Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)



Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)
Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)
Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)
Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)
Способ приготовления низкомолекулярного комплекса активированного эмбрионального (ника-эм)

 


Владельцы патента RU 2560845:

Федеральное государственное автономное образовательное учреждение высшего профессионального образования "Северо-Кавказский федеральный университет" (RU)

Изобретение относится к фармацевтической промышленности, в частности способу получению низкомолекулярного комплекса. Способ приготовления низкомолекулярного комплекса заключается в том, что проводят отбор свежих, неинфицированных куриных яиц, затем их инкубируют, облучают лазерным аппаратом и облучают под ультрафиолетовой лампой, затем яйца охлаждают, помещают в низкотемпературный холодильник и оттаивают, эмбриональные и внеэмбриональные ткани отделяют от скорлупы и проводят их гомогенизацию, разбавляют эмбрионально-яичную массу хлористым натрием, добавляют к полученной смеси раствор формалина, гомогенизируют, центрифугируют, отделяют надосадочную жидкость и разливают в стерильные флаконы, закрывают, помещают в термостат, полученный препарат хранят в холодильнике при определенных условиях. Вышеописанный способ позволяет получить более стабильное и эффективное иммунотропное средство. 1 табл., 3 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к биотехнологии и ветеринарии, в частности способу получения биологически активного препарата иммунотропного действия. Разработка эффективных иммуномодулирующих средств для ветеринарии имеет высокую актуальность в связи с широким распространением у животных иммунодефицитных заболеваний, различной этиологии. При этом иммунные нарушения могут выступать как в качестве первичных, так и усугубляться в динамике патологического процесса при различных инфекционных и неинфекционных заболеваниях, резко снижающих рентабельность животноводства. Ситуацию с напряженностью иммунного статуса усугубляет бесконтрольное использование вакцинных препаратов, антибиотических, гормональных и различных синтетических фармакологических средств, что, хотя и направлено на увеличение количества животноводческой продукции, но значительно ухудшило ее качество по причине нарушения метаболического и морфологического гомеостаза организма животных, напрямую контролируемых иммунными процессами. Указанные нарушения иммунитета, как правило, носят сочетанный сложный характер, при котором сложно выделить патогенетически ведущее, поскольку задействованы сразу несколько звеньев иммунитета. Таким образом, иммунный дисбаланс, служащий основой для формирования многочисленных патологических процессов, сопровождающихся глубокими расстройствами системного уровня, является и сам результатом системных нарушений в организме.

Разработанный низкомолекулярный комплекс активированный эмбриональный (НИКА-ЭМ) включает широкий перечень биологически активных веществ, оказывающих действие на все звенья иммунитет и может использоваться сельскохозяйственным и домашним животным с целью повышения уровня специфической и неспецифической резистентности организма как в составе комплексной терапии, так и отдельно.

Уровень техники

Известен способ получения биологически активного тканевого препарата, включающий отмывку плацентарной оболочки, грубое измельчение, тонкое измельчение до получения частиц размером 0,01-1,0 мм и гемолиз плацентарной оболочки, который осуществляют в течение 10-18 ч в очищенной воде с температурой 8-10°C, расходом воды не более 3 л на 1 кг тканей, обработку их окисляющим раствором проводят 3%-ным раствором перекиси водорода, воздействуя на суспензию в течение 50-60 мин при постоянном перемешивании, дважды подвергают тонкому измельчению в течение 4,5-5 мин и фильтруют его, получая готовый препарат (см. патент на изобретение РФ 2148408, кл. А61K 35/00).

Недостатком данного способа приготовления препарата является сложность подбора сырья, сложность технологии, малый выход и высокая себестоимость.

Известен способ получения биологически активной субстанции из крови кур для активации пролиферации недифференцированных клеток костного мозга человека, включающий электростимуляцию куриных голов в режиме 100-120 В, силой тока 3-5 А в течение 3-5 секунд, осуществление забора и инкубацию крови. Затем отделяют сыворотку. Выделяют из нее полипептидную фракцию с молекулярной массой 150-170 кДа. Полученную пептидную фракцию лиофилизируют и стерилизуют путем облучения в линейном ускорителе электронов с дозой 28-32 кГр (см. патент на изобретение РФ 2508297, кл. А61K 35/14).

Недостатком данного способа приготовления препарата является сложность технологии, малый выход и высокая себестоимость.

Известен способ получения средства для неспецифической иммунотерапии. Изобретение относится к области фармакологии и медицины. Заявлено средство для неспецифической иммунотерапии, содержащее эмбриональный противоопухолевый модулятор (ЭПОМ) в качестве активного агента и фармацевтически приемлемый носитель. ЭПОМ получают из эмбриональных субстанций путем криодеструкции, экстракции и осаждения в спиртах возрастающей концентрации и содержит комплекс гиалуроновой кислоты, опухолеассоциированные антигены нормального эмбриогенеза. Средство может быть выполнено в виде раствора, линимента, крема, зубной пасты (см. патент на изобретение РФ 2341272, кл. А61K 35/54).

Недостатком данного способа приготовления препарата является сложность технологии, малый выход и высокая себестоимость.

Известен способ получения биологически активного сырья из эмбрионов северных оленей. Способ заключается в том, что сбор сырья проводится до покрытия эмбрионов шерстным покровом, замораживается при температуре ниже минус 20°C, затем проводится консервирование при +35°C и величине вакуума 0,096-0,098 МПа в течение 12 часов, затем активно охлаждают и вентилируют в воздушном потоке при +20°C со скоростью движения воздуха 7-12 м/сек. При достижении в сырье 13-17% влажности его измельчают и расфасовывают в вакуумные упаковки. Порошок обрабатывают ультрафиолетовыми лучами, и/или электромагнитным полем, и/или автоклавированием. Из готового порошка путем поэтапного экстрагирования получают водный и водно-спиртовой экстракт (см. патент на изобретение РФ 2300386, кл. А61K 35/54).

Недостатком данного способа приготовления препарата является сложность подбора сырья, сложность технологии, малый выход и высокая себестоимость.

Известен способ получения средства, нормализующего обмен веществ в тканях кожи. Способ заключается в том, что для получения фракции нРНК 100 г смеси эмбриональных тканей мелко измельчают в 500 мл 50 мМ цитрата натрия pH 7,5 и затем гомогенизируют в ножевом гомогенизаторе в лечение 2 мин при 4000 об/мин для вскрытия клеток и ядер. Затем к гомогенату добавляют равный объем смеси фенол/хлороформ (1:1) и инкубируют на водяной бане при 40°C в течение 30 мин, регулярно перемешивая. На этой стадии достигается отделение клеточных белков и ДНК от РНК и переход последних в водную фазу. После 15-минутного охлаждения при 4°C полученную смесь центрифугировали 20 мин при 3000 об/мин при комнатной температуре. Водную фазу собирали и добавляли к ней 2,5 объема охлажденного 96% этанола и выдерживали его при минус 20°C не менее суток для формирования осадка РНК. Для увеличения выхода препарата промежуточный слой, отделенный от фенол/хлороформной фазы, перемешивают и центрифугируют еще раз при тех же условиях. Супернатант собирают и обрабатывают, как описано выше. Для обогащения препарата низкомолекулярными РНК к оставшейся интерфазе добавляют 50 мл 50 мМ цитрата натрия pH 7,5, равный объем фенол/хлороформа и инкубируют смесь при 70°C в течение 30 мин, регулярно перемешивая. После инкубации смесь 30 мин охлаждают и затем центрифугируют при комнатной температуре в течение 20 мин при 3000 об/мин. С супернатантом поступают, как описано выше. Спиртовые смеси супернатантов, содержащих различные температурные фракции мРНК, смешивают. Из спирта мРНК высаживают центрифугированием (20 мин, 3000 об/мин, комнатная температура), подсушивают на воздухе и растворяют в дистиллированной воде. Для освобождения от остатков фенола проводят повторное переосаждение из спирта. Полученный таким образом препарат содержит ассоциированные с белками низкомолекулярные РНК из ядер и цитоплазмы клеток (см. патент на изобретение РФ 2229886, кл. А61K 38/00).

Недостатком данного способа приготовления препарата является сложность технологии, малый выход и высокая себестоимость.

Известен способ получения тканевого препарата для нормализации течения окот и случек, скорости роста, профилактики и лечения острых и хронических заболеваний животных незаразной этиологии. Готовят тканевой препарат с использованием яичников коров без желтых тел, щитовидной и паращитовидных желез, вилочковой, поджелудочной железы, печени крупного рогатого скота до 4-х лет. Органы раздельно выдерживают 9-10 суток в холодильнике, раздельно 3 раза измельчают мясорубкой, разводят свежей водопроводной водой в соотношении 1:2, экстрагируют 4 часа в стеклянной посуде при комнатной температуре, тщательно перемешивают каждые 10-15 минут, обрабатывают в течение часа в водяной бане при 58-59°C, раздельно фильтруют через 2 слоя стерильной марли, фильтрат 4 раза с суточным интервалом выдерживают в водяной бане при 58-59°C в течение часа. Смешивают компоненты так, чтобы их соотношение в препарате было, вес. %: тканевая эмульсия яичников - 10,3, эмульсия щитовидной и паращитовидных желез - 10,3, вилочковой железы - 10,3, поджелудочной железы - 17,2, печени - 20,6, АСД ф-2 - 10,3, формалин - 0,4, мед натуральный пчелиный - 20,6. Перед инъекцией препарат перемешивают и вводят по 1/2 части дозы в дорсальные мышцы поясницы из расчета 0,02-0,04 мл/кг массы тела животного (см. патент на изобретение РФ 2259195, кл. А61K 31/115).

Недостатком данного способа приготовления препарата является сложность подбора сырья, сложность технологии, малый выход и высокая себестоимость.

Известен способ получения нуклеопротеидных комплексов из эмбрионов птиц, обладающих иммунотропной и радиопротективной активностью. 100 яиц с эмбрионами птиц (куры, перепела и т.д.), полученные из инкубатора, протирают спиртом, извлекают эмбрионы и трижды промывают 250 мл 0,15 М NaCl. К отмытым эмбрионам приливают равный объем 0,15 М NaCl (обычно 60-65 мл) и гомогенизируют в размельчителе тканей в течение 1 мин при скорости ножей 8000 об/мин. Гомогенат центрифугируют на холоде при 4000 g в течение 15-20 мин. Супернатант объемом 120-130 мл пропускают через полые волокна из полиамида с верхним пределом селективности 50 kDa. Для этого используют установку УПЛ-0,1 производства г.Кириши или аналогичную. Давление и скорость потока устанавливают согласно паспортным данным установки. Ультрафильтрат в объеме 100-110 мл собирают и пропускают через полые волокна из полиамида с верхним пределом селективности 5 kDa. Концентрат, представляющий собой целевую фракцию в объеме 25 мл, центрифугируют для отделения денатурировавших белков и лиофильно высушивают. Для получения лекарственной формы препарат подвергают стерилизующей фильтрации, розливу согласно дозе и высушиванию стандартными методами, предусмотренными для лекарственных препаратов. Из 100 эмбрионов получают 350 доз препарата иммуностимулирующего радиопротективного и противоопухолевого действия (см. патент на изобретение РФ 2110267, кл. А61K 35/00).

Недостатком данного способа приготовления препарата является сложность технологии, малый выход и высокая себестоимость.

Известен способ получения экстрактов куриных эмбрионов. Берутся куриные яйца после 12 дней инкубации. Все содержимое куриных яиц гомогенизируют, подвергают сублимационной сушке, превращают в порошок и хранят при температуре 20°C до использования. Данный яичный порошок сначала растворяли в воде (5% масса/объем), а затем подвергают последовательному in vitro расщеплению. Значение pH образцов доводили до pH 2,0 с помощью 1 н. HCl, и смесь инкубировали с пепсином при 800 U/мл в трясущейся бане в течение 2 ч при 37°C при встряхивании при 100 оборотах в минуту. Затем образец нейтрализовали 1 М NaOH до pH 7.0 перед добавлением панкреатина в дозе 2 мг/мл и желчного экстракта 0,3 мг/мл, затем инкубировали 2 часа. Наконец переваривание оканчивали путем кипячения в течение 10 минут (Xi Li, Yujie Su, Jun Sun, Yanjun Yang, 2012).

Недостатком данного способа приготовления экстракта является сложность и высокая себестоимость.

Наиболее близким по технической сущности и достигаемому положительному эффекту и принятый авторами за прототип является способ приготовления биостимулятора эмбрионального, включающий отбор свежих, неинфицированных куриных яиц, затем их инкубацию в течение 9 суток, при этом на 5, 6, 7 сутки яйца облучают по 30 с при частоте модуляции 9 Гц и мощности излучения 9 мВт, затем яйца охлаждают в течение 6-7 суток, проводят гомогенизацию, разбавляют яичную массу 1:10 физиологическим раствором, тщательно перемешивают, добавляют к полученному раствору 5%-ный раствор фенола так, чтобы концентрация фенола составляла 0,3%, фильтруют полученный раствор и разливают в стерильные флаконы, закрывают и хранят в холодильнике при температуре 2-6°C (см. патент на изобретение РФ 2197251, кл. А61K 35/12).

Недостатком данного способа приготовления биостимулятора является низкая стабильность.

Раскрытие изобретения

Технический результат, который может быть достигнут с помощью предлагаемого способа, сводится к иммуномодуляции организма, получению более стабильного и эффективного иммунотропного средства.

Технический результат достигается с помощью известного способа приготовления низкомолекулярного комплекса активированного эмбрионального, включающего отбор куриных яиц, охлаждение при температуре 2-4°C, заморозку, оттаивание, гомогенизацию, разбавление, гомогенизацию под высоким давлением, центрифугирование, отбор низкомолекулярной надосадочной фракции, помещение в термостат, при этом перед гомогенизацией яйцо инкубируют в течение 10 суток, причем на 4, 5, 6, 7 сутки яйцо облучают лазерным аппаратом АЛ-01 «Семикон» в течение 30 с при частоте модуляции 9 Гц и мощности излучения 9 мВт и облучают 30 с под ультрафиолетовой лампой на расстоянии 50 см и охлаждают в течение 5-6 суток при температуре 2-6°C, замораживают при температуре минус 38-40°C 24 часа, оттаивают 24 часа при температуре 2-6°C, при этом в качестве разбавителя используют 0,9% натрий хлористый в соотношении 1:10 с добавлением 40%-ного раствора формалина до его концентрации 0,2%.

Сущность способа приготовления низкомолекулярного комплекса активированного эмбрионального заключается в следующем.

Проводят отбор свежих, неинфицированных куриных яиц, затем их инкубируют в течение 10 суток, при этом на 4, 5, 6, 7 сутки яйца облучают лазерным аппаратом АЛ-01 «Семикон» в течение 30 с при частоте модуляции 9 Гц и мощности излучения 9 мВт и облучают 30 с под ультрафиолетовой лампой на расстоянии 50 см, затем яйца охлаждают в течение 5-6 суток при температуре 2-6°C, затем помещают на 24 часа в низкотемпературный холодильник при температуре минус 38-40°C и оттаивают при температуре 2-6°C на 24 часа, эмбриональные и внеэмбриональные ткани отделяют от скорлупы и проводят их гомогенизацию, разбавляют эмбрионально-яичную массу 0,9% хлористым натрием 1:10, тщательно перемешивают, добавляют к полученной смеси 40%-ный раствор формалина, так чтобы концентрация формалина составляла 0,2%) гомогенизируют с использованием гомогенизатора высокого давления при 600 бар четырехкратно, центрифугируют полученный раствор при 4800 g в течение 30 минут при температуре 2-6°C, отделяют надосадочную жидкость и разливают в стерильные флаконы, закрывают, помещают в термостат при температуре 37°C на 7 суток, полученный препарат хранят в холодильнике при температуре 2-6°C.

Примеры конкретного выполнения опытов приготовления низкомолекулярного комплекса активированного эмбрионального.

Опыт 1. Проводят отбор свежих, неинфицированных куриных яиц, затем их инкубируют в течение 10 суток, во время инкубации на 4, 5, 6, 7 сутки проводят облучение яиц лазерным аппаратом АЛ-01 «Семикон» в течение 30 с при частоте модуляции 9 Гц и мощности излучения 9 мВт и облучают 30 с под ультрафиолетовой лампой на расстоянии 50 см, затем яйца охлаждают в течение 5-6 суток при температуре 2-6°C, помещают на 24 часа в низкотемпературный холодильник при температуре минус 38-40°C и оттаивают при температуре 2-6°C на 24 часа, эмбриональные и внеэмбриональные ткани отделяют от скорлупы и гомогенизируют до однородной массы, разбавляют яичную массу 0,9% хлористым натрием 1:10, добавляю 5% фенол до его концентрации 0,3%, тщательно перемешивают, разливают в стерильные флаконы, закрывают, полученный препарат хранят в холодильнике при температуре 2-6°C.

Полученный препарат обладает недостатками: препарат не стабилен, выпадает значительный осадок, при применении животным не дает выраженного иммуномодулирующего эффекта, выявляются случаи местной аллергической реакции.

Опыт 2. Проводят аналогично опыту 1, но для стабилизации после гомогенизации вместо фенола используется 40% раствор формалина до концентрации 0,2%, и после фильтрации препарат помещают в термостат при 37°C на 7 суток для стерилизации.

Полученный препарат не стабилен, выпадает значительный осадок.

Опыт 3. Проводят аналогично опыту 2, но после добавления формалина полученную взвесь измельчают в гомогенизаторе высокого давления при 600 бар четырехкратно, центрифугируют полученный раствор при 4800 g в течение 30 минут при температуре 2-6°C, отделяют надосадочную жидкость и разливают в стерильные флаконы, закрывают, помещают в термостат при температуре 37°C на 7 суток, полученный препарат хранят в холодильнике при температуре 2-6°C.

Полученный препарат при данных параметрах обладает стабильностью, широким перечнем БАВ и выраженным иммуномодулирующим эффектом (табл. 1, фиг. 1, 2, 3, 4).

Проведены испытания физико-химических характеристик нового варианта препарата «НИКА-ЭМ», в том числе дзета-потенциал, размер частиц, образующих препарат, общее количество белка, РНК, ДНК и спектрофотометрический профиль в сравнении с препаратом «СТЭМБ».

Для определения дзета-потенциала и размера частиц использовался анализатор Malvern Zetasizer Nano ZS (Malvern, Великобритания).

Для определения химического состава осуществляли:

1) количественную оценку содержания белков в образце методом специфической флуоресценции (флуориметр Qubit 2.0, Life Technologies, США);

2) количественную оценку содержания рибонуклеиновых кислот (РНК) в образце методом специфической флуоресценции (флуориметр Qubit 2.0, Life Technologies, США);

3) количественную оценку содержания дезоксирибонуклеиновых кислот (ДНК) в образце методом специфической флуоресценции (флуориметр Qubit 2.0, Life Technologies, США);

4) оценку характеристических спектров поглощения исследуемых образцов в диапазоне длин волн 190-840 нм (спектрофотометр NanoDrop 2000С, Thermo Fisher Scientific, США) (табл. 1).

Результаты исследований свидетельствуют, о том, что биологически активный препарат «НИКА-ЭМ» по сравнению с препаратом «СТЭМБ» приобрел признаки большей физической устойчивости. Кроме того, выявлено, что большинство частиц в препарате имеют диаметр ниже 100 nm и таким образом относятся к низкомолекулярным соединениям. В препарате «НИКА-ЭМ» достоверно увеличилось количество общего белка, ДНК и в особенности РНК соответственно на 71 мкг/мл (на 27,3%), 0,34 мкг/мл (на 9,7%) и 13,2 мкг/мл (на 194,1%), что свидетельствует о более качественном разрушении клеточных структур и выходе в раствор биологически активных действующих веществ, обуславливающих биологическую активность препарата.

Кроме того, расширение диапазона характеристических спектров вправо свидетельствует о качественном увеличении перечня БАВ в препарате «НИКА-ЭМ» (фиг. 1, 2). На фиг. 1 показан характеристический спектр поглощения в диапазоне длин волн 190-840 нм, тканевого препарата «СТЭМБ» (max 219 nm, 229 nm). На фиг. 2. - характеристический спектр поглощения в диапазоне длин волн 190-840 нм, тканевого препарата «НИКА-ЭМ» (max 215 nm, 228 nm, 275 nm).

Кроме того, проведены исследования влияния препарата «НИКА-ЭМ» на развитие поствакцинального иммунитета. Согласно нормативным документам СТО 00482861-0005-2006 (ФГУП «Ставропольская биофабрика»), включающим проверку вакцины на иммуногенность, были взяты две группы клинически здоровых, без абсцессов и поражений, нормальной упитанности кроликов живой массой 3-3,5 кг по 5 животных в каждой. Животным первой группы в ушную вену вводилась вакцина, животным второй группы кроме вакцины подкожно вводился препарат «НИКА-ЭМ» в дозе 0,1 мл на кг живой массы однократно. Через 25 дней после введения вакцины у кроликов из ушной вены осуществляли забор крови в количестве 5-8 см3 в стеклянные пробирки, которые затем выдержали в термостате при 37°C в течение 30 минут. По истечению времени сгусток обводили и помещали в холодильник для ретракции сгустка на 1 сутки. Отстоявшуюся сыворотку исследовали в РМА (реакция микроагглютинации) со всеми штаммами лептоспир 5-10 суточного роста, входящими в состав вакцины, с накоплением 60-70 подвижных лептоспир в поле зрения микроскопа. Каждую пробу сыворотки разводили физиологическим раствором до 1:1600, антигеном - до 1:3200. РМА ставили на пластинках из оргстекла, которые после проведенных манипуляций помещали в термостат на 1 ч. Реакцию учитывали под микроскопом с конденсором темного поля при увеличении 20×1,5×10. Агглютинация проявлялась в склеивании лептоспир и образовании «паучков». Свободные концы лептоспир оставались подвижными. Титром сыворотки считали наибольшее разведение, в котором агглютинировало не менее 50% лептоспир.

Через 30 суток после начала опыта, включающего проверку вакцины на иммуногенность, проводили убой всех подопытных животных с последующим патологоанатомическим вскрытием и отбором кусочков органов для гистологического исследования.

Гистологические исследования органов проводились по общепринятой методике. Органы помещались в 10% нейтральный формалин на 3 суток, затем промывались в проточной воде в течение 24 часов. Резка осуществлялась на микротоме «Техном МЗП-01» и при помощи замораживающего устройства «ОМТ 0228» при температуре минус 12°C. Срезы наклеивались на стекла и окрашивались гематоксилин-эозином без депарафинирования по общепринятой методике. Площадь красной и белой пульпы селезенки определяли микроморфометрически с использованием окуляр-микрометра ×16 и микроскопа Микмед-2. Все подсчеты проводили под фиксированным увеличением на 10 различных полях гистопрепарата селезенки с расчетом среднего значения. Результаты экспериментальной работы подвергали вариационно-статистической обработке с использованием программы Primer of Biostatistics (Version 4.03).

При изучении развития поствакционального иммунитета против лептоспироза в обеих группах животных выявлено, что по отношению к серогруппе Помона в контроле наблюдалось увеличение титров выше нормативных у двух кроликов 1:800 и 1:3200, в опыте - у четырех от 1:800 до 1:1600; по отношению к серогруппе Тарассови в контроле и опыте у всех кроликов были практически максимальные титры; по отношению к серогруппе Гриппотифоза в контроле увеличение титров выше нормативных - у одного кролика 1:800, в опыте - у четырех от 1:800 до 1:3200; по отношению к серогруппе Сейро (серовар Харджио) в контроле у всех кроликов были минимальные нормативные титры 1:400, а в опыте увеличение титров выше нормативных было у трех кроликов от 1:800 до 1:1600.

Анализ результатов изучения специфического иммунитета при использовании препарата «НИКА-ЭМ» показал, что по отношению к серогруппе Помона происходит выравнивание титров антител у большинства животных, в отличие от контроля, где титры антител колебались от минимальных у большинства животных (1:400) до максимальных значений (1:3200). По отношению к серогруппе Тарассови, введение препарат «НИКА-ЭМ» не оказало влияния на титры антител, как в контрольной, так и в опытной группах титры были максимальными. По отношению к серогруппам Гриппотифоза и Сейро (серовар Харджио), произошло стимулирование поствакцинального иммунитета - в контроле почти у всех животных наблюдался минимальный уровень титров (1:400), а при использовании препарата «НИКА-ЭМ» у большинства животных титры антител варьировали от 1:800 до 1:1600.

Для изучения влияния введения вакцины поливалентной «ВГНКИ» против лептоспироза животных в комплексе с иммуномодулятором «НИКА-ЭМ» на морфологию внутренних органов через 30 дней после начала опыта, включающего, проверку вакцины на иммуногенность, проводили убой всех подопытных животных с последующим патологоанатомическим вскрытием и отбором кусочков органов для гистологического исследования.

В результате патологоанатомического вскрытия у всех кроликов, которым вакцина вводилась совместно с препаратом «НИКА-ЭМ» обнаружено увеличение селезенки, отмечается ее бугристость и выраженность структуры на разрезе, что соответствует патоморфологическим признакам паренхиматозной гиперплазии органа, другие органы и ткани были без макроскопических изменений.

При гистологическом исследовании селезенки животных, которым совместно вводилась вакцина и препарат «НИКА-ЭМ» обнаружено развитие большого количества вторичных селезеночных фолликулов с герминативный центром, артериальная гиперемия, интенсивная инфильтрация паренхимы селезенки клетками белой крови, в особенности макрофагами и плазматическими клетками. При сравнительной оценке площади белой и красной пульпы селезенок животных первой и второй групп определено, что площадь белой пульпы селезенки у кроликов, которым на фоне вакцины вводили препарат «НИКА-ЭМ», составляет 62%±5,6 при Р≤0,05, что на 30% больше, чем у кроликов контрольной группы, где реактивность селезеночных фолликулов была сравнительно слабой (фиг. 3, 4). На фиг. 3 показана стократно увеличенная селезенка кроликов контрольной группы: слабая реактивность вторичных селезеночных фолликулов; окраска гематоксилином и эозином. На фиг. 4 изображена стократно увеличенная селезенка кроликов контрольной группы: слабая реактивность вторичных селезеночных фолликулов; окраска гематоксилином и эозином.

Полученные результаты свидетельствуют о том, что препарат «НИКА-ЭМ» оказал иммуномодулирующее действие на показатели поствакцинального иммунитета при введении вакцины поливалентной «ВГНКИ» против лептоспироза животных. Иммуномодулирующий эффект заключается в адекватной динамике образования антител в результате антигензависимой дифференцировки В-лимфоцитов селезенки в зависимости от специфической реакции организма животного на определенную серогруппу лептоспир.

Литература

1. Патент №2341272 РФ. Средство для неспецифической иммунотерапии / Л.Н. Мкртчян. - Опубл. 27.02.2014.

2. Патент №2229886 РФ. Средство, нормализующее обмен веществ в тканях кожи / Т.П. Клюшник, А.А. Зозуля, Р.В. Корнеева. - Опубл. 10.06.2004.

3. Патент №2197251 РФ. Способ приготовления биостимулятора эмбрионального / Л.Д. Тимченко, И.В. Ржепаковский, В.В. Михайленко и др. - Опубл. 27.01.2003. - Бюл. №3. - Ч. 3.

4. Патент №2148408 РФ. Способ получения биологически активного тканевого препарата / P.M. Полковников. - Опубл. 10.05.2000.

5. Патент №2508297 РФ. Способ получения биологически активной субстанции из крови кур для активации пролиферации недифференцированных клеток костного мозга человека / А.Г. Румянцев, В.А. Шестаков, С.А. Румянцев, А.П. Иванов. - Опубл. 27.02.2014.

6. Патент №2300386 РФ. Способ получения биологически активного сырья из эмбрионов северных оленей / А.А. Кайзер, Касим А.Л., А.А. Гнедов, И.Н. Кольца. - Опубл. 10.06.2007.

7. Патент №2110267 РФ. Способ получения нуклеопротеидных комплексов из эмбрионов птиц, обладающих иммунотропной и радиопротективной активностью / В.И. Масычева, В.В. Хомов, А.А. Сизов, В.А. Разворотнев, В.А. Фадина. - Опубл. 10.05.1998.

8. Патент №2259195 РФ. Способ профилактики и лечения заболеваний животных биостимуляторами и гормонами тканевого препарата комплексного действия / О.Н. Моисеев, К.С. Савенков, А.И. Клименко, Ю.Д. Дробин, Г.А. Тихенко. - Опубл. 27.08.2005.

9. Xi, Li Chicken embryo extracts enhance spleen lymphocyte and peritoneal macrophages function / Li Xi, Su Yujie, Sun Jun, Yang Yanjun // Journal of Ethnopharmacology. - 2012. - №144. - P. 255-260.

Способ приготовления низкомолекулярного комплекса, характеризующийся тем, что проводят отбор свежих, неинфицированных куриных яиц, затем их инкубируют в течение 10 суток, при этом на 4, 5, 6, 7 сутки яйца облучают лазерным аппаратом АЛ-01 «Семикон» в течение 30 с при частоте модуляции 9 Гц и мощности излучения 9 мВт и облучают 30 с под ультрафиолетовой лампой на расстоянии 50 см, затем яйца охлаждают в течение 5-6 суток при температуре 2-6°C, затем помещают на 24 часа в низкотемпературный холодильник при температуре минус 38-40°C и оттаивают при температуре 2-6°C на 24 часа, эмбриональные и внеэмбриональные ткани отделяют от скорлупы и проводят их гомогенизацию, разбавляют эмбрионально-яичную массу 0,9% хлористым натрием 1:10, добавляют к полученной смеси 40%-ный раствор формалина, так чтобы концентрация формалина составляла 0,2%, гомогенизируют с использованием гомогенизатора высокого давления при 600 бар четырехкратно, центрифугируют полученный раствор при 4800 g в течение 30 минут при температуре 2-6°C, отделяют надосадочную жидкость и разливают в стерильные флаконы, закрывают, помещают в термостат при температуре 37°C на 7 суток, полученный препарат хранят в холодильнике при температуре 2-6°C.



 

Похожие патенты:
Изобретение относится к фармацевтической промышленности, а именно к способу получения препарата для регенерации тканей ротовой полости. Способ получения поликомпонентного мелатонинсодержащего препарата для регенерации тканей ротовой полости, включающий инкубирование яиц с последующим охлаждением, гомогенизацией и ультрамикрофильтрацией, при этом инкубирование яиц осуществляют в течение 5-6 суток, перед ультрамикрофильтрацией к гомогенату добавляют 0,1% раствора натрия бензойнокислого, в полученную субстанцию из эмбрионально-яичной массы вводят вторую субстанцию, содержащую медицинский желатин, отвар шалфея и зверобоя, мелатонин, масло эвкалипта, глицерин, полученную определенным способом, перемешивают в гомогенизаторе, полученную массу разливают в емкость, помещают в термостат, затем охлаждают до застывания в форме пленок, затем разрезают пленки на полоски шириной 1 см и фасуют в полиэтиленовую упаковку.

Изобретение относится к фармацевтической промышленности, а именно к способу получения биологически активного вещества, содержащего комплекс макро- и микроэлементов яичной скорлупы в виде комплесонатов, которое может быть использовано в фармакологии, ветеринарии, медицине и пищевой промышленности в качестве лекарственного средства и/или биологически активной добавки.

Изобретение относится к мази, обладающей ранозаживляющим действием, которая состоит из основы эмульсионного типа и фармакологически активного вещества. В качестве фармакологически активного вещества мазь содержит фракцию с Т.
Изобретение относится к фармацевтической промышленности, а именно к способу получения биологически активного тканевого препарата из плода-телочки, для лечения коров с эндометритом, нарушением функций яичников.
Изобретение относится к фармацевтической промышленности, а именно к заменителю слюны. .
Изобретение относится к экспериментальной медицине и может быть использовано для повышения физической выносливости. .
Изобретение относится к медицине, а именно к кардиологии, и касается лечения ишемической болезни сердца. .
Изобретение относится к области ветеринарии. .
Изобретение относится к переработке оленеводческой продукции, в частности к способам получения биологически активного продукта типа пантокрина из свежих половых органов пантовых оленей.

Изобретение относится к медицине, а именно к экспериментальной биологии, и может быть использовано для моделирования экспериментального амилоидоза у животных. Для этого проводят введение молодой мыши через день подкожно в течение 30 дней эксперимента белкового препарата, содержащего нативный яичный альбумин, при этом в качестве белкового препарата, содержащего нативный яичный альбумин, вводят 30% раствор нативного яичного альбумина в цельном обезжиренном молоке по 0,5 мл. Изобретение обеспечивает образование амилоидных масс преимущественно в печени, селезенке, почках у молодых мышей с целью дальнейшего использования их в экспериментах, например, при апробации способов лечения амилоидоза. 13 ил., 1 табл.

Настоящее изобретение относится к способу получения панкреатических гормонпродуцирующих клеток (варианты). Представленный способ включает культивирование человеческих индуцированных плюрипотентных стволовых (iPS) клеток в среде, содержащей (+)-(R)-транс-4-(1-аминоэтил)-N-(4-пиридил)циклогексанкарбоксамид дигидрохлорид; далее культивирование полученных клеток в среде, содержащей (i) 6-[[2-[[4-(2,4-дихлорфенил)-5-(4-метил-1Н-имидазол-2-ил)-2-пиримидинил]амино]этил]амино]никотинонитрил и/или (ii) (2′Z,3′Е)-6-броминдирубин-3′-оксим; далее культивирование полученных клеток в среде, содержащей (i) 6-[[2-[[4-(2,4-дихлорфенил)-5-(4-метил-1Н-имидазол-2-ил)-2-пиримидинил]амино]этил]амино]никотинонитрил и/или (ii) (2′Z,3′E)-6-броминдирубин-3′-оксим и активин; далее образование клеточной массы из полученных клеток и культивирование клеточной массы в суспензионном состоянии в среде; далее культивирование полученных клеток в среде, содержащей ретиноевую кислоту, дорсоморфин, 4-[4-(1,3-бензодиоксол-5-ил)-5-(2-придинил)-1Н-имидазол-2-ил]-бензамид и основной фактор роста фибробластов; далее культивирование полученных клеток. При осуществлении заявленного изобретения не используется питающая клетка, а среда не содержит сыворотку. Изобретение может быть использовано в клеточной терапии при лечении сахарного диабета. 2 н. и 1 з.п. ф-лы, 8 ил., 3 пр.
Изобретение относится к фармацевтическим композициям из сырья животного происхождения и может быть использовано для лечения и реабилитации различных видов эндометриоза и некоторых онкологических заболеваний. Фармацевтическую композицию для лечения эндометриоза получают из фолликулярной жидкости крупного рогатого скота, из которой выделяют сывороточный альбумин и белок семейства TGF-β, имеющий иммуноспецифичность ингибина βА, и добавляют соль NaCl при следующем соотношении компонентов, мас. %: белок семейства TGF-β, имеющий иммуноспецифичность ингибина βА: 0,0000015-0,3%; сывороточный альбумин: 3-5%; соль NaCl: остальное. Использование заявленного изобретения обеспечивает повышение эффективности лечения эндометриоза за счет значительного уменьшения или полного отсутствия рецидивов после курса лечения, отсутствия значимых побочных эффектов, нормализации гормонального статуса.

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый. Препарат экзосом, выделенных культурой клеток K562/i-S9, содержащий, по данным иммуноферментного анализа, белок, антигены СЕА и 5Т4, лиганды FasL и TRAIL в определенном количестве. Применение вышеописанного препарата повышает уровень иммунного ответа и снижает титр онкомаркёров у добровольцев. 2 н. и 1 з.п. ф-лы, 4 ил., 2 табл., 7 пр.
Наверх