004 June 1; 113(11): 1641-1650; рецептор конечных продуктов глубокого гликирования (RAGE) регулирует сепсис, но не адаптивный иммунный ответ). Блокирование F(ab)2-фрагментов, полученных из анти-RAGE-IgG, снижает воспалительную реакцию в случае MOG- или MBP-индуцированного EAE (Yan, S. S., et al. 2003. Nat. Med. 9: 287-293). Показано вовлечение RAGE в злокачественные опухоли (Abe-R et al. Journal of Investigative Dermatology, 2004, 122/2 (461-467). У несущих опухоли мышей была продлена выживаемость, и спонтанные метастазы в легкие были ингибированы при лечении с использованием нейтрализующих анти-RAGE-антител.

Антитела и части антител согласно изобретению можно применять для лечения людей, страдающих от таких заболеваний.

Следует понимать, что антитела согласно изобретению или их антигенсвязывающие части можно использовать отдельно или в сочетании с дополнительным средством, например, терапевтическим средством, при этом указанное дополнительное средство выбирает специалист в данной области для предполагаемой цели. Например, дополнительное средство может представлять собой терапевтическое средство, известное в данной области как применимое для лечения заболевания или состояния, которые подвергают лечению антителом согласно настоящему изобретению. Дополнительное средство также может представлять собой средство, которое придает полезное свойство терапевтической композиции, например, средство, которое влияет на вязкость композиции.

Кроме того, следует понимать, что сочетания, которые должны быть включены в объем настоящего изобретения, представляют собой сочетания, которые применимы для предполагаемой цели. Средства, указанные ниже, приведены с целью иллюстрации и не предназначены для ограничения. Сочетания, которые являются частью настоящего изобретения, могут представлять собой сочетания антител согласно настоящему изобретению и, по меньшей мере, одного дополнительного средства, выбранного из приведенных ниже списков. Сочетание также может включать в себя более одного дополнительного средства, например, два или три дополнительных средства, если сочетание таково, что образованная композиция может выполнять свою функцию, для которой она предназначена.

Не ограничивающими примерами терапевтических средств в случае рассеянного склероза, с которыми можно сочетать антитело или часть антитела согласно изобретению, являются следующие средства: кортикостероиды; преднизолон; метилпреднизолон; азатиоприн; циклофосфамид; циклоспорин; метотрексат; 4-аминопиридин; тизанидин; интерферон-β1a (AVONEX; Biogen); интерферон-β1b (BETASERON; Chiron/Berlex); интерферон α-n3 (Interferon Sciences/Fujimoto), интерферон-α (Alfa Wassermann/J&J), интерферон β1A-1F (Serono/Inhale Therapeutics), пегинтерферон α2b (Enzon/Schering-Plough), сополимер 1 (Cop-1; COPAXONE; Teva Pharmaceutical Industries, Inc.); кислород под повышенным давлением; внутривенный иммуноглобулин; клабрибин; антитела или антагонисты других цитокинов человека или факторов роста и их рецепторов, например, TNF, LT, IL-1, IL-2, IL-6, IL-7, IL-8, IL-23, IL-15, IL-16, IL-18, EMAP-II, GM-CSF, FGF и PDGF. Антитела согласно изобретению или их антигенсвязывающие части можно сочетать с антителами к молекулам клеточной поверхности, такими как CD2, CD3, CD4, CD8, CD19, CD20, CD25, CD28, CD30, CD40, CD45, CD69, CD80, CD86, CD90 или их лиганды. Антитела согласно изобретению или их антигенсвязывающие части также можно сочетать с такими средствами, как метотрексат, циклоспорин, FK506, рапамицин, микофенолят мофетил, лефлюномид, НПВС, например, ибупрофен, кортикостероиды, такие как преднизолон, ингибиторы фосфодиэстеразы, агонисты аденозина, противотромботические средства, ингибиторы комплемента, адренергические средства, средства, которые препятствуют передаче сигнала провоспалительными цитокинами, такими как TNF-альфа или IL-1 (например, IRAK, NIK, IKK, p38 или ингибиторы MAP-киназ), ингибиторы IL-1β-превращающего фермента, ингибиторы TACE, ингибиторы передачи сигналов T-клеток, такие как ингибиторы киназ, ингибиторы металлопротеиназы, сульфазалазин, азатиоприн, 6-меркаптопурины, ингибиторы ангиотензин-превращающего фермента, растворимые рецепторы цитокинов и их производные (например растворимые рецепторы TNF p55 или p75, sIL-1RI, sIL-1RII, sIL-6R) и противовоспалительные цитокины (например, IL-4, IL-10, IL-13 и TGF-бета).

Конкретными примерами терапевтических средств для лечения рассеянного склероза, с которыми можно сочетать антитело или его антигенсвязывающую часть, являются интерферон-бета, например, IFNβ1a и IFNβ1b; копаксон, кортикостероиды, ингибиторы каспаз, например, ингибиторы каспазы-1, ингибиторы IL-1, ингибиторы TNF и антитела к лиганду CD40 и CD80.

В частности, связывающие белки и антитела согласно настоящему изобретению можно применять для лечения амилоидоза, например, болезни Альцгеймера и синдрома Дауна. Следует понимать, что связывающие белки и антитела согласно изобретению можно применять отдельно или в сочетании, по меньшей мере, с одним дополнительным средством, подходящим для лечения одного из указанных выше заболеваний. Указанное, по меньшей мере, одно дополнительное средство может быть выбрано специалистом в данной области для предполагаемой им цели. Например, дополнительное средство может представлять собой терапевтическое средство, такое как ингибитор холестериназы (например, тактрин, донепезил, ривастигмин или галантамин), частичный блокатор рецептора NMDA (например, мемантин), миметик гликозаминогликана (например, альцемед), ингибитор или аллостерический модулятор гамма-секретазы (например, R-флурбипрофен), агонист гонадотропин-рилизинг гормона, блокирующий лютеинизирующий гормон (например, лейпрорелин), антагонист рецептора серотонина 5-HT1A, хелатирующее средство, селективный для нейронов блокатор кальциевых каналов L-типа, иммуномодулятор, ингибитор амилоидного фибриллогенеза или ингибитор отложения амилоидного белка (например, M266), другое антитело (например, бапинейзумаб), антагонист рецептора 5-HT1a, ингибитор PDE4, агонист гистамина, белок-рецептор конечных продуктов глубокого гликирования, стимулятор PARP, антагонист рецептора серотонина 6, агонист рецептора 5-HT4, стероид человека, стимулятор захвата глюкозы, который усиливает метаболизм нейронов, селективный антагонист CB1, частичный агонист рецепторов бензодиазепина, антагонист или ингибитор продукции амилоида бета, ингибитор отложения амилоида бета, частичный антагонист NNR альфа-7, терапевтическое средство, нацеленное против PDE4, ингибитор трансляции РНК, мускариновый агонист, агонист рецептора фактора роста нервов, агонист рецептора NGF и модулятор генной терапии (т.е., средства, которые известны в настоящее время или будут известны в будущем, которые применимы для лечения заболевания или состояния, которое подвергают лечению антителом или связывающим белком согласно настоящему изобретению). Дополнительным средством также может быть средство, которое придает полезное свойство терапевтической композиции, например, средство, которое влияет на вязкость композиции.

Антитела согласно изобретению или их антигенсвязывающие части также можно сочетать с такими средствами, как алемтузумаб, дронабинол, унимед, даклизумаб, митоксантрон, гидрохлорид ксалипродена, фампридин, ацетат глатирамера, натализумаб, синнабидол, a-иммунокин NNSO3, ABR-215062, AnergiX.MS, антагонисты рецептор хемокина, BBR-2778, калагуалин, CPI-1189, LEM (инкапсулированный в липосомы митоксантрон), THC.CBD (антагонист каннабиноида) MBP-8298, мезопрам (ингибитор PDE4), MNA-715, антитело против рецептора IL-6, нейровакс, пирфенидон аллотрап 1258 (RDP-1258), sTNF-R1, талампанел, терифлуномид, TGF-бета-2, типлимотид, антагонисты VLA-4 (например, TR-14035, VLA4 Ultrahaler, антегран-ELAN/Biogen), антагонисты интерферона гамма, агонисты IL-4.

Фармацевтические композиции согласно изобретению могут включать в себя «терапевтически эффективное количество» или «профилактически эффективное количество» антитела или части антитела согласно изобретению. «Терапевтически эффективное количество» относится к количеству, эффективному в дозах и в течение периодов времени, необходимых для достижения требуемого терапевтического результата. Терапевтически эффективное количество антитела или части антитела может быть определено специалистом в данной области и может варьировать в зависимости от таких факторов, как состояние болезни, возраст, пол и масса пациента и способность антитела или части антитела вызывать требуемый ответ у пациента. Терапевтически эффективное количество также представляет собой количество, при котором любые токсические или вредные эффекты антитела или части антитела перевешиваются терапевтически полезными эффектами. «Профилактически эффективное количество» относится к количеству, эффективному в дозах и в течение периодов времени, необходимых для достижения требуемого профилактического результата. Обычно, поскольку профилактическую дозу применяют у субъектов до заболевания или на более ранней стадии заболевания, профилактически эффективное количество будет меньше, чем терапевтически эффективное количество.

Схемы дозирования могут быть скорректированы, чтобы обеспечить оптимальный требуемый ответ (например, терапевтический или профилактический ответ). Например, можно вводить один болюс, можно вводить несколько дробных доз в течение определенного периода времени, или доза может быть пропорционально снижена или увеличена в зависимости от того что требует терапевтическая ситуация. Особенно предпочтительно приготовление парентеральных композиций в стандартной лекарственной форме для простоты введения и единообразия дозирования. Стандартная лекарственная форма в используемом в настоящем изобретении смысле относится к физически дискретным единицам, подходящим в качестве единичных доз для млекопитающих; при этом каждая единица содержит предварительно определяемое количество активного соединения, вычисляемое для получения требуемого терапевтического эффекта, в ассоциации с требуемым фармацевтическим носителем. Технические характеристики стандартных лекарственных форм согласно изобретению продиктованы и напрямую зависят от (a) уникальных свойств активного соединения и конкретного терапевтического или профилактического эффекта, который необходимо достичь, и (b) ограничений, имеющих место в области приготовления препаратов такого активного соединения для лечения чувствительности пациентов.

Примерный не ограничивающий диапазон терапевтически или профилактически эффективного количества антитела или части антитела согласно изобретению составляет 0,1-20 мг/кг, более предпочтительно 1-10 мг/кг. Следует отметить, что значения доз могут варьировать в зависимости от типа и тяжести состояния, которое необходимо облегчить. Кроме того, следует понимать, что для любого конкретного субъекта, конкретные схемы дозирования следует корректировать с течением времени в соответствии с индивидуальной потребностью и профессиональным решением специалиста, который вводит или контролирует введение композиций, и что схемы дозирования, указанные в настоящем описании, являются только примерными и не предназначены для ограничения объема изобретения или практического применения заявленной композиции.

Специалистам в данной области будет легко понять, что другие подходящие модификации и адаптации способов согласно изобретению, описанных в настоящей публикации, являются очевидными и могут быть осуществлены с использованием подходящих эквивалентов, не выходя за рамки объема изобретения или вариантов, раскрытых в настоящей публикации. Далее после подробного описания настоящего изобретения оно будет понятно яснее при обращении к следующим примерам, которые включены только в целях иллюстрации и не предназначены для ограничения изобретения.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Пример 1. Предпочтительные анти-huRAGE-антитела

1.1. Получение гибридом и антител

Мышей Balb/c и A/J 4-6-недельного возраста иммунизировали и подвергали бустер-иммунизации подкожно, используя RAGE человека. Животным проводили инъекции каждые три недели, начиная с первой инъекции 30 мкг в полном адъюванте Фрейнда и используя бустер-инъекции 30 мкг в неполном адъюванте Фрейнда. Мышам, отобранным для слияния, внутривенно инъецировали 10 мкг hRAGE в физиологическом растворе за четыре дня до слияния. Селезенки иммунизированных животных извлекали и готовили суспензии одиночных клеток. Клетки миеломы SP2/0 собирали из культуры и промывали. Клетки селезенки и опухолевые клетки смешивали в соотношении 5:1 и сливали, используя 50% ПЭГ 3000 стандартным способом (Kohler and Milstein, 1975). Слитые клетки высевали в 96-луночные планшеты в селективные среды при плотности 2,5×105 клеток селезенки на лунку. Слитые клетки инкубировали при 37°C в течение 7-10 суток. В тот момент, когда наблюдали макроскопические колонии, надосадки удаляли и тестировали в ELISA hRAGE.

Гибридомы, которые продуцировали мАт с требуемыми свойствами, субклонировали способом лимитирующего разведения. Надосадок, содержащий субклоны, анализировали в отношении связывания с hRAGE с помощью ELISA. Подклассы тяжелых и легких цепей мАт определяли, используя набор для изотипирования Zymed EIA.

1.2. Определение аминокислотной последовательности вариабельной области каждого мышиного мАт против RAGE

Для каждого определения аминокислотной последовательности примерно 10×106 клеток гибридом выделяли центрифугированием и обрабатывали тризолом (Gibco BRL/Invitrogen, CA), чтобы выделить суммарную РНК, следуя инструкциям производителя. Суммарную РНК использовали для синтеза первой нити ДНК с применением системы для синтеза первой нити SuperScript (Invitrogen, CA) согласно инструкциям производителя. Олиго-(dT) использовали для затравки синтеза первой нити, чтобы отобрать поли(A)+-РНК. Затем кДНК-продукт в виде первой нити амплифицировали в ПЦР, используя праймеры, сконструированные для амплификации вариабельных областей иммуноглобулина мыши (наборы Ig-Primer, Novagen, Wis.). ПЦР-продукты разделяли в агарозном геле, вырезали, очищали и затем субклонировали, используя набор для клонирования TOPO, в вектор pCR2.1-TOPO (Invitrogen, CA) и трансформировали в химически компетентные E. coli TOP10 (Invitrogen, CA). На трансформантах осуществляли ПЦР колоний, чтобы идентифицировать клоны, содержащие вставку. Плазмидную ДНК выделяли из клонов, содержащих вставку, используя набор QIAprep Miniprep (Qiagen, Valencia, Calif.). Вставки в плазмидах секвенировали на обеих нитях, чтобы определить последовательности ДНК вариабельных областей тяжелой или легкой цепи, используя прямой праймер M13 и обратный праймер M13 (Fermentas Life Sciences, Hanover Md.). Вариабельные последовательности тяжелой и легкой цепей 3 моноклональных антител 7F9, 11E6 и 4E5 и их три CDR вариабельной области тяжелой цепи и три CDR вариабельной области легкой цепи указаны в таблице 4, выше.

1.3. Конструирование и экспрессия рекомбинантных антител против RAGE человека

ДНК, кодирующую константную область тяжелой цепи мышиных моноклональных антител против RAGE 7F9, 11E6 и 4E5, заменяли фрагментом кДНК, кодирующим константную область IgG1 человека, посредством гомологичной рекомбинации в бактериях. Константную область легкой цепи каждого из указанных антител заменяли константной область каппа человека (таблица 1, выше). Полноразмерные химерные антитела временно экспрессировали в клетках COS или клетках 293 путем совместной трансфекции химерными кДНК тяжелой и легкой цепей, лигированными в экспрессирующую плазмиду pBOS или pTT3 (Mizushima and Nagata, Nucleic Acids Research 1990, Vol. 18, p. 5322). Надосадки клеток, содержащие рекомбинантное химерное антитело, очищали хроматографией на белок A-сефарозе и связанное антитело элюировали добавлением кислого буфера. Антитела нейтрализовали и диализовали в PBS.

1.4. Связывание в ELISA рекомбинантных мАт против RAGE человека и полученных из гибридом мАт против RAGE человека

Очищенные химерные моноклональные антитела против RAGE человека тестировали в отношении их способности связывать RAGE человека в конкурентном ELISA. Рекомбинантные химерные моноклональные антитела против RAGE или полученные из гибридом моноклональные антитела против RAGE разбавляли в PBST + 10% раствор Superblock (Pierce Biotech, Rockford, IL) и готовили в виде 2-кратного исходного раствора в различных концентрациях в диапазоне от 320 мкг/мл до 0,0156 мкг/мл (7F9 и 11E6) и от 160 мкг/мл до 0,0078 мкг/мл (4E5). Биотинилированные полученные из гибридом моноклональные антитела против RAGE человека (7F9-биотин, 11E6-биотин и 4E5-биотин) готовили в концентрации 8 мкг/мл в PBST + 10% Superblock. Смешивали равные объемы (50 мкл) каждого из рекомбинантных химерных моноклональных антител против RAGE человека или полученных из гибридом моноклональных антител против RAGE человека и каждого из соответствующих биотилированных полученных из гибридом анти-RAGE-мАт. Затем 50 мкл полученной смеси добавляли в планшеты для ELISA, предварительно покрытые рекомбинантным RAGE человека в концентрации 2 мкг/мл, и инкубировали в течение 1,5 часов при комнатной температуре. Лунки три раза промывали PBS + 0,05% твин-20. Стрептавидин-HRP (1 мг/мл) разбавляли 1:16000 в PBST + 10% Superblock; добавляли 50 мкл/лунку и планшеты инкубировали в течение 1 часа при комнатной температуре. Планшеты 3 раза промывали PBS + 0,05% твин-20. В каждую лунку добавляли 50 мкл раствора TMB (Sigma, St Louis, Mo.) и инкубировали в течение 10 минут при комнатной температуре. Реакцию останавливали добавлением 1N серной кислоты. Планшеты регистрировали спектрофотометрически при длине волны 450 нм. Результаты показаны на фиг. 1A, 1B и 1C.

Пример 2. Создание рекомбинантного sRAGE человека (husRAGE)

Рекомбинантный белок husRAGE 293/6.1 sRAGE His 6 экспрессировали и очищали из клеток HEK293 (ATCC CRL-1573). Экспрессирующий вектор, используемый для получения стабильной экспрессии, представлял собой вектор «pcDNA3(-)6.1 C HIS A».

Использовали стандартные молекулярно-биологические способы согласно Sambrook and Russel (Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press. 2001). Суммарную РНК из лимфоцитов человека (PBL) обратно транскрибировали в кДНК, используя систему ОТ-ПЦР Superscript (Invitrogen, Carlsbad USA). Используя олигонуклеотидные праймеры RAGE-SE: CCG AAT TCC GGA AGC AGG ATG GCA GCC G (SEQ ID NO: 81) и RAGE-AS: CCC TCG AGC CCC TCA AGG CCC TCA GTA CTA CT (SEQ ID NO: 82), кДНК RAGE амплифицировали с кДНК (полученной как описано выше), получая кДНК RAGE, которая описана в качестве эталонной последовательности NM-001136. ПЦР-фрагмент разгоняли в агарозном геле, очищали и экстрагировали, используя набор для экстракции из геля QIAquick (Qiagen GmbH, Germany). Затем кДНК разрезали эндонуклеазами рестрикции EcoRI и XhoI. Полученный фрагмент очищали из геля и лигировали в вектор pcDNA3 (Invitrogen, USA), который был предварительно расщеплен XhoI/EcoRI. После трансформации клеток E. coli XL-1 blue (Invitrogen, USA) идентифицировали позитивный рекомбинантный клон. Последовательность такого клона подтверждали и выделяли ДНК плазмиды pcDNA3/RAGE 2.6, используя мининабор для плазмид (Qiagen, Germany). Кодирующую область внеклеточной части RAGE, husRAGE, амплифицировали с pcDNA3/RAGE 2.6, используя ПЦР и праймеры N-SE A: AGT AAC GGC CGC CAG TGT GCT GGA ATT CGG A (SEQ ID NO: 83) и C-SE B: CCG GTA CCA CCT GCA GTT GGC CCC TCC TCG CC (SEQ ID NO: 84). Полученный ПЦР-продукт расщепляли эндонуклеазами рестрикции EcoRI и KpnI, очищали из геля как описано выше и лигировали в «pcDNA3.1(-)Myc HIS» (Invitrogen, USA), которая была предварительно расщеплена EcoRI/KpnI. Полученную плазмиду «pcDNA 3(-)6.1 C HIS A» трансфицировали в клетки HEK293, используя Superfect (Qiagen, Germany) согласно инструкциям производителя. Селекцию резистентных клеток осуществляли, используя 800 мкг/мл G418 в среде MEM (№M4528, Sigma, Germany) + 10% FCS, 2 мМ L-глутамин, 100 ед./мл пенициллина/стрептавидина (Invitrogen, USA). Клонирование отдельных клеток посредством серийных разведений клеточных суспензий привело к идентификации клона «293/6.1 sRAGE His 6», который секретировал husRAGE в среду для культивирования клеток, что подтверждено благодаря Вестерн-блоттингу с использованием RAGE-специфичного антитела (Santa Cruz; № sc5563). Для экспрессии и очистки достаточных количеств белка husRAGE указанный клон выращивали в среде для культивирования клеток, содержащей сыворотку (смотри выше), используя «клеточные фабрики» (Nunc, Germany). Затем клетки переносили в бессывороточную среду Pro293a-CDM (№12-764Q, BioWhittaker, Belgium) и инкубировали в течение 3 суток при 37°C. 80 литров среды без клеток собирали и концентрировали, используя высокопоточные колонки серии F Hemoflow (Fresenisus Medical Care AG, Germany) до объема 1400 мл.

Очистку белка осуществляли, используя аффинную хроматографию с иммобилизованными ионами металла (IMAC) Diarect AG (Freiburg, Germany) и сефарозу FF для хелатирования (Amersham-Bioscience, Sweden). Уравновешивание колонки и связывание белка, содержащего гекса-His, из надосадков клеток с матриксом осуществляли согласно инструкциям производителя. Элюирование белка осуществляли, используя ступенчатые градиенты с возрастающими концентрациями имидазола. Элюированные фракции анализировали в отношении белка, содержащего гекса-His, используя Вестерн-блоты и анти-HIS-антитела. Очищенный husRAGE, специфично элюировался при 250-500 мМ имидазола. Позитивные фракции объединяли, концентрировали и 3 раза диализовали против PBS (2×4 час, 1×16 час).

Укороченный на N-конце вариант husRAGE (102-331-sRAGE-HIS), в котором отсутствуют первые 101 аминокислота RAGE человека, создавали, используя стандартные способы молекулярной биологии, которые описаны выше для белка husRAGE. Такой белок создавали, используя такой же основной способ, который применяли для husRAGE (1-331). Используя плазмиду, описанную выше (pcDNA3/RAGE 2.6) и два праймера (CGA AGC TTG ATG AAC AGG AAT GGA AAG GAG ACC AAG (SEQ ID NO: 85) и TCC TCG AGC ACC TGC AGT TGG CCC CTC CTC GCC T (SEQ ID NO: 86)) укороченный вариант ДНК для husRAGE амплифицировали в ПЦР. После агарозного геля и элюирования фрагмента полученный очищенный фрагмент расщепляли эндонуклеазами рестрикции HindIII и XhoI и снова очищали, используя агарозный гель и элюирование. Фрагмент лигировали в psecTAG 2A (Invitrogen, USA), который был предварительно разрезан эндонуклеазами рестрикции HindIII и XhoI. После трансформации клеток E. coli «TOP10 One Shot» (Invitrogen, USA) отбирали позитивный клон и выделяли плазмидную ДНК. ДНК в экспрессирующем векторе трансфицировали в клетки HEK293 F, используя систему экспрессии Freestyle (Invitrogen, USA). После 96 часов экспрессии не содержащий клеток надосадок использовали для очистки с помощью шариков Ni-NTA Superflow (Quiagen, Germany). Уравновешивание и связывание осуществляли согласно инструкции производителя. Связанный белок элюировали буфером (PBS, 160 мМ NaCl, 150 мМ имидазол, pH 8,0). Фракции, содержащие белок, объединяли и диализовали в течение ночи при 4°C против TBS (забуференный трисом физиологический раствор; pH 7,4). Концентрации очищенного husRAGE (102-331) определяли спектрофотометрически.

Укороченный на C-конце вариант слитого белка husRAGE (1-130-sRAGE-Fc), в котором отсутствуют аминокислоты после аминокислоты 130 RAGE человека, создавали стандартными способами молекулярной биологии, которые описаны выше для белка husRAGE. Используя описанную выше плазмиду (pcDNA3/RAGE 2.6) и два праймера (GCACCATGGCAGCCGGAACAGCAGTTG (SEQ ID NO: 87) и GAGTCTCGAGGCAGAATCTACAATTTCTG (SEQ ID NO: 88)), укороченный вариант ДНК для husRAGE амплифицировали в ПЦР. После агарозного геля и элюирования фрагмента полученный очищенный фрагмент расщепляли эндонуклеазами рестрикции NcoI и XhoI и снова очищали, используя агарозный гель и элюирование. Затем фрагмент лигировали в плазмиду pENTR4, которая была предварительно разрезана эндонуклеазами рестрикции NcoI и XhoI. Смесями для лигирования трансформировали клетки E. coli «TOP10 One Shot» (Invitrogen, USA), чтобы создать pENTR4-RAGE 1-130. Отбирали позитивный клон и выделяли плазмидную ДНК. Используя сайт-специфичную рекомбинацию и «шлюзовую» систему клонирования (Invitrogen, Carlsbad, USA; attL x attR) с использованием ДНК клона pENTR4 hRAGE 1-130 и ДНК вектора pcDNA3.1(+)Zeo hIgG lambda hc 257-Stop, конструировали плазмиду (смотри ниже), которая после трансформации в клетки «TOP10 One Shot» (Invitrogen, USA) и очистки кодировала husRAGE-1-130-Fc (плазмида названа: pEXP hRAGE 1-130/hIgG lambda hc 257-Stop). Экспрессия указанной плазмиды с использованием системы экспрессии Freestyle и клеток 293F (пример 2.1) и очистка полученного белка из надосадка клеток с использованием шариков с белком G (пример 2.2) давали белок, имеющий чистоту >95%.

Пример 3. Конструирование pcDNA3.1(+)Zeo hIgG lambda hc 257-Stop

2 олигонуклеотидных праймера (gtacgatatcgagggacgaatggatccaccgtgcccagcacc (SEQ ID NO: 91); ctagtctagatcatttacccggagacagggag (SEQ ID NO: 92)) использовали для амплификации последовательности ДНК для тяжелой цепи лямбда hIgG из библиотеки кДНК плаценты человека (Clontech № HL5014a), используя полимеразу EasyA в ПЦР, полимеразной цепной реакции. Полученную ДНК очищали из геля (как описано выше), клонировали в векторе pcDNA3.1 V5-His TOPO (набор для экспрессии pcDNA3.1/ V5/His TOPO TA, Invitrogen №K4800-01), используя инструкцию производителя, и трансформировали клетки E. coli TOP10, как описано выше. Идентифицировали позитивные клоны и полученную плазмидную ДНК очищали (названа: pcDNA3.1(V5His) FC/hIgG lambda hc Nr.2/7), используя ПЦР и олигонуклеотидные праймеры (gtacgatatcgagggacgaatggatccaccgtgcccagcacc (SEQ ID NO: 93); ctagtctagatcatttacccggagacagggag (SEQ ID NO: 94)). hIgG lambda hc-часть ДНК амплифицировали, разрезали EcoRV/XbaI, лигировали в предварительно разрезанную EcoRV/XbaI векторную ДНК pcDNA3.1(+)Zeo и трансформировали клетки E. coli TOP10. Полученная плазмида названа: pcDNA3.1(+)Zeo hIgG lambda hc 257-Stop, и такую плазмиду использовали для дальнейшей работы, чтобы экспрессировать белки, слитые на N-конце в рамке с C-концевой частью тяжелых цепей иммуноглобулина IgG.

3.1. Трансфекция и экспрессия белков в клетках HEK293F

Клетки HEK 293F, которые были выращены в культуре в течение 2-3 суток в среде для экспрессии Free Style 293, центрифугировали при 400 g и надосадок отбрасывали. Осадок клеток ресуспендировали в среде и доводили до концентрации 3×107 клеток в 28 мл свежей среды, переносили в колбу Эрленмейера объемом 125 мл и инкубировали в инкубаторе при 37°C, 8% CO2 на орбитальном встряхивателе при 150 об./мин вплоть до подготовки смеси для трансфекции.

Смеси для трансфекции комплексом 293fectin-ДНК готовили следующим образом:

(i) 30 мкг ДНК разбавляли Opti-MEM I до общего объема 1000 мкл (контроль 1000 мкл Opti-MEM I) и перемешивали.

(ii) 35 мкл 293fectin (Invitrogen №12347-019; 1 мл) разбавляли Opti-MEM I до общего объема 1000 мкл, перемешивали и инкубировали в течение 5 минут при комнатной температуре.

Смесь ДНК и раствор 239fectin, описанные в пп. (i) и (ii), переносили в новую пробирку, слегка перемешивали и после инкубации в течение 25 минут при комнатной температуре добавляли к клеткам в колбу Эрленмейера.

Клетки инкубировали с полученной смесью для трансфекции в течение указанного времени в инкубаторе при 37°C, 8% CO2 на орбитальном встряхивателе при 150 об./мин. Надосадки клеток собирали центрифугированием при 400 g в течение 10 минут.

3.2. Очистка слитых белков RAGE-Fc с использованием белка G-сефарозы

Чтобы связать белок из клеточных надосадков с шариками, шарики (белок G-сефароза 4 Fast Flow (Amersham Bioscience)) 3 раза промывали в PBS, суспендируя шарики в PBS и центрифугируя при 13500 об./мин, при этом надосадок отбрасывали. Шарики инкубировали с соответствующими надосадками клеток (300 мл надосадков клеток на мл шариков), которые необходимо связать, в течение 1-2 часов на вращающем устройстве при комнатной температуре. Шарики 3 раза промывали PBS и инкубировали с надосадками клеток в течение 12 часов или в течение ночи при 4°C. После инкубации шарики 3 раза промывали PBS как описано выше. Связанный белок элюировали, добавляя 200 мкл 140 мМ NaCl + 0,1 М глицин к осадку шариков и инкубируя в течение 30 минут на вращающем устройстве. После центрифугирования надосадок сразу же нейтрализовали добавлением 2 М трис, чтобы довести pH до 7,1-7,4. Осадок шариков отбрасывали. Полученные образцы диализовали против PBS и хранили замороженными в аликвотах при -20°C. Слитый белок RAGE-Fc, содержащий полный внеклеточный эктодомен RAGE, получали из R&D systems (№ 1145-RG; химеры рекомбинантный RAGE человека/Fc).

3.3. Дот-блот-связывание антител к пептидам или фрагментам RAGE в неденатурированной форме

Дот-блоты использовали для оценки связывания антител с пептидами или фрагментами RAGE в неденатурированной форме. Используемые белки представляли собой либо белок sRAGE (1-331 sRAGE-HIS), либо укороченный на N-конце вариант (102-331-sRAGE-HIS). Пептиды были заказаны и синтезированы в Biotrend стандартными способами (твердофазный синтез пептидов на синтезаторе AMS 222 с использованием Fmoc/tBu-химии) и содержали свободный карбоксильный конец. Пептиды очищали с помощью ВЭЖХ и проводили анализ каждого пептида в отношении чистоты, используя ОФ-ВЭЖХ. Все пептиды имели чистоту >80%. Идентичность пептидов подтверждали масс-спектрометрией.

Используемые пептиды представляли собой 30-меры, охватывающие внеклеточную область белка RAGE человека. Суммарный заряд большинства пептидов был сходным.

Доты, содержащие разные количества белка/пептида (30 нг, 10 нг, 3 нг, 1 нг, 0,3 нг, 0,1 нг, 0,03 нг и 0,01 нг) в объеме 1 мкл в 1xPBS, наносили пятнами на нитроцеллюлозную мембрану Hybond-ECL (Amersham, RPN68D) в двух повторах. Мембраны сушили и неспецифичное связывание блокировали встряхиванием мембран в течение 1 часа при комнатной температуре с реагентом для блокирования Вестерн-блотов (Roche, № 1921673). Блокирующий реагент удаляли и мембраны инкубировали с антителами в концентрации 7,14 нМ (встряхивание, 1 час при комнатной температуре). Моноклональные антитела представляли собой антитела ML37-7F9, ML37-11E6, ML37-4E5, коммерчески доступные антитела из R&D systems (например, AF1145). Блоты 4 раза промывали (каждый раз 5-минутная инкубация со встряхиванием при комнатной температуре) 1xPBS. Затем блоты инкубировали со вторым антителом козы против IgG мыши AP (Sigma № A-7434), разбавленным 1:2000 в реагенте для блокирования Вестерн-блотов (Roche, № 192173). Инкубацию в течение 1 часа осуществляли, как указано ранее (встряхивание, комнатная температура). Фильтры 4 раза промывали (5 минут каждый раз) в 1xPBS. Проявление сигналов осуществляли согласно инструкциям производителя, используя раствор субстрата NBT/BCIP (Roche, № 1697471). Развитие окраски останавливали через 10 минут дважды дистиллированной водой. Смотри фиг. 2.

Хотя husRAGE выявляли на дот-блотах с использованием всех трех моноклональных антител согласно настоящему изобретению и поликлонального антитела AF1145 (из коммерческого источника, R&D), моноклональные антитела согласно настоящему изобретению не выявляли ни один из пептидов. Однако поликлональное антитело выявляло несколько пептидов. Пептид 9, который не содержал аминокислотную последовательность, используемую для создания поликлональных антител, которые описаны Ostendorp с соавторами (EMBO J. 2638752007), четко выявлялся коммерчески доступным поликлональным антителом. Полученные результаты свидетельствуют о том, что моноклональные антитела согласно настоящему изобретению несомненно узнают другой эпитоп, отличный от эпитопа, узнаваемого имеющимися в настоящее время антителами.

Дополнительную характеристику связывания осуществляли с помощью анализа RAGE-мутантов sRAGE человека, экспрессированных в E. coli. Моноклональные антитела 11E6 и 4E5 связываются с областью вблизи домена C2, так как связывание утрачено у делеционных мутантов, у которых отсутствуют аминокислоты 235-336, и связывание наблюдали в случае мутантного белка RAGE, состоящего из аминокислот 235-336.

Пример 4. Взаимодействие между Aβ1-42-глобуломером и белком, полученным из husRAGE с использованием методики HTRF

Анализ основан на методике HTRF (гомогенной флуоресценции с временным разрешением), доступной из CIS Bio International (Bagnols, France).

Донорные и акцепторные компоненты HTRF, анти-6HIS-европийкриптат (CIS Bio № в каталоге: 61HISKLA; 500 лунок/13 мкг) и стрептавидин XL-665 (CIS Bio № в каталоге: 611SAXLA, 500 лунок/250 мкг) растворяли в 250 мкл дважды дистиллированной воды. Указанные исходные растворы разбавляли в 100 раз, используя PBS, 0,1% БСА, pH 7,4, получая рабочие растворы с конечными концентрациями 3,7 нМ анти-6His-криптат и 60,6 нМ стрептавидин XL-665. Растворы 10 мкМ, 5 мкМ, 2,5 мкМ, 1,25 мкМ, 0,625 мкМ, 312,5 нМ, 156,25 нМ биотинилированного Aβ-глобуломера (1/5 пептида Aβ1-42, используемого для получения Aβ-глобуломеров, была представлена биотинил-β-амилоидный белок (1-42) (Bachem № H-5642) готовили согласно описанию Barghorn с соавторами (J. Neurochemistry, vol. 95, № 3, pp. 834-847, 2005 и WO/2007/062852; международная заявка № PCT/EP2006/011530); используемую концентрацию глобуломера вычисляли на основе концентрации мономеров Aβ1-42, которые использовали для создания глобуломеров. Растворы 10 мкМ, 5 мкМ, 2,5 мкМ, 1,25 мкМ, 0,625 мкМ, 0,312 мкМ, 0,156 мкМ биотинилированного Aβ-глобуломера готовили в таком же буфере (PBS, 0,1% БСА, pH 7,4). 4 мкл таких растворов или 4 мкл буфера смешивали с 4 мкл 1 мкМ рекомбинантного белка husRAGE и раствор инкубировали при комнатной температуре в течение 1 часа, затем добавляли 4 мкл каждого из растворов (3,7 нМ анти-6His-криптат и 60,6 нМ стрептавидин XL-665).

Смесь для анализа инкубировали в течение 2 часов при 4°C. После добавления 4 мкл 2М исходного раствора KF сигнал HTRF измеряли в режиме HTRF, используя устройство для флуоресценции BMG Pherastar (BMG Labtech GmbH, Germany). Использовали кривые максимального сигнала без антитела и фоновые результаты с использованием только раствора анти-6HIS-криптата или стрептавидина XL. Значения дельта F в % вычисляли согласно инструкциям производителя CisBio с использованием GraphPad Prism 4 (компьютерная программа GraphPad, San Diego, USA).

Пример 5. Ингибирование связывания Aβ1-42-глобуломера с husRAGE антителами с использованием методики HTRF

Использовали основной протокол, который описан выше, с небольшими модификациями. Донорные и акцепторные компоненты HTRF разбавляли в 40 раз до 10,25 нМ в случае анти-6HIS-европийкриптата и 151,5 нМ в случае стрептавидина XL-665 в PBS, pH 7,4, содержащем 0,1% БСА.

Использовали очищенные моноклональные антитела (мАт) против husRAGE или контрольные иммуноглобулины (мышиный IgG1 и мышиный IgG2a; № M-5284 и № M-5409, соответственно; Sigma, Germany) в качестве контрольных антител.

Анализ осуществляли в общем объеме 20 мкл в 384-луночных планшетах. Для каждой точки анализа: 4 мкл 1 мкМ husRAGE инкубировали с 4 мкл тестируемого антитела или контрольными IgG-антителами в концентрациях 2 мкМ, 1 мкМ, 0,5 мкМ, 0,25 мкМ, 0,125 мкМ, 62,5 нМ, 31,25 нМ, 15,62 нМ, 7,81 нМ, 3,9 нМ в течение 1 часа при комнатной температуре. Фоновый контроль получали без husRAGE и без антител. Максимальный сигнал получали без антител. Затем добавляли 4 мкл 800 нМ биотинилированного Aβ-глобуломера, а также 2 мкл 10,25 нМ в случае анти-6HIS-европийкриптата и 151,5 нМ в случае стрептавидина XL-665. Различия в объеме корректировали, добавляя буфер для связывания (1xPBS pH 7,4; 0,1% БСА). Смесь для анализа инкубировали еще в течение часа. После добавления 4 мкл 2М исходного раствора KF сигнал HTRF измеряли в режиме HTRF, используя устройство для флуоресценции BMG Pherastar (BMG Labtech GmbH, Germany). Использовали кривые максимального сигнала без антитела и фоновые результаты с использованием только раствора анти-6HIS-криптата или стрептавидина XL. Значения дельта F в % вычисляли согласно инструкциям производителя CisBio с использованием GraphPad Prism 4 (компьютерная программа GraphPad, San Diego, USA). Результаты показаны на фиг. 3A, 3B и 3C. Концентрации, указанные на фигурах, являются конечными концентрациями белков в 20 мкл объеме анализируемой смеси.

Как показано на фиг. 4, husRAGE, экспрессирующий все три домена RAGE, связывался с глобуломерами амилоида Aβ. Мутантный белок RAGE, состоящий из sRAGE человека, в котором отсутствует v-домен (RAGE 102-331), связывался с более высокой аффинностью с глобуломерами амилоида Aβ, что свидетельствует о том, что домен в RAGE человека для связывания с глобуломерами Aβ находится в C-концевой части.

Пример 6. Связывание Aβ-глобуломеров с белками RAGE с использованием методики скринингового анализа ALPHA

Указанный анализ осуществляли в буфере для анализа (25 мМ HEPES, 100 мМ NaCl pH 7,4 и 0,1% БСА) в объеме 20 мкл. Используемые донорные шарики были покрыты стрептавидином (Perkin Elmer; 6760002S), а используемые акцепторные шарики белок A-ALPHALISA (Perkin Elmer; CUSM64133000EA), 4 мкл каждого образца шариков предварительно разбавляли, добавляя 196 мкл буфера для анализа.

Используя 384-луночный планшет Proxi (Perkin Elmer, № 6006280), донорные шарики нагружали биотин-aβ-глобуломерами (смотри выше), используя 4 мкл предварительно разбавленных донорных шариков и 6 мкл 200 нМ раствора биотинилированных аβ-глобуломеров.

Акцепторные шарики нагружали разными количествами слитых белков RAGE-Fc, используя 4 мкл предварительно разбавленных акцепторных шариков и 6 мкл разных разведений слитых белков RAGE-Fc (начиная, например, со 100 мкг/мл).

Загрузку (связывание белков с шариками) осуществляли в темноте при комнатной температуре в течение 30 минут.

Связывание Aβ-глобуломеров с RAGE начиналось при объединении препаратов предварительно нагруженных донорных и акцепторных шариков в течение дополнительных 180 минут в темноте. Сигналы измеряли с использованием прибора ALPHA-Quest (Perkin Elmer) с временной задержкой в 1 секунду. Дальнейшие анализы осуществляли с использованием компьютерной программы GraphPadPrism. В другом эксперименте, но с использованием той же самой методики, связывание Aβ-глобуломеров с RAGE-Fc, состоящим из все трех доменов, сравнивали со связыванием Aβ-глобуломеров с мутантным белком RAGE-Fc, состоящим только из v-домена (аминокислоты 1-130 huRAGE). Как показано на фиг. 5, связывание глобуломеров амилоида Aβ с тремя доменами растворимого RAGE было сильным, а связывание глобуломеров амилоида Aβ с v-доменом RAGE было незначительным. Так как связывание Aβ-глобуломеров с RAGE имело место в C-концевой области, то можно предположить, что антитела, предпочтительно связывающиеся с такими доменами, конкурируют с таким связыванием.

Пример 7. Конструирование, экспрессия и очистка фрагментов RAGE E. coli

7.1. Получение конструкций

Конструкции RAGE E. coli, перечисленные в таблице 6, создавали следующим образом. Конструкцию 1 создавали посредством ПЦР-амплификации с матричной плазмиды pcDNA3(-)6.1 C HIS A, используя прямой праймер (atgctacatatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccgctcaaaacatcacagcc (SEQ ID NO: 89)) и обратный праймер (atgctactcgagtcagtggtggtggtggtggtgagttcccagccctgatcctcccacagagcctgcagttggcccctcc (SEQ ID NO: 90)), которые вводили сайты рестрикции NdeI и XhoI, которые использовали для субклонирования в аналогичных сайтах pET29. Остальные конструкции (№2-№7, таблица 6) создавали, используя конструкцию 1 в качестве матрицы. Последовательности, кодирующие аминокислотные остатки RAGE 24-129, 24-234, 24-336, 130-234, 130-336, 235-336, амплифицировали в ПЦР с конструкции 1. Полученные фрагменты ДНК разгоняли в 1,0% агарозном геле и ДНК очищали, используя набор для экстракции из геля QIAquick, Qiagen. Фрагменты ДНК расщепляли NdeI и XhoI и лигировали в pET28a, расщепленный подобным образом. Смесью для лигирования трансформировали максимально эффективные компетентные клетки DH5a, которые высевали на чашки с LB-агаром, содержащим 50 мг/л канамицина. После инкубации в течение ночи при 37°C по три колонии для каждого клона инокулировали в 3 мл бульона LB, содержащего 50 мг/л канамицина, и встряхивали в течение ночи при 37°C. ДНК выделяли, используя набор QIAprep Spin Miniprep, Qiagen, и вставку секвенировали, используя праймеры, специфичные к промотору T7 и терминатору T7. Последовательность ДНК плазмид, кодирующих конструкции №1-№7, указаны в виде SEQ ID NO: 27-33, и соответствующие транслируемые области указаны в виде SEQ ID NO: 34-40.

Штамм E. coli BL21(DE3) трансформировали плазмидной ДНК конструкции №1, высевали на чашки с LB, содержащей канамицин (50 мг/л), и инкубировали при 37°C в течение ночи. На следующий день в 14 колб Фернбаха, каждая из которых содержала 1 л бульона Terrific с канамицином (50 мг/л), высевали КОЕ и помещали на встряхивателе (180 об./мин) в инкубатор при 37°C. Когда культуры достигали OD600нм 0,47, колбы переносили в инкубатор на 30°C (все еще встряхивая при 180 об./мин) и экспрессию индуцировали добавлением 0,4 мМ IPTG. Клетки собирали через 4 часа после индукции центрифугированием (15900 g, 8 минут, 4°C), и клеточную массу затем замораживали при -80°C вплоть до очистки.

Очистке конструкции 1 RAGE предшествовала первая разморозка и ресуспендирование 20 г осадка клеток в 180 мл лизирующего буфера [50 мМ трис pH 7,6, 300 мМ NaCl, 10% глицерин, 0,1% тритон X-100, 0,5 мМ MgCl2, 20 мМ имидазол, 1Х не содержащие EDTA ингибиторы протеаз Roche, 20 ед./мл ДНКазы I]. Клетки лизировали, пропуская суспензию последовательно три раза через микрофлюидизатор Avestin Emulsiflex при 3°C. Осветленный лизат затем наносили на колонку HiTrap IMAC объемом 5 мл (GE Healthcare, 17-5255-01) со скоростью 2 мл/мин. Затем колонку промывали 10 объемами колонки буфера для промывки [50 мМ трис pH 7,6, 300 мМ NaCl, 10% глицерин, 20 мМ имидазол]. После стадии промывки RAGE подвергали градиентному элюированию, используя буфер для элюирования [50 мМ трис pH 7,6, 300 мМ NaCl, 10% глицерин, 500 мМ имидазол]. Фракции, содержащие RAGE, объединяли и затем диализовали против 50 мМ трис pH 7,6, 20 мМ NaCl, 10% глицерин. Масс-спектрометрический анализ очищенного вещества подтверждал, что OmpA-лидер был удален при процессинге, и что очищенное вещество, как и ожидалось, начинается с остатка 23 RAGE (т.е. последовательность A-Q-N-...).

Плазмидами, кодирующими конструкции №2-№7, по отдельности трансформировали штамм E. coli BL21(DE3), высевали на чашки со средой LB, содержащей канамицин (50 мг/л), и инкубировали при 37°C в течение ночи. На следующий день в 1 л среды Overnight Express Instant TB (Novagen) высевали колонию и встряхивали в течение 19 часов при 30°C. Клетки осаждали центрифугированием (15900 xg, 10 минут, 4°C) и затем замораживали при -80°C. Осадки (5-6 грамм каждого) размораживали и ресуспендировали в 50 мл лизирующего буфера [50 мМ трис, pH 8, 300 мМ NaCl, 0,1% тритон X-100, 10% глицерин, 0,2 мг/мл лизоцима, 1 мл смеси ингибиторов протеаз III (Calbiochem), 20 ед./мл бензоназы, 5 мМ B-меркаптоэтанол]. Лизаты обрабатывали ультразвуком в течение 2 минут с использованием ультразвукового устройства Vibra Cell с последующим центрифугированием при 20K x g в течение 30 минут. Колонки Econo-Pac 10 фирмы Bio-Rad заполняли смолой с никелем ProBond, получая объем слоя 2 мл, и уравновешивали лизирующим буфером. Осветленные лизаты пропускали через колонки последовательно 3 раза, затем промывали 3×10 объемами колонки (всего 60 мл) буфера для промывки [2Х PBS, 20 мМ имидазол, 10% глицерин, 5 мМ B-меркаптоэтанол]. Белки элюировали с колонок 5×1 объемом колонки (всего 10 мл) элюирующего буфера [2Х PBS, 500 мМ имидазол, 10% глицерин, 5 мМ B-меркаптоэтанол]. Элюированное вещество переносили в PBS, содержащий 10% глицерин и 1 мМ DTT, используя колонки Bio-Rad Econo-Pac 10DG.

7.2. Экспрессия анти-RAGE моноклональных антител 11E6, 4E5 и 7F9

Среды, используемые для размножения клеток гибридом, состояли из среды BD Cell MAb Quantum Yield (Becton Dickenson-№ в каталоге 220511), содержащей 10% фетальной бычьей сыворотки со сверхнизким содержанием IgG (Invitrogen, № в каталоге 16250-078). Коротко, несколько инокулятов объемом 300 мл мышиной линии клеток гибридомы, экспрессирующей моноклональное RAGE-антитело 11E6, размножали во вращающихся флаконах объемом 2 л, встряхивая в инкубаторе (65 об./мин, 8% CO2, 37°C) вплоть до достижения плотности 1,0×106 клеток/мл. Затем клетки высевали в 20 л среды при плотности 0,06×106 клеток/мл в биореакторе Wave объемом 25 л, используя следующие рабочие установки: 14 качаний/минуту, угол наклона качалки 6°, температура 37°C и 8% CO2, скорость омывания 0,15 литров в минуту. Через двое суток культуры размножали, добавляя среду до конечного объема 24 л, достигая новой плотности клеток 0,43×106 клеток/мл. Культуру собирали через 12 суток после наращивания до полного объема. Клетки удаляли непрерывным центрифугированием (Carr ViaFuge, 6000 об./мин, 1,7 литров в минуту). После добавления 5 мМ NaN3 (из 1 М исходного раствора NaN3, Hampton Research) к осветленной среде, вещество сразу же использовали в процессе очистки.

Среды, используемые для размножения клеток гибридом, состояли из среды BD Cell MAb Quantum Yield (Becton Dickenso, № в каталоге 220511), содержащей 10% фетальной бычьей сыворотки со сверхнизким содержанием IgG (Invitrogen, № в каталоге 16250-078). Коротко, несколько инокулятов объемом 300 мл мышиной линии клеток гибридомы, экспрессирующей моноклональное RAGE-антитело 4E5, размножали во вращающихся флаконах объемом 2 л, встряхивая в инкубаторе (65 об./мин, 8% CO2, 37°C) вплоть до достижения плотности 1,0×106 клеток/мл. Затем клетки высевали в 5 л среды при плотности 0,12×106 клеток/мл в биореакторе Wave объемом 25 л, используя следующие рабочие установки: 12 качаний/минуту, угол наклона качалки 6°, температура 37°C и 8% CO2, скорость омывания 0,15 литров в минуту. Через четверо суток культуры дополнительно размножали, добавляя среду до конечного объема 24 л, достигая новой плотности клеток 0,24×106 клеток/мл. Скорость качания увеличивали до 14 качаний/минуту. Культуру собирали через 12 суток после наращивания до полного объема. Клетки удаляли непрерывным центрифугированием (Carr ViaFuge, 6000 об./мин, 1,7 литров в минуту). После добавления 5 мМ NaN3 (из 1 М исходного раствора NaN3, Hampton Research) к осветленной среде, вещество сразу же использовали в процессе очистки.

Среды, используемые для размножения клеток гибридом, состояли из среды BD Cell MAb Quantum Yield (Becton Dickenso, № в каталоге 220511), содержащей 10% фетальной бычьей сыворотки со сверхнизким содержанием IgG (Invitrogen, № в каталоге 16250-078). Коротко, несколько инокулятов объемом 300 мл мышиной линии клеток гибридомы, экспрессирующей моноклональное RAGE-антитело 7F9, размножали во вращающихся флаконах объемом 2 л, встряхивая в инкубаторе (65 об./мин, 8% CO2, 37°C) вплоть до достижения плотности 1,0×106 клеток/мл. Затем клетки высевали в 10 л среды при плотности 0,05×106 клеток/мл в биореакторе Wave объемом 25 л, используя следующие рабочие установки: 12 качаний/минуту, угол наклона качалки 6°, температура 37°C и 8% CO2, скорость омывания 0,15 литров в минуту. Через четверо суток культуры дополнительно размножали, добавляя среду до конечного объема 25 л, достигая новой плотности клеток 0,25×106 клеток/мл. Скорость качания увеличивали до 14 качаний/минуту. Культуру собирали через 10 суток после наращивания до полного объема. Клетки удаляли непрерывным центрифугированием (Carr ViaFuge, 6000 об./мин, 1,7 литров в минуту). После добавления 5 мМ NaN3 (из 1 М исходного раствора NaN3, Hampton Research) к осветленной среде, вещество сразу же использовали в процессе очистки.

7.3. Очистка моноклональных анти-RAGE-антител 11E6, 4E5, 7F9

К осветленной среде после культивирования гибридом добавляли глицин и NaCl до конечных концентраций 3M и 1,5M, соответственно. Значение pH доводили до 8,0, используя NaOH. Вещество фильтровали, используя мембранный фильтр с размером пор 5 мкм Pall Capsule № 120, и наносили на колонку объемом 200 мл с белком A BioSepra. Раствор белка промывали 11 объемами колонки буфера для промывки (20 мМ фосфат натрия pH 8,0, 1 мМ азид натрия) и элюировали, используя ступенчатый градиент 50 мМ глицина (pH 3,0). Собирали фракции размером 100 мл и концентрацию белка определяли, измеряя A280 нм. Все стадии обработки колонки проводили при 4°C. Объединенный материал диализовали против 20 л 10 мМ трис pH 8,0 в течение ночи при 4°C. Дополнительную хроматографическую очистку осуществляли, используя картридж Singlesep Mini с сильным щелочным анионообменником SartoBind Q (Sartorius) в режиме непрерывного потока со скоростью 10 мл/мин. Антитело не связывается с колонкой, и его собирают в виде одного пула. После указанной стадии вещество концентрировали до 5 мг/мл, используя ячейку под давлением Amicon с мешалкой (мембрана с отсечением по молекулярной массе 5000, 75 фунтов/кв. дюйм (0,52 МПа), 4°C). Наконец антитело два раза диализовали против 20 л буфера PBS (10 мМ фосфат, 0,138 M NaCl, 0,0027 M KCl, pH 7,4), каждый цикл в течение 24 часов при 4°C.

7.4. Эксперименты по связыванию в ELISA

Антигены (очищенные белки конструкций №1-7) разбавляли в буфере для покрывания [100 мМ NaHCO3, pH 8,2] до 1 мкг/мл и затем 100 мкл полученного раствора делили на аликвоты в 96-луночном планшете Nunc Immuno (Maxi-Sorb Surface, с плоским дном, № в каталоге 439454). Планшет герметично закрывали герметизирующей пленкой и инкубировали при 4°C в течение ночи. На следующий день каждую лунку планшета 3 раза промывали 150 мкл буфера PBST [Sigma PBS + 0,05% твин 20]. Затем в каждую лунку добавляли 300 мкл блокирующего раствора (3% NFDM в PBST). Планшет инкубировали в течение 2 часов при комнатной температуре и встряхивании при 100 об./мин. После стадии инкубации каждую лунку снова три раза промывали 150 мкл PBST. Добавляли по 100 мкл соответствующего тестируемого антитела (т.е., 7F9, 11E6, и 4E5) в различных разведениях в PBST/0,5% БСА. Затем планшет герметично закрывали герметизирующей пленкой и инкубировали в течение 2 часов при комнатной температуре и встряхивании при 100 об./мин. Затем раствор антитела удаляли из лунок и затем каждую лунку три раза промывали 200 мкл PBST. Затем в каждую лунку добавляли 200 мкл конъюгированного второго антитела [конъюгат антитело осла против Ig мыши-HRPO, Jackson Immuno Research, № в каталоге 715-035-150] в разведении 1:5000 (в PBST/1% NFDM). Планшет накрывали и инкубировали в течение 1 часа при комнатной температуре и встряхивании при 100 об./мин. После такой инкубации раствор из лунок удаляли и каждую лунку три раза промывали 200 мкл PBST. В каждую лунку добавляли 100 мкл раствора субстрата HRPO [жидкий субстрат 3,3',5',5'-тетраметилбензидин (TMB), сверхчувствительный для ELISA, Sigma, № в каталоге T4444] и планшет инкубировали при комнатной температуре в течение 10 минут. Наконец в каждую лунку добавляли 50 мкл 2 М раствора H2SO4, чтобы остановить реакцию, и измеряли A540нм в каждой лунке, используя считывающее устройство для планшетов для микротитрования.

Результаты таких экспериментов по связыванию показаны на фиг. 6A, 6B и 6C и на фиг. 7A, 7B и 7C. На фиг. 6A, 6B, и 6C показано, что остатки RAGE 24-234 не вовлечены в связывание моноклональных RAGE-антител 11E6, 4E5 или 7F9. Напротив, как показано на фиг. 7A, 7B и 7C, остатки RAGE 235-336 достаточны для связывания моноклональных RAGE-антител 11E6 и 4E5. Не наблюдали никакого связывания RAGE-мАт 7F9 ни с одним из указанных (экспрессированных в E. coli) фрагментов RAGE.

Пример 8. Картирование эпитопов

8.1. Иммобилизация антител 11E6, 4E5 и 7F9

Примерно 20 мг смолы на основе CNBr-активированной сефарозы Fast Flow взвешивали и помещали в три компактные реакционные колонки, заполненные 35 мкм фриттами. Смоле давали возможность набухнуть в 200 мкл 1 мМ HCl, затем 3 раза промывали 200 мкл 1 мМ HCl. Затем смолу 3 раза промывали 200 мкл 100 мМ натрий-бикарбонатного буфера (pH 8,3), содержащего 500 мМ хлорида натрия (буфер A). После завершения растворы спускали с колонок так, чтобы только тонкий слой буфера оставался на поверхности смолы. Примерно 5,5 нмоль антител иммобилизовали на смолах, для этого требовалось добавление 235 мкл 7F9 (3,4 мг/мл), 500 мкл 11E6 (1,6 мг/мл) и 200 мкл 4E5 (3,75 мг/мл). В случае иммобилизации антител 7F9 и 4E5 также включали 200 мкл буфера A. Компактные реакционные колонки герметично закрывали и обеспечивали возможность перемешивания с помощью переворачивания при комнатной температуре в течение 4 часов. После завершения перемешивания компактные реакционные колонки раскрывали и промывали, добавляя по три раза 200 мкл буфера A, чтобы удалить несвязанное антитело. После промывки в каждую колонку добавляли 200 мкл буфера, содержащего 100 мМ трис-HCl (pH 8) и 500 мМ хлорида натрия (буфер B). Колонки снова герметично закрывали и обеспечивали возможность перемешивания с помощью переворачивания при комнатной температуре, чтобы блокировать несвязанные, но активные участки смолы. Через 2 часа колонки открывали и промывали сначала 200 мкл 100 мМ натрий-ацетатного буфера (pH 4), содержащего 500 мМ хлорида натрия (буфер C), а затем 200 мкл буфера B. Указанный процесс повторяли еще два раза, чтобы гарантировать полное удаление несвязанного антитела и полностью блокировать оставшиеся участки связывания на смоле. Затем смолы четыре раза промывали 200 мкл 100 мМ натрий-бикарбонатного буфера (pH 8,3), содержащего 100 мМ хлорида натрия (буфер D), перед связыванием антигена.

8.2. Протеолитическое расщепление антигенов sRAGE, экспрессированных в E. coli и BacMam

Антигенам sRAGE давали возможность связаться с антителом на колонках, добавляя 75 мкл экспрессированного в E. coli антигена к смоле, содержащей 11E6 и 4E5, и добавляя 125 мкл BacMam-экспрессированного антигена к смоле, содержащей 11E6, 4E5 и 7E9. Колонки герметично закрывали, и образцы подвергали перемешиванию посредством переворачивания при комнатной температуре в течение 2 часов. После указанного периода времени колонки открывали и промывали, 4 раза добавляя по 200 мкл буфера D. После смывания в ходе промывок смолы ресуспендировали в 200 мкл буфера D, а также с добавлением протеаз, приготовленных в виде растворов, содержащих 0,1 мг/мл либо трипсина, либо эндопротеиназы Glu-C, либо химотрипсина. Количества протеаз варьировали в разных экспериментах, чтобы ослабить расщепление, но количества были в диапазоне 200-400-кратного избытка антигена по сравнению с протеазой по массе. Протеолиз осуществляли при комнатной температуре с перемешиванием посредством переворачивания в течение 12 часов. Спустя указанное время колонки открывали, и раствор после протеолиза сливали и хранили для дальнейшего анализа. В случае образцов, подвергнутых двойному расщеплению, смолы ресуспендировали в 200 мкл буфера D и подвергали действию второй протеазы перед следующими стадиями. В случае образцов, не обрабатываемых второй протеазой, колонки подвергали двум отдельным промывкам буфером D по 200 мкл с последующей промывкой 200 мкл буфера A, затем подвергали конечной промывке 200 мкл буфера D. Промывные воды в каждом случае хранили отдельно для последующего анализа. Содержащие эпитоп пептиды элюировали с колонки тремя отдельными промывками 2% муравьиной кислотой по 200 мкл каждая. Каждый элюированный образец хранили отдельно для последующего анализа.

8.3. Масс-спектрометрический анализ пептидов, содержащих эпитоп

Образцы анализировали, используя масс-спектрометр ионно-циклотронного резонанса с преобразованием Фурье Bruker Apex QE 7T (FT-ICR), а также масс-спектрометр Applied Biosystems Q-STAR Pulsar I. Для масс-спектрометрического анализа FT-ICR 8 мкл образцов вырезанных эпитопов инъецировали на колонку с обращенной фазой Jupiter C4 (0,5×150 мм, размер частиц 5 мкм, размер пор 300 Å) с помощью системы для капиллярной ВЭЖХ Agilent серии 1100. Образцы промывали в течение 5 минут в смеси 90% воды с 0,1% муравьиной кислоты (растворитель A)/10% ацетонитрила с 0,1% муравьиной кислотой (растворитель B) со скоростью 5 мкл/мин для обессоливания. Пептиды элюировали в масс-спектрометр, изменяя состав подвижной фазы до получения смеси 5% растворителя A/95% растворителя B. Образцы, требующие прямой инфузии для тандемной масс-спектрометрии, инъецировали в микроловушку белка (Michrom), уравновешенную смесью 98% воды, 1% ацетонитрила и 1% муравьиной кислоты. Образцы промывали 1 мл растворителя для уравновешивания перед элюированием с использованием 300 мкл 60% ацетонитрила, 40% воды и 0,1% муравьиной кислоты. Элюент непосредственно вводили в масс-спектрометр FT-ICR со скоростью 2 мкл/мин. В случае масс-спектрометра Q-STAR Pulsar 5-30 мкл образца инъецировали в микроловушку белка (Michrom) с помощью устройства для ВЭЖХ Agilent серии 1100. Образцы промывали в смеси 95% растворителя A/5% растворителя B в течение 1 минуты перед элюированием связанных пептидов в масс-спектрометр в смеси 5% растворителя A/95% растворителя B.

Протеолитическое расщепление экспрессированного в E. coli sRAGE, связываемого с антителом 11E6, и элюирование пептидов, содержащих эпитопы, выявило наличие пептида с массой 12204,5 Д. Отбор по массе и активированная столкновениями диссоциация в зарядовом состоянии 10+ подтвердили идентичность данного пептида, который соответствовал остаткам Val229-His346 (указанный остаток His является следствием добавления гекса-His-метки к белку sRAGE). Дополнительное картирование эпитопов с использованием трипсина с последующим протеолизом химотрипсином показало расщепление C-концевой гексагистидиновой метки, с очищением при этом эпитопа до остатков Val229-His341 (указанный остаток His является следствием добавления гекса-His-метки к белку sRAGE). Дальнейшей очистки данного эпитопа невозможно было получить с использованием протеолиза. Проведенное подобным образом протеолитическое расщепление экспрессированного в E. coli sRAGE, связываемого с антителом 4E5, выявило такой же пептид 12204,5 Д, который наблюдали в случае исследования эпитопа антитела 11E6. Соответственно, расщепление BacMam-экспрессированного sRAGE, связываемого с антителом 11E6 или 4E5, выявило два основных пептида, содержащих эпитопы, с массами 10671,9 Д и 10614,0 Д. Такие пептиды совпадали с C-концом BacMam-экспрессированной конструкции, охватывая остатки Val229-Gly331 и Val229-Ala330, соответственно.

Протеолитическое расщепление BacMam-экспрессированного sRAGE, связываемого с антителом 7F9, и элюирование пептидов, содержащих эпитопы, выявило множество образцов, соответствующих нескольким перекрывающимся пептидам. Деконволюция масс-спектра выявила пептиды с массами 12079,6 Д, 12372,9 Д, 13477,3 Д и 24132,3 Д. Указанные массы соответствуют остаткам Asn105-Arg216, Asn105-Arg218, Asn105-Arg228 и Asn105-Gly331, соответственно, что свидетельствует о том, что минимальный эпитоп охватывает остатки Asn105-Arg216.

Полученные результаты свидетельствуют о том, что антитела 11E6 и 4E5 имеют эпитопы на C-концах как экспрессированного в E. coli, так и BacMam-экспрессированного sRAGE, и что антитело 7F9 узнает эпитоп в центральном домене BacMam-экспрессированного sRAGE.

Пример 9. Измерения Biacore и резонанса поверхностного плазмона

Аффинность трех моноклональных антител согласно настоящему изобретению, т.е. 7F9, 11E6 и 4E5, измеряли, используя Biacore и измерения резонанса поверхностного плазмона.

9.1. Материалы и способы определения кинетики связывания анти-RAGE

Устройство Biacore 2000 использовали для измерения кинетики связывания мышиных анти-RAGE-мАт. Форма анализа аффинности мАт представляла собой основанное на Fc улавливание с помощью иммобилизованных анти-Fc-антител. Стандартный протокол связывания аминов использовали для иммобилизации Fc-специфичного IgG посредством первичных аминов на содержащей карбоксиметил-(CM)декстран поверхности сенсорных чипов CM5 (Biacore). Для исследования мышиных анти-RAGE-мАт антитело против Fc мыши (Biacore, антимышиный, BR-1005-14) использовали в качестве иммобилизованного улавливающего реагента. Автоматизированный протокол, доступный при использовании Biacore 2000, применяли для иммобилизации 8000-10000 условных единиц улавливающего реагента во всех 4 проточных ячейках сенсорного чипа. Коротко поверхности CM-декстрана активировали свежеприготовленной смесью 1:1 50 мМ N-гидроксисукцинимид (NHS):200 мМ 3-(N,N-диметиламино)пропил-N-этилкарбодиимид (EDC). Затем улавливающий анти-Fc IgG-реагент (20 мкг/мл в 10 мМ ацетате натрия, pH 4,5) наносили на поверхность с последующей дезактивацией поверхности и блокированием оставшихся химически активных участков 1 М этаноламином (pH 8,5).

Рабочий буфер HBS-EP+[10 мМ HEPES, pH 7,4, 150 мМ NaCl, 3 мМ EDTA, 0,05% поверхностно-активное вещество P20 (Biacore)] использовали для мышиных анти-RAGE-мАт. Каждый экспериментальный цикл состоял из следующих стадий: 1) анти-RAGE-мАт улавливали в проточных ячейках 2, 3 или 4 до уровня 50-200 условных единиц (в зависимости от антигена). Все измерения сравнивали с эталонной проточной ячейкой 1, на которой не улавливали анти-RAGE-мАт. 2) Антиген инъецировали через все 4 проточные ячейки по 180 мкл со скоростью 60 мкл/мин. После инъекции антигена наблюдали диссоциацию в течение 600 секунд при 60 мкл/мин. 3) Анти-Fc-улавливающую поверхность регенерировали глицином с низким значением pH. Для кинетических определений инъекции RAGE осуществляли, используя 2-кратные серийные разведения от 20 нМ до 0,31 нМ и только буфер в рандомизированных повторах.

9.2. Оценка и результаты

Данные обрабатывали, используя компьютерную программу для оценки Biacore. Коротко, данные дважды корректировали, во-первых, вычитая сигнал от эталонной ячейки, и, во-вторых, вычитая сигнал, полученный при инъекциях только одного буфера. Затем дважды скорректированные данные для серии инъекций RAGE подвергали глобальной подгонке к модели связывания 1:1 (Ленгмюра), которая включала компонент переноса массы, чтобы определить кинетические константы скорости связывания, ka и kd, и аффинность, KD.

В таблице 7 показано, что 4E5 не связывалось с мышиным RAGE (Mu-RAGE). 11E6 и 4E5 перекрестно конкурировали друг с другом за связывание с RAGE. 7F9 не связывается с RAGE, продуцируемым в E. coli, где отсутствует гликозилирование.

В таблице 7 также показаны специфичные эпитопы, с которыми три антитела согласно настоящему изобретению связываются при связывании RAGE человека, полученные в результате картирования эпитопов с использованием защиты sRAGE человека от протеолитического расщепления и идентификации защищенных пептидов с помощью масс-спектрометрии. мАт 7F9 связывалось с C1 (Asn105-Pro215); мАт 4E5 связывалось с C2 (Val229-Thr340 в RAGE E. coli; Val229-Gly331 в husRAGE, продуцированном в клетках млекопитающих), и 11E6 связывался с C2 (Val238-Arg314 в RAGE E. coli; Val229-Gly331 в husRAGE, продуцированном в клетках млекопитающих).

Пример 10. Исследования церебрального объема крови (CBV) in vivo у самок мышей C57BL/6

10.1. Животные

Самок мышей C57BL/6 (4-6-месячного возраста; Taconic, Germantown, N.Y., USA) содержали в стандартной стерильной подстилке из древесных стружек в тихом помещении в условиях цикла: 12 часов освещение включено/12 часов освещение выключено (в 06:00), при этом корм и вода были в неограниченном доступе. Всего использовали 33 мыши в исследованиях fMRI-CBV. Все исследования были одобрены и находились под непосредственным контролем комитета по институциональному уходу за животными и их использованию Abbott, который соблюдает инструкции Национального института здоровья в отношении рекомендаций по уходу и использованию лабораторных животных в учреждениях, аккредитованных Ассоциацией по аттестации и аккредитации ухода за лабораторными животными.

10.2. Получение растворимого Aβ-пептида

Aβ1-40 (чистота >99%) синтезировали в Abbott Laboratories. Коротко, E. coli. BL21(DE3) индуцировали, используя 1 мМ IPTG, и экспрессировали в течение 3 часов при 41°C в ферментере объемом 18 л. Собирали 185 грамм клеточной массы. Пептид экспрессировали в виде телец включения. Клетки лизировали в 0,1 М трис-буфере, содержащем 0,1% тритон X100. Затем осадок промывали 3 раза 50 мМ трис-буфером и один раз водой. Промывные воды отбрасывали, а конечный осадок ресуспендировали в воде и подвергали лиофилизации. Лиофилизированный осадок экстрагировали, используя 500 мл ДМСО, и разбавляли до 1 л 0,2% аммиаком в воде. Полученный образец объемом 1 л диализовали против 19 л 10% этанола, содержащего 0,1% аммиак. Диализ продолжали, используя только 0,1% аммиак в воде в течение общего периода времени, составляющего 5 часов, при комнатной температуре. Образец объемом 1,4 л разбавляли 0,1% раствором аммиака до 2 л и наносили на колонку для ВЭЖХ PLRP-S размером 2,5×25 см (Polymer Labs, Amherst, Mass.), уравновешенную 0,1% раствором аммиака в воде. Элюирование осуществляли ацетонитрилом, содержащим 0,1% аммиака. Aβ1-40 элюировался при использовании градиента от 10 до 30% B в течение 200 минут. Объединенный материал подвергали лиофилизации. Анализ MALDI использовали для подтверждения идентичности и чистоты вещества. Вещество очищали в виде Aβ Met-1-40, меченого N15. Небольшое количество метионинсульфоксида присутствовало в образце при +16 единицах массы. 138 мг очищали за один такой проход в виде аммонийной соли пептида. Обратную последовательность, Aβ40-1 (чистота >99%) приобретали из Sigma Chemical Co. (St. Louis, Mo., USA). Пептиды Aβ (0,01 или 0,1 мг) по отдельности растворяли в свежем фосфатно-солевом буфере (0,1 мл; PBS) непосредственно перед каждым экспериментом fMRI-CBV. Для начальных исследований мышей случайным образом распределяли на пять групп обработки: контроль PBS, Aβ1-40 (0,01 или 0,1 мг/мышь) или Aβ40-1 (0,01 или 0,1 мг/мышь) по пять животных в каждой группе.

10.3. Получение антител

Антитело для негативного контроля IgG и анти-RAGE-антитело 11E6 (оба антитела с чистотой >99%) синтезировали в Abbott Laboratories.

10.4. Измерение CBV с использованием fMRI

Все эксперименты fMRI осуществляли, используя горизонтальный магнит 7,0 Т/21 см с внесением градиента магнитного поля 20 гаусс/см (Biospec Bruker, Billerica, Mass.). Животных сначала анестезировали медитомидином (1 мг/кг, внутрибрюшинно; Pfizer Animal Health, Exton, Pa., USA) + кетамином (75 мг/кг, внутрибрюшинно; Fort Dodge Animal Health, Iowa, USA) и затем помещали в небольшой бокс для фиксирования животных с двумя катушками (Insight Neuroimaging Systems, LLC, Worcester, Mass.), включая объемную катушку для передачи и поверхностную катушку для приема. Частоту дыхания и форму сигнала непрерывно контролировали с помощью датчика усилия. Ректальную температуру контролировали и поддерживали на уровне 37±1°C с помощью подушки с циркулирующей водой, регулируемой по принципу обратной связи. Всю визуализацию осуществляли во время фазы освещения. Электромагнитное взаимодействие между катушками активно прерывали. Анатомические изображения получали, используя последовательность импульсов RARE (быстрое спин-эхо, быстрое получение изображений с усиленной релаксацией) с TR=3 сек, эффективным TE=100 мсек, матрицей =256×256, FOV=2,56 см × 2,56 см, девятью срезами 1,0 мм и четырьмя усреднениями. Градиентное эхо, пошаговую эхо-планарную визуализацию (EPI) использовали для получения изображения fMRI-CBV с TR=2 сек, TE=13 мсек, матрицей =64×64, FOV=2,56 см × 2,56 см, и получая разрешение в плоскости =400 мкм × 400 мкм. Контрастное средство в виде сверхмалых частиц супермагнитного оксида железа (USPIO) 10 мг Fe/кг (SH U555C, Schering AG, Germany) вводили внутривенно 2 минуты из 18 минут получения изображения. Растворимый Aβ и PBS вводили в хвостовую вену через 6 минут после контрастного средства, используя шприцевой насос (0,1 мл/мин в течение 1 мин), и затем выявляли изменения CBV на протяжении последующего 10-минутного периода. Контрольное IgG1-антитело или 11E6 вводили мышам внутрибрюшинно в клетках, где их содержали за 3 часа до начала исследований по визуализации.

10.5. Анализ данных fMRI

Анализ данных осуществляли, используя пакет компьютерных программ для анализа функциональных нейроизображений (AFNI) (Cox R.W., Comput. Biomed. Res. 29: 162-173, 1996). Чтобы идентифицировать зависимое от времени относительное изменение CBV, rCBV(t) вычисляли, используя необработанные данные, полученные в течение определенного периода времени, на основании зависимости (Mandeville et al., 1999),

уравнение 1

где s(t) означает интенсивность сигнала после инфузии Aβ или PBS, S0(t) означает сигнал исходного уровня перед инфузией Aβ или PBS, и Spre означает интенсивность сигнала перед введением контрастного средства. В отношении изменения rCBV с течением времени исключали тренд с использованием линейной функции, учитывая элиминацию контрастного средства из крови (Cox, 1996).

Затем сигнал rCBV для каждого воксела в случае каждой мыши подгоняли к нелинейной дифференциальной экспоненциальной модели (уравнение 2), отражающей кинетику лекарственного средства (Luo et al., 2004), где t0 означает временную задержку ответа, k означает мультипликативный коэффициент, α1 означает скорость элиминации, а α2 - скорость всасывания.

уравнение 2

Начальные значения, подходящие к параметрам t0, k, α1 и α2, составляли 0-45 секунд, -500-500, 0-0,15 и 0,15-0,5, соответственно, на основании известной кинетики Aβ (Shiiki et al., J. Neurosci. 24: 9632-9637, 2004). Конечные значения для t0, k, α1 и α2 определяли автоматически, используя AFNI, на основании максимальной значимости подгонки к модели. Затем определяли активированные вокселы rCBV при p<0,05 после поправки Бонферрони.

Результаты, показанные на фиг. 8, свидетельствуют, что Aβ1-40 уменьшал CBV зависимым от дозы и специфичным для области образом (0,01 мг на фиг. 8a и 0,1 мг на фиг. 8b). Степень уменьшения CBV была значимо выше, когда мышей обрабатывали высокой дозой (фиг. 8b) по сравнению с более низкой дозой (фиг. 8a) Aβ1-40, хотя были затронуты сходные области головного мозга (например, лобная кора, хвостатое ядро, таламус, гиппокамп). В отличие от зависимого от дозы влияния Aβ1-40 обратный пептид, Aβ40-1, значимо не влиял на CBV при тестировали в таких же дозах (0,01 мг на фиг. 8c и 0,1 мг на фиг. 8d), и наблюдаемая степень уменьшения CBV значимо не отличалась от обработанной PBS контрольной группы (PBS, фиг. 8e). В течение 12-минутного периода времени амплитуда уменьшения CBV, индуцированного Aβ1-40, которая была в диапазоне 10-20% для затронутых вокселей в нескольких областях головного мозга, одинаковым образом достигала максимума в течение 5 минут после введения, оставалась пониженной в течение исследования (типичные данные показаны для гиппокампа на фиг. 8f) и была сходной при обеих дозах Aβ1-40. Полученные данные согласуются с дополнительным исследованием, проведенным с использованием инвазивного способа лазерной доплеровской проточной флоуметрии (не показано).

Чтобы проверить влияние 11E6 на CBV с использованием fMRI, сначала оценивали эффекты предварительного введения контрольного IgG1-антитела. Как и ожидалось, предварительное введение IgG1-антитела за 3 часа до начала визуализации, не блокировало влияние стимуляции с использованием Aβ1-40 (0,01 мг на фиг. 9a). Напротив, 11E6 в дозе 0,1 мг/мышь, вводимое за 3 часа до начала визуализации, полностью блокировало уменьшение CBV, обычно вызываемое стимуляцией Aβ1-40 (0,1 мг на фиг. 9b). Подобным образом, уменьшение амплитуды CBV также было устранено в результате предварительной обработки анти-RAGE-антителом 11E6, но не контрольным антителом (фиг. 9c). Полученные данные демонстрируют функциональную активность in vivo антитела 11E6 в животной модели, соответствующей болезни Альцгеймера.

Пример 11. Конструирование CDR-привитых антител

Применяя стандартные способы, хорошо известные в данной области, CDR-последовательности цепей VH и VL моноклонального антитела 11E6 (смотри таблицу 4 выше) прививали в разные акцепторные последовательности тяжелой и легкой цепи человека. На основания выравниваний последовательностей VH и VL с последовательностями VH и VL моноклонального антитела 11E6 согласно настоящему изобретению отобраны следующие известные последовательности человека:

a) VH7-4.1 и VH1-2, а также связывающие последовательности hJH6 для конструирования акцепторных последовательностей тяжелой цепи (согласно таблице 2 выше);

b) 1-12/L5 и 3-15/L2, а также hJK2 для конструирования акцепторных последовательностей легкой цепи (согласно таблице 3 выше).

Благодаря прививке соответствующих CDR VH и VL антитела 11E6 в указанные акцепторные последовательности получили следующие CDR-привитые гуманизированные модифицированные последовательности VH и VL (смотри также таблицу 5, выше): VH 11E6.1-GL, VH 11E6.2-GL, VL 11E6.1-GL и VL 11E6.2-GL.

Пример 12. Конструирование обратных мутаций каркаса в CDR-привитых антителах

Чтобы создать мутации каркаса гуманизированного антитела, мутации вводили в CDR-привитые антитела, используя синтез de novo вариабельных доменов и/или мутагенные праймеры и ПЦР, способами, хорошо известными в данной области. Различные сочетания обратных мутаций и других мутаций конструировали для каждой CDR-прививаемых областей следующим образом.

В случае тяжелой цепи VH 11E6.1-GL один или несколько из следующих остатков верниера и остатков области контакта VH/VL подвергали обратным мутациям следующим образом: V2→I и/или Y95→F.

В случае тяжелой цепи VH 11E6.2-GL один или несколько из следующих остатков верниера и остатков области контакта VH/VL подвергали обратным мутациям следующим образом: V2→I, V68→F, M70→F, R72→L, Y95→F.

В случае легкой цепи VL 11E6.1-GL один или несколько из следующих остатков верниера и остатков области контакта VH/VL подвергали обратным мутациям следующим образом: A43→S, Y49→F, Y87→F.

В случае легкой цепи VL 1E6.2-GL один или несколько из следующих остатков верниера и остатков области контакта VH/VL подвергали обратным мутациям следующим образом: A43→S, Y49→F, I58→V, Y87→F.

Дополнительные мутации включают следующие мутации:

для тяжелой цепи

VH 11E6.1-GL, Q1→E, и для

VH 11E6.2-GL, Q1→E, 176→T, R85→S, D89→E;

для легкой цепи

VL 11E6.1-GL, V11→L, и

VL 11E6.2-GL, V13→L, E70→D.

Пример 13. Конструирование и экспрессия рекомбинантных гуманизированных анти-RAGE-антител

Экспрессирующие векторы pHybE, несущие тяжелые и легкие цепи, содержащие обратные мутации в каркасе, совместно трансфицировали в клетки 293-6E для временной продукции полноразмерных гуманизированных антител. Мутации вводили в последовательности CDR-привитых антител, которые получены согласно примеру 11, путем синтеза de novo вариабельного домена и/или с использованием мутагенных праймеров и ПЦР способами, хорошо известными в данной области. Аминокислотные последовательности областей VH и VL гуманизированных антител описаны в таблице 8.

В частности, в случае тяжелых цепей:

VH h11E6.1, VH h11E6.2, VH h11E6.3 и VH h11E6.4 содержат VH 11E6.1-GL с мутацией Q1→E.

VH h11E6.5, VH h11E6.6, VH h11E6.7 и VH h11E6.8 содержат VH 11E6.1-GL с мутацией Q1→E и следующими обратными мутациями остатков верниер-зоны и остатков области контакта VH/VL: V2→I и Y95→F.

VH h11E6.9, VH h11E6.110, VH h11E6.11 и VH h11E6.12 содержат VH 11E6.2-GL с мутацией Q1→E, I76→T, R85→S и D89→E.

VH h11E6.13, VH h11E6.14, VH h11E6.15 и VH h11E6.16 содержат VH 11E6.2-GL с мутацией Q1→E, I76→T, R85→S, D89→E и следующими обратными мутациями остатков верниер-зоны и остатков области контакта VH/VL: V2→I, V68→F, M70→F, R72→L и Y95→F.

В случае легких цепей:

VL h11E6.1, VL h11E6.5, VL h11E6.9 и VL h11E6.13 содержат VL 11E6.1-GL с мутацией V11→L.

VL h11E6.2, VL h11E6.6, VL h11E6.10 и VL h11E6.14 содержат VL 11E6.1-GL с мутацией V11→L и следующими обратными мутациями остатков верниер-зоны и остатков области контакта VH/VL: A43→S, Y49→F и Y87→F.

VL h11E6.3, VL h11E6.7, VL h11E6.11 и VL h11E6.15 содержат VL 11E6.2-GL с мутациями V13→L и E70→D.

VL h11E6.4, VL h11E6.8, VL h11E6.12 и VL h11E6.16 содержат VL 11E6.2-GL с мутациями V13→L и E70→D и следующими обратными мутациями остатков верниер-зоны и остатков области контакта VH/VL: A43→S, Y49→F, I58→V и V87→F.

Пример 14. Характеристика гуманизированных антител 11E6 с использованием конкурентного ELISA

Планшеты для ELISA (Costar 3369) покрывали в течение ночи при 4°C, используя 50 мкл/лунку раствора, содержащего 2 мкг/мл hRAGE (1-331) в 0,2 М буфере на основе карбоната-бикарбоната натрия, pH 9,4, промывали буфером для промывки (PBS, содержащий 0,1% твин 20) и блокировали в течение 1 часа при комнатной температуре, используя 200 мкл/лунку 2% обезжиренного сухого молока в PBS. После промывки буфером для промывки добавляли в двух повторах смесь биотинилированного m11E6 (конечная концентрация 0,3 мкг/мл) и меченного конкурентного тестируемого антитела (начиная с конечной концентрации 81 мкг/мл и серийно разбавляемого в 3 раза) по 50 мкл/лунку в буфере ELISA. После инкубации планшетов в течение 1 часа при комнатной температуре и промывки буфером для промывки связанные антитела выявляли, используя 100 мкл/лунку конъюгированного с HRP стрептавидина (Fitzgerald) в разведении 1:10000 в буфере для ELISA. После инкубации в течение 1 часа при комнатной температуре и промывки буфером для промывки развития окраски достигали при добавлении 100 мкл/лунку буфера TMB (Zymed). После инкубации в течение 15 минут при комнатной температуре развитие окраски останавливали добавлением 50 мкл/лунку 1N хлористоводородной кислоты. Регистрировали оптическую плотность при 490 нм. В таблице 9 показаны значения IC50 для гуманизированных антител 11E6, полученные с использованием компьютерной программы GraphPad Prism (GraphPad Software Inc., San Diego, Calif.).

Пример 15. Определение констант связывания для взаимодействия анти-RAGE-мАт с RAGE

Устройства Biacore 2000 и Biacore T100 использовали для измерения кинетики связывания анти-RAGE-мАт. Форма анализа аффинности мАт представляла собой основанное на Fc улавливание с помощью иммобилизованных анти-Fc-антител. Стандартный протокол связывания аминов использовали для иммобилизации Fc-специфичного IgG посредством первичных аминов на содержащей карбоксиметил-(CM)-декстран поверхности сенсорных чипов CM5 (Biacore). Для исследования мышиных анти-RAGE-мАт антитело против Fc мыши (Biacore, антимышиный, BR-1005-14) использовали в качестве иммобилизованного улавливающего реагента, а для исследования гуманизированных анти-RAGE-мАт в качестве иммобилизованного улавливающего реагента использовали антитело против Fc человека (Pierce 31125). Автоматизированный протокол, доступный при использовании Biacore 2000 и Biacore T100, применяли для иммобилизации 8000-10000 условных единиц улавливающего реагента во всех 4 проточных ячейках сенсорного чипа. Коротко поверхности CM-декстрана активировали свежеприготовленной смесью 1:1 50 мМ N-гидроксисукцинимид (NHS):200 мМ 3-(N,N-диметиламино)пропил-N-этилкарбодиимид (EDC). Затем улавливающий анти-Fc IgG-реагент (20 мкг/мл в 10 мМ ацетате натрия, pH 4,5) наносили на поверхность с последующей дезактивацией поверхности и блокированием оставшихся химически активных участков 1 М этаноламином (pH 8,5).

Рабочий буфер PBS-P [1Х PBS (Sigma P3813), pH 7,4, 0,005% поверхностно-активного вещества P20 (Biacore)] использовали для гуманизированных антител. Каждый экспериментальный цикл состоял из следующих стадий: 1) анти-RAGE-мАт улавливали в проточных ячейках 2, 3 или 4 до уровня 50-200 условных единиц (в зависимости от антигена). Все измерения сравнивали с эталонной проточной ячейкой 1, на которой не улавливали анти-RAGE-мАт. 2) Антиген инъецировали через все 4 проточные ячейки по 240 мкл со скоростью 80 мкл/мин. После инъекции антигена наблюдали диссоциацию в течение 600 секунд при 80 мкл/мин. 3) Анти-Fc-улавливающую поверхность регенерировали глицином с низким значением pH. Для кинетических определений инъекции антигена осуществляли, используя 3-кратные серийные разведения от 30 нМ до 0,12 нМ (для sRAGE [RAGE (1-331)] и только буфер в рандомизированных повторах.

Данные обрабатывали, используя компьютерную программу для оценки Biacore или компьютерную программу Scrubber 2.0 (BioLogic Software). Коротко, данные дважды корректировали, во-первых, вычитая сигнал от эталонной ячейки, и, во-вторых, вычитая сигнал, полученный при инъекциях только одного буфера. Затем дважды скорректированные данные для серии инъекций RAGE подвергали глобальной подгонке к модели связывания 1:1 (Ленгмюра), которая включала компонент переноса массы, чтобы определить кинетические константы скорости связывания, ka и kd, и аффинность, KD (ka=kon; kd=koff).

Значения KD представляли собой двузначные числа в пМ для всех трех мАт, и, по-видимому, не было значимого различия между тремя мАт в отношении их кинетики связывания. В параллельном эксперименте оценивали исходное мышиное мАт 11E6 с использованием данного антигена (sRAGE 1-331 человека, V №400), и также получили KD с двузначным значением в пМ.

Ранее сообщалось, что исходное мАт мышиное 11E6 имеет значение 290 пМ. Однако в таких ранних экспериментах использовали другую буферную систему (Буфер Biacore HBS-EP+: 10 мМ HEPES, pH 7,4, 150 мМ NaCl, 3 мМ EDTA, 0,05% P20). Выбор буфера, конечно, может влиять на кинетику.

Пример 16. Исследования объема крови в сосудах головного мозга (CBV) in vivo у старых мышей Tg2576

16.1. Животные

В модели болезни Альцгеймера на мышах Tg2576 (Hsiao et al., 1996) экспрессируется мутация Swedish APP (APPK670N,M671L) на высоком уровне под контролем промотора прионного белка хомячка (PrP). Хорошо установлено, что такая мутация вызывает сопутствующее увеличение секретирумого Ab42 и Ab40. По мере старения мышей Tg2576 появляются бляшки, которые сходны с бляшками, наблюдаемыми при болезни Альцгеймера. Кроме того, у мышей Tg2576 развиваются зависимые от возраста поведенческие нарушения, которые оценивают с помощью испытания в Y-лабиринте, T-лабиринте и водном лабиринте Морриса (Hsiao et al. (1996) Correlative memory deficits, Ab elevation, and amyloid plaques in transgenic mice. Science 274: 99-102).

16.2 Получение антител

Негативное контрольное IgG-антитело и анти-RAGE-антитело 11E6 (оба антитела с чистотой >99%) синтезировали в Abbott Laboratories.

16.3. Измерение CBV с использованием fMRI

Эксперименты fMRI-CBV осуществляли, используя горизонтальный магнит 7,0 T/21 см с внесением градиента магнитного поля 20 гаусс/см (Biospec Bruker, Billerica, Mass.). Старых мышей Tg2576 (19-20-месячного возраста) сначала анестезировали медитомидином (1 мг/кг, внутрибрюшинно; Pfizer Animal Health, Exton, Pa., USA) + кетамином (75 мг/кг, внутрибрюшинно; Fort Dodge Animal Health, Iowa, USA) и затем помещали в небольшой бокс для фиксирования животных с двумя катушками (Insight Neuroimaging Systems, LLC, Worcester, Mass.), включая объемную катушку для передачи и поверхностную катушку для приема. Частоту дыхания и форму сигналов непрерывно контролировали с помощью датчика усилия. Ректальную температуру контролировали и поддерживали на уровне 37±1°C с помощью подушки с циркулирующей водой, регулируемой по принципу обратной связи. Всю визуализацию осуществляли во время фазы освещения. Электромагнитное взаимодействие между катушками активно прерывали. Анатомические изображения получали, используя последовательность импульсов RARE (быстрое спин-эхо, быстрое получение изображений с усиленной релаксацией) с TR=3 сек, эффективным TE=100 мсек, матрицей=256×256, FOV=2,56 см × 2,56 см, девятью срезами 1,0 мм и четырьмя усреднениями. Градиентное эхо, пошаговую эхо-планарную визуализацию (EPI) использовали для получения изображения fMRI-CBV с TR=2 сек, TE=13 мсек, матрицей=64×64, FOV=2,56 см × 2,56 см, и получая разрешение в плоскости = 400 мкм × 400 мкм. Контрастное средство в виде сверхмалых частиц супермагнитного оксида железа (USPIO) 10 мг Fe/кг (SH U555C, Schering AG, Germany) вводили внутривенно 2 минуты из 18 минут получения изображения. Мышиное антитело 11E6 или неспецифичный мышиный IgG1 (контрольное антитело) вводили в хвостовую вену через 6 минут после контрастного средства, используя шприцевой насос (0,1 мл/мин в течение 1 мин), и затем выявляли изменения CBV на протяжении последующего 10-минутного периода.

16.4. Анализ данных fMRI

Анализ данных осуществляли, используя пакет компьютерных программ для анализа функциональных нейроизображений (AFNI) (Cox R.W., Comput. Biomed. Res. 29: 162-173, 1996). Чтобы идентифицировать зависимое от времени относительное изменение CBV, rCBV(t) вычисляли, используя необработанные данные, полученные в течение определенного периода времени, на основании зависимости (Mandeville et al., 1999),

уравнение 1

где s(t) означает интенсивность сигнала после инфузии Aβ или PBS, S0(t) означает сигнал исходного уровня перед инфузией Aβ или PBS, и Spre означает интенсивность сигнала перед введением контрастного средства. В отношении изменения rCBV с течением времени исключали тренд с использованием линейной функции, учитывая элиминацию контрастного средства из крови (Cox, 1996).

Затем сигнал rCBV для каждого воксела в случае каждой мыши подгоняли к нелинейной дифференциальной экспоненциальной модели (уравнение 2), отражающей кинетику лекарственного средства (Luo et al., 2004), где t0 означает временную задержку ответа, k означает мультипликативный коэффициент, α1 означает скорость элиминации, а α2 - скорость всасывания.

уравнение 2

Конечные значения для t0, k, α1 и α2 определяли автоматически, используя AFNI, на основании максимальной значимости подгонки к модели. Затем определяли активированные вокселы rCBV при p<0,05 после поправки Бонферрони. Регистрировали активированные вокселы целого головного мозга с увеличением CBV. Так как данные без преобразования не подтверждались с использованием предположений ANOVA, использовали преобразование Бокса-Кокса, чтобы гарантировать приемлемую нормальность и однородность дисперсии. Эффект 11E6 является статистически значимым по сравнению с IgG1 (p<0,05) у мышей TG2576 19-месячного возраста в модели fMRI-CBV.

Результаты показаны на прилагаемой фиг. 10. Полученные авторами данные расширяют результаты, полученные Deane (Deane et al, 2003), показывающие, что поликлональные анти-RAGE-антитела, направленные против множества эпитопов в RAGE, могут усиливать перфузию кровью головного мозга у APP-трансгенных мышей. Полученные авторами данные впервые показывают, что моноклональное антитело 11E6, направленное к C2-домену RAGE, увеличивает перфузию кровью головного мозга у APP-трансгенных мышей. Указанный эффект вероятно опосредован высоким уровнем конкурентного связывания Aβ с RAGE. Высокий уровень Aβ существует в головном мозге и плазме вследствие сверхэкспрессии APP человека. Таким образом, лечение Aβ-пациентов с использованием 11E6 может увеличивать перфузию у таких пациентов, что потенциально приведет к улучшению функций нейронов. Вместе с тем лечение пациентов потенциально можно контролировать посредством слежения за мозговым кровообращением во время лечения.

Пример 17. Защита нейронов гиппокампа от индуцированного Aβ расщепления динамина антителом 11E6

17.1. Культура нейронов гиппокампа

Нейроны гиппокампа крыс готовили согласно инструкциям, имеющимся в литературе (Goslin and Banker. (1991) Rat Hippocampal Neurons in Low-Density Culture. In: Banker G and Goslin K (ed). Culturing Nerve Cells, MIT Press, Cambridge) с небольшой модификацией. Коротко, гиппокампы 19-дневных эмбрионов крыс вырезали и освобождали от оболочек. Нейроны гиппокампа получали трипсинизацией ткани (0,1% трипсин/17-20 мин/37°C) с последующим растиранием с помощью оплавленных пипеток Пастера. Нейроны гиппокампа высевали при плотности 0,2-1,0×105 клеток в покрытые поли-D-лизином 6-луночные или 24-луночные планшеты (планшет BiocoatTM; BD Biosciences, Heidelberg, Germany), используя 0,5-3 мл бессывороточной культуральной среды (нейробазальная среда, добавка B27, 2 мМ L-глутамин; 1% пенициллин-стрептомицин; Invitrogen, Karlsruhe, Germany). Клетки культивировали при 37°C, 5% CO2 в течение, по меньшей мере, 21 дня, и одну треть среды заменяли раз в неделю.

17.2. Индуцированное Aβ расщепление динамина

Aβ подвергали агрегации согласно инструкциям, описанным в литературе (Kelly, B. L., and Ferreira, A. (2006) J. Biol. Chem. 281(38), 28079-28089; Kelly, B. L., Vassar, R., and Ferreira, A. (2005) J. Biol. Chem. 280(36), 31746-31753) с небольшими модификациями. Коротко, Aβ1-40 (American Peptide, Sunnyvale, Calif.) растворяли в бессывороточной культуральной среде в концентрации 0,1 мг/мл и инкубировали в течение 4 суток при 37°C. Моноклональное анти-RAGE-антитело 11E6, моноклональное антитело для контроля изотипа IgG1, направленное против KLH (гемоцианин морского блюдечка Megathura crenulata, Abbott) или PBS инкубировали с агрегированным Aβ в течение 1 часа при 25°C при постоянном встряхивании в конечном объеме 225 мкл-1 мл. Смеси добавляли к культуральной среде до конечной концентрации 5 мкМ Aβ (в расчете на мономер) и 2 мкМ антитела, соответственно. Каждую обработку осуществляли в трех повторах и в качестве дополнительных контролей включали лунки без добавления Aβ или антител. Клетки культивировали еще в течение 24 часов и быстро проверяли под световым микроскопом перед обработкой для Вестерн-блота. Обработка Aβ не индуцировала явной гибели нейронов во время периода инкубации.

17.3. Вестер-блот, количественная оценка расщепления динамина и статистический анализ

Культуральную среду удаляли и клетки промывали один раз PBS. Клетки лизировали добавлением холодного буфера (50 мМ трис-HCl pH 7,5; 150 мМ NaCl; 1% NP-40; 1% тритон X-100; 2 мМ EDTA), содержащего смесь ингибиторов протеаз и фосфатаз (Roche, Mannheim, Germany). Клетки соскабливали и гомогенат центрифугировали при 13000 g при 4°C в течение 5 минут. Надосадок удаляли и определяли концентрацию общего белка способом Бредфорда, используя коммерческий набор (Bio-Rad, Muinchen, Germany). Белок разбавляли до 1 мкг/мкл в буфере для загрузки (Bio-Rad, Muinchen, Germany) и кипятили в течение 5 минут. 25 мкг каждого образца разгоняли в 4-20% SDS-ПААГ (Invitrogen, Karlsruhe, Germany) и переносили на нитроцеллюлозные мембраны, используя систему iBlot (Invitrogen, Karlsruhe, Germany). Альтернативно клетки лизировали непосредственно в 96-луночных планшетах, разбавляли буфером для загрузки и от 1/4 до 1/5 белка наносили на SDS-ПААГ. Мембраны блокировали при комнатной температуре в течение 1-2 часов, используя 1 x блокирующий реагент (Roche, Mannheim, Germany), и затем инкубировали с первым антителом против динамина I (PA-1-660; разведение 1:1000; Affinity BioReagents, Golden, Co) при 4°C в течение ночи. Затем на блоты наносили конъюгированное с пероксидазой хрена второе антитело (антитело козы против IgG кролика, Jackson ImmunoResearch, West Grove, Pa.) при комнатной температуре в течение 1 часа и осуществляли регистрацию, используя усиленную хемилюминесценцию (хемилюминесцентный субстрат SuperSignal West Pico; Pierce, Rockford, Ill.). Сигналы на иммуноблотах визуализировали с помощью системы VersaDoc (Bio-Rad, Muinchen, Germany) и количественно оценивали сигнал интактного динамина I (~100 кД), используя компьютерную программу Quantity One (Bio-Rad, Muinchen, Germany). Для нормализации блоты десорбировали (десорбирующий буфер для регенерации Вестерн-блота; Pierce, Rockford, Il.) в течение 30 минут при 37°C, промывали в PBS и повторно анализировали, используя первое антитело, направленное против тубулина βIII (TuJ-I, разведение 1:1000, Abcam, Cambridge, Mass.), и второе антитело (антитело осла против IgG мыши, Jackson ImmunoResearch, West Grove, Pa.). Среднее значение нормализованной экспрессии динамина I в клетках, не обработанных Aβ, принимали за 100%. Данные в процентах для трех отдельных экспериментов анализировали в отношении статистической значимости, используя однофакторный ANOVA (критерий Крускала-Уоллиса) с последующим использованием критерия Даннета (GraphPad PrismTM; компьютерная программа GraphPad, San Diego, Calif.).

17.4. Анти-RAGE-антитело 11E6 защищает нейроны гиппокампа от Aβ-индуцированного расщепления динамина

Недавно было показано, что агрегированный Aβ1-40 индуцирует расщепление синаптического маркерного белка динамина I в нейронах гиппокампа (Kelly et al, 2005; Kelly and Ferreira, 2006). В полном соответствии с опубликованными результатами авторы наблюдали заметное уменьшение количества интактного (~100 кД) динамина I после инкубации нейронов гиппокампа с агрегированным Aβ в течение 24 часов и сопутствующее увеличение количества продукта расщепления ~90 кД (фиг. 11, верхняя панель). Предварительная инкубация Aβ с анти-RAGE-антителом 11E6 предотвращала расщепление примерно до 70%. Напротив, не имеющее отношения к RAGE мышиное антитело, используемое в качестве контроля изотипа IgG1, не обеспечивало защиты (фиг. 11, нижняя панель). Денситометрическое сканирование образцов в трех повторах, нормализация количества контрольного белка (тубулин βIII) и анализ данных, полученных в трех независимых экспериментах, выявили статистическую значимость наблюдаемого защитного эффекта (фиг. 11, нижняя панель; однофакторный ANOVA; p<0,05).

Пример 18. Влияние антитела 11E6 на индуцированную глобуломером супрессию синаптической передачи

18.1. Тест A

Органотипические культуры срезов гиппокампа готовили с использованием модифицированного протокола, описанного Stoppini с соавторами (Journal of Neuroscience Methods, 37, Issue 2, April 1991, Pages 173-182 «A simple method for organotypic cultures of nervous tissue» L. Stoppinia, P.A. Buchsa and D. Muller) и культивировали на мембранах millicell-CM (Millipore, Billerica, USA) в среде с высоким содержанием калия в течение 3 суток и затем в нейробазальной среде A с добавками на границе раздела жидкость/газ при 34°C/5% CO2.

Культуры срезов гиппокампа крыс получали от крыс Wistar 9-дневного возраста и использовали на 15-16 сутки in vitro. Культуры срезов инкубировали в течение ночи со следующими добавками:

- 1 мкМ глобуломер 1-42,

- 0,1 мкМ 11E6 (RAGE-мАт ML 39-11E6, очистка №4194, образец №6116) + 1 мкМ глобуломер 1-42,

- контроль (ультрафильтрат глобуломера + SDS).

В группе, в которой использовали совестную инкубацию, антитело вносили в среду для культивирования срезов за 2 часа до глобуломера. Регистрацию осуществляли в камере, регистрирующей границу раздела, в условиях непрерывной перфузии искусственной спинномозговой жидкости. Полевые возбуждающие постсинаптические потенциалы регистрировали в поле CA1 после стимуляции коллатерали Шаффера двухфазными импульсами с разными значениями напряжения. Коллатераль Шаффера стимулировали двухфазными импульсами (0,1 мсек/фазу), используя биполярный вольфрамовый электрод 0,5M (WPI; Saraosta USA), и амплитуды fEPSP регистрировали с использованием стеклянных электродов, заполненных aCSF (0,7-1,1 мегаом, GC150F-15, Harvard Apparatus, Hugstetten, Germany). Сигналы оцифровывали, используя Power CED 1401 (Cambridge Electronic Design Ltd., Cambridge, UK) и анализировали, используя Signal 2.14 (Cambridge Electronic Design Ltd., Cambridge, UK).

Результаты показаны на фиг. 12A. Внесение глобуломера сильно подавляло синаптическую передачу. Одновременное внесение 0,1 мкМ 11E6 полностью отменяло индуцированное глобуломером нарушение. Таким образом, 11E6 может отменять индуцированные глобуломером нарушения синаптической передачи.

18.2. Тест B

Культуры срезов гиппокампа крыс получали от крыс Wistar 9-дневного возраста и использовали на 16-18 сутки in vitro. Культуры срезов инкубировали в течение ночи со следующими добавками:

- 1 мкМ глобуломер 1-42,

- 0,1 мкМ IgG1-мАт H35C206 (KHL) + 1 мкМ глобуломер 1-42,

- контроль (SDS).

Регистрацию осуществляли (в искусственной спинномозговой жидкости) от области CA1 после стимуляции коллатерали Шаффера при разных интенсивностях.

Результаты показаны на фиг. 12B. Внесение глобуломера сильно подавляло синаптическую передачу. Одновременное внесение IgG1 не отменяло индуцированного глобуломером нарушения. Таким образом, контрольное IgG-антитело не отменяет индуцированных глобуломером нарушений синаптической передачи в концентрации 0,1 мкМ.

Пример 19. In situ-анализ влияния антитела 11E6 на амилоидные бляшки в лобной коре мышей Tg2576

Для таких экспериментов использовали мышей Tg2576 14,5-месячного возраста (Hsiao et al., 1996, Science; 274(5284), 99-102). У мышей имеет место сверхэкспрессия APP человека с так называемой Шведской мутацией (K670N/M671L) и образуются амилоидные отложения в паренхиме головного мозга примерно в возрасте 11 месяцев. Начиная с 12-месячного возраста мышам инъецировали 500 мкг 11E6 (n=19) в/б (внутрибрюшинно) или контрольное IgG1-антитело (n=19) один раз в неделю в течение 12 недель. После последней инъекции животных подвергали глубокой анестезии и транскардиально перфузировали 0,1 М фосфатно-солевым буфером (PBS), чтобы промыть кровь. Затем головной мозг извлекали из черепа и разделяли в продольном направлении. Одну полусферу головного мозга подвергали шоковой заморозке, другую фиксировали посредством погружения в 4% параформальдегид. Фиксированную погружением полусферу подвергали криопротекции вымачиванием в 30% сахарозе в PBS и помещали в замораживающий микротом. Целый передний мозг нарезали на срезы толщиной 40 мкм, которые собирали в PBS и помещали на предметные стекла Superfrost® Plus (Menzel Glaeser, Braunschweig, Germany) для последующей процедуры окрашивания. Окрашивание содержащих Aβ амилоидных бляшек осуществляли с использованием мышиного моноклонального антитела 6G1, полученного против мономерного Aβ (Barghom et al., 2005, J. Neurochem.), на автоматическом устройстве для окрашивания (Ventana Discovery®, Roche Diagnostics GmbH, Mannheim, Germany) согласно следующему протоколу:

- срезы на предметных стеклах тщательно сушили на воздухе и переносили в устройство Ventana;

- использовали автоматизированный протокол, предлагаемый Ventana для способа с применением хромогенного диаминобензидина (DAB), который включал в себя стадии промывки и блокирования и окрашивания с помощью набора DAB MapTM; восстановление антигена и первичная и вторичная иммуногистохимия были включены в автоматизированный протокол экспериментатором:

- восстановление антигена получали в присутствии восстановителя № 2 (основанный на цитрате буфер, pH 6,0) при 95°C в течение 45 минут;

- инкубация с 6G1 (1:500) в разбавителе антитела (Roche Diagnostics GmbH, Mannheim, Germany) при 37°C в течение 3 часов;

- инкубация с биотинилированным вторым антителом осла против IgG мыши (1:500; Jackson ImmunoResearch, Newmarket, UK) при 37°C в течение 30 минут;

- после завершения автоматизированного окрашивания срезы промывали в обычной воде, дегидратировали в градиенте этанола с повышающейся концентрацией, просветляли в XTRA-Solve® (J. T. Baker, Griesheim, Germany) и накрывали покровным стеклом с использованием UltraKitt® (J. T. Baker, Griesheim, Germany).

Окрашивание бляшек количественно оценивали на 3 гистологических срезах неокортекса, используя систему анализа изображений ImagePro 5.0. Экспериментатор проводил исследование вслепую в отношении обработки мыши в ходе анализа и определял следующие параметры: площадь неокортекса, площадь, покрытую позитивным окрашиванием 6G1, и количество окрашенных бляшек. Указанные параметры были переменными и не имели нормального распределения. Поэтому уменьшение нагрузки в виде бляшек оценивали статистически с использованием одностороннего U-критерия Манна-Уитни. Результаты окрашивании отложений Aβ у мышей Tg2576 показаны на фиг. 13.

Оценка коричневых отложений DAB показала, что анти-RAGE-антитело уменьшало количество и площадь амилоидных бляшек в неокортексе на 24,5% и 26,8%, соответственно (p<0,1). Уменьшение количества и площади бляшек было наиболее очевидным во фронтальном неокортексе (p<0,05).

Документы, упоминаемые в настоящем описании, включены в виде ссылки.

1. Выделенное моноклональное антитело, способное связывать эпитоп молекулы RAGE человека, содержащее набор из трех последовательностей CDR тяжелой цепи CDR-H1, CDR-H2 и CDR-H3, и трех последовательностей CDR легкой цепи CDR-L1, CDR-L2 и CDR-L3, который выбран из группы, состоящей из:

набор 7F9
CDR-H1 остатки 31-35 последовательности SEQ ID NO: 1 SEQ ID NO: 2
CDR-H2 остатки 50-68 последовательности SEQ ID NO: 1 SEQ ID NO: 3
CDR-H3 остатки 101-108последовательности SEQ ID NO: 1 SEQ ID NO: 4
CDR-L1 остатки 24-34 последовательности SEQ ID NO: 5 SEQ ID NO: 6
CDR-L2 остатки 50-56 последовательности SEQ ID NO: 5 SEQ ID NO: 7
CDR-L3 остатки 89-97 последовательности SEQ ID NO: 5 SEQ ID NO: 8
набор 11E6
CDR-H1 остатки 31-35 последовательности SEQ ID NO: 9 SEQ ID NO: 10
CDR-H2 остатки 50-66 последовательности SEQ ID NO: 9 SEQ ID NO: 11
CDR-H3 остатки 99-109 последовательности SEQ ID NO: 9 SEQ ID NO: 12
CDR-L1 остатки 24-34 последовательности SEQ ID NO: 13 SEQ ID NO: 14
CDR-L2 остатки 50-56 последовательности SEQ ID NO: 13 SEQ ID NO: 15
CDR-L3 остатки 89-97 последовательности SEQ ID NO: 13 SEQ ID NO: 16
набор 4Е5
CDR-H1 остатки 31-35 последовательности SEQ ID NO: 17 SEQ ID NO: 18
CDR-H2 остатки 50-66 последовательности SEQ ID NO: 17 SEQ ID NO: 19
CDR-H3 остатки 99-109 последовательности SEQ ID NO: 17 SEQ ID NO: 20
CDR-L1 остатки 24-34 последовательности SEQ ID NO: 21 SEQ ID NO:22
CDR-L2 остатки 50-56 последовательности SEQ ID NO: 21 SEQ ID NO: 23
CDR-L3 остатки 89-97 последовательности SEQ ID NO: 21 SEQ ID NO: 24

2. Антитело по п. 1, дополнительно содержащее акцепторный каркас человека.

3. Антитело по п. 1, содержащее вариабельный домен тяжелой цепи, выбранный из последовательностей SEQ ID NO: 56 и 57, и один вариабельный домен легкой цепи, выбранный из последовательностей SEQ ID NO: 58 и 59.

4. Антитело по п. 3, содержащее, по меньшей мере, одну мутацию в каркасе, выбранную из группы, состоящей из:
(положения последовательности тяжелой цепи): 1, 2, 68, 70, 72, 76, 85, 89, 95;
(положения последовательности легкой цепи): 11, 13, 43, 49, 58, 70, 87.

5. Антитело по п. 1, содержащее один вариабельный домен (с мутацией в каркасе), имеющий аминокислотную последовательность, выбранную из группы, состоящей из:
(последовательностей тяжелой цепи) SEQ ID NO: 62, 67, 68 и 69;
(последовательностей легкой цепи) SEQ ID NO: 63, 64, 65 и 66.

6. Выделенная нуклеиновая кислота, кодирующая аминокислотную последовательность антитела по любому из пп. 1-5.

7. Вектор экспрессии, содержащий выделенную нуклеиновую кислоту по п. 6.

8. Клетка-хозяин для экспрессии, содержащая вектор по п. 7, где указанная клетка-хозяин не является эмбриональной клеткой человека.

9. Способ получения антитела по любому из пп. 1-5, включающий
(i) культивирование клетки-хозяина по п. 8 в культуральной среде в условиях, достаточных для продуцуирования антитела; и
(ii) выделение антитела из указанной культуральной среды.

10. Антитело, способное связывать эпитоп молекулы RAGE человека, полученное способом по п. 9.

11. Фармацевтическая композиция с длительным высвобождением для лечения или профилактики состояний, ассоциированных с рецептором конечных продуктов глубокого гликирования (RAGE), содержащая
(a) антитело по любому из пп. 1-5 в кристаллизованной форме; и,
(b) по меньшей мере, один полимерный носитель.

12. Фармацевтическая композиция для лечения или профилактики состояний, ассоциированных с рецептором конечных продуктов глубокого гликирования (RAGE), содержащая эффективное количество антитела по любому из пп. 1-5 и фармацевтически приемлемый носитель.

13. Способ лечения млекопитающего, имеющего состояние, ассоциированное с рецептором конечных продуктов глубокого гликирования (RAGE), включающий стадию введения млекопитающему эффективного количества композиции по п. 11 или 12.

14. Способ по п. 13, где способ предназначен для лечения сепсиса или неврологических заболеваний, выбранных из группы, включающей боковой амиотрофический склероз, повреждение плечевого сплетения, повреждение головного мозга, включая травматическое повреждение головного мозга, церебральный паралич, атаксию Фридриха, синдром Гийена-Барре, лейкодистрофию, рассеянный склероз, постполиомиелитный синдром, расщепление позвоночника, повреждение спинного мозга, спинальную мышечную атрофию, опухоль спинного мозга, инсульт, поперечный миелит, деменцию, сенильную деменцию, умеренное когнитивное нарушение, деменцию, связанную с болезнью Альцгеймера, хорею Хантингтона, позднюю дискинезию, гиперкинезию, манию, болезнь Паркинсона, синдром Стила-Ричарда, синдром Дауна, бульбоспинальный паралич, травму нервов, васкулярный амилоидоз, церебральную геморрагию I с амилоидозом, воспаление головного мозга, атаксию Фридриха, острую спутанность сознания, амиотрофический боковой склероз, глаукому, болезнь Альцгеймера, диабетическую нефропатию, ревматоидный артрит и родственные воспалительные заболевания.

15. Способ по п. 13, где способ представляет собой способ лечения болезни Альцгеймера.

16. Способ по п. 15, в котором композиция содержит антитело, имеющее набор CDR 11E6.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой выделенную полинуклеотидную молекулу с функцией rEVE, рекомбинантный вектор экспрессии, экспрессионный шаттл-вектор, клетку-хозяина, а также способы с использованием вышеуказанной выделенной полинуклеотидной молекулы.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложено IL-1β-связывающее антитело или его IL-1β-связывающий фрагмент, включающее вариабельную область тяжелой цепи и легкой цепи.

Изобретение относится к области биохимии, в частности к антителам, которые специфично связываются с рецепторами эпидермального фактора роста (EGFR), а также к ДНК, которые кодируют вариабельные области тяжелой цепи указанных антител, ДНК, которые кодируют вариабельные области легкой цепи указанных антител.

Изобретение относится к области биотехнологии и касается изолированного полипептида, фармацевтической композиции, включающей такой полипептид, а также способа лечения рака.

Синтез нмо // 2517602
Изобретение относится к биотехнологии, в частности к бактериальной клетке, стабильно культивируемой в среде, где клетка адаптирована для продукции олигосахаридов.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты выделенного моноклонального антитела, специфичного к hGM-CSF, где каждый вариант характеризуется тяжелой и легкой цепью.

Настоящее изобретение относится к области биотехнологии и медицины. Предложен способ создания антитела и его функциональных фрагментов, направленных против опухолевого антигена, экспрессируемого на поверхности опухоли, устойчивой по меньшей мере к одному противоопухолевому соединению, основанный на применении для иммунизации измельченного гомогената, и/или суспензии, и/или клеточного лизата, происходящих из такой опухоли.

Предлагаемое изобретение относится к области биологии и химии и касается выделенной нуклеиновой кислоты, кодирующей флуоресцентный белок со свойствами биосенсора, кассеты экспрессии, обеспечивающей экспрессию такого флуоресцентного белка, клетки, продуцирующей такой белок, и непосредственно флуоресцентного белка со свойствами биосенсора.

Изобретение относится к области биотехнологии. Описана молекула химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), которая включает молекулу нуклеиновой кислоты, кодирующую цирковирус свиней 2 типа (PCV2), которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1).

Изобретение относится к области биотехнологии. Представлен выделенный химерный полинуклеотид для усиления продуцирования представляющего интерес гетерологичного белка, содержащий полинуклеотидную последовательность промотора SigA или SigH, функционально связанную с полинуклеотидом, кодирующим белок YmaH, причем химерный полинуклеотид содержит последовательность, которая по меньшей мере на 90% идентична SEQ ID NO: 1, 2, 3 или 13.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложено IL-1β-связывающее антитело или его IL-1β-связывающий фрагмент, включающее вариабельную область тяжелой цепи и легкой цепи.

Изобретение относится к области иммунологии. Предложен вариант полипептида Fc человеческого IgG с заменами 259I и 308F, где нумерация положений приведена согласно индексу EU Kabat.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты выделенного моноклонального антитела, специфичного к hGM-CSF, где каждый вариант характеризуется тяжелой и легкой цепью.

Настоящее изобретение относится к области биотехнологии и медицины. Предложен способ создания антитела и его функциональных фрагментов, направленных против опухолевого антигена, экспрессируемого на поверхности опухоли, устойчивой по меньшей мере к одному противоопухолевому соединению, основанный на применении для иммунизации измельченного гомогената, и/или суспензии, и/или клеточного лизата, происходящих из такой опухоли.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложен связывающий белок для связывания одной или более мишеней, содержащий четыре полипептидные цепи, которые образуют четыре функциональных антигенсвязывающих сайта.

Изобретение относится к области иммунологии и медицины. Представлено антитело для восстановления центральной нервной системы, содержащее антиген-связывающий участок, который специфично связывается с полипептидом Nogo А человека или NiG человека (SEQ ID NO: 2 и 3, соответственно, приведенные в описании), где указанный антиген-связывающий участок содержит: CDR-H1-6А3 (SEQ ID NO:8), CDR-H2-6А3 (SEQ ID NO:9) и CDR-H3-6А3 (SEQ ID NO:10); и CDR-L1-6А3 (SEQ ID NO:11), CDR-L2-6А3 (SEQ ID NO:12) и CDR-L3-6А3 (SEQ ID NO:13).

Группа изобретений относится к биотехнологии, генной и белковой инженерии, конкретно к рекомбинантной плазмидной ДНК pG1-Rm7, обеспечивающей в клетках Escherichia coli синтез гибридного белка G1-Rm7, способного связывать фактор некроза опухолей и обладающего биолюминесцентной активностью люциферазы Renilla muelleri, где указанная плазмидная ДНК включает нуклеотидную последовательность SEQ ID NO: 1, и может быть использована в медицине.

Настоящая группа изобретений относится к области биотехнологии. Предложено гуманизированное анти-CD79b антитело и его антигенсвязывающий фрагмент, полученные из мышиного антитела MA79b и имеющие по существу аналогичную с ним аффинность связывания CD79b.

Изобретение относится к области иммунологии. Представлено антитело против ангиопоэтина-2 (Ang-2), причем указанное антитело включает вариабельную область тяжелой цепи SEQ ID No:7 (MEDI5) и вариабельную область легкой цепи, выбранную из SEQ ID No:3 (MEDI1); SEQ ID No:4 (MEDI2); SEQ ID No:5 (MEDI3); и SEQ ID No:6 (MEDI4).

Настоящее изобретение относится к области иммунологии. Предложены моноклональные антитела, которые связываются с внеклеточным доменом рецепторной тирозинкиназы AXL и которые, по меньшей мере, частично ингибируют активность AXL, а также их антигенсвязывающие фрагменты.

Изобретение относится к области биохимии, в частности к антителам, которые специфично связываются с рецепторами эпидермального фактора роста (EGFR), а также к ДНК, которые кодируют вариабельные области тяжелой цепи указанных антител, ДНК, которые кодируют вариабельные области легкой цепи указанных антител.
Наверх