Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди



Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди
Генетический тест на накопление меди в печени собак и корм для домашних животных с низким содержанием меди

 


Владельцы патента RU 2564129:

МАРС, ИНКОРПОРЕЙТЕД (US)

Изобретение относится к области биотехнологии. Предложен способ тестирования собаки с целью определения вероятности наличия у собаки защиты от накопления меди в печени или к предрасположенности к накоплению меди в печени. Способ предусматривает генотипирование образца ДНК собаки на присутствие или отсутствие в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом (a). Также описано применение указанных полиморфизмов для определения вероятности наличия у собаки защиты от накопления меди в печени или к предрасположенности к накоплению меди в печени, а также способы отбора собак для получения потомства и способ предотвращения заболевания, связанного с накоплением меди в печени собак. Предложенная группа изобретений может быть использовано в ветеринарии. 4 н. и 11 з.п. ф-лы, 11 ил., 11 табл., 9 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к способу определения вероятности защищенности собаки от накопления меди в печени и от опосредованного медью заболевания печени. Изобретение также относится к корму для собак, предназначенному для предотвращения накопления меди в печени и опосредованного медью заболевания печени у собаки, а также к способу получения данного корма.

Уровень техники

Хотя заболевания печени редко встречаются у собак, одной из наиболее распространенных форм таких заболеваний является хронический гепатит (CH). CH является гистологическим диагнозом, который характеризуется наличием фиброза, воспаления и апоптоза и некроза клеток печени. На конечной стадии заболевания может развиваться цирроз. Одной из причин CH является накопление меди в печени. Накопление меди в печени может возникать в результате повышенного потребления меди, первичного метаболического дефекта в метаболизме меди в печени или изменения в биллиарной экскреции меди. В последнем случае токсичность меди является вторичной по отношению к воспалению печени, фиброзу печени и холестазу, хотя не ясно в какой степени она встречается у собак. При вторичной болезни накопления меди данное накопление в основном ограничено перипортальной паренхимой и концентрация меди в печени ниже, чем в случае наследственных болезней накопления. Хотя природа инициирующего фактора (факторов) и сенсибилизирующего антигена неизвестна, иммунологические нарушения и морфологические признаки, характерные для первичного биллиарного цирроза, наблюдаются одновременно, свидетельствуя о наличии механизма, опосредованного иммунной системой.

Тонкий кишечник считается основным участком абсорбции пищевой меди у млекопитающих. Перенос из просвета кишечника в слизистую оболочку кишки представляет собой опосредованный носителем процесс, включающий компонент насыщаемого транспорта. После поступления в клетки слизистой оболочки примерно 80% абсорбированной меди находится в цитозоле, в основном, в состоянии, связанном с металлотионеинами (MT). Металлотионеины представляют собой низкомолекулярные индуцируемые белки, которые выполняют разные функции, включающие гомеостаз, накопление, транспорт и детоксикацию металлов. После прохождения через энтероциты медь поступает в кровообращение в системе воротной вены, где она связывается с пептидами и аминокислотами белков-носителей и транспортируется в печень и, в меньших количествах, в почки. У большинства млекопитающих медь легко выводится, причем основным путем экскреции меди является желчь.

Генетическая причина накопления меди в печени неизвестна. Ее трудно определить, поскольку медь участвует во множестве разных биологических путей, каждый из которых является очень сложным и кодируется большим числом генов. Собак с избыточным накоплением меди в печени обычно лечат D-пеницилламином, эффективным хелатором меди. Однако, в конечном счете, наиболее успешным способом лечения собак с CH является трансплантация печени. В WO 2009/044152 A2 раскрыт способ определения у собаки предрасположенности к накоплению меди в печени, включающий определение присутствия или отсутствия (a) полиморфизма в гене собаки GOLGA5, ATP7a или UBL5, который указывает на предрасположенность к накоплению меди, и/или (b) полиморфизма, находящегося в неравновесном сцеплении с указанным полиморфизмом (a). В международной заявке PCT/GB09/02355 (еще не опубликована) раскрыты другие полиморфизмы, которые можно использовать для определения предрасположенности собаки к накоплению меди в печени.

Сущность изобретения

Авторы настоящего изобретения обнаружили кодирующую мутацию в гене собаки ATP7A, которая связана с низкими уровнями меди в печени собак и, следовательно, указывает на наличие защиты от накопления меди в печени. Мутация представляет собой полиморфизм одиночных нуклеотидов (SNP), который вызывает изменение аминокислотного состава белка. В описанном в данном описании исследовании показано, что полиморфизм оказывает функциональное влияние на транспорт меди в клетках. Открытие данного полиморфизма в гене ATP7A является основой для тестирования с целью предсказания защищенности собаки от накопления меди в печени путем выявления данного полиморфизма и/или одного или более полиморфизмов, находящихся в неравновесном сцеплении с данным полиморфизмом.

Авторы настоящего изобретения также недавно обнаружили, что полиморфизмы в собачьих генах GOLGA5, ATP7A и UBL5 или в их областях, связаны с высокими уровнями меди в печени собак и, следовательно, указывают на предрасположенность к накоплению меди в печени (WO 2009/044152 A2 и неопубликованная международная заявка PCT/GB 09/02355). Следовательно, генетический тест, который объединяет результаты детекции одного или более полиморфизмов, свидетельствующих о наличии защиты от накопления меди в печени, и результаты детекции одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени собак, является особенно информативным в отношении вероятности того, что у собаки существует риск накопления меди в печени.

Накопление меди в печени собаки может приводить к развитию одного или более заболеваний или состояний печени, связанных с высоким уровнем меди в печени. Например, высокий уровень меди в печени может вызывать хронический гепатит, цирроз печени и, в конечном счете, печеночную недостаточность. Таким образом, изобретение позволяет идентифицировать собак, которые не защищены или имеют риск развития таких заболеваний или состояний печени, которые связаны с высоким уровнем меди. После идентификации собаки, которая не содержит мутацию, указывающую на наличие защиты от накопления меди в печени, можно определить для такой собаки подходящие профилактические меры, позволяющие поддерживать низкий или нормальный уровень меди в печени, которые включают, например, введение корма настоящего изобретения. Кроме того, собаки, идентифицированные как содержащие мутации, связанные с защитой от накопления меди в печени, идеально подходят для применения в программе улучшения породы, целью которой является выведение собак с пониженным риском развития заболеваний печени или других состояний, связанных с высоким уровнем меди.

Таким образом, изобретение предоставляет способ тестирования собаки с целью определения вероятности наличия у собаки защиты от накопления меди в печени, включающий детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом (a).

Изобретение также предоставляет:

базу данных, содержащую информацию, относящуюся к SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и/или одному или более полиморфизмам, которые находятся с ним в неравновесном сцеплении, и к их связи с предрасположенностью собаки к накоплению меди в печени;

способ определения вероятности наличия у собаки защиты от накопления меди в печени включающий:

(a) ввод в компьютерную систему данных, касающихся присутствия или отсутствия полиморфизма в геноме собаки, как определено в данном описании;

(b) сравнение данных с компьютерной базой данных, содержащей информацию, относящуюся к указанным полиморфизмам и их связи с защищенностью собаки от накопления меди в печени или с предрасположенностью собаки к накоплению меди в печени; и

(c) определение вероятности наличия у собаки защиты от накопления меди в печени на основе сравнения;

компьютерную программу, содержащую средства программного кода, которая при выполнении на компьютерной системе инструктирует ее, как осуществлять способ настоящего изобретения;

компьютерную среду для хранения, содержащую компьютерную программу настоящего изобретения и базу данных настоящего изобретения;

компьютерную систему, приспособленную для проведения способа настоящего изобретения, которая включает:

(a) средства для получения данных, касающихся присутствия или отсутствия в геноме собаки полиморфизма, как определено в данном описании;

(b) базу данных, содержащую информацию, относящуюся к указанным полиморфизмам и/или одному или более полиморфизмам, которые находятся с ними в неравновесном сцеплении, и к их связи с наличием у собаки защиты от накопления меди в печени или с предрасположенностью собаки к накоплению меди в печени;

(c) модуль для сравнения данных с базой данных; и средства для определения вероятности наличия у собаки защиты от накопления меди в печени на основе указанного сравнения;

способ определения вероятности наличия у собаки защиты от накопления меди в печени, включающий детекцию присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с полиморфизмом (a);

применение определенного в данном описании полиморфизма для определения защищенности собаки от накопления меди в печени; и

способ отбора собаки для получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени, который включает:

определение присутствия в геноме первой собаки-кандидата одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени в соответствии с настоящим изобретением; и, как следствие, определение пригодности первой собаки-кандидата для получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени;

необязательно определение присутствия в геноме второй собаки, имеющей пол, противоположный полу первой собаки, одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени в соответствии с настоящим изобретением; и

необязательно спаривание первой собаки со второй собакой с целью получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени.

Дополнительно и неожиданно, авторы настоящего изобретения обнаружили корм, который более эффективно уменьшает концентрацию меди в печени лабрадоров ретриверов, чем лекарственное средство пеницилламин. Следовательно, такой корм можно использовать для предотвращения накопления меди в печени собак породы лабрадор ретривер и для предотвращения заболевания или состояния, связанного с высоким уровнем меди в печени, такого как хронический гепатит, цирроз и печеночная недостаточность.

Соответственно, настоящее изобретение также предоставляет корм, содержащий медь в концентрации от 4,5 до 12 мг/кг сухого вещества, обеспечивающий профилактику заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер, предпочтительно, если с помощью способа настоящего изобретения установлено, что существует вероятность наличия у собаки защиты от накопления меди в печени.

Настоящее изобретение также предоставляет:

способ предотвращения заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер, предпочтительно, если с помощью способа настоящего изобретения установлено, что существует вероятность наличия у собаки защиты от накопления меди в печени, где способ включает кормление собаки кормом настоящего изобретения;

применение меди в производстве корма для собаки, имеющей генетическую наследственность породы лабрадор ретривер, предпочтительно, если с помощью способа настоящего изобретения установлено, что существует вероятность наличия у собаки защиты от накопления меди в печени, где корм содержит медь в концентрации от 4,5 до 12 мг/кг сухого вещества и предназначается для предотвращения заболевания, связанного с накоплением меди в печени указанной собаки;

упаковку, содержащую корм с концентрацией меди от 4,5 до 12 мг/кг сухого вещества и цинковую добавку, обеспечивающую концентрацию по меньшей мере 120 мг/кг сухого вещества, предназначенные для одновременного, раздельного или последовательного применения с целью предотвращения заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер, предпочтительно, если с помощью способа настоящего изобретения установлено, что существует вероятность наличия у собаки защиты от накопления меди в печени; и

маркированный корм настоящего изобретения или маркированную упаковку настоящего изобретения.

Краткое описание фигур

Фиг.1 иллюстрирует прогрессирование накопления меди в печени в отсутствии лечения. На фигуре показана концентрация меди в печени (мг/кг сухой массы) 11 лабрадоров ретриверов, полученная в двух исследованиях, проведенных с интервалом 8,7 месяцев (диапазон 6-15 месяцев), перед лечением. На протяжении этого периода все животные получали обычную поддерживающую диету, в которой, по утверждению производителей, концентрация пищевой меди составляет 12-25 мг/кг сухого вещества, и концентрация цинка составляет 80-270 мг/кг сухого вещества. Ромбовидные символы обозначают отклонения.

На фиг.2 показана концентрация меди в печени (мг/кг сухой массы) 24 лабрадоров ретриверов в начале исследования и в процессе получения диеты, определенной с помощью 2 контрольных анализов. Собак подразделяли на две группы следующим образом: группа 1 = диета+таблетки глюконата цинка, группа 2 = диета+плацебо. Нумерацию по оси x осуществляют следующим образом: 1+2 = до обработки, 3+4 = контрольная проверка 1 (первый контрольный анализ через 8 месяцев (в интервале 5-13 месяцев)), 5+6 - контрольная проверка 2 (второй контрольный анализ через 16 месяцев (в интервале 12-25 месяцев)). Количество тестируемых собак было следующим: 1: N=12 собак в группе 1, 2: N=12 собак в группе 2, 3: N=9 собак в группе 1, 4: N=12 собак в группе 2, 5: N=6 собак в группе 1, 6: N=10 собак в группе 2. Ромбовидные символы обозначают отклонения. Пунктирная линия обозначает нормальный уровень меди в печени взрослых собак.

Фиг.3 иллюстрирует эффективность диеты настоящего изобретения в отношении влияния на концентрацию меди в печени (мг/кг сухой массы) 18 лабрадоров ретриверов по сравнению с эффективностью одного пеницилламина. Обозначения, используемые на оси x: 1 = до получения пеницилламина, 2 = после получения пеницилламина/до получения корма, 3 = после получения корма. Прогрессирование вдоль оси x от 1 до 2 демонстрирует эффект пеницилламина, тогда как прогрессирование от 2 до 3 демонстрирует эффект корма. Пунктирная линия обозначает нормальный уровень меди в печени взрослых собак.

Фиг.4 схематически иллюстрирует варианты осуществления функциональных компонентов, организованных так, чтобы обеспечить осуществление настоящего изобретения.

На фиг.5 изображены средние уровни меди у лабрадоров ретриверов (данные, приведенные в таблице VII) в зависимости от пола и генотипа ATP7A. На оси y откладывают количество меди в пересчете на сухую массу печени (мг/кг). На оси x представлен генотип ATP7a: слева направо первые три позиции обозначают самок собак, участвующих в исследовании, и последние две обозначают самцов собак, участвующих в исследовании. Планки погрешностей соответствуют стандартной ошибке.

На фиг.6 приведена коробчатая диаграмма гистологических оценок содержания меди у лабрадоров ретриверов в зависимости от пола и генотипа ATP7a (данные, приведенные в таблице VII). На оси y откладывают значения гистологических оценок содержания меди. На оси x представлен генотип ATP7a: слева направо первые три позиции обозначают самок собак, участвующих в исследовании, и последние две обозначают самцов собак, участвующих в исследовании. p-Значение для критерия Крускала-Уоллиса составляет 0,000396.

На фиг.7A и 7B показаны изотопные измерения меди в первичных фибробластах собаки. Измерения изотопа меди (64Cu) проводят в клетках ATP7AC/C, ATP7AC/T и ATP7AT/T после (A) 24 ч или 48 ч инкубации в присутствии 10 мкМ, 50 мкМ и 100 мкМ 64Cu, или (B) 24 ч инкубации с последующим экстенсивным промыванием и инкубацией в среде, не содержащей изотоп меди, в течение 2 ч. Гамма-счетчики корректируют по условиям культивирования клеток посредством анализа белка и анализа MTS. Точки на графике, представляющие результаты, полученные после 24 ч инкубации, обозначают среднее значение +/-SEM от двух независимых экспериментов, проводимых с двойными повторами, выраженное в виде числа импульсов в минуту (cpm) по отношению к содержанию общего белка в клетке. Другие точки на графике обозначают среднее значение +/-SEM от одного эксперимента с двойными повторами.

На фиг.7C и 7D показаны изотопные измерения меди в первичных фибробластах собаки. Измерения изотопа меди (64Cu) проводят в первичных фибробластах, полученных от пациентов с болезнью Менкеса или от пациентов, у которых отсутствует болезнь Менкеса (контроль), после (C) 24 ч или 48 ч инкубации в присутствии 10 мкМ, 50 мкМ и 100 мкМ 64Cu, или (D) 24 ч инкубации с последующим экстенсивным промыванием и инкубацией в среде, не содержащей изотоп меди, в течение 2 ч. Гамма-счетчики корректируют по условиям культивирования клеток посредством анализа белка. Точки на графике обозначают такие же значения, как в пунктах (A) и (B).

На фиг.8 показаны уровни экспрессии гена ATP7A в первичных фибробластах собаки. (A) Клетки ATP7AC/C, ATP7AC/T и ATP7AT/T оставляют необработанными (верхний график) или инкубируют в присутствии 100 мкМ меди в течение 24 ч (нижний график), после чего проводят анализ методом количественной ПЦР 3'-области (ATP7Aiii), 5'-области (ATP7Aii) или области, содержащей мутацию (ATP7Ai). Точки на графике обозначают среднее значение +/-SD результатов двух независимых экспериментов, проводимых с тройными повторами лунок. (B) Анализ экспрессии ATP7A методом вестерн-блоттинга. Клетки оставляют необработанными (-), инкубируют со 100 мкМ BCS или со 100 мкМ меди в течение 24 ч. Образцы лизируют, белки разделяют методом SDS-PAGE в 12% геле и подвергают иммуноблоттингу с использованием куриных антител против ATP7A (разведение 1:2000) в течение 1 ч. Затем мембраны инкубируют с козлиным антителом против куриных Ig, конъюгированным с HRP (разведение 1:10000), в течение еще 1 ч и затем для развития окрашивания добавляют реагенты для детекции ECLTM, используемые в вестерн-блоттинге. Мембраны соскребают и подвергают повторному зондированию с использованием β-тубулина (разведение 1:20000), чтобы подтвердить равную нагрузку. Стрелки указывают на предполагаемый полноразмерный белок.

На фиг.9 показаны уровни экспрессии гена металлотионеина в первичных фибробластах собаки. Клетки ATP7AC/C, ATP7AC/T и ATP7AT/T инкубируют в присутствии 1, 10 или 100 мкМ меди или оставляют необработанными (UT) в течение 24 часов и затем методом количественной ПЦР анализируют ген металлотионеина. Фиг.9(A) демонстрирует степень изменения по сравнению с UT ATP7AC/С с доверительным интервалом (CI) 95%, (B) демонстрирует степень изменения по сравнению с экспрессией UT ATP7Aгенотип с CI 95%, и (C) демонстрирует log10 уровня экспрессии с доверительным интервалом (CI) 95%. В панели (C) верхняя линия на графике соответствует генотипу ATP7AT/T, средняя линия соответствует генотипу ATP7AC/T, и нижняя линия соответствует генотипу ATP7AC/C.

На фиг.10 показаны уровни экспрессии гена металлотионеина в тканях кишечника и печени собаки. Ткани (A) печени и (B) тонкого кишечника выделяли из собак, экспрессирующих ATP7AC/C, ATP7AC/T и ATP7AT/T, и затем методом количественной ПЦР анализировали ген металлотионеина. Результаты изображены в виде среднего log10 уровня экспрессии и 95% CI от 5 независимых экспериментов (правые панели) и степени изменения с CI 95% по сравнению с ATP7AC/C.

На фиг.11 приведена характеристика опосредованного медью транспорта белка ATP7A. Клетки ATP7AC/C (левая панель) и ATP7AT/T (правая панель) выращивали на предметных стеклах в присутствии 100 мкМ BCS в течение 18 ч, затем промывали и инкубировали с 100 мкМ медью в течение 1, 2 или 3 ч в среде для культивирования. Клетки фиксировали и окрашивали антителом против ATP7A (первая колонка в каждой панели) и антителом против 58K (вторая колонка в каждой панели), обрабатывали для проведения непрямой микроскопии с тройной меткой и затем визуализировали методом эпифлуоресцентной микроскопии. Изображения ATP7A и 58K объединяют, чтобы выявить перекрывающиеся участки (третья колонка в каждой панели).

Краткое описание последовательностей

SEQ ID NO:1-143 показывают полинуклеотидные последовательности, охватывающие SNP настоящего изобретения.

SEQ ID NO:144-159 представляют собой последовательности праймеров.

Подробное описание настоящего изобретения

Определение защиты от накопления или предрасположенности к накоплению меди в печени

Накопление меди в печени приводит к заболеванию печени у собак разных пород, таких как лабрадор ретривер, доберман-пинчер, немецкая овчарка, кейсхонд, коккер-спаниель, вест-хайленд-уайт терьер, бедлингтон-терьер и скайтерьер. Концентрация меди в печени нормальных собак любой породы составляет от 200 до 400 мг/кг в расчете на сухую массу, хотя у новорожденных концентрация меди в печени обычно выше. Количество меди в печени собаки можно измерить путем биопсии.

Собака, защищенная от накопления меди в печени, имеет низкий риск или низкую вероятность накопления меди в печени, и концентрация меди в ее печени реже достигает уровня, превышающего 400 мг/кг в расчете на сухую массу. Концентрация меди в печени собаки, защищенной от накопления меди в печени, составляет менее 600 мг/кг, например, менее 500 мг/кг, менее 400 мг/кг или менее 300 мг/кг. Определение вероятности наличия у собаки защиты от накопления меди в печени в соответствии с настоящим изобретением включает определение вероятности накопления меди в печени собаки на уровне менее 600 мг/кг, например, менее 500 мг/кг, менее 400 мг/кг или менее 300 мг/кг.

Собака, предрасположенная к накоплению меди в печени, имеет тенденцию к накоплению меди в печени с достижением концентрации меди в печени выше 400 мг/кг в расчете на сухую массу. Определение риска или вероятности предрасположенности собаки к накоплению меди в печени включает определение риска или вероятности того, что медь накапливается в печени собаки до уровня, превышающего 400 мг/кг, например, превышающего 600 мг/кг, превышающего 800 мг/кг, превышающего 1000 мг/кг, превышающего 1500 мг/кг, превышающего 2000 мг/кг, превышающего 5000 мг/кг или превышающего 10000 мг/кг.

Накопление меди в печени можно оценить с помощью гистохимического анализа. Например, полуколичественное определение концентрации меди можно осуществить методом гистохимии по описанному ранее способу (Van den Ingh T.S.G.A.M., R.J., Cupery R. (1988) Vet Q 10: 84-89), используя окрашивание рубеановой кислотой для анализа распределения меди. Концентрацию можно оценить по шкале от 0 до 5 следующим образом: 0 = медь отсутствует, 1 = отдельные клетки печени и/или ретикулогистиоцитарные (RHS) клетки содержат несколько положительных по меди гранул, 2 = небольшие группы клеток печени и/или клеток RHS содержат положительные по меди гранулы в количестве от низкого до среднего, 3 = более крупные группы или кластеры клеток печени и/или клеток RHS содержат умеренные количества положительных по меди гранул, 4 = большие кластеры клеток печени и/или клеток RHS содержат много положительных по меди гранул, 5 = диффузное состояние клеток печени и/или клеток RHS с большим числом положительных по меди гранул. В соответствии с данной системой оценка содержания меди выше 2 соответствует аномальному состоянию.

Следовательно, определение вероятности наличия у собаки защиты от накопления меди в печени в соответствии с настоящим изобретением включает определение вероятности того, что собака получит оценку менее или равную 3, например, менее или равную 2,5, 2, 1,5, или менее или равную 1, по системе оценок, описанной в Van den Ingh et al. Определение риска или вероятности предрасположенности собаки к накоплению меди в печени может включать определение риска или вероятности того, что собака получит оценку более или равную 2, например, более или равную 2,5, 3, 3,5, или более или равную 4, по системе оценок, описанной в Van den Ingh et al.

Вероятность защиты или риск предрасположенности можно выразить, например, как фактор, процент или вероятность риска. Можно определить, накапливает ли собака медь на указанных выше уровнях. Например, способ определения вероятности защиты от накопления меди в печени может включать определение, накапливает ли собака медь на уровне, превышающем 400 мг/кг.

Накопление меди в печени на уровне, превышающем 400 мг/кг, связано с заболеванием печени и, в конечном счете, может привести к печеночной недостаточности. Следовательно, идентификация в геноме собаки одного или более полиморфизмов, указывающих на защиту от накопления меди в печени, свидетельствует о пониженной вероятности развития у собаки заболевания или состояния, обусловленного накоплением меди в печени, такого как хронический гепатит, цирроз и печеночная недостаточность. И наоборот, идентификация в геноме собаки одного или более полиморфизмов, указывающих на наличие предрасположенности к накоплению меди в печени, свидетельствует о предрасположенности собаки к такому заболеванию или состоянию. Таким образом, изобретение обеспечивает способ тестирования собаки на предрасположенность к заболеванию, связанному с накоплением меди в печени, такому как хронический гепатит, цирроз и печеночная недостаточность, или на вероятность защиты от такого заболевания.

Полиморфизмы и определение предрасположенности к накоплению меди или защиты от накопления меди

Авторы настоящего изобретения неожиданно обнаружили полиморфизм, оказывающий влияние на аминокислотную последовательность белка ATP7A, который свидетельствует о наличии защиты от накопления меди в печени, в отличие от полиморфизма, свидетельствующего о предрасположенности к накоплению меди в печени (примеры 2-5). Указанный полиморфизм изменяет последовательность белка, кодируемого геном ATP7A, по аминокислотному положению 328, приводя к замене треонина на изолейцин. Эксперименты in vitro демонстрируют, что данная мутация оказывает большое влияние на функционирование белка (пример 5). Результаты экспериментов показывают, что степень накопления меди выше в клетках, экспрессирующих мутантную форму белка; накопление выше при воздействии меди, и высвобождение происходит медленнее после воздействия меди. Кроме того, в ответ на воздействие меди в клетках, несущих мутацию, изменяется внутриклеточный транспорт ATP7A. В клетках, несущих мутацию, также наблюдается повышенная экспрессия белка, осуществляющего транспортировку меди. Клетки, несущие две формы, имеют одинаковые уровни экспрессии ATP7A. Следовательно, кодирующая мутация в ATP7A оказывает большое влияние на функционирование белка.

Таким образом, настоящее изобретение относится к способу определения в геноме собаки одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени. В частности, настоящее изобретение обеспечивает способ определения вероятности защищенности собаки от накопления меди в печени, включающий детекцию присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (положение 102 SEQ ID NO:142), и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом (a).

Фраза "детекция присутствия или отсутствия полиморфизма" обычно относится к определению присутствия полиморфизма в геноме собаки. Полиморфизмы включают полиморфизмы одиночных нуклеотидов (SNP), микросателлитные полиморфизмы, инсерционные полиморфизмы и делеционные полиморфизмы. Предпочтительно полиморфизм представляет собой SNP. Детекция присутствия или отсутствия SNP включает генотипирование SNP или типирование нуклеотида (нуклеотидов), присутствующего(их) в геноме собаки, по SNP. Как правило, определяют нуклеотиды, присутствующие в одинаковых положениях на двух гомологичных хромосомах. Следовательно, собака может быть идентифицирована как гомозиготная по первому аллелю, гетерозиготная или гомозиготная по второму аллелю, содержащему SNP.

Определение фенотипа субъекта, такого как предрасположенность субъекта к заболеванию или состоянию или защищенность субъекта от заболевания или состояния, не ограничивается детекцией полиморфизма, являющегося причиной заболевания или состояния. В процессе генетического картирования определяют связь генетических вариаций в ряде маркерных локусов, выделенных из образцов субъектов, с указанным фенотипом. При наличии такой связи между конкретным маркерным локусом и фенотипом можно предположить, что вариация по данному маркерному локусу влияет на представляющий интерес фенотип, или, что вариация по данному маркерному локусу находится в неравновесном сцеплении с локусом, реально связанным с фенотипом, который не подвергают генотипированию. В случае группы полиморфизмов, которые находятся в неравновесном сцеплении друг с другом, информация о существовании каждого из таких полиморфизмов у конкретного субъекта обычно бывает излишней. Таким образом, при определении содержания в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени или к связанному с медью заболеванию печени, или на защиту от такого накопления или заболевания, можно детектировать только один полиморфизм из такой группы полиморфизмов.

В результате неравновесного сцепления полиморфизм, который не является функциональным полиморфизмом, отвечающим за предрасположенность/защиту, но находится в неравновесном сцеплении с функциональным полиморфизмом, может действовать в качестве маркера, указывающего на присутствие функционального полиморфизма. Полиморфизм, который находится в неравновесном сцеплении с полиморфизмом настоящего изобретения, указывает на предрасположенность к накоплению меди в печени или на защиту от накопления меди в печени.

Соответственно, любое из полиморфных положений, определенных в данном описании, можно идентифицировать непосредственно, то есть, путем определения нуклеотида, присутствующего в данном положении, или косвенно, например, путем определения нуклеотида, присутствующего в другом полиморфном положении, которое находится в неравновесном сцеплении с указанным полиморфным положением.

Неравновесное сцепление представляет собой неслучайное гаметическое распределение аллелей разных локусов в популяции. Полиморфизмы, которые имеют тенденцию наследоваться вместе, вместо отдельного наследования в результате случайного распределения генов, находятся в неравновесном сцеплении. Полиморфизмы подвергаются случайному распределению или наследуются независимо друг от друга, если частота одновременной встречаемости двух полиморфизмов является суммой отдельных частот встречаемости этих полиморфизмов. Например, если два полиморфизма в разных полиморфных участках присутствуют на 50% хромосом в популяции, считается, что они случайно распределяются, если два аллеля присутствуют вместе на 25% хромосом в популяции. Более высокий процент означает, что два аллеля связаны. Отсюда следует, что первый полиморфизм находится в неравновесном сцеплении со вторым полиморфизмом, если частота одновременной встречаемости двух полиморфизмов больше, чем сумма частот отдельной встречаемости этих полиморфизмов в популяции. Предпочтительно первый полиморфизм находится в неравновесном сцеплении со вторым полиморфизмом, если частота одновременной встречаемости полиморфизмов более чем на 10%, например, более чем на 30%, более чем на 50% или более чем на 70% превышает сумму частот отдельной встречаемости двух полиморфизмов.

Исследование показало, что неравновесное сцепление широко распространено среди собак (Extensive and breed-specific linkage disequilibrium in Canis familiaris, Sutter et al., Genome Research 14: 2388-2396). Полиморфизмы, которые находятся в неравновесном сцеплении, зачастую физически располагаются близко друг от друга и, поэтому, наследуются вместе. Полиморфизмы, которые находятся в неравновесном сцеплении с приведенными в данном описании полиморфизмами, располагаются с ними на одной хромосоме. Расстояние между полиморфизмами, которые присутствуют в неравновесном сцеплении у собак, обычно находится в пределах 5 миллионов оснований, предпочтительно, в пределах 2 миллионов оснований, в пределах 1 миллиона оснований, в пределах 700 т.п.о., в пределах 600 т.п.о., в пределах 500 т.п.о., в пределах 400 т.п.о., в пределах 200 т.п.о., в пределах 100 т.п.о., в пределах 50 т.п.о., в пределах 10 т.п.о., в пределах 5 т.п.о., в пределах 1 т.п.о., в пределах 500 п.о., в пределах 100 п.о., в пределах 50 п.о. или в пределах 10 п.о.

Рутинные методы идентификации полиморфизмов, находящихся в неравновесном сцеплении с одним из полиморфных положений, в соответствии с приведенным в данном описании определением, входят в компетенцию опытных специалистов. После выбора потенциального полиморфизма специалист в данной области может легко определить, действительно ли данный полиморфизм, и какая именно версия или аллель полиморфизма, находится в существенной связи с одним из определенных в данном описании полиморфизмов.

Более подробно, чтобы определить, действительно ли полиморфизм находится в неравновесном сцеплении с одним из определенных в данном описании полиморфизмов, специалисту нужно генотипировать кандидатный полиморфизм и один или более из определенных в данном описании полиморфизмов у группы собак. Размер группы должен быть достаточным для того, чтобы получить статистически значимый результат. Как правило, генотипированию подвергают образцы, полученные по меньшей мере от 100, предпочтительно, по меньшей мере от 150 или по меньшей мере от 200 разных собак. В состав группы могут входить собаки любой породы, однако обычно они имеют одинаковый или подобный генетический фон. После генотипирования полиморфизмов в группе собак можно измерить неравновесное сцепление одной или нескольких пар полиморфизмов с помощью одного из ряда легкодоступных пакетов программ обработки статистических данных. Примером бесплатного пакета программ является Haploview (Haploview: analysis and visualisation of LD and haplotype maps, Barrett et al., 2005, Bioinformatics, 21(2): 263-265), доступный для скачивания на сайте http://www.broadinstitute.org/haploview/haploview.

Показателем неравновесного сцепления является D'. Если значение D' находится в диапазоне от 0,5 до 1, оно свидетельствует о том, что пара полиморфизмов находится в неравновесном сцеплении, причем 1 соответствует наиболее значимому равновесному сцеплению. Таким образом, если обнаружено, что для кандидатного полиморфизма и конкретного полиморфизма, определенного в данном описании, D' составляет от 0,5 до 1, предпочтительно от 0,6 до 1, от 0,7 до 1, от 0,8 до 1, от 0,85 до 1, от 0,9 до 1, от 0,95 до 1, или наиболее предпочтительно D' равен 1, можно сказать, что кандидатный полиморфизм предвещает определенный в данном описании полиморфизм и, следовательно, указывает на предрасположенность к накоплению меди в печени или на наличие защиты от накопления меди в печени. В предпочтительном способе настоящего изобретения полиморфизм, который находится в неравновесном сцеплении с определенным в данном описании полиморфизмом, находится в пределах 680 т.п.о. и располагается на той же хромосоме, что и определенный в данном описании полиморфизм, и рассчитанный показатель неравновесного сцепления для пары полиморфизмов, D', больше или равен 0,9.

Другой мерой неравновесного сцепления является R в квадрате, где R представляет собой коэффициент корреляции. R в квадрате, который также известен как "коэффициент смешанной корреляции", представляет собой долю вариаций в генотипах первого полиморфизма, которая учитывается в генотипах второго полиморфизма. Следовательно, если R в квадрате для кандидатного полиморфизма и конкретного полиморфизма, определенного в данном описании, равен 0,5, это означает, что кандидатный полиморфизм обуславливает 50% вариаций конкретного полиморфизма. R в квадрате можно определить с помощью стандартных пакетов программ, таких как Haploview. Как правило, R в квадрате, равный 0,25 или большему значению (R >0,5 или <-0,5), соответствует высокой степени корреляции. Следовательно, если обнаружено, что R в квадрате составляет 0,5 или больше, предпочтительно 0,75, 0,8, 0,9 или 0,95 или больше, для кандидатного полиморфизма и конкретного полиморфизма, определенного в данном описании, можно сказать, что кандидатный полиморфизм предсказывает определенный в данном описании полиморфизм и, как следствие, указывает на предрасположенность к накоплению или на наличие защиты от накопления меди в печени. В предпочтительном способе настоящего изобретения полиморфизм, который находится в неравновесном сцеплении с определенным в данном описании полиморфизмом, присутствует в пределах 680 т.п.о. на той же хромосоме, что и определенный в данном описании полиморфизм, а рассчитанная мера неравновесного сцепления пары полиморфизмов, R в квадрате, больше или равен 0,85.

После идентификации полиморфизма, как находящегося в неравновесном сцеплении и, следовательно, коррелирующего с определенным в данном описании полиморфизмом, специалист в данной области может легко определить, какая версия полиморфизма, т.е. какой аллель, связан с предрасположенностью к накоплению или защитой от накопления меди в печени. Такую идентификацию можно проводить путем фенотипирования группы собак по накоплению меди в печени и классификации собак по уровню накопления меди в печени. Затем группу собак генотипируют по представляющему интерес полиморфизму. Затем генотипы соотносят с уровнем меди в печени, чтобы определить связь генотипов с уровнем меди в печени и таким образом идентифицировать аллель, связанный с предрасположенностью к накоплению или защитой от накопления меди в печени.

Полиморфизмы настоящего изобретения, которые свидетельствуют о наличии защиты от накопления меди в печени, включают SNP, приведенный в таблице VI (ATP7a_Reg3_F_6 (положение 102 SEQ ID NO:142)), и один или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом. Следовательно, способ настоящего изобретения включает детекцию присутствия или отсутствия одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), и (b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с указанным полиморфизмом (a). Предпочтительно способ включает детекцию присутствия или отсутствия SNP, приведенного в таблице VI (ATP7a_Reg3_F_6 (SEQ ID NO:142)), т.е. полиморфизма (a).

При осуществлении настоящего изобретения можно детектировать любое число или любое сочетание полиморфизмов. Предпочтительно детектируют по меньшей мере 2 полиморфизма. Предпочтительно, детектируют от 2 до 5, от 3 до 8 или от 5 до 10 полиморфизмов.

ДНК собаки можно типировать в соответствующих положениях:

(i) по полиморфизму (a);

(ii) по одному или более полиморфизмам (b); или

(iii) по полиморфизму (a) и по одному или более полиморфизмам (b).

Предпочтительный способ включает детекцию присутствия или отсутствия (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и по меньшей мере одного полиморфизма (b), находящегося в неравновесном сцеплении с указанным полиморфизмом (a)

В предпочтительном способе полиморфизм, находящийся в неравновесном сцеплении с указанным полиморфизмом (a), представляет собой SNP. Предпочтительно полиморфизм представляет собой любой полиморфизм в гене ATP7A собаки или в области данного гена, который свидетельствует о наличии защиты от накопления меди в печени. Примером SNP, находящегося в неравновесном сцеплении с полиморфизмом (a), является SNP ATP7a_Regl6_F_42 (положение 68 SEQ ID NO:143). Обнаружено, что данный SNP находится в неравновесном сцеплении с SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и свидетельствует о наличии защиты от накопления меди в печени (пример 4). Следовательно, для определения вероятности защищенности собаки от накопления меди в печени данный SNP можно использовать сам по себе или в сочетании с полиморфизмом (a). Соответственно, способ определения вероятности защищенности собаки от накопления меди в печени может включать детекцию присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), (b) SNP ATP7a_Reg16_F_42 (SEQ ID NO:143) и одного или более полиморфизмов, находящихся в неравновесном сцеплении с (a) и/или (b). Предпочтительный способ включает детекцию присутствия или отсутствия (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и (b) SNP ATP7a_Regl6_F_42 (SEQ ID NO:143).

Аллель T по SNP ATP7A, приведенному в таблице VI (ATP7a_Reg3_F_6 (SEQ ID NO:142)), авторы изобретения определяют как указывающий на наличие защиты от накопления меди. Данный SNP находится на X-хромосоме. Собаки, гомозиготные (в случае самок собак) или гемизиготные (в случае самцов собак) по аллелю T, имеют защиту от накопления меди. Собаки, которые содержат аллель C, не защищены от накопления меди. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля T по SNP, приведенному в таблице VI (ATP7a_Reg3_F_6 (SEQ ID NO:142)). Соответственно, предпочтительный способ настоящего изобретения включает детекцию присутствия или отсутствия генотипа TT или TC по ATP7a_Reg3_F_6 (SNP 142) и определения, таким образом, содержания в геноме собаки полиморфизма, указывающего на наличие защиты от накопления меди в печени.

Поскольку SNP ATP7A, приведенный в таблице VI, расположен на X-хромосоме, и наличие защиты является рецессивным признаком, защищенный фенотип с большей вероятностью встречается у самцов собак. Поэтому способ настоящего изобретения может включать определение пола собаки. SNP ATP7A ((ATP7a_Reg3_F_6 (SEQ ID NO:142)) является особенно полезным для собак всех пород, в том числе для собак неизвестной породы или смешанной породы (дворняга), с учетом того, что самцы собак, как правило, менее предрасположены к накоплению меди, чем самки. В примере 3 также приведены данные, свидетельствующие о том, что способ настоящего изобретения можно использовать для собак всех пород во всех географических регионах. Следовательно, способ настоящего изобретения может включать определение содержания в геноме собаки смешанной или гибридной породы, или дворняги, или аутбредной собаки, одного или более полиморфизмов по гену ATP7a, которые указывают на наличие защиты от накопления меди в печени, или одного или более полиморфизмов, находящихся с ними в неравновесном сцеплении.

Авторы настоящего изобретения обнаружили, что аллель T по SNP ATP7a_Regl6_F_42 (SEQ ID NO:143), который находится в неравновесном сцеплении с SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), свидетельствует о наличии защиты от накопления меди. Как указано выше, ген ATP7A и, следовательно, данный SNP расположен на X-хромосоме. Собаки, гомозиготные (в случае самок собак) или гемизиготные (в случае самцов собак) по аллелю T, имеют защиту от накопления меди. Собаки, которые содержат аллель C, не защищены от накопления меди. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля T по SNP, приведенному в таблице X (ATP7a_Reg16_F_42 (SEQ ID NO:143)). Соответственно, предпочтительный способ настоящего изобретения включает детекцию присутствия или отсутствия генотипа TT или TC по ATP7a_Reg16_F_42 (SNP 143) и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на наличие защиты от накопления меди в печени.

Авторы настоящего изобретения ранее обнаружили, что полиморфизмы в собачьих генах GOLGA5, ATP7A и UBL5 или в их областях, указывают на предрасположенность к накоплению меди в печени собак (примеры 1-2). Следовательно, указанные полиморфизмы можно использовать в сочетании с полиморфизмами настоящего изобретения для проведения усовершенствованного генетического теста с целью определения риска или вероятности того, что собака предрасположена к накоплению или защищена от накопления меди в печени. Таким образом, способ настоящего изобретения может включать определение присутствия или отсутствия сочетания SNP, свидетельствующего о предрасположенности к накоплению или защищенности от накопления меди в печени. ДНК собаки можно типировать по одному или более SNP, свидетельствующим о предрасположенности к накоплению меди в печени, и по одному или более SNP, свидетельствующим о защищенности от накопления меди в печени. Присутствие одного или более SNP, "свидетельствующих о предрасположенности", в сочетании с отсутствием одного или более SNP, "свидетельствующих о защищенности", указывает на то, что собака предрасположена к накоплению меди в печени.

Полиморфизм настоящего изобретения, который указывает на предрасположенность к накоплению меди в печени, может присутствовать в одном из генов GOLGA5, ATP7A и UBL5 или он может отсутствовать в этих генах, но находиться в неравновесном сцеплении с полиморфизмом, присутствующим в одном из указанных генов. Таким образом, настоящее изобретение также может включать определение присутствия или отсутствия (c) полиморфизма в собачьем гене GOLGA5, ATP7A и UBL5, который указывает на предрасположенность к накоплению меди в печени, и/или (d) полиморфизма, который находится в неравновесном сцеплении с указанным полиморфизмом (c). При осуществлении настоящего изобретения можно детектировать любое число или любое сочетание полиморфизмов. Предпочтительно детектируют по меньшей мере 2 полиморфизма. Предпочтительно, детектируют от 2 до 5, от 3 до 8 или от 5 до 10 полиморфизмов.

Следовательно, ДНК собаки можно типировать в соответствующих положениях (i) по полиморфизму (a) и/или (ii) по одному или более полиморфизмам (b). Кроме того, ДНК собаки можно типировать в соответствующих положениях:

(iii) по двум или более полиморфизмам (c);

(iv) по двум или более полиморфизмам (d);

(v) по одному или более полиморфизмам (c) и по одному или более полиморфизмам (d).

Если существуют два полиморфизма (c), они могут находиться на разных генах, выбранных из GOLGA5, ATP7A и UBL5, или на одном из этих генов. Если существуют три или более полиморфизмов (c), например, от 3 до 10 таких полиморфизмов, полиморфизмы могут находиться на одном гене, на двух генах или на всех трех генах.

Подобным образом, если существуют два полиморфизма (d), каждый из них может находиться в неравновесном сцеплении с полиморфизмом, присутствующим на другом гене, выбранном из GOLGA5, ATP7A и UBL5, или на том же гене. Если существуют три или более полиморфизмов (d), например, от 3 до 10 таких полиморфизмов, полиморфизмы могут находиться в неравновесном сцеплении с полиморфизмами, расположенными на том же гене, на двух генах или на всех трех генах.

Предпочтительный способ включает детекцию присутствия или отсутствия по меньшей мере одного полиморфизма (c) в гене собаки GOLGA5, ATP7A или UBL5, который указывает на предрасположенность к накоплению меди в печени, и по меньшей мере одного полиморфизма (d), находящегося в неравновесном сцеплении с указанным полиморфизмом (c).

В предпочтительном способе настоящего изобретения полиморфизм, указывающий на предрасположенность, представляет собой SNP. SNP может представлять собой любой SNP, присутствующий в гене собаки GOLG A5, ATP7a или UBL5, или в области такого гена, который указывает на предрасположенность к накоплению меди в печени, и/или SNP, который находится в неравновесном сцеплении с указанным SNP.

Если способ включает определение, содержит ли геном собаки один или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени, предпочтительно SNP выбирают из SNP, приведенных в таблице III, таблице IV и таблице V. Все SNP, приведенные в таблицах III и IV, присутствуют в последовательности в положении 61. Для каждого SNP по данному положению предлагаются первый и второй аллели ([первый/второй]). В таблице V также указаны первый и второй аллели для каждого SNP. SNP, приведенные в таблицах III, IV и V, можно использовать в любом количестве и в любом сочетании. SNP можно объединить с полиморфизмом другого типа.

Предпочтительно способ определения в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени, включает детекцию присутствия или отсутствия одного или более SNP, выбранных из SNP, приведенных в таблицах III и V, и/или одного или более SNP, которые находятся с ними в неравновесном сцеплении. Следовательно, предпочтительно один или более SNP выбраны из группы, включающей BICF2P506595 (положение 61 SEQ ID NO:1), BICF2P772765 (положение 61 SEQ ID NO:2), BICF2S2333187 (положение 61 SEQ ID NO:3), BICF2P1324008 (положение 61 SEQ ID NO:4), BICF2P591872 (положение 61 SEQ ID NO:5), ATP7a_Reg4_F_9 (положение 164 SEQ ID NO:131), UBL5_ReglF_16 (положение 97 SEQ ID NO:132), golga5_Regl_24 (положение 70 SEQ ID NO:133), golga5_26 (положение 88 SEQ ID NO:134), golga5_27 (положение 104 SEQ ID NO:135), golga5_28 (положение 139 SEQ ID NO:136), golga5_29 (положение 128 SEQ ID NO:137), golga5_30 (положение 95 SEQ ID NO:138), golga5_31 (положение 106 SEQ ID NO:139), atp7aregl7_32 (положение 95 SEQ ID NO:140), atp7aregl7_33 (положение 90 SEQ ID NO:141), и один или более SNP, которые находятся с ними в неравновесном сцеплении. Соответственно, можно типировать любой из указанных 16 SNP, или все SNP, которые находятся в неравновесном сцеплении с одним из указанных 16 SNP. Предпочтительно типируют по меньшей мере 2 из указанных 16 SNP или SNP, находящихся с ними в неравновесном сцеплении.

Более предпочтительно способ определения в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени, включает детекцию присутствия или отсутствия одного или более SNP, выбранных из SNP, приведенных в таблице III. Соответственно, можно типировать любой из указанных 5 SNP или все SNP, которые находятся в неравновесном сцеплении с одним из указанных 5 SNP. Предпочтительно типируют по меньшей мере 2 из указанных 5 SNP или SNP, находящиеся с ними в неравновесном сцеплении. Более предпочтительно, типируют все 5 положений. Таким образом, предпочтительно типируемый нуклеотид (типируемые нуклеотиды) выбирают из нуклеотидов, находящихся в положениях, эквивалентных:

положению 61 SEQ ID NO:1 (BICF2P506595, SNP1);

положению 61 SEQ ID NO:2 (BICF2P772765, SNP 2);

положению 61 SEQ ID NO:3 (BICF2S2333187, SNP 3);

положению 61 SEQ ID NO:4 (BICF2P 1324008, SNP 4);

положению 61 SEQ ID NO:5 (BICF2P591872, SNP 5); или любому положению, находящемуся в неравновесном сцеплении с одним из указанных положений. Предпочтительно способ включает детекцию присутствия или отсутствия следующих SNP: BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4) и BICF2P591872 (SEQ ID NO:5).

SNP 1 находится в интроне гена GOLGA5. SNP 2, 3 и 4 находятся в области гена UBL5. SNP 5 находится в области гена ATP7A. Следовательно, способ детекции настоящего изобретения относится к любому SNP, который присутствует в одном или нескольких из указанных генов (в кодирующих или других областях), или в области этих генов, или к любому другому SNP, который находится в неравновесном сцеплении с указанным SNP.

Пример 1 демонстрирует применение указанных SNP для разработки булевской модели предрасположенности к накоплению меди. В таблице I приведены бинарные состояния аллелей по трем геномным областям. Двойные значения указывают на то, что собака содержит аллели, свидетельствующие о предрасположенности к накоплению меди ("плохие" аллели). Например, 000 указывает на отсутствие всех трех плохих аллелей. 111 указывает на присутствие всех трех плохих аллелей. Xs обозначает неиспользуемые аллели данного гена. Строки 1xx и 0xx демонстрируют возможность тестирования одного гена с использованием только SNP в гене GOLGA5.

Аллель A по SNP BICF2P506595 (SNP 1) авторы изобретения определяют как указывающий на предрасположенность к накоплению меди в печени. Собаки, гомозиготные по аллелю A, имеют предрасположенность к накоплению меди в печени. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля A по SNP BICF2P506595 и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа AA по SNP BICF2P506595.

Аллель G по SNP BICF2P772765 (SNP 2) авторы изобретения определяют как указывающий на предрасположенность к накоплению меди в печени. Собаки, гомозиготные по аллелю G, имеют предрасположенность к накоплению меди в печени. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля G по SNP BICF2P772765 и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа GG по SNP BICF2P772765.

Аллель C по SNP BICF2S2333187 (SNP 3) авторы изобретения определяют как указывающий на предрасположенность к накоплению меди в печени. Собаки, гомозиготные по аллелю С, имеют предрасположенность к накоплению меди в печени. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля С по SNP BICF2S2333187 и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа CC по SNP BICF2S2333187.

Аллель G по SNP BICF2P1324008 (SNP 4) авторы изобретения определяют как указывающий на предрасположенность к накоплению меди в печени. Собаки, гомозиготные по аллелю G, имеют предрасположенность к накоплению меди в печени. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля G по SNP BICF2P 1324008 и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа GG по SNP BICF2P1324008.

Аллель A по SNP BICF2P591872 (SNP 5) авторы изобретения определяют как указывающий на предрасположенность к накоплению меди в печени. Собаки, гомозиготные или гетерозиготные по аллелю А, имеют предрасположенность к накоплению меди в печени. Следовательно, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля А по SNP BICF2P591872 и определение, таким образом, содержания в геноме собаки полиморфизма, указывающего на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа AA или AG по SNP BICF2P591872.

Таким образом, более предпочтительный способ настоящего изобретения включает детекцию присутствия или отсутствия (i) генотипа TT или TC по ATP7a_Reg3_F_6 (SNP 142); и/или (ii) генотипа TT или TC по ATP7a_Regl 6 F 42 (SNP 143); и может также включать детекцию присутствия или отсутствия:

(iii) генотипа AA по SNP BICF2P506595 (SNP 1);

(iv) генотипа GG по SNP BICF2P772765 (SNP 2);

(v) генотипа CC по SNP BICF2S2333187 (SNP 3);

(vi) генотипа GG по SNP BICF2P 1324008 (SNP 4); и/или

(vii) генотипа AA или AG по SNP BICF2P591872 (SNP 5);

и определение, таким образом, содержания в геноме собаки одного или более полиморфизмов, указывающих на защиту от накопления или на предрасположенность к накоплению меди в печени. Более предпочтительный способ включает детекцию присутствия или отсутствия генотипа по пункту (iii); генотипа по пункту (iv), (v) и (vi); или генотипа по пункту (vii). Еще более предпочтительный способ включает детекцию присутствия или отсутствия всех 5 генотипов по пунктам (iii)-(vii).

ДНК собаки можно типировать по:

(i) одному или более SNP, выбранным из (a) SNP, приведенных в таблице VI (ATP7a_Reg3_F_6 (SNP 142)), и (b) одному или более SNP, которые находятся в неравновесном сцеплении с указанным SNP (a), таким как SNP, приведенный в таблице X (ATP7a_Regl6_F_42 (SNP 143)); и

(ii) одному или более SNP, выбранным из (a) SNP, приведенных в таблицах III, IV и V, и (b) одному или более SNP, которые находятся в неравновесном сцеплении с указанным (a).

Типирование нуклеотида (нуклеотидов), присутствующего в геноме собаки в положении, указанном в одной из таблиц III, IV, V, VI или X, может представлять собой типирование нуклеотида, присутствующего в данном положении в последовательности, точно соответствующей последовательности, приведенной в таблице III, IV, V, VI или X. Однако следует понимать, что у тестируемой собаки необязательно должно присутствовать точное соответствие последовательностям, представленным в SEQ ID NO:1-5, приведенных в таблице III, SEQ ID NO:6-130, приведенных в таблице IV, SEQ ID NO:131-141, приведенных в таблице V, и SEQ ID NO:142, приведенной в таблице VI, и SEQ ID NO:143, приведенной в таблице X. Следовательно, типирование присутствующего нуклеотида можно проводить по положению, указанному в таблице III, IV, V, VI или X, или по эквивалентному или соответствующему положению последовательности. Термин эквивалентный в данном описании относится к положению, соответствующему указанному в таблице III, IV, V, VI или X. Последовательность и, следовательно, положение SNP может варьировать, например, вследствие делеций или добавлений нуклеотидов в геном собаки. Специалисты в данной области могут определить положение, которое соответствует или является эквивалентным соответствующему положению одной из SEQ ID NO:1-143, с помощью, например, компьютерной программы, такой как GAP, BESTFIT, COMPARE, ALIGN, PILEUP или BLAST. Пакет UWGCG содержит программы, включающие GAP, BESTFIT, COMPARE, ALIGN и PILEUP, с помощью которых можно рассчитывать гомологию или выравнивать последовательности (например, с использованием параметров по умолчанию). Алгоритм BLAST также можно использовать для сравнения или выравнивания двух последовательностей, как правило, с помощью параметров по умолчанию. Программное обеспечение BLAST для проведения сравнения двух последовательностей является широкодоступным и может быть получено из Национального центра биотехнологической информации (http://www.ncbi.nlm.nih.gov/). Данный алгоритм подробно описан ниже. Подобные широкодоступные инструменты для выравнивания и сравнения последовательностей, такие как программы ALIGN и CLUSTALW, можно найти на сайте Европейского института биоинформатики (http://www.ebi.ac.uk).

Существует ряд различных способов, позволяющих определить, указывает ли полиморфизм на предрасположенность к накоплению меди в печени или на наличие защиты от накопления меди в печени. Как правило, кандидатный полиморфизм сравнивают с базой данных полиморфизмов, где указана их связь с предрасположенностью к накоплению меди в печени или с защитой от накопления меди в печени. Такую базу данных получают путем фенотипирования группы собак по накоплению меди в печени, например путем биопсии печени и классификации собак по уровню накопления меди. Собак из данной группы также генотипируют по ряду полиморфизмов. Затем можно определить связь каждого генотипа с уровнем меди в печени. Таким образом, определение связи полиморфизма с предрасположенностью к накоплению меди в печени или с наличием защиты от накопления меди в печени, осуществляют путем определения места полиморфизма в базе данных.

Если не определять место полиморфизма в базе данных, как описано выше, связь полиморфизма с предрасположенностью к накоплению меди в печени или с наличием защиты от накопления меди в печени, можно определить другим способом. А именно, можно провести фенотипирование группы собак по накоплению меди в печени и классификацию собак по уровню накопления меди в печени. Затем собак из данной группы генотипируют по представляющему интерес полиморфизму. Затем определяют корреляцию генотипов и уровня меди в печени, чтобы установить связь генотипов с уровнем меди в печени.

Путем детекции присутствия или отсутствия в геноме собаки одного или более полиморфизмов настоящего изобретения определяют предрасположенность собаки к накоплению меди в печени или наличие у собаки защиты от накопления меди в печени. Генотип каждого полиморфизма, взятого отдельно или в сочетании с другими полиморфизмами, указывает на наличие защиты от накопления меди в печени или на предрасположенность к накоплению меди в печени.

Подобным образом, наличие у собаки защиты от накопления меди в печени можно определить путем генотипирования в геноме собаки SNP, приведенного в таблице VI, с использованием образца ДНК собаки. Эта функциональная мутация находится в ATP7A (на X-хромосоме) и обеспечивает защиту, если собака является гомозиготной по данной мутации (TT). Это может объяснять предрасположенность самок к хроническому гепатиту, поскольку самцы имеют только одну копию X-хромосомы и являются гемизиготными по локусу ATP7A. X-связанный рецессивный генный эффект с большей вероятностью наблюдается у самцов, чем у самок, вследствие гемизиготного статуса X-хромосомы самцов. Описанный в данном описании защитный эффект является рецессивным, поэтому он чаще встречается в популяции самок (см. пример 2, таблицу VII и фигуру 5). После определения генотипа SNP можно установить, имеет ли собака защиту от накопления меди в печени. Присутствие альтернативного аллеля (T) указывает на наличие защиты от накопления меди в печени. Собака, которая является гомозиготной по альтернативного аллеля (TT), с большей вероятностью защищена от накопления меди в печени. Таким образом, предпочтительный способ настоящего изобретения включает определение присутствия или отсутствия аллеля T SNP ATP7A в геноме собаки. Способ может включать определение гомозиготности (в случае самок собак) или гемизиготности (в случае самцов собак) собаки по аллелю T SNP ATP7A.

Если способ дополнительно включает тестирование на присутствие или отсутствие SNP, указывающих на предрасположенность к накоплению меди в печени, можно использовать модель, которая объединяет результаты с получением общей оценки риска предрасположенности собаки к накоплению или вероятности защищенности собаки от накопления меди в печени. В качестве примера в таблице I приведены разные возможные генотипы, включающие сочетание 5 SNP в областях генов GOLGA5, UBL5 и ATP7A, и процент собак с указанными генотипами, которые имеют высокое содержание меди (уровень меди в печени выше 600 мг/кг). В данном примере, чтобы определить предрасположенность собаки к накоплению меди в печени, можно генотипировать 5 SNP в геноме собаки с использованием образца ДНК собаки. После определения генотипов SNP их можно превратить в бинарные значения на основе ключа, приведенного в примере 1, т.е. на основе степени зависимости высокого содержания меди от генотипа. Затем с использованием таблицы 1 бинарные значения превращают в фактор риска на основе процента собак, которые имеют данный генотип и высокое содержание меди. Таким образом, указанные результаты можно объединить с результатами по защитному полиморфизму (полиморфизмам).

С помощью способа настоящего изобретения можно протестировать собаку любого возраста, например, собаку в возрасте от 0 до 12 лет, от 0 до 6 лет, от 0 до 5 лет, от 0 до 4 лет, от 0 до 3 лет, от 0 до 2 лет или от 0 до 1 года. Предпочтительно собаку тестируют в максимально раннем возрасте, например, в течение первого года, первых 6 месяцев или первых 3 месяцев жизни. Предпочтительно собаку тестируют до накопления меди. История собаки может быть известна или неизвестна. Например, собака может быть щенком известных родителей, которые могут иметь известную историю в отношении накопления меди. Альтернативно, собака может представлять собой заблудившееся или спасенное животное с неизвестной родословной и историей.

С помощью способа настоящего изобретения можно протестировать собаку любой породы. Изобретение предлагает способ определения содержания в геноме собаки смешанной или гибридной породы, или дворняги, или аутбредной собаки, одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени или на предрасположенность к накоплению меди в печени.

Если способ используют для определения содержания в геноме собаки одного или более полиморфизмов, указывающих на защищенность от накопления меди в печени, собака может быть предположительно может иметь защиту от накопления меди в печени. Альтернативно, собака может иметь риск предрасположенности или она может иметь предрасположенность к накоплению меди в печени. В предпочтительном способе настоящего изобретения собака наследует генетические признаки породы лабрадор ретривер, золотистый ретривер или карликовый пудель. Собака может относиться к смешанной или гибридной породе, или она может представлять собой дворнягу или аутбредную собаку. Собака может наследовать по меньшей мере 25%, по меньшей мере 50% или по меньшей мере 100% генома любой чистой породы или, более предпочтительно, любой породы, выбранной из лабрадора ретривера, золотистого ретривера или карликового пуделя. Собака может быть чистопородной. В одном варианте осуществления настоящего изобретения один или оба родителя тестируемой собаки являются или были чистопородными собаками. В другом варианте осуществления один или более прародителей являются или были чистопородными собаками. Один, два, три или все четыре прародителя тестируемой собаки могут быть или могли быть чистопородными собаками.

Предпочтительно, в способе определения содержания в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени, собака наследует генетические признаки лабрадора ретривера. Собака может быть чистопородным лабрадором ретривером. Альтернативно, собака может относиться к смешанной или гибридной породе, или она может представлять собой аутбредную собаку (дворнягу). Один или оба родителя могут представлять собой чистопородных лабрадоров ретриверов. Один, два, три или четыре прародителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Собака может наследовать по меньшей мере 50% или по меньшей мере 75% генетического фона породы лабрадор ретривер. Таким образом, по меньшей мере 50% или по меньшей мере 75% генома собаки может представлять собой геном породы лабрадор ретривер.

Генетический фон породы собаки можно определить путем оценки частоты аллелей генетических маркеров, таких как SNP или микросателлиты. Сочетания частот аллелей разных SNP или микросателлитов у собаки являются характерным признаком, позволяющим идентифицировать породу собаки или породы, составляющие смешанную породу собаки. Такой генетический тест может быть коммерчески доступным. Альтернативно, собака может не нуждаться в тестировании на наследование генетических признаков конкретной породы, если собственник собаки или ветеринар предполагает, что собака наследует признаки определенной породы. Такое предположение может быть сделано на основе сведений о родословной собаки или на основе ее внешнего вида.

Предсказательный тест настоящего изобретения можно проводить в сочетании с одним или несколькими другими предсказательными или диагностическими тестами, такими как определение генетического фона породы/наследственности собаки или ее предрасположенности к одному или более другим заболеваниям.

Детекция полиморфизмов

Детекция полиморфизмов в соответствии с настоящим изобретением может включать приведение в контакт полинуклеотида или белка, находящегося в образце, полученном от собаки, со связующим средством, специфичным для полиморфизма, и определение связывания средства с полинуклеотидом или белком, где связывание средства указывает на наличие полиморфизма, и отсутствие связывания указывает на отсутствие полиморфизма.

Способ обычно осуществляют in vitro на образце, полученном от собаки, где образец содержит ДНК собаки. Как правило, образец представляет собой жидкость организма и/или клетки собаки и может быть получен, например, путем смыва, такого как смыв полости рта. Образец может представлять собой образец крови, мочи, слюны, кожи, буккальную клетку или образец корня волоса. Перед проведением способа образец обычно обрабатывают, например, проводят экстракцию ДНК. Полинуклеотид или белок в образце можно расщепить физически или химически, например, с помощью подходящего фермента. В одном варианте осуществления перед детекцией полиморфизма часть полинуклеотида в образце размножают или амплифицируют, например, путем клонирования или с помощью метода ПЦР.

В настоящем изобретении один или более способов могут включать определение присутствия или отсутствия у собаки одного или более полиморфизмов. Как правило, полиморфизм детектируют путем непосредственного определения присутствия полиморфной последовательности в полинуклеотиде или белке собаки. Такой полинуклеотид обычно представляет собой геномную ДНК, мРНК или кДНК. Полиморфизм можно детектировать с помощью любого подходящего способа, такого как описанные ниже способы.

Специфическое связующее средство представляет собой средство, которое связывается селективно или с высокой аффинностью с белком или полипептидом, содержащим полиморфизм, но не связывается или связывается только с низкой аффинностью с другими полипептидами или белками. Специфическое связующее средство может представлять собой зонд или праймер. Зонд может представлять собой белок (такой как антитело) или олигонуклеотид. Зонд может представлять собой меченую молекулу или он может быть помечен косвенным способом. Связывание зонда с полинуклеотидом или белком можно использовать для иммобилизации либо зонда, либо полинуклеотида или белка.

Как правило, в данном способе полиморфизм можно детектировать путем определения связывания средства с полиморфным полинуклеотидом или белком собаки. Однако в одном варианте осуществления средство также способно связываться с соответствующей последовательностью дикого типа, например, путем связывания нуклеотидов или аминокислот, которые фланкируют вариантное положение, хотя характер связывания последовательности дикого типа заметно отличается от связывания полинуклеотида или белка, содержащего полиморфизм.

В основе способа может лежать анализ лигирования олигонуклеотидов, в котором используют два олигонуклеотидных зонда. Указанные зонды связываются с областями полинуклеотида, примыкающими к области, содержащей полиморфизм, что позволяет после связывания лигировать два зонда с помощью соответствующего фермента лигазы. Однако наличие одного несовпадения в одном из зондов может нарушить связывание и лигирование. Такое лигирование зондов может происходить только в полинуклеотиде, который содержит полиморфизм, и, следовательно, детекцию лигированного продукта можно использовать для определения присутствия полиморфизма.

В одном варианте осуществления зонд используют в системе, основанной на гетеродуплексном анализе. В такой системе, если зонд связан с полинуклеотидной последовательностью, содержащей полиморфизм, он образует гетеродуплекс в области полиморфизма и, следовательно, не образует двухцепочечную структуру. Такую гетеродуплексную структуру можно детектировать с помощью фермента, специфичного к одноцепочечной или двухцепочечной структуре. Как правило, зонд представляет собой зонд РНК, гетеродуплексную область расщепляют с помощью РНК-азы H и полиморфизм идентифицируют путем детекции продуктов расщепления.

Способ может быть основан на флуоресцентном анализе несоответствий химического расщепления, который описан, например, в PCR Methods and Applications 3, 268-71 (1994) и Proc. Natl. Acad. Sci. 85, 4397-4401 (1998).

В одном варианте осуществления используют праймер ПЦР, который инициирует реакцию ПЦР только при связывании с полинуклеотидом, содержащим полиморфизм, например, в последовательность-специфичной системе ПЦР, где полиморфизм можно идентифицировать путем детекции продукта ПЦР. Предпочтительно участок праймера, комплементарный полиморфизму, находится на 3'-конце или вблизи 3'-конца праймера. Присутствие полиморфизма можно определить с помощью ПЦР анализа, в котором используют флуоресцентный краситель и гаситель, такого как ПЦР с системой детекции Taqman.

Специфическое связующее средство способно специфически связывать аминокислотную последовательность, кодируемую полиморфной последовательностью. Например, такое средство может представлять собой антитело или фрагмент антитела. В способе детекции можно использовать метод ELISA. Способ может быть основан на использовании RFLP. Способ используют, если присутствие полиморфизма в полинуклеотиде создает или разрушает область рестрикции, распознаваемую ферментом рестрикции.

Присутствие полиморфизма можно определить по обусловленному полиморфизмом изменению подвижности полинкулеотида или белка в процессе гель-электрофореза. В случае полинуклеотида можно использовать анализ одноцепочечного конформационного полиморфизма (SSCP) или электрофорез в градиенте денатурирующего геля (DDGE). В другом способе детекции присутствие полиморфизма в полинуклеотиде определяют путем секвенирования полинуклеотида на протяжении участка, содержащего полиморфизм.

Присутствие полиморфизма можно определить методом резонансного переноса энергии флуоресценции (FRET). В частности, полиморфизм можно детектировать с помощью двойной системы гибридизационных зондов. Данный способ включает применение двух олигонуклеотидных зондов, расположенных близко друг к другу и комплементарных внутреннему сегменту представляющего интерес полинуклеотида-мишени, где оба зонда помечены флуорофором. В качестве флуорофора можно использовать любые подходящие флуоресцентные метки или красители, при условии, что длина волны эмиссии флуорофора на одном зонде (донор) совпадает с длиной волны возбуждения флуорофора на втором зонде (акцептор). Как правило, в качестве донорного флуорофора используют флуоресцеин (FAM), и конкретные акцепторные флуорофоры включают техасовый красный, родамин, LC-640, LC-705 и цианин 5 (Cy5).

Чтобы произошел резонансный перенос энергии флуоресценции, после гибридизации обоих зондов с мишенью два флуорофора должны разместиться в непосредственной близости друг от друга. После возбуждения донорного флуорофора светом с соответствующей длиной волны, энергия спектра испускания переносится на флуорофор акцепторного зонда, инициируя его флуоресценцию. Следовательно, детекция излучения данной длины волны при возбуждении светом с длиной волны, подходящей для донорного флуорофора, указывает на гибридизацию и близкое расположение флуорофоров, находящихся на двух зондах. Зонды метят флуорофором по одному концу, так что зонд, расположенный выше по ходу считывания (5'), содержит метку на 3'-конце, и зонд, расположенный ниже (3'), содержит метку на 5'-конце. Расстояние между двумя зондами после их связывания с последовательностью-мишенью может составлять от 1 до 20 нуклеотидов, предпочтительно от 1 до 17 нуклеотидов, более предпочтительно от 1 до 10 нуклеотидов, например, 1, 2, 4, 6, 8 или 10 нуклеотидов.

Первый из двух зондов можно сконструировать так, чтобы он связывался с консервативной последовательностью гена, примыкающей к участку полиморфизма, и второй зонд можно сконструировать так, чтобы он связывался с участком, содержащим один или более полиморфизмов. Полиморфизмы в последовательности гена, на которую направлен второй зонд, можно детектировать путем определения изменения температуры плавления в результате несовпадения оснований. Степень изменения температуры плавления зависит от числа и типа оснований, участвующих в нуклеотидных полиморфизмах.

Типирование полиморфизма также можно осуществлять методом удлинения праймера. В данном методе целевой участок, окружающий полиморфный участок, размножают или амплифицируют, например, методом ПЦР. Затем проводят реакцию одноосновного секвенирования с использованием праймера, который гибридизуется на расстоянии одного основания от полиморфного участка (аллель-специфичное включение нуклеотида). Затем детектируют продукт удлинения праймера, чтобы определить нуклеотид, присутствующий в полиморфном участке. Существует несколько способов детекции продукта удлинения. В одном способе детекции для остановки реакции удлинения на полиморфном участке используют, например, флуоресцентно меченные дидезоксинуклеотидные терминаторы. Альтернативно, используют дидезоксинуклеотидные терминаторы с измененной массой и продукты удлинения праймера детектируют с помощью масс-спектрометрии. Путем специфического мечения одного или более терминаторов можно определить последовательность удлиненного праймера и, следовательно, нуклеотид, присутствующий в полиморфном участке. В одной реакции можно анализировать несколько продуктов и, следовательно, можно определить нуклеотид, присутствующий на обеих гомологичных хромосомах, если используют несколько специфически меченых терминаторов.

Изобретение также предлагает праймеры или зонды, которые можно использовать для детекции любого из описанных в настоящем описании SNP с целью определения предрасположенности к накоплению меди. Полинуклеотиды настоящего изобретения также можно использовать в качестве праймеров в реакциях удлинения праймеров для детекции описанных в данном описании SNP.

Длина таких праймеров, зондов и других полинуклеотидных фрагментов предпочтительно составляет по меньшей мере 10, предпочтительно по меньшей мере 15, или по меньшей мере 20, например, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 40 нуклеотидов. Как правило, их длина составляет 40, 50, 60, 70, 100 или 150 нуклеотидов. Зонды и фрагменты могут иметь в длину более 150 нуклеотидов, например, до 200, 300, 400, 500, 600, 700 нуклеотидов, или они могут быть короче полноразмерной полинуклеотидной последовательности настоящего изобретения всего на несколько нуклеотидов, например на пять или десять нуклеотидов.

Праймеры и зонды для генотипирования SNP настоящего изобретения можно сконструировать с помощью любого известного в данной области программного обеспечения для конструирования последовательностей, используя последовательности SNP, приведенные в таблицах III, IV, V, VI или X. Для конструирования праймеров и зондов также можно использовать гомологи указанных полинуклеотидных последовательностей. Такие гомологи, как правило, гомологичны по меньшей мере на 70%, предпочтительно по меньшей мере на 80, 90%, 95%, 97% или 99%, например, области, содержащей по меньшей мере 15, 20, 30, 100 или более смежных нуклеотидов. Гомологию можно рассчитать на основе идентичности нуклеотидов (иногда такую гомологию называют "строгая гомология").

Например, пакет UWGCG содержит программу BESTFIT, с помощью которой можно рассчитывать гомологию (например, используя параметры по умолчанию) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). Алгоритмы PILEUP и BLAST можно использовать для расчета гомологии или выравнивания последовательностей, например, для идентификации эквивалентных или подобных последовательностей (как правило, с использованием параметров по умолчанию), например, как описано в Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al. (1990) J Mol Biol 215:403-10.

Программное обеспечение для проведения анализов BLAST является широкодоступным и может быть получено из Национального центра биотехнологической информации (http://www.ncbi.nlm.nih.gov/). Данный алгоритм включает вначале определение пар последовательностей с максимальным сходством (HSP - high scoring sequence pairs) путем идентификации коротких слов длиной W в исследуемой последовательности, которые либо совпадают, либо удовлетворяют некоторому положительному значению параметра T, при выравнивании с элементом информации (словом) такой же длины из последовательности, полученной из базы данных. T представляет собой параметр, задающий длину слова (Altschul et al., supra). Указанные совпадения исходных слов используют для инициации поиска содержащих их HSP. Совпадающие слова продлевают в обоих направлениях вдоль каждой последовательности до тех пор, пока это не перестанет приводить к увеличению кумулятивной оценки выравнивания. Удлинение совпадающих слов в каждом направлении останавливают, если: кумулятивная оценка выравнивания уменьшается на величину X по сравнению с максимальным значением; кумулятивная оценка падает до нуля или ниже вследствие накопления одного или более выравниваний, содержащих остатки с отрицательными оценками; достигнут конец одной из последовательностей. Параметры алгоритма BLAST W, T и X определяют чувствительность и скорость выравнивания. Программа BLAST использует по умолчанию длину слова (W) 11, матрицу замен BLOSUM62 (см. Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919), число битов (B) 50, достоверность (E) 10, M=5, N=4, и сравнение обоих цепей.

С помощью алгоритма BLAST можно осуществлять статистический анализ подобия двух последовательностей; см., например, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. Мера подобия, предлагаемая алгоритмом BLAST, представляет собой вероятность наименьшей суммы (Р(N)), которая является показателем вероятности случайного совпадения двух нуклеотидных или аминокислотных последовательностей. Например, аминокислотная последовательность считается подобной другой последовательности, если вероятность наименьшей суммы при сравнении первой последовательности со второй последовательностью составляет менее чем приблизительно 0,1, более предпочтительно менее чем приблизительно 0,01, и, наиболее предпочтительно менее чем приблизительно 0,001.

Гомологичные последовательности обычно различаются по меньшей мере 1, 2, 5, 10, 20 или более мутациями, которые могут представлять собой замены, делеции или инсерции нуклеотидов.

Полинуклеотиды настоящего изобретения, такие как праймеры или зонды, могут присутствовать в выделенном или практически очищенном виде. После смешивания с носителями или разбавителями, которые не препятствуют их предполагаемому использованию, они все еще могут считаться практически выделенными. Полинуклеотиды находятся в практически очищенном виде, если их препарат содержит по меньшей мере 90%, например, по меньшей мере 95%, 98% или 99% полинуклеотидов.

Детекторные антитела

Детекторное антитело представляет собой антитело, специфичное к одному полиморфизму, но не связывающееся ни с каким другим полиморфизмом, описанным в данном описании. Детекторные антитела используют, например, в способах очистки, выделения или скрининга, включающих методы иммунопреципитации.

Можно получить антитела против конкретных эпитопов полипептидов настоящего изобретения. Антитело или другое соединение "специфически связывается" с полипептидом, если оно связывается селективно или с высокой аффинностью с белком-мишенью, но по существу не связывается или связывается только с низкой аффинностью с другими полипептидами. Для определения способности антитела к специфическому связыванию можно использовать ряд хорошо известных в данной области методов конкурентного связывания или иммунорадиометрических анализов (см., например, Maddox et al., J. Exp. Med. 158, 1211-1226, 1993). Такие иммуноанализы обычно включают образование комплексов конкретного белка и специфичного к нему антитела и измерение комплексообразования.

Если не указано иное, термин "антитело", для целей настоящего изобретения, охватывает фрагменты, которые связывают полипептид настоящего изобретения. Такие фрагменты включают фрагменты Fv, F(ab') и F(ab')2, а также одноцепочечные антитела. Кроме того, антитела и их фрагменты могут представлять собой химерные антитела, CDR-привитые антитела или гуманизированные антитела.

Антитела могут быть использованы в способе детекции полипептидов настоящего изобретения в биологическом образце (таком как любой из приведенных в данном описании образцов), который включает:

I получение антитела настоящего изобретения;

II инкубацию биологического образца с указанным антителом в условиях, которые обеспечивают образование комплекса антитело-антиген; и

III определение образования комплекса антитело-антиген, содержащего антитело.

Антитела настоящего изобретения можно получить с помощью любого подходящего способа. Способы получения и характеризации антител хорошо известны в данной области, см., например Harlow and Lane (1988) "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Например, антитело можно получить путем индуцирования у животного-хозяина продукции антитела против целого полипептида или его фрагмента, например, его антигенного эпитопа, далее называемого "иммуноген". Фрагмент может представлять собой любой из приведенных в данном описании фрагментов (как правило, его длина составляет по меньшей мере 10 или по меньшей мере 15 аминокислот).

Способ получения поликлонального антитела включает иммунизацию подходящего животного-хозяина, например, экспериментального животного, иммуногеном и выделение иммуноглобулинов из сыворотки животного. Соответственно, животное можно инокулировать иммуногеном, затем у животного можно взять кровь и выделить фракцию IgG. Способ получения моноклонального антитела включает иммортализацию клеток, которые продуцируют целевое антитело. Клетки гибридомы можно получить путем гибридизации клеток селезенки инокулированного экспериментального животного опухолевыми клетками (Kohler and Milstein (1975) Nature 256, 495-497).

Селекцию иммортализованных клеток, продуцирующих целевое антитело, можно проводить с помощью традиционного способа. Гибридомы можно выращивать в культуре или их можно вводить внутрибрюшинно, для образования асцитной жидкости, или в кровоток аллогенного или иммунокомпетентного хозяина. Человеческое антитело можно получить путем иммунизации человеческих лимфоцитов in vitro с последующей трансформацией лимфоцитов вирусом Эпштейна-Барра.

Для получения как моноклональных, так и поликлональных антител в качестве экспериментального животного можно использовать козу, кролика, крысу, мышь, морскую свинку, курицу, овцу или лошадь. При желании, иммуноген можно вводить в виде конъюгата, который содержит иммуноген, соединенный, например, через боковую цепь одного из аминокислотных остатков, с подходящим носителем. Молекула носителя, как правило, представляет собой физиологически приемлемый носитель. Полученное антитело может быть выделено и, если это желательно, очищено.

Набор для детекции

Изобретение также обеспечивает набор, который включает средства для типирования одного или более определенных в данном описании полиморфизмов. В частности, такие средства могут включать специфическое связующее средство, зонд, праймер, пару или сочетание праймеров, или антитело, включающее фрагмент антитела, определенный в данном описании, которое можно использовать для детекции или которое может способствовать детекции определенных в данном описании полиморфизмов. Праймер или пара или сочетание праймеров могут представлять собой специфичные к последовательности праймеры, которые только инициируют ПЦР-амплификацию полинуклеотидной последовательности, которая содержит подлежащий детекции полиморфизм, описанный в данном описании. Альтернативно, праймер или пара праймеров могут быть специфичными не к полиморфному нуклеотиду, а к области, находящейся выше (5') и/или ниже (3') данного нуклеотида. Указанные праймеры позволяют амплифицировать область, окружающую полиморфный нуклеотид. Набор, подходящий для применения в методе удлинения праймера, может специально включать трифосфаты меченных дидезоксинуклеотидов (ddNTP). Они могут содержать, например, флуоресцентную метку, или они могут иметь измененную массу, что позволяет детектировать продукт удлинения и, следовательно, нуклеотид, присутствующий в полиморфном положении.

Набор также может содержать специфическое связующее средство, зонд, праймер, пару или сочетание праймеров, или антитело, которое можно использовать для детекции отсутствия полиморфизма. Набор может дополнительно содержать буферы или водные растворы.

Набор также может содержать один или более других реагентов или инструментов, позволяющих осуществить приведенные выше варианты осуществления способа. Такие реагенты или инструменты могут включать один или более из следующих реагентов и инструментов: средства для детекции связывания агента с полиморфизмом, детектируемую метку, такую как флуоресцентная метка, фермент, способный воздействовать на полинуклеотид, такой как полимераза, рестриктаза, лигаза, РНКаза H или фермент, который может присоединять метку к полинуклеотиду, подходящий буфер (буферы) или водные растворы для ферментных реагентов, праймеры ПЦР, которые связываются с участками, фланкирующими полиморфизм, как указано в данном описании, положительный и/или отрицательный контроль, аппаратуру для гель-электрофореза, средства для выделения ДНК из образца, средства для получения образца от субъекта, такие как тампон на стержне или инструмент, содержащий иглу, или штатив, содержащий лунки, в которых можно проводить реакции детектирования. Набор может представлять собой или включать чип, такой как полинуклеотидный чип, содержащий специфическое связующее средство, предпочтительно, зонд настоящего изобретения. Как правило, набор содержит ряд инструкций по применению.

Биоинформатика

Последовательности, содержащие полиморфизмы, можно хранить в электронном формате, например, в компьютерной базе данных. Соответственно, изобретение предоставляет базу данных, содержащую информацию, относящуюся к SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и/или одному или более полиморфизмам, которые находятся с ними в неравновесном сцеплении, а также к их связи с защитой собаки от накопления меди в печени. База данных также может содержать информацию, относящуюся к одному или более полиморфизмам в генах GOLGA5, ATP7A или UBL5 и/или одному или более полиморфизмам, которые находятся с ними в неравновесном сцеплении, а также к их связи с предрасположенностью собаки к накоплению меди в печени. База данных также может содержать дополнительную информацию о полиморфизме, например, о степени связи полиморфизма с защитой от накопления или с предрасположенностью к накоплению меди в печени.

Описанную в данном описании базу данных можно использовать для определения содержания в геноме собаки одного или более полиморфизмов, указывающих на защиту от накопления или на предрасположенность к накоплению меди в печени. Такое определение можно проводить с помощью электронных средств, например, путем использования компьютерной системы (такой как PC).

Как правило, определение содержания в геноме собаки одного или более полиморфизмов, указывающих на защиту от накопления меди в печени, проводят путем ввода в компьютерную систему генетических данных собаки; сравнения генетических данных с базой данных, содержащей информацию, относящуюся к SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и/или одному или более полиморфизмам, которые находятся с ним в неравновесном сцеплении, а также к их связи с защищенностью собаки от накопления меди в печени, и, необязательно, содержащей информацию, относящуюся к одному или более полиморфизмам в генах GOLGA5, ATP7A или UBL5 и/или одному или более полиморфизмам, которые находятся с ними в неравновесном сцеплении, а также к их связи с предрасположенностью собаки к накоплению меди в печени; и определения на основе этого сравнения содержания в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени. Такую информацию можно затем использовать для регуляции уровней меди в печени собаки.

Изобретение также предоставляет компьютерную программу, которая содержит программные средства, обеспечивающие проведение всех стадий способа настоящего изобретения, при выполнении указанной программы на компьютере. Кроме того, изобретение предоставляет компьютерный программный продукт, который содержит программные средства, сохраненные на машиночитаемом носителе, обеспечивающие проведение способа настоящего изобретения при выполнении указанной программы на компьютере. Дополнительно предоставляется компьютерный программный продукт, содержащий программные средства на волне несущей частоты, которые при выполнении на компьютерной системе инструктируют ее в отношении проведения способа настоящего изобретения.

Как показано на фиг.4, изобретение также предоставляет аппаратуру, предназначенную для проведения способа настоящего изобретения. Аппаратура обычно включает компьютерную систему, такую как PC. В одном варианте осуществления компьютерная система содержит: средства 20 для получения генетических данных собаки; модуль 30 для сравнения данных с базой данных 10, содержащей информацию, относящуюся к полиморфизмам; и средства 40 для определения на основе указанного сравнения содержания в геноме собаки одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени или на защиту собаки от накопления меди в печени.

Инструменты улучшения породы

Племенную ценность определяют как ценность субъекта, являющегося родителем, и традиционно используют для улучшения желательных признаков породы в сельском хозяйстве. Чтобы улучшить способность собак к усвоению меди в целом и уменьшить встречаемость ассоциированных с медью заболеваний, таких как хронический гепатит, для бридинга предпочтительно выбирают собак, имеющих защиту от накопления меди в печени. Отбор таких собак, оказывающий влияние на бридинг, можно проводить с использованием полиморфизмов, указывающих на наличие защиты от накопления меди в печени.

Например, на способность потомства двух собак к усвоению меди может влиять генотип родителей по локусу ATP7A. Передача конкретного варианта данного локуса может оказывать благоприятное действие на потомство. Путем определения генотипа по данному локусу можно определить племенную ценность будущего родителя и, таким образом, решить, подходит ли конкретная пара для проведения бридинга.

Соответственно, изобретение предлагает способ выбора собаки для получения потомства с защитой от накопления меди в печени, который включает определение с помощью способа настоящего изобретения содержания в геноме первой собаки-кандидата одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени; и определение, таким образом, пригодности первой собаки-кандидата для получения потомства, защищенного от накопления меди в печени. Способ может дополнительно включать определение с помощью способа настоящего изобретения содержания в геноме второй собаки, пол которой противоположен полу первой собаки, одного или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени. Если результаты свидетельствуют о том, что первая и/или вторая собака имеет генотип, указывающий на наличие защиты от накопления меди в печени, можно первую собаку повязать со второй собакой, чтобы получить потомство, имеющее защиту от накопления меди в печени.

Например, способ может включать определение присутствия или отсутствия одного или более полиморфизмов, выбранных из SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), и одного или более полиморфизмов, которые находятся с ними в неравновесном сцеплении, в геноме первой собаки-кандидата. Более предпочтительно способ может включать определение присутствия или отсутствия SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) и/или SNP ATP7a_Reg16_F_42 (SEQ ID NO:143). Способ настоящего изобретения может включать определение присутствия или отсутствия аллеля T ATP7a_Reg3_F_6 (SEQ ID NO:142) и/или аллеля T SNP ATP7a_Reg16_F_42 (SEQ ID NO:143). Еще более предпочтительно, способ может включать определение, является ли собака гомозиготной (в случае самок собак) или гемизиготной (в случае самцов собак) по аллелю T SNP ATP7a_Reg3_F_6 и/или SNP ATP7a_Reg16_F_42 (SEQ ID NO:143). Присутствие SNP указывает на то, что собака имеет защиту от накопления меди в печени и, следовательно, является хорошим кандидатом для вязки со второй собакой. Предпочтительно первая и вторая собаки являются гомозиготными или гемизиготными по аллелю T SNP. Наиболее предпочтительно первая и/или вторая собака является гомозиготной, поскольку гомозиготность увеличивает вероятность того, что потомство будет гомозиготным и, следовательно, будет иметь защиту от накопления меди в печени.

Изобретение также предоставляет способ выбора собаки для получения потомства с защитой от накопления меди в печени с использованием полиморфизмов настоящего изобретения, которые указывают на предрасположенность к накоплению меди. Отсутствие таких полиморфизмов в геноме собаки указывает на то, что такая собака является хорошим кандидатом для вязки. Способ включает определение с помощью способа настоящего изобретения содержания в геноме первой собаки-кандидата одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени; и определение, таким образом,, подходит ли первая собака-кандидат для получения потомства с защитой от накопления меди в печени.

Способ также может включать детекцию присутствия или отсутствия в геноме первой собаки-кандидата (c) полиморфизма в гене GOLGA5, ATP7a или UBL5, указывающего на предрасположенность к накоплению меди в печени, и/или (d) полиморфизма, находящегося в неравновесном сцеплении с указанным полиморфизмом (c). Способ может дополнительно включать определение в геноме второй собаки, пол которой противоположен полу первой собаки, одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени. Следовательно, способ может включать детекцию присутствия или отсутствия в геноме второй собаки (c) полиморфизма в гене GOLGA5, ATP7a или UBL5, указывающего на предрасположенность к накоплению меди в печени, и/или (d) полиморфизма, находящегося в неравновесном сцеплении с указанным полиморфизмом (c). Если результаты свидетельствуют о том, что генотип первой и/или второй собаки не указывает на предрасположенность к накоплению меди в печени, первую собаку можно повязать со второй собакой, чтобы получить потомство, у которого отсутствует предрасположенность к накоплению меди в печени.

Способ может включать определение в геноме первой собаки-кандидата присутствия или отсутствия одного или более полиморфизмов, выбранных из SNP, приведенных в таблицах III, IV и V, и одного или более полиморфизмов, которые находятся с ними в неравновесном сцеплении. Присутствие одного или более из указанных полиморфизмов свидетельствует о том, что первая собака предрасположена к накоплению меди в печени и, следовательно, не является хорошим кандидатом для вязки со второй собакой с целью получения потомства с защитой от накопления меди в печени.

Первая собака-кандидат и/или вторая собака-кандидат могут относиться к любой породе. Предпочтительно первая собака-кандидат и/или вторая собака-кандидат наследуют генетические признаки породы, выбранной из лабрадора ретривера, золотистого ретривера и карликового пуделя. Более предпочтительно первая собака-кандидат и/или вторая собака-кандидат наследуют генетические признаки породы лабрадор ретривер. Собака может представлять собой чистопородного лабрадора ретривера. Альтернативно, собака может относиться к смешанной или гибридной породе или она может представлять собой аутбредную собаку (дворнягу). Один или оба родителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Один, два, три или четыре прародителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Генетический фон собаки может содержать по меньшей мере 50% или по меньшей мере 75% генетического фона породы лабрадор ретривер. Следовательно, по меньшей мере 50% или по меньшей мере 75% генома собаки составляет геном породы лабрадор ретривер.

Генетический фон породы собаки можно определить путем оценки частоты аллелей генетических маркеров, таких как SNP или микросателлиты. Сочетания частот аллелей разных SNP или микросателлитов у собаки являются характерным признаком, позволяющим идентифицировать породу собаки или породы, составляющие смешанную породу собаки. Такой генетический тест может быть коммерчески доступным. Альтернативно, собака может не нуждаться в тестировании на наследование генетических признаков конкретной породы, если собственник собаки или ветеринар предполагает, что собака наследует признаки определенной породы. Такое предположение может быть сделано на основе сведений о родословной собаки или на основе ее внешнего вида.

Наиболее чистопородные собаки, относящиеся к породам, которые можно найти в племенной книге всех пород собак, контролируются "закрытыми племенными книгами". Племенная книга, как правило, представляет собой официальную книгу записей собак, соответствующих стандартам определенной породы, которую ведет, например, ассоциация собаководов или клуб собаководства. Племенную книгу обычно называют "закрытой", если собаку в нее можно добавить только в том случае, если зарегистрированы оба родителя. Большинство пород имеет закрытые племенные книги, что свидетельствует об инбридинге, поскольку генетическое разнообразие не может пополняться за счет особей, не входящих в существующую популяцию. У многих пород, признанных клубами собаководов, это приводит к высокой встречаемости генетических заболеваний или нарушений и к другим проблемам, таким как уменьшение размеров помета, уменьшение продолжительности жизни и неспособность к естественному оплодотворению.

Чтобы избежать проблем, связанных с инбридингом, для улучшения породы предпочтительно выбирают собак, состоящих в более дальнем родстве, чем близкородственные собаки. Следовательно, в одном аспекте настоящего изобретения определяют генетические признаки породы у первой собаки-кандидата и у второй собаки-кандидата, с целью установления степени родства этих двух собак. В данном аспекте настоящего изобретения термин "генетические признаки породы" относится к генетической родословной собаки в пределах конкретной породы. Наследование собакой генетических признаков породы можно определить с помощью описанного в данном описании способа. Путем определения генетической наследственности собак можно различить собак в пределах одной породы и определить, насколько близким является их родство.

Таким образом, в одном аспекте настоящего изобретения определяют степень родства первой собаки-кандидата и второй собаки-кандидата путем сравнения генетических признаков породы первой собаки-кандидата и второй собаки-кандидата, относящихся к одной и той же породе. Предпочтительно собаки являются чистокровными собаками. Наследование генетических признаков породы каждой собакой можно определить, например, путем идентификации присутствия или отсутствия у указанной собаки одного или более характерных для данной породы полиморфизмов.

Степень родства можно определить исходя из числа характерных для данной породы полиморфизмов, общих для всех собак. Например, две собаки одной породы могут содержать от 0 до 100% характерных для данной породы полиморфизмов, тестируемых совместно, например, от 10 до 90%, от 20 до 80%, от 30 до 70% или от 40 до 60%. Следовательно, две собаки могут содержать по меньшей мере 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% или 90% характерных для данной породы полиморфизмов, тестируемых совместно. Процент совместно тестируемых характерных для данной породы полиморфизмов можно использовать в качестве меры степени их родства. В данном аспекте настоящего изобретения двух собак вяжут только в том случае, если они находятся в достаточно дальнем родстве. Например, их можно вязать только в том случае, если они содержат менее 60%, 50%, 40%, 30% или менее 20% характерных для данной породы полиморфизмов, тестируемых совместно.

Изобретение также предоставляет способ выбора одной или нескольких собак для бридинга с использованием испытуемой собаки, включающий:

(a) определение содержания в геноме испытуемой собаки и каждой собаки в тестируемой группе, состоящей из двух или более собак, пол которых противоположен полу испытуемой собаки, одного или более полиморфизмов, указывающих на защищенность от накопления меди в печени и необязательно одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени; и

(b) выбор одной или нескольких собак из тестируемой группы для бридинга с использованием испытуемой собаки.

Тестируемая группа может содержать по меньшей мере 2, 3, 4, 5, 10, 15, 20, 25, 30, 50, 75, 100 или 200 разных собак, например, от 2 до 100, от 5 до 70 или от 10 до 50 собак. Собак обычно выбирают из тестируемой группы по наличию защиты от накопления меди в печени. Собака или собаки, выбранные из тестируемой группы, могут иметь генетические признаки породы, идентичные или подобные генетическим признакам испытуемой собаки.

Испытуемая собака и все собаки из тестируемой группы могут относиться к любой породе. Предпочтительно испытуемая собака и/или все собаки из тестируемой группы имеют генетические признаки породы, выбранной из лабрадора ретривера, золотистого ретривера или карликового пуделя. Более предпочтительно собака имеет генетические признаки породы лабрадор ретривер. Собака может являться чистопородным лабрадором ретривером. Альтернативно, собака может относиться к смешанной или гибридной породе или она может представлять собой аутбредную собаку (дворнягу). Один или оба родителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Один, два, три или четыре прародителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Собака может содержать по меньшей мере 50% или по меньшей мере 75% генетического фона породы лабрадор ретривер. Таким образом, геном собаки содержит по меньшей мере 50% или по меньшей мере 75% генома породы лабрадор ретривер. В одном варианте осуществления настоящего изобретения для бридинга с использованием испытуемой собаки из тестируемой группы выбирают собаку, которая с наибольшей вероятностью защищена от накопления меди в печени, что определяют на основе присутствия или отсутствия полиморфизмов, связанных с предрасположенностью к накоплению меди в печени или с наличием защиты от накопления меди в печени. В другом варианте осуществления для бридинга с использованием испытуемой собаки из тестируемой группы выбирают ряд собак, имеющих большую вероятность защиты от накопления меди в печени. Например, из тестируемой группы можно выбрать по меньшей мере 2, 3, 4, 5, 10, 15 или 20 собак. В группе выбранных собак можно провести дополнительную селекцию по другим факторам, таким как географическое местоположение, возраст, племенное состояние, история болезни, восприимчивость к заболеванию или физические характеристики.

Как указано выше, если вязку проводят среди собак одной породы, желательно, чтобы они обладали минимальным генетическим родством. Это обеспечивает увеличение или сохранение генетического разнообразия в пределах породы и уменьшает вероятность возникновения у потомства проблем, связанных с инбридингом. Следовательно, дополнительную селекцию собак из тестируемой группы можно проводить по степени их генетического родства по отношению к испытуемой собаке. Соответственно, в одном аспекте настоящего изобретения способ может дополнительно включать:

(a) сравнение генетических признаков породы испытуемой собаки с генетическими признаками породы каждой собаки из тестируемой группы, состоящей из двух или более собак одной породы, которые имеют пол, противоположный полу испытуемой собаки;

(b) определение на основе сравнения степени родства испытуемой собаки со всеми собаками тестируемой группы; и

(c) выбор одной или нескольких собак из тестируемой группы для бридинга с использованием испытуемой собаки.

Собак можно выбирать из тестируемой группы на основе их родства с испытуемой собакой (т.е. собакой, которую используют для бридинга). Предпочтительно собака или собаки, выбранные из тестируемой группы, обладают наиболее отдаленным родством (т.е. имеют наименьшую степень родства) среди собак тестируемой группы. Генетические признаки породы испытуемой собаки и собак из тестируемой группы могут быть известны или их можно определить, например, с помощью коммерчески доступного теста бридинга.

Таким образом, изобретение предоставляет способ, позволяющий рекомендовать одну или несколько подходящих собак для бридинга с использованием испытуемой собаки. Рекомендация может быть адресована собственнику испытуемой собаки или лицу, ухаживающему за этой собакой, ветеринару, собаководу, клубу собаководства или ведомству по регистрации собак.

Изобретение также относится к способу выведения собак, где по меньшей мере у двух собак противоположного пола, необязательно относящихся к одной породе, перед вязкой определяют наличие защиты от накопления меди в печени или предрасположенность к накоплению меди в печени.

Сведения о предрасположенности собаки к накоплению меди в печени или о наличии у собаки защиты от накопления меди в печени можно хранить в электронном формате, например, в компьютерной базе данных. Соответственно, изобретение предоставляет базу данных, содержащую информацию, относящуюся к предрасположенности к накоплению меди в печени или наличию защиты от накопления меди в печени и к полу одной или нескольких собак. База данных может содержать дополнительную информацию о собаке, такую как генетические признаки породы, племенной статус, возраст, географическое местонахождение, история болезни, предрасположенность к заболеваниям или физические характеристики собаки. Как правило, база данных также содержит уникальное имя собаки, например, зарегистрированное имя собаки. Доступ к базе данных может осуществляться дистанционно, например, через Интернет.

Корм настоящего изобретения

Настоящее изобретение относится к корму для собак, имеющих генетическую наследственность породы лабрадор ретривер. Авторы изобретения обнаружили, что уровень меди, присутствующий в коммерческих диетических средствах, способствует накоплению меди в печени лабрадоров ретриверов, и что уменьшение уровня меди в диете неожиданно приводит к нормализации уровня меди в печени с большей эффективностью, чем лекарственное средство пеницилламин. Корм настоящего изобретения имеет низкую концентрацию меди, а именно, менее чем 21 мг/кг сухого вещества. Корм используют для профилактики накопления меди в печени лабрадора ретривера. Следовательно, его можно использовать для предотвращения заболевания или состояния, связанного с накоплением меди в печени. Таким образом, корм настоящего изобретения можно давать собаке, в геноме которой с помощью способа настоящего изобретения обнаружено присутствие одного или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени. Термин "корм", как использовано в данном описании, охватывает корма, диету, съестные припасы или добавки. Все они могут находиться в твердой, полутвердой или жидкой форме.

Более подробно, корм настоящего изобретения содержит медь в концентрации менее 21 мг/кг сухого вещества. Предпочтительно концентрация меди составляет менее чем 20, менее чем 17, менее чем 15, менее чем 12, менее чем 10 мг/кг или менее чем 8 мг/кг сухого вещества. Предпочтительно концентрация меди составляет по меньшей мере 3, по меньшей мере 3,5, по меньшей мере 4, по меньшей мере 4,5, по меньшей мере 4,75, по меньшей мере 5, или по меньшей мере 8 мг/кг сухого вещества. Как правило, концентрация меди находится в интервале от 3 до 21 мг/кг, от 4 до 12 мг/кг, от 4,5 до 12 мг/кг, от 4 до 11 мг/кг, от 4,5 до 11 мг/кг, от 4 до 10 мг/кг, от 4,5 до 10 мг/кг, от 4 до 9 мг/кг, от 4,5 до 9 мг/кг, от 4 до 8 мг/кг или от 4,5 до 8 мг/кг сухого вещества. Медь может присутствовать в корме в виде любой физиологически приемлемой формы. Таким образом, медь может предоставляться в виде любой физиологически приемлемой соли, такой как сульфат меди.

Корм может также содержать цинк в концентрации, составляющей по меньшей мере 120 мг/кг сухого вещества. Предпочтительно концентрация цинка составляет по меньшей мере 150, по меньшей мере 180 или по меньшей мере 200 мг/кг сухого вещества. Предпочтительно концентрация цинка не превышает максимум, разрешенный органами, контролирующими продукты питания. Как правило, концентрация цинка составляет менее 250, менее 240, менее 230 или менее 220 мг/кг сухого вещества. Обычно концентрация цинка находится в интервале от 120 до 250, от 150 до 250 или от 200 до 250 мг/кг сухого вещества.

Предпочтительно количество цинка в корме превышает количество меди. Следует понимать, что эффективная концентрация цинка и/или меди в корме, который потребляется собакой, зависит от присутствия или отсутствия неусваиваемых веществ. Предпочтительно отношение цинка к меди в корме равно 5 или более высокому значению, такому как 6, 7, 8, 9, 10 или более, где количество цинка и меди определяют по отношению к массе корма.

Цинк может присутствовать в том же корме настоящего изобретения, что и медь. Альтернативно, цинк может находиться в виде добавки, которую можно добавлять к корму настоящего изобретения. Добавка может находиться в форме таблетки, порошка или жидкой композиции. Цинк может входить в состав корма или добавки в виде любой физиологически приемлемой формы. Таким образом, цинк может присутствовать в виде любой физиологически приемлемой соли, такой как ацетат цинка, сульфат цинка, глюконат цинка, карбонат цинка, хлорид цинка или оксид цинка.

Концентрация меди или цинка приводится в пересчете на сухое вещество, т.е. по отношению к массе корма без учета воды, чтобы можно было проводить непосредственное сравнение разных кормов, имеющих разное содержание влаги. Чтобы измерить концентрацию меди или цинка во влажном или полусухом корме, сначала из образца корма удаляют воду путем сушки, например, с использованием печи. Затем в образце высушенного корма можно измерить концентрацию меди или цинка с помощью любого подходящего метода. Хорошо известным в данной области примером такого метода является спектрофотометрия с пламенной атомной абсорбцией.

Корм настоящего изобретения может находиться в форме, например, влажного корма для животных, полусухого корма для животных или сухого корма для животных. Содержание влаги во влажном корме для животных обычно составляет более 65% по массе. Полусухой корм для животных обычно имеет содержание влаги 20-65% по массе и может содержать увлажняющие средства и другие ингредиенты, предотвращающие рост микробов. Сухой корм для животных, также называемый гранулированным, как правило, имеет содержание влаги ниже 20% по массе, и его обработка обычно включает экструдирование, сушку и/или обжиг в печи.

Корм может находиться в виде смеси влажного и сухого кормов. Такое сочетание может предоставляться в виде заранее полученной смеси или в виде двух или более отдельных кормов, которые можно давать собаке по отдельности, одновременно или последовательно.

Корм включает любой продукт, входящий в рацион собаки. Изобретение охватывает стандартные пищевые продукты и корма для животных в виде закусок. Корм предпочтительно представляет собой продукт, подвергнутый кулинарной обработке. Он может содержать мясо или вещество животного происхождения (например, полученное из коровы, курицы, индейка, ягненка, рыбы и др.). Альтернативно, мясо может отсутствовать в продукте (предпочтительно в качестве источника белка используют заменитель мяса, такой как соя, глютен маиса или соевый продукт). Продукт также может содержать источник крахмала, например, одно или несколько зерен (например, кукурузы, риса, овса, ячменя и др.), или крахмал в продукте может отсутствовать.

Ингредиенты сухого корма для животных могут быть выбраны из злаков, волокон, мяса, птицы, жиров, витаминов и минералов. Как правило, после смешивания ингредиенты обрабатывают в экструдере/варочном аппарате. Затем продукт обычно формуют и сушат, и после сушки на поверхность сухого продукта можно нанести или распылить ароматизаторы и жиры.

Все корма для животных должны обеспечивать определенный уровень питательных веществ. Например, Американская ассоциация государственных инспекторов по качеству кормов для животных (AAFCO) и Институт кормов для домашних животных устанавливают профили питательных веществ в кормах для животных на основе традиционно используемых ингредиентов. Эти установленные профили называют "AAFCO-профили питательных веществ в кормах для собак". В соответствии с указанными нормативами, корма для животных должны содержать концентрации питательных веществ, которые удовлетворяют минимальному уровню и не превышают максимального уровня, установленного AAFCO.

Композиция корма для собак может быть изготовлена в соответствии с требованиями по содержанию калорий, белков, жиров, углеводов, волокон, витаминов или минералов в кормах для собак. Например, композиция корма для собак может содержать подходящее количество или соотношения незаменимых жирных кислот, таких как жирные кислоты омега-6 и омега-3. Основным источником жирных кислот омега-6 являются растительные масла, такие как подсолнечное масло, соевое масло, сафлоровое масло и масло энотеры, тогда как жирные кислоты омега-3 присутствуют, в основном, в льняном семени и морепродуктах. Пищевые ингредиенты с высоким содержанием меди, использования которых можно избежать при получении корма, включают моллюски, печень, почки, сердце, мясо, орехи, грибы, злаки, какао, бобовые и мягкую воду (полученную с использованием медных труб). В состав композиции могут входить пищевые ингредиенты, обогащенные цинком, такие как молоко, желатин, яичные желтки, рис и картофель.

Предпочтительно корм находится в упаковке. Упаковка может быть изготовлена из металла (обычно в виде банки или фольги), пластика (обычно в виде мешочка или бутылки), бумаги или картона. Тип используемой или требуемой упаковки может быть выбран в зависимости от количества влаги в продукте.

Корм настоящего изобретения может находиться в одной упаковке с источником цинка. Цинк может присутствовать в любой форме. Цинк может входить в состав одного или более кормов или отдельной добавки, которая находится в одной упаковке с кормом, содержащим максимальный уровень меди настоящего изобретения. Если цинк обеспечивается в составе корма, он может входить в состав корма настоящего изобретения, который содержит определенный уровень меди, или он может входить в состав одного или более других кормов, или в тот и в другой корм. Таким образом, изобретение предлагает упаковку, содержащую корм с концентрацией меди менее чем 21 мг/кг сухого вещества и цинксодержащую добавку. После добавления к корму цинксодержащая добавка обеспечивает концентрацию сухого вещества по меньшей мере 120 мг/кг. Корм и цинксодержащая добавка предназначены для одновременного, раздельного или последовательного применения с целью предотвращения заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер.

Изобретение также предоставляет описанный в данном описании корм, снабженный этикеткой. На этикетке может быть указано, например, что корм подходит для собак породы лабрадор ретривер. Также могут присутствовать другие указания или инструкции. Например, может быть указано количество меди и/или цинка, содержащееся в рационе или корме. Кроме того, этикетка может содержать инструкции по кормлению.

Лабрадор ретривер

Корм настоящего изобретения можно использовать для предотвращения накопления меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер. Как правило, собака представляет собой собаку-компаньона или домашнюю собаку. Собака может быть чистопородным лабрадором ретривером. Альтернативно, собака может относиться к смешанной или гибридной породе или она может представлять собой аутбредную собаку (дворнягу). Один или оба родителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Один, два, три или четыре прародителя собаки могут представлять собой чистопородных лабрадоров ретриверов. Собака может наследовать по меньшей мере 50% или по меньшей мере 75% генетического фона породы лабрадор ретривер. Таким образом, по меньшей мере 50% или по меньшей мере 75% генома собаки может представлять собой геном породы лабрадор ретривер.

Генетический фон породы собаки можно определить путем оценки частоты аллелей генетических маркеров, таких как SNP или микросателлиты. Сочетания частот аллелей разных SNP или микросателлитов у собаки являются характерным признаком, позволяющим идентифицировать породу собаки или породы, составляющие смешанную породу собаки. Такой генетический тест может быть коммерчески доступным. Альтернативно, собака может не нуждаться в тестировании на наследование генетических признаков породы лабрадор ретривер, если собственник собаки или ветеринар предполагает, что собака наследует признаки данной породы. Такое предположение может быть сделано на основе сведений о родословной собаки или на основе ее внешнего вида.

Корм предназначен для собак любого возраста. Корм можно использовать для собак в возрасте от 0 до 12 лет, например, от 1 до 5 лет, от 2 до 7 лет или от 3 до 9 лет.

Как правило, корм подходит для здоровых собак. Он подходит для собак, у которых отсутствует накопление меди в печени на детектируемом уровне. Корм можно использовать для профилактического применения, т.е. для предотвращения накопления меди в печени собаки. Корм предназначается для минимизации риска накопления меди и, следовательно, уменьшения риска развития у собаки заболевания или состояния, обусловленного накоплением меди в печени, такого как хронический гепатит, цирроз или печеночная недостаточность. Как правило, корм предназначается для предотвращения накопления меди у собак, у которых не наблюдается аномальной концентрации меди в печени, и, следовательно, присутствует небольшая вероятность риска гепатита, ассоциированного с медью. У собаки также может отсутствовать история накопления меди. Следовательно, собака предпочтительно имеет нормальный уровень меди в печени, составляющий примерно менее 400 мг/кг сухой массы печени. Однако у новорожденных собак нормальный уровень меди в печени составляет примерно менее 600 мг/кг сухой массы печени. Корм можно использовать для предотвращения повышения концентрации меди в печени до уровня, значительно превышающего нормальный уровень. Способы определения концентрации меди в печени собаки хорошо известны в данной области. Подходящий способ описан в примере 6.

Корм можно использовать для предотвращения ассоциированного с медью хронического гепатита. Предпочтительно корм используют для предотвращения накопления меди у собаки, у которой не диагностировано заболевание печени, с целью предотвращения такого заболевания. Корм также можно использовать для лечения заболевания или состояния, обусловленного накоплением меди в печени, такого как хронический гепатит, цирроз или печеночная недостаточность. Признаки или симптомы заболевания печени включают такие клинические проявления, как летаргия, диарея и желтуха. Биохимические проявления болезни печени включают аномально высокий уровень билирубина в сыворотке и активности в сыворотке фермента печени, такого как щелочная фосфатаза (ALP), аланинаминотрансфераза (ALT), аспартатаминотрансфераза (AST) и гамма-глутамилтранспептидаза. Биохимические способы измерения таких показателей болезни печени хорошо известны в данной области.

Предпочтительно собака, для которой предназначается корм, не имеет каких-либо клинических проблем.

Производство корма

Корм настоящего изобретения можно получить путем смешивания подходящих ингредиентов. Производство контролируют таким образом, чтобы достичь нужной концентрации меди в корме. Концентрацию меди можно регистрировать в процессе получения корма. Таким образом, изобретение предоставляет способ получения корма настоящего изобретения, включающий смешивание ингредиентов корма таким образом, чтобы концентрация меди в корме составляла менее 21 мг/кг сухого вещества. Источником меди в корме могут служить один или более компонентов. Однако важно избегать применения компонентов, которые с большой вероятностью имеют высокое содержание меди. Пищевые ингредиенты с высоким содержанием меди, использование которых можно избежать при получении корма, включают моллюски, печень, почки, сердце, мясо, орехи, грибы, злаки, какао, бобовые и мягкую воду (полученную с использованием медных труб). Корм настоящего изобретения необязательно содержит один или более компонентов, являющихся источником цинка. В состав композиции могут входить пищевые ингредиенты, обогащенные цинком, такие как молоко, желатин, яичные желтки, рис и картофель. Компоненты/ингредиенты можно добавлять в любой момент производства/обработки корма.

Важно измерить концентрацию меди, присутствующей в корме, чтобы определить, что она находиться ниже предела, установленного в соответствии с настоящим изобретением. Также можно измерить концентрацию цинка, чтобы удостовериться, что она составляет указанный выше минимальный предел, установленный в соответствии с настоящим изобретением. Одна из стадий способа промышленного получения корма может включать измерение концентрации меди в образце корма. После получения корма можно провести по меньшей мере одно измерение концентрации меди в образце корма. Измерения также можно проводить в процессе получения корма, чтобы отслеживать уровни меди и/или цинка после добавления очередных ингредиентов. Например, измерение можно проводить в образце после добавления одного или более ингредиентов. Измерение содержания меди, цинка и других элементов можно проводить в образце с помощью любого подходящего способа, известного в данной области, такого как спектрофотометрия с пламенной атомной абсорбцией.

Как правило, способ получения корма настоящего изобретения включает стадии смешивания ингредиентов с необязательной тепловой обработкой сырых ингредиентов; измерение концентрации меди и необязательно цинка в образце корма; и расфасовку корма. Способ получения корма может дополнительно включать снабжение кормом собственника собаки, лица, отвечающего за питание собаки, или ветеринара и/или предоставление корма собаке.

Хотя отсутствие меди не характерно для корма, медь можно добавить в виде добавки к корму, чтобы достичь минимального суточного уровня меди в диете собаки (например, рекомендуемого Американской ассоциацией государственных инспекторов по качеству кормов для животных (AAFCO)) и, при этом, сохранить концентрацию меди на уровне ниже требуемого изобретением. Следовательно, изобретение также предлагает применение меди в производстве кормов для собак, имеющих генетическую наследственность породы лабрадор ретривер, где корма содержат медь в концентрации менее 21 мг/кг и предназначаются для применения в предотвращении накопления меди у указанных собак. Медь можно добавить к корму в виде любой подходящей формы. Примеры медьсодержащих добавок включают хлорид меди и пентагидрат сульфата меди. Аппаратура, используемая в настоящем изобретении для промышленного получения кормов, как правило, включает один или более из следующих компонентов: контейнер для сухих ингредиентов корма для животных; контейнер для жидкостей; миксер; формующее устройство и/или экструдер; отрезающее устройство; устройство для тепловой обработки (например, печь); охлаждающее устройство; устройство для расфасовки; и устройство для нанесения этикетки. Контейнер для сухих ингредиентов обычно имеет отверстие на дне. Данное отверстие может закрываться элементом, регулирующим объем, таким как шлюзовой затвор. Элемент, регулирующий объем, может открываться и закрываться в соответствии с инструкциями производителя электронного оборудования, регулируя добавление сухих ингредиентов в корм для животных. Сухие ингредиенты, традиционно используемые в производстве кормов для животных, включают кукурузу, пшеницу, мясную и/или птичью муку. Жидкие ингредиенты, традиционно используемые в производстве кормов для животных, включают жир, таловый жир и воду. Контейнер для жидкостей может содержать насос, который, в соответствии с инструкциями производителя электронного оборудования, обеспечивает добавление нужного количества жидкости в корм для животных.

В одном варианте осуществления контейнер (контейнеры) для сухих ингредиентов и контейнер (контейнеры) для жидкостей соединяют с миксером, в который поступают заданные количества сухих ингредиентов и жидкостей. Миксер может управляться в соответствии с инструкциями производителя электронного оборудования. Например, продолжительность или скорость перемешивания могут регулироваться. Затем смесь ингредиентом обычно поступает в формующее устройство или экструдер. Формующее устройство/экструдер может представлять собой любое известное в данной области формующее устройство или экструдер, которое используют для придания нужной формы смеси ингредиентов. Как правило, смесь ингредиентов пропускают под давлением через отверстия определенного размера с получением непрерывных нитей. После экструдирования нити можно разрезать на кусочки (гранулы) с помощью отрезающего устройства, такого как нож. Гранулы обычно подвергают тепловой обработке, например, в печи. Время и температуру тепловой обработки можно регулировать в соответствии с инструкциями производителя электронного оборудования. Время тепловой обработки можно изменить, чтобы получить корм с желаемым содержанием влаги. После тепловой обработки гранулы можно перенести в охлаждающее устройство, например, в камеру, содержащую один или более вентиляторов.

Аппаратура для промышленного получения корма для животных может содержать устройство для расфасовки. Устройство для расфасовки обычно помещает корм для животных в контейнеры, такие как пластиковые или бумажные пакеты или коробки. Аппаратура также может содержать устройство для нанесения этикеток, как правило, после расфасовки корма. На этикетках могут быть указаны порода собаки, для которой подходит корм (т.е. лабрадор ретривер), и/или ингредиенты корма.

Применение корма

Корм настоящего изобретения можно использовать для предотвращения накопления меди в печени собаки. Следовательно, его можно использовать для предотвращения заболевания или состояния, обусловленного высоким уровнем меди, такого как ассоциированный с медью хронический гепатит, цирроз или печеночная недостаточность. Соответственно, изобретение предлагает способ предотвращения накопления меди в печени и предотвращения заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы лабрадор ретривер, где способ включает кормление собаки описанным в данном описании кормом. Изобретение также предоставляет способ предотвращения ассоциированного с медью хронического гепатита у собаки, имеющей генетическую наследственность породы лабрадор ретривер, где способ включает кормление собаки кормом настоящего изобретения. Как правило, корм настоящего изобретения предназначается для профилактического применения, а именно, для профилактики накопления меди у лабрадоров ретриверов. Обычно его также используют для предотвращения ассоциированного с медью хронического гепатита у лабрадоров ретриверов.

Предпочтительно корм настоящего изобретения используют для предотвращения накопления меди в печени собаки, геном которой, как установлено с помощью описанного в данном описании генетического теста, не содержит один или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени, и необязательно содержит один или более полиморфизмов, указывающих на предрасположенность к накоплению меди в печени.

Таким образом, изобретение предлагает способ предотвращения заболевания, связанного с накоплением меди в печени собаки, наследующей генетические признаки породы лабрадор ретривер, который включает (i) определение наличия у собаки защиты от накопления меди в печени путем детекции присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142), и (b) одного или более полиморфизмов, которые находятся с в неравновесном сцеплении с полиморфизмом (a); и (ii) назначение, обеспечение или скармливание собаке корма, содержащего медь в концентрации, составляющей по меньшей мере от 4,5 до менее чем 12 мг/кг сухого вещества. Корм можно предоставлять собственнику собаки, лицу, ухаживающему за собакой, или ветеринару. Изобретение также предлагает корм для применения в указанном способе.

Применение корма настоящего изобретения может включать обеспечение собаки источником цинка. Как описано в данном описании, цинк может быть предоставлен собаке в виде любой подходящей формы. Корм настоящего изобретения, содержащий низкий уровень меди, может дополнительно содержать цинк, например, в концентрации, составляющей по меньшей мере 120 мг/кг сухого вещества. Альтернативно, цинк может входить в состав одного или более отдельных кормов или добавок. Применение корма настоящего изобретения может включать предоставление собаке цинксодержащей добавки. Цинксодержащую добавку можно давать в любое время, т.е. добавку и корм настоящего изобретения можно давать отдельно, одновременно или последовательно. Например, цинксодержащую добавку можно смешать с кормом настоящего изобретения перед подачей собаке или ее можно добавить в питьевую воду.

Корм настоящего изобретения можно давать собаке один или более раз в день. Предпочтительно корм дают собаке вместо ее обычной пищи. Способ предотвращения накопления меди или предотвращения хронического гепатита можно использовать в течение неопределенного периода времени, т.е. на протяжении жизни собаки.

Изобретение иллюстрируется с помощью нижеследующих примеров.

Пример 1

Выявление SNP, связанных с предрасположенностью к накоплению меди

Образцы ДНК 120 лабрадоров генотипируют более чем по 22000 SNP. 72 образца получают от собак, характеризующихся высоким содержанием меди (уровни меди в печени выше 600 мг/кг), и 48 образцов получают от собак, характеризующихся нормальным уровнем меди в печени (ниже 400 мг/кг). Данные анализируют, используя попарное сравнение всех возможных пар собак. Данные упорядочивают, чтобы получить информационный локус для заболевания. Данные от трех наилучших геномных участков используют, чтобы с помощью булевых операторов найти маркеры, наилучшим образом связанные с высокими уровнями меди. Результаты, полученные для трех участков с использованием булевой модели, приведены ниже:

Таблица I
Результаты, полученные с использованием булевой модели для трех участков CFA8, CFA32 и CFAX
CFA8 (область гена G0LGA5) CFA32 (область гена UBL5) CFAX (область гена ATP7A) % собак с указанным распределением аллелей, которые имеют высокое содержание меди
1 X X 69,0%
1 1 X 72,3%
1 1 1 81,5% Из 27 собак, содержащих все три аллеля, 22 (81,5%) имеют высокое содержание меди
1 1 0 60,0%
1 0 X 64,9%
1 0 1 77,8%
1 0 0 60,7%
0 X X 36,1%
0 1 X 55,6%
0 1 1 42,9%
0 1 0 63,6%
0 0 X 16,7%
0 0 1 50,0%
0 0 0 7,1% Из 14 собак, у которых отсутствуют все три аллеля, 1 имеет высокое содержание меди

Бинарные значения, приведенные в таблице I, расшифровываются следующим образом:

Геномный участок CFA8 (ген GOLGA5):

1 = в случае генотипа AA по SNP BICF2P506595;

0 = в случае любого другого генотипа по SNP BICF2P506595.

Геномный участок CFA32 (участок гена UBL5):

1 = в случае генотипа GG по BICF2P772765, генотипа CC по BICF2S2333187 и генотипа GG по BICF2P1324008;

0 = в случае любого другого генотипа по одному из указанных SNP.

Геномный участок CFAX (участок гена ATP7A):

1 = в случае генотипа AA или AG по BICF2P591872;

0 = в случае генотипа GG по BICF2P591872.

Во всех участках X = неиспользуемые аллели.

В таблице I показаны бинарные состояния аллелей для трех геномных участков. В геномном участке CFA8 используют один SNP (SNP 1). В геномном участке CFA32 используют три SNP (SNP 2, 3 и 4). В геномном участке CFAX используют один SNP (SNP 5). Бинарные значения обозначают собаку, имеющую аллели, которые свидетельствуют о предрасположенности к накоплению меди ("плохие" аллели). Например, 000 обозначает отсутствие всех трех плохих аллелей. 111 обозначает присутствие всех трех плохих аллелей. X обозначает неиспользуемые аллели по данному гену. Строки 1xx и 0xx свидетельствуют о том, что один ген тестируют с использованием только SNP в гене GOLGA5.

Таблица II демонстрирует, что собаки с большим числом указывающих аллелей в среднем имеют более высокую концентрацию меди. Также приведено число собак, имеющих каждое сочетание аллелей:

Таблица II
Сочетание генов Среднее количество Cu 2 (мг/кг) % собак с указанным распределением аллелей, которые имеют высокое содержание меди Число собак с указанным распределением аллелей
111 1253,09 81,5% 27
110 733,40 60,0% 20
101 1138,90 77,8% 9
100 737,84 60,7% 28
011 502,27 42,9% 7
010 670,83 63,6% 11
001 450,00 50,0% 4
000 332,47 7,1% 14

В таблице III показаны положения и последовательности SNP, используемых для получения результатов, приведенных в таблицах I и II.

Результаты получены для трех геномных участков (находящихся в генах GOLGA5, UBL5 и ATP7A, или около них), связанных с предрасположенностью к накоплению меди. Другие SNP в указанных участках, которые свидетельствуют о предрасположенности к накоплению меди, приведены в таблице IV.

Таблица III

Пример 2

Идентификация других SNP, связанных с предрасположенностью к накоплению меди в печени, и защитных SNP

Три гена, идентифицированные в примере 1, анализируют, чтобы выявить другие SNP, связанные с предрасположенностью к накоплению меди в печени. Выбирают тридцать три ампликона, охватывающие все экзоны трех идентифицированных генов. Указанные ампликоны получают амплификацией 72 образцов геномной ДНК собак породы лабрадор ретривер. Образцы берут у собак с высоким уровнем меди (уровень меди в печени превышает 600 мг/кг) или у собак с нормальным уровнем меди в печени (ниже 400 мг/кг). Амплифицированный продукт секвенируют в обоих направлениях по способу Сенгера. Для сборки последовательности каждого ампликона используют программное обеспечение 'Seqman 4.0', поставляемое DNASTAR. Затем сборку анализируют, чтобы найти одноосновные вариации (SNP). Указанные вариации генотипируют путем определения интенсивности оснований SNP в последовательности в обоих направлениях. Если генотипы SNP, определенные в обоих направлениях, не совпадают более чем в 10 образцах, SNP считают артефактом и игнорируют. Идентифицированные, свидетельствующие о предрасположенности, SNP приведены в таблице V.

Неожиданно также был обнаружен SNP, свидетельствующий о наличии защиты. Он указан в таблице VI. Этот SNP находится в кодирующем участке гена ATP7A (ген, связанный с X-хромосомой) и приводит к изменению кодирующей последовательности. Исследуют зависимость средних уровней меди в печени от пола и генотипа ATP7A (таблица VII). На фиг.5 показано графическое изображение данных, приведенных в таблице VII. Фиг.6 иллюстрирует эти же данные в виде гистологических оценок содержания меди. Значение p (0,000396) определяют с использованием критерия Крускала-Уоллиса для гистологических оценок в зависимости от пола/генотипа в разных группах. Полученные данные свидетельствуют о том, что присутствие аллеля T указывает на наличие у собаки защиты от накопления меди в печени.

Полученные результаты могут объяснить склонность самок к хроническому гепатиту. Самцы собак содержат только одну копию X-хромосомы и, следовательно, являются гемизиготными по локусу ATP7A. Эффект X-связанного рецессивного гена с большей вероятностью наблюдается у самцов, чем у самок, вследствие гемизиготного статуса X-хромосомы у самцов. Описанный в данном описании защитный эффект является рецессивным, поэтому в популяции самок наблюдается больше случаев.

SNP, свидетельствующий о защите, включает замену треонина на изолейцин в положении 328 ATP7A, приводящую к уменьшению числа возможных водородных связей от 3 до 0 и к повышению гидрофобности, что может привести к изменению формы белка. Треонин в данном положении является консервативным и присутствует у многих млекопитающих, включая лошадей, людей, шимпанзе и дельфинов, что свидетельствует о большом значении данной аминокислоты для функционирования белка.

Пример 3

Исследование различий среди защитных SNP ATP7A у разных пород и в разных географических регионах

SNP ATP7A, приведенный в таблице VI, генотипируют в образцах ДНК собак, породы которых отличаются от лабрадора ретривера, чтобы определить, присутствует ли данный SNP у других пород. В таблице VIII приведены результаты такого генотипирования наряду с числом собак, относящихся к каждому генотипу. Колонка 'T' относится к гомозиготным самкам (TT) и гемизиготным самцам (T). Результаты демонстрируют, что SNP присутствует у собак разных пород и, следовательно, может использоваться в качестве фактора, указывающего на наличие защиты от накопления меди у собак разных пород, собак смешанных пород и дворняг. Аллель T данного SNP также обнаружен в популяциях лабрадоров, находящихся в США и Японии, свидетельствуя о том, что географическое местоположение не является препятствием для применения SNP.

Таблица VII
Пол Генотип Средний уровень меди Число
Самки TT 323,3 3
CT 818,3 22
CC 1041,3 45
Самцы T 437,5 13
C 905,8 34
Таблица VIII
Порода C CT T (мутация, связанная с низким уровнем меди)
Лабрадор ретривер 31 13 28
Карликовый пудель 3 2 8
Золотистый ретривер 0 0 1

Пример 4

Идентификация другого защитного, но не кодирующего SNP

В результате секвенирования гена ATP7A был обнаружен интронный SNP, который находится почти в полном неравновесном сцеплении с кодирующим SNP ATP7a_Reg3_F_6. Как и кодирующий SNP, интронный SNP (ATP7a_Reg 16 F42) в значительной степени связан с защитой от накопления меди в печени (таблица IX). Значимость обоих измеряют с использованием хи-квадрата с двумя степенями свободы, допуская независимость генотипа и статуса заболевания. Статус заболевания является положительным, если количественное содержание меди в сухой ткани печени >600 мг/кг и гистологическая оценка >=2,5; статус является отрицательным, если количественное содержание меди в сухой ткани печени <400 мг/кг и гистологическая оценка <2,5. Приведенные в таблице результаты основаны на байесовой оценке частот генотипа и встречаемости заболевания для образца при предположении о независимости двух переменных.

Рассчитывают показатели неравновесного сцепления некодирующего SNP и кодирующего SNP: D'=0,93, и R-квадрат=0,86. Следовательно, SNP находятся почти в полном неравновесном сцеплении.

Последовательность, окружающая ATP7a_Reg 16 F42, показана в таблице X.

Пример 5

Эксперименты in vitro, проводимые для определения функционального эффекта кодирующей мутации ("SNP ATP7A")

Материалы и способы

Клеточные линии

Фибробластные клетки кожи собаки CDFIB44, CDFIB62 и CDFIB111 выделяют из самок лабрадоров после эйтаназии. Образцы крови, взятые перед эвтаназией, подвергают генетическому тесту настоящего изобретения, чтобы подтвердить наличие повышенного риска заболевания. CDFIB111 являются гомозиготными по ATP7A SNP, и CDFIB62 являются гетерозиготными. CDFIB42 используют в качестве контроля. Указанные клетки обозначают ATP7AC/C, ATP7AC/T или ATP7AT/T, в зависимости от того, экспрессируют ли кожные фибробласты собаки ATP7A дикого типа, его гетерозиготные или вариантные формы. Фибробластные клетки кожи человека HB 156 получают от пациента с болезнью Менкеса (ATAC). Клетки H8881 используют в качестве контроля. До настоящего времени ATP7A из указанных клеток не секвенировали. Информация о последовательности ATP7A, присутствующего в этих клетках, отсутствует.

Фибробласты обычно культивируют в модифицированной по способу Дульбекко среде Игла (Invitrogen), содержащей L-глутамин (2 мМ), 10% FBS, MEM неэссенциальные аминокислоты (100 мкМ) и пенициллин/стрептомицин при 37°C во влажной атмосфере, содержащей 5% CO2. Среда с низким содержанием сыворотки содержит такие же компоненты, как и 2% FBS. В этих экспериментах используют собачьи клетки после 4-9 пассажей. Ткани тонкого кишечника и печени выделяют и затем хранят в РНК при 20°C до последующего использования.

Иммунофлуоресценция

Для проведения иммунофлуоресцентного анализа и микроскопии клетки, выращенные на покровных стеклах, инкубируют в среде с низким уровнем сыворотки, содержащей 200 мМ батокупроин дисульфоновой кислоты (BCS; Sigma), в течение 24 ч. Клетки фиксируют в свежеприготовленном 4% растворе парафармальдегида в PBS в течение 20 мин, промывают и нарушают проницаемость мембраны с помощью 0,2% раствора тритон-X100 в PBS. Неспецифические сигналы блокируют 3% раствором BSA в PBS, содержащим 0,2% тритон-X100 в течение 1 ч, затем инкубируют в такой же блокирующей среде, содержащей куриное антитело против ATP7A (1:50; abl3995 (Abeam), против аминокислот 1407-1500)+мышиное антитело против 58k (1:50; Abeam) в течение 2 ч. Для детекции первичных антител используют конъюгированные с техасовым красным козлиные антитела против куриных иммуноглобулинов (1:100) и конъюгированные с FITC ослиные антитела против мышиных иммуноглобулинов (1:100) (Abeam) (1 ч). Затем для усиления сигнала от вторичных козлиных антител против куриных иммуноглобулинов используют конъюгированные с техасовым красным кроличьи антитела против козлиных иммуноглобулинов (1:1000; Abeam) (1 ч). Наконец, покровные стекла помещают в реагент Prolong Anti-fade gold (Sigma) и наблюдают посредством эпифлуоресценции.

Радиоизотопные эксперименты

Изотоп 64медь получают из металлической медной проволоки (3,3 мг), которую облучают в течение ночи в реакторе с индуцированной активностью примерно 170 МБк.мг-1. Примерно через четыре часа после облучения и за 30 минут до начала исследования медную проволоку растворяют в 50 мкл концентрированной HNO3 (10,3 M) и нейтрализуют 1,3 мл 0,5M NaOH. Добавляют среду DMEM с получением конечной концентрации меди 4,7 мМ. Фибробластные клетки помещают с двойными повторами в 6-луночные планшеты в среде DMEM, содержащей 5% FBS и добавки.

Для обработки медью, клетки инкубируют в 10, 50 и 100 мкМ растворах меди в течение 24 или 48 ч. После обработки среду удаляют и клетки промывают четыре раза раствором Хэнкса, содержащим равное количество нерадиоактивного CuCl2. После промывания клетки лизируют путем добавления 325 мкл 0,2% SDS и затем клеточные лизаты при помощи пипетки вносят в пробирки для подсчета радиоактивности. Эмиссию измеряют в отдельных пробирках, содержащих среду, продукты стадий промывания или лизаты, в гамма-счетчике Packard B5003 (Packard BioScience Benelux, Groningen, the Netherlands) в диапазоне от 450 до 800 кэВ в течение 2 минут. Чтобы исследовать отток веществ, после обработки медью в течение 24 ч клетки промывают четыре раза раствором Хэнкса и затем инкубируют в свежей теплой среде, не содержащей другой меди, в течение 2 ч. Затем с помощью описанного выше способа анализируют содержание меди в клетках. Накопление меди нормализуют по концентрации белка в клеточных лизатах (количественное определение белка проводят с помощью набора для анализа белка Bio Rad, Bio Rad) и одновременно проводят колориметрический анализ MTS (3-[4,5-диметилтиазол-2-ил]-5-[3-карбоксиметоксифенил]-2-[4-сульфофенил]-2H-тетразолий) (Promega). С помощью этого количественного анализа детектируют живые, но не мертвые клетки. Поглощение при 490 нм (длина волны тестирования) и при 650 нм (длина волны сравнения) измеряют с помощью планшет-ридера для иммуноферментного твердофазного анализа (Bio-Rad); в качестве контролей используют лунки, которые содержат культуральную среду, но не содержат клетки. В данном эксперименте в каждую лунку 96-луночного планшета высевают 104 клеток в 100 мкл культуральной среды. После достижения 70% слияния клетки обрабатывают 10, 50 или 100 мкМ растворами меди. После инкубации в течение 24 и 48 ч лунки промывают и затем в каждую лунку добавляют 100 мкл культуральной среды и 20 мкл MTS. Инкубируют 2 ч при 37°C и затем измеряют поглощение при 490 нм.

Выделение РНК

Общую РНК выделяют из тканевых фибробластов с тройными повторами методом фенол-хлороформной экстракции с последующей очисткой с использованием набора Qiagen RNeasy Tissue (Qiagen) в соответствии с инструкциями производителя. Коротко, примерно 75 мг ткани выделяют и добавляют к 1 мл реагента Tri, содержащему стальные шарики Qiagen размером 5 мм. Ткань гомогенизируют, используя TissueLyser (Qiagen), 3 раза в течение 2 мин при 20 30 Гц. Добавляют 100 мкл 1-бром-3-хлорпропана, перемешивают на вортексе в течение короткого промежутка времени, оставляют стоять на 5 мин при комнатной температуре и затем центрифугируют в течение 15 мин при 4°C в настольной центрифуге. Прозрачную водную фазу удаляют и добавляют к 0,5 мл изопропанола, оставляют осаждаться и снова центрифугируют в течение 10 мин при 4°C. Осадок промывают 70% этанолом, сушат на воздухе при комнатной температуре и ресуспендируют в 300 мкл воды. РНК дополнительно очищают, используя колонки для удаления геномной ДНК и набор Qiagen RNeasy plus. Общую РНК выделяют из клеток с помощью набора Qiagen RNeasy plus.

В общей сложности 2 мкг РНК подвергают обратной транскрипции с использованием набора High Capacity RNA to cDNA (ABI) в соответствии с инструкциями производителя в реакционном объеме 20 мкл. Полученную из ткани кДНК разбавляют в соотношении 1 к 20 и затем анализируют методом количественной ПЦР. Полученную из клеток кДНК разбавляют в соотношении 1 к 100 для анализа ATP7A или 1 к 10 для анализа MT1A.

Образцы РНК обрабатывают ДНКазой I (набор Qiagen RNase free DNase). В общей сложности 3 мкг РНК инкубируют с праймерами поли(dT) при 42°C в течение 45 мин в реакционном объеме 60 мкл, используя систему для обратной транскрипции Promega (Promega Benelux, Leiden, The Netherlands).

Количественная ПЦР в режиме реального времени (колПЦР)

Количественную ПЦР проводят по способу, описанному Spee et al (J Vet Intern Med 2006: 20:1085-1092). ПЦР в режиме реального времени проводят с использованием красителя SYBR green I, с высокой аффинностью связывания с двухцепочечной ДНК, с тройными повторами в термоциклере со спектрофотометрическим детектором. Реакции ПЦР проводят в 384-луночных планшетах, для каждой реакции ПЦР используют 8,7 мкл (разбавленного исходного раствора) кДНК в реакционном объеме 20 мкл, содержащем 1× мастер-микс для ПЦР Power SYBR® Green, 40 пмоль обоих праймеров. Пары праймеров (за исключением используемых для получения ATP7A), приведенные в таблице XI, описаны у Spee et al. Все схемы ПЦР включают 5-минутную стадию активации полимеразы и затем 40 циклов, включающих денатурацию при 95°C в течение 20 сек, отжиг в течение 30 сек и удлинение при 72°C в течение 30 сек, с конечным удлинением в течение 5 мин при 72°C. Температуры отжига варьируют от 50°C до 67°C (таблица XI). Анализ чистоты и специфичности каждого образца осуществляют с использованием кривых диссоциации, Bioanalyser (Agilent 2100) и секвенирования (MWG). Кривые эффективности, построенные путем нанесения на график сравнительного исходного количества в зависимости от параметров цикла, получают с использованием серийных 10-кратных разведений кДНК. Эффективность амплификации, E (%)=(10(1/s)1)×100, (s=угол наклона), для каждой стандартной кривой находится в широком динамическом диапазоне и составляет >95% и <105%. Каждый экспериментальный образец нормализуют по эндогенным стандартам гипоксантин-фосфорибозилтрансферазе (HPRT), RPL8, RPS5 и RPS19 с соответствующим преобразованием ошибок.

Вестерн-блоттинг

Клетки промывают три раза PBS, лизируют, используя 200 мкл свежеприготовленного кипящего буфера для лизиса (забуференный трисом физиологический раствор (TBS), содержащий 1% SDS), и соскабливают клетки с помощью резинового скребка. Образцы гомогенизируют путем многократного пропускания через иглу 25 калибра, затем нагревают при 70°C в течение 5 мин и хранят при -20°C до анализа. Клеточные лизаты оттаивают, кипятят 5 мин в загрузочном буфере (50 мМ трис-HCl, pH 6,8, 2% SDS, 0,1% бромфенол синий, 10% глицерин, 40 мМ DTT) и загружают на заранее собранную систему SDS-PAGE. Мембраны блокируют 5% молоком/PBS-T в течение 1-2 ч и затем инкубируют 1 ч при комнатной температуре с первичным антителом. Мембраны промывают 3 раза в течение 10 мин блокирующим буфером и затем инкубируют 1 ч при комнатной температуре с HRP-кроличьим антителом против куриного Ig, разбавленным блокирующим буфером в соотношении 1:10000. Мембраны промывают 3 раза блокирующим буфером в течение 10 мин и затем 1 раз PBS-T. Мембраны быстро промывают PBS, чтобы удалить детергент, и проявляют, используя систему реагентов ECL для детекции вестерн-блоттинга, в соответствии с инструкциями производителя. Затем мембраны экспонируют на рентгеновской пленке SuperRX Fuji (Tokyo, Japan) и проявляют в автоматическом процессоре Kodak (Eastman Kodak Company, Japan).

Чтобы продемонстрировать равную загрузку белка, мембраны зачищают и повторно анализируют. Мембраны анализируют методом вестерн-блоттинга с использованием мышиного антитела против тубулина (разведение 10000, 5% BSA/TBS-T/T, 1 ч при комнатной температуре, с последующей инкубацией с HRP-козлиным антителом против мышиного иммуноглобулина (1:10000), 1% BSA/PBS-T/T, 1 ч при комнатной температуре) и визуализируют, используя реагенты ECL для детекции вестерн-блоттинга, как описано выше.

Зачистка мембран

Перед повторным анализом мембраны очищают от связанного антитела. Мембраны инкубируют при 55°C в течение 30 мин в буфере для зачистки (100 мМ 2-меркаптоэтанол, 2% SDS, 62,5 мМ Tris-HCl, pH 6,7), затем экстенсивно промывают PBS и анализируют методом вестерн-блоттинга.

Статистика

Перед анализом данные количественной ПЦР превращают в log 10, чтобы гарантировать однородность дисперсии (допущение параметрического анализа). Затем значения log10(экспрессии) анализируют методом ANOVA и взвешивают для определения стандартной ошибки значений экспрессии. Проводят попарные сравнения с генотипом ATP7A и рассчитывают степени изменений с доверительными интервалами 95%.

Таблица XI
Нуклеотидные последовательности специфичных для собаки праймеров, используемых для проведения количественной ПЦР в режиме реального времени
Ген Праймер Последовательность (5'-3') Tm (°C) Номер доступа SEQ ID NO:
Гипоксантин-фосфорибозилтрансферазы (HPRT) Прямой AGCTTGCTGGTGAAAAGGAC 56 L77488/ L77489 144
Обратный TTATAGTCAAGGGCATATCC 145
Металлотионеина (MT1A) Прямой AGCTGCTGTGCCTGATGTG 61 D84397 146
Обратный TATACAAACGGGAATGTAGAAAAC 147
Рибосомального белка S5 (RPS5) Прямой TCACTGGTGAGAACCCCCT 62,5 XM_533568 148
Обратный CCTGATTCACACGGCGTAG 149
Рибосомального белка S19(RPS19) Прямой CCTTCCTCAAAAA/GTCTGGG 61 XM_533657 150
S19(RPS19) Обратный GTTCTCATCGTAGGGAGCAAG 151
Рибосомального белка L8 (RPL8) Прямой CCATGAATCCTGTGGAGC 55 XM_532360 152
Обратный GTAGAGGGTTTGCCGAT G 153
АТФазы, Cu++-транспортирующей, альфа-полипептид (ATP7Ai) Прямой CTACACTCCAATATGTAAGCAGC 60 AY603040 154
Обратный AGGTACTCTCAACTTCACTAGC 155
АТФазы, Cu++-транспортирующей, альфа-полипептид (ATP7Aii) Прямой AAACATCAAAGGCTCCTATCC 57 AY603040 156
Обратный GGAAAGCAAAGCGTATTATCG 157
АТФазы, Cu++-транспортирующей, альфа-полипептид (ATP7Aiii) Прямой AGTATGAGTGTGGATTCGGT 60 AY603040 158
Обратный TTTGGAGTCTGTAGTTTAGGGT 159

Результаты

Мутантные фибробласты кожи собаки поглощают больше меди 64 и выделяют ее с меньшей скоростью, чем клетки дикого типа или гетерозиготные клетки

Далее клетки дикого типа, гетерозиготные клетки и мутантные клетки обозначают ATP7AC/C, ATP7AC/T или ATP7AT/T, соответственно. Инкубация фибробластов с изотопом меди-64 (Cu64) в концентрации, превышающей физиологическую (100 мкМ), приводит примерно к двукратному увеличению включения меди через 24 ч и 48 ч в клетках ATP7AT/T и клетках ATP7AC/T по сравнению с клетками ATP7AC/C (фиг.7A). При более низкой концентрации меди (50 мкМ) клетки ATP7AT/T поглощают более высокое количество меди, чем клетки с другими генотипами. При инкубации с медью в физиологических концентрациях различия в поглощении меди клетками разных типов отсутствуют. Чтобы определить, действительно ли увеличение уровней меди в клетках ATP7AT/T обусловлено отсутствием ее оттока, авторы измеряют уровень оттока из клеток путем вымывания (фиг.7B). После добавления высоких количеств Cu64 (100 мкМ) и вымывания в течение 2 ч, в клетках ATP7AC/C остается примерно 45% изотопа, тогда как в клетках ATP7AT/T остается почти 90% изотопа. Клетки ATP7AC/T, которые поглощают такое же количество меди, как и клетки ATP7AT/T, имеют такую же скорость оттока, как и клетки ATP7AC/C. Обнаружено, что в условиях высокой нагрузки меди повышенному уровню поглощения меди сопутствует более низкая жизнеспособность клеток ATP7AT/T (результаты не показаны).

В качестве контроля параллельно проводят эксперимент с использованием человеческих клеток дикого типа и клеток, полученных от пациента с болезнью Менкеса. Как и ожидалось, клетки Менкеса характеризуются более высоким включением меди при всех используемых концентрациях Cu64 (фиг.7C) и более низкой скоростью оттока Cu64, чем клетки дикого типа (фиг.7D). Интересно, что включение Cu64 через 24 и 48 ч и в клетках дикого типа, и в клетках Менкеса выше, чем в собачьих клетках. Остается очевидным, что статические уровни меди в базовых условиях присутствуют в человеческих и собачьих клетках.

Экспрессия гена ATP7A не изменяется в клетках ATP7A T/T

Чтобы установить, обусловлено ли уменьшение оттока уровнем экспрессии ATP7A, авторы анализируют уровни транскриптов ATP7A методом количественной ПЦР. Изоформы ATP7A не описаны для собак, поэтому конструируют 3 нижеследующих набора праймеров: ATP7Ai - для амплификации участка, включающего мутацию, и ATP7Aiii и ATP7Aii конструируют для амплификации участков на 3'- и 5'-концах транскрипта, чтобы охватить сплайс-варианты. В базовых условиях или в условиях инкубации с медью различия в уровнях экспрессии ATP7A среди клеток с разными генотипами не обнаружены (фиг.8A). Однако в результате измерения уровней белка ATP7A обнаружено, что экспрессия ATP7A зависит от концентрации меди во всех 3 линиях собачьих клеток, причем в клетках ATP7AT/T наблюдается максимальная экспрессия (фиг.8B), которая не уменьшается при добавлении хелатора меди BCS в течение периода проведения измерений. Интересно, что в базовых условиях экспрессия ATP7A в клетках ATP7AT/T выше, чем в клетках ATP7AC/C. На мембране присутствует ряд полос, которые предположительно соответствуют разным изоформам. Указанные полосы не меняются и для простоты не указываются. Чтобы идентифицировать специфические полосы ATP7A, предпринимают дополнительное исследование с использованием миРНК и конструкций сверхэкспрессии.

В клетках ATP7A T/T наблюдается повышенная экспрессия гена MT1A

Чтобы определить действительно ли повышение уровня включения меди в клетки ATP7AT/T приводит к повышению экспрессии чувствительных к меди генов, авторы проводят анализ экспрессии металлотионеина 1A (MT1A) методом количественной ПЦР в клетках ATP7AC/C, ATP7AC/T и ATP7AT/T (фиг.9). Анализ экспрессии MT1A в необработанных клетках показывает, что клетки ATP7AC/T и ATP7AT/T характеризуются гораздо более высокой экспрессией MT1A, чем клетки ATP7AC/C (фиг.9A). Клетки ATP7AC/T и ATP7AT/T характеризуются значительной повышающей регуляцией экспрессии MT1A в ответ на 1-100 мкМ медь, тогда как в клетках ATP7AC/C существенная экспрессия наблюдается при добавлении меди на уровне выше 10 мкМ (фиг.9B). Дополнительное сравнение повышающей регуляции экспрессии MT1A в ответ на медь среди клеток с разными генотипами не дает значимых результатов при сравнении разных генотипов, за исключением ATP7AT/T в ответ на добавление 1 мкМ меди ATP7AC/CUT vs Cu1 vs ATP7AT/TUT vs Cu1; (p=0,014). Следовательно, клетки ATP7AT/T являются более чувствительными к меди (фиг.9C).

Медь-зависимая экспрессия гена металлотионеина выше в клетках ATP7A T/T , чем в клетках ATP7A C/C

Повышенное удерживание меди и соответственно повышенная медь-зависимая экспрессия MT1A в фибробластах ATP7AT/T, побудили авторов исследовать, действительно ли соответствующий фенотип Менкеса наблюдается в биопсийных образцах кишечника и печени. Так, экспрессию MT1A анализируют методом количественной ПЦР в замороженных биопсийных образцах тканей печени и тонкого кишечника, полученных от 3 субъектов, от которых были взяты фибробласты (фиг.10). Экспрессия MT1A значительно ниже в клетках ATP7AT/T ткани печени и значительно выше в клетках ATP7AT/T ткани тонкого кишечника, чем в клетках ATP7AC/C.

Фибробласты кожи собаки ATP7A T/T характеризуются пониженным транспортом ATP7A

Чтобы определить, действительно ли увеличение уровня меди в клетках ATP7AT/T обусловлено уменьшением транспорта ATP7A, авторы анализируют методом иммуноцитохимии изменение локализации ATP7A в ответ на медь в клетках разных типов. BCS используют для образования комплексов с внутриклеточной медью до "стадии" ATP7A в TGN (верхняя панель). Как и ожидалось, ATP7A в клетках ATP7AC/C и ATP7AT/T преимущественно находится в TGN (меченном антителом против 58K, средняя панель). После вымывания и последующей инкубации со 100 мкМ медью в течение 1-3 ч ATP7A в клетках ATP7AC/C перемещается из TGN на периферию клетки, чтобы обеспечить выведение меди из клетки. Клетки ATP7AT/T характеризуются заметным прекращением перемещения ATP7A, поскольку после воздействия меди ATP7A обнаруживается преимущественно в TGN. Плотность клеток, указанная на панелях, не является показателем скорости роста. Рост клеток обоих типов характеризуется одинаковой морфологией и плотностью.

Вывод

Исследования показывают, что скорость накопления меди выше в клетках, экспрессирующих мутантную форму белка; накопление выше в процессе воздействия меди, и высвобождение происходит медленнее после воздействия меди. Кроме того, внутриклеточное перемещение ATP7A в ответ на воздействие меди изменяется в клетках, несущих мутацию. В клетках, несущих мутацию, также повышается экспрессия белка, транспортирующего медь. Клетки, несущие две формы, имеют одинаковые уровни экспрессии ATP7A.

Результаты данного исследования позволяют предположить, что существуют значительные различия в транспорте и перемещении меди в клетках, несущих нормальные и мутантные формы ATP7A. Указанные различия могут служить основой для объяснения механизма, обеспечивающего выраженную характерную предрасположенность лабрадоров к накоплению меди как фактору развития CACH.

Пример 6

Краткое описание

Целью данного исследования является определение эффективности влияния диеты на концентрацию меди в печени лабрадоров после лечения пеницилламином, и является ли полезной дополнительная обработка цинком.

Исследование проводят в группе из 24 собак, включающей 12 самок и 12 самцов чистопородных лабрадоров. Собаки являются членами семьи бывших пациентов с хроническим гепатитом, связанным с медью. В начале испытания диетой собаки были клинически здоровыми, но концентрация меди в печени 20 собак превышала нормальное значение 400 мг/кг сухой массы (среднее: 894, диапазон: 70-2810 мг/кг сухой массы). Концентрацию меди измеряют после завершения лечения пеницилламином.

Все собаки получают одинаковую диету. В дополнение к диете вводят глюконат цинка (7,5 мг/кг PO BID, группа 1) или плацебо (группа 2). О распределении групп на протяжении исследования знает только фармацевт. Концентрацию меди в печени и гистопатологию определяют наряду с клиническим осмотром и анализом крови до и после лечения на протяжении в среднем 8 месяцев (диапазон 5-13) и 16 месяцев (диапазон 12-25). Концентрацию цинка в плазме измеряют в дополнительные моменты времени в процессе лечения.

К концу исследования остается двадцать одна собака породы лабрадор. К началу исследования средний возраст собак в группе 1 составляет 4,1 лет (диапазон 2,7-8,3). Шесть собак являются самками (5 стерилизованные, 1 интактная), и шесть - самцами (2 кастрированные, 4 интактные). Средний возраст собак в группе 2 составляет 4,8 лет (диапазон 3,6-11,2). Шесть собак являются самками (4 стерилизованные, 2 интактная), и шесть - самцами (2 кастрированные, 4 интактные). У 3 собак в группе, получающей в качестве добавки глюконат цинка, наблюдаются побочные эффекты в виде рвоты, анорексии и диарреи.

Существует значительное различие в концентрации меди в печени у обеих групп, получающих диету, с течением времени (8 месяцев: группа 1 p<0,001, группа 2 p=0,001, и 16 месяцев: группа 1 p=0,03, группа 2 p=0,04). Однако в указанных группах различия в концентрации меди в печени отсутствуют до лечения (p=0,65), при контрольной проверке 1 (p=0,52) и при контрольной проверке 2 (p=0,79), свидетельствуя о том, что применение цинксодержащей добавки не оказывает благоприятного влияния на накопление меди в печени.

Результаты демонстрируют, что определенная диета может способствовать эффективному снижению концентрации меди в печени лабрадоров. Дополнительное применение цинка не усиливает эффект снижения уровня меди.

Далее исследование описывается более подробно.

Материалы и способы

Лабрадоры ретриверы

Исследуемая популяция состоит из 24 чистопородных лабрадоров ретриверов, которые являются членами семейств собак, у которых ранее описан CACH. Все собаки зарегистрированы в голландском клубе лабрадоров ретриверов.

Лечение всех собак пеницилламином завершают до начала данного исследования. Для всех собак составляют истории болезни и проводят клиническое обследование. Образцы крови с Na-цитратным буфером используют для анализа профиля коагуляции, включающего протромбиновое время (PT), активированное частичное тромбопластиновое время (aPTT) и фибриноген. Образцы крови, содержащие гепарин и EDTA, используют для анализа гепатобилиарных ферментов, щелочной фосфатазы (ALP), аланинаминотрансферазы (ALT), желчных кислот (BA), а также для определения числа тромбоцитов и концентрации цинка в плазме. Биопсию печени проводят по методу Менгини, изложенному Rothuizen (Rothuizen J, I. T. (1998) Tijdschr Diergeneeskd 123: 246-252). У каждой собаки проводят по меньшей мере три биопсии печени. Образцы, полученные в результате двух биопсий, фиксируют 10 процентным нейтральным забуференным раствором формалина, и образец, полученный в результате третьей биопсии, хранят в контейнере, не содержащем меди, для количественного определения меди.

Все образцы, полученные в результате биопсий, подвергают гистологическому анализу. Анализ распределения и полуколичественное определение меди проводят по описанному ранее способу (Van den Ingh T.S.G.A.M., R. J., Cupery R. (1988) Vet Q 10: 84-89) путем окрашивания ткани печени рубеановой кислотой. В соответствии с используемой системой оценок, оценка содержания меди выше 2 соответствует аномальному состоянию (0: медь отсутствует, 1: отдельные клетки печени и/или ретикулогистиоцитарные (RHS) клетки содержат несколько положительных по меди гранул, 2: небольшие группы клеток печени и/или клеток RHS содержат положительные по меди гранулы в количестве от низкого до среднего, 3: более крупные группы или кластеры клеток печени и/или клеток RHS содержат умеренные количества положительных по меди гранул, 4: большие кластеры клеток печени и/или клеток RHS содержат много положительных по меди гранул, 5: диффузное состояние клеток печени и/или клеток RHS с большим числом положительных по меди гранул).

Количественный анализ меди проводят путем активации нейтронами, в соответствии с методом, описанным Teske et al, используя средства, описанные Bode (Bode, P. (1990) Journal of Trace and Microprobe Techniques 8: 139; Teske et al. (1992) Vet Rec 131: 30-32). Точную концентрацию меди измеряют в лиофилизированных биопсийных образцах печени и выражают в мг/кг сухой массы печени.

Помимо содержания меди, другие гистологические изменения классифицируют по шкале от 0 до 5, чтобы обеспечить статистическое тестирование (0 = гистологические признаки воспаления отсутствуют, 1 = реактивный гепатит, 2 = легкий хронический гепатит, 3 = средний хронический гепатит, 4 = тяжелый хронический гепатит, 5 = цирроз).

Данное исследование проводят с разрешения комитета по институциональному уходу за животными и их использованию университета г. Утрехта. Для всех собак получено согласие информированных владельцев.

Прогрессирование накопления меди в печени в отсутствии лечения

У одиннадцати собак измерение концентрации меди в печени повторяют в среднем через 8,7 месяцев (диапазон 6-15 месяцев), до какого-либо лечения. В течение этого времени все животные получают обычную поддерживающую диету, которая содержит медь в концентрации 12-25 мг/кг сухого вещества и цинк в концентрации 80-270 мг/кг сухого вещества, в соответствии с информацией, предоставляемой производителями.

Диета

Всем владельцам собак предоставляют одинаковые специально произведенные корма. Анализ показывает, что потребляемый корм примерно содержит: влаги 57,9%, неочищенного белка 6,1%, неочищенного жира 5,9%, минералов 1,7%. Метаболическая энергия (измеренная по методу Американской ассоциации государственных инспекторов по качеству кормов для животных): 1650 ккал/кг при потреблении). Корм содержит медь в концентрации 4,75 мг/кг сухого вещества и цинк в концентрации 102 мг/кг сухого вещества. Собаки получают корм без дополнительных пищевых добавок и в отсутствии лечения. Лабрадоры, участвующие в данном исследовании, получают от 420 до 840 г корма/день.

Фармакокинетический анализ

Для фармакокинетического анализа используют двух не состоящих в родстве здоровых лабрадоров ретриверов возрастом девять лет (1 самка и 1 самец). Подачу корма приостанавливают в течение 12-часового периода до перорального введения цинка и в процессе начального 6-часового периода тестирования. Вода находится в свободном доступе. Глюконат цинка вводят перорально собаке 1 в дозе 10 мг/кг, и собаке 2 в дозе 5 мг/кг. Гепаринизированные образцы крови (4 мл) собирают из яремной вены до введения (момент времени 0) и затем через 15, 30, 45, 60, 90, 120 минут, и через 4, 8, 12 и 24 часов после применения лекарственного средства. Плазму хранят при -20°C до анализа на цинк методом атомно-абсорбционной спектрометрии.

Получение лекарственного средства, рандомизация и проведение слепого исследования

Выбор глюконата цинка основан на клиническом наблюдении авторов изобретения, которое показывает, что данное лекарственное средство имеет меньше побочных эффектов, чем другие соли, такие как ацетат или сульфат. Таблетки производит ветеринарная аптека факультета ветеринарной медицины Университета г. Утрехта. Таблетки цинка содержат 25 мг элементарного цинка в виде соли глюконата цинка (Toppharm Zink 25 gluconaat, Parmalux BV, Uitgeest, NL). Таблетки плацебо содержат 160 мг лактозы (Albochin, Pharmachemie BV, Haarlem, NL). Таблетки из обеих групп имеют одинаковый вид.

Перед исследованием фармацевт случайным образом распределяет собак по группам, состоящим из шести особей, путем бросания монеты. Три собаки получают плацебо и три получают цинк. По назначению клинициста таблетки (плацебо или цинк) распределяют в соответствии с таблицей рандомизации.

Дозировку назначают в соответствии со следующей схемой:

Масса тела:

<28 кг (<61,6 фунт): 8 таблеток BID (200 мг BID)

28-35 кг (61,6-77 фунт): 9 таблеток BID (225 мг BID)

выше 35 (>77 фунт): 10 таблеток BID (250 мг BID)

В соответствии с полученными инструкциями владельцы дают собакам таблетки, смешанные с небольшим количеством корма за 30 минут до кормления. Ни владелец, ни клиницист не осведомлены о том, какое средство получает собака. На протяжении испытания таблица рандомизации остается на хранении у фармацевта, который показывает ее только после окончания эксперимента.

Статистический анализ

Определение фармакокинетических параметров (WinNonlin 4.0.1. (Pharsight Corporation, 800 West El Camino Real, Mountain View, CA, USA) и статистический анализ (SPSS 11.0 for windows, 2001, SPSS Inc., Chicago, IL, USA) проводят с использованием коммерчески доступных пакетов программ. Поскольку группы имеют небольшой размер, для их сравнения используют непараметрический статистический тест. Тест Манна-Уитни используют для определения различия в концентрации меди в печени до и после применения диеты и глюконата цинка (группа 1) в двух контрольных анализах (контрольная проверка 1 и контрольная проверка 2), и после применения диеты и плацебо (группа 2) в обоих контрольных анализах. Кроме того, указанный тест используют для определения различий между группой 1 и группой 2 до исследования, при контрольной проверке 1, и при контрольной проверке 2 (уровень достоверности p<0,05).

Результаты

Прогрессирование накопления меди в печени в отсутствии лечения

У одиннадцати собак породы лабрадор измерение концентрации меди в печени повторяют до какого-либо лечения, пока собаки получают обычную поддерживающую диету. У всех собак, кроме одной, концентрация меди в печени повышается на протяжении интервала 8,7 месяцев между обоими измерениями от среднего значения 1000 мг/кг сухой массы (диапазон 290-2370) до среднего значения 1626 мг/кг сухой массы (диапазон 630-3610). С учетом массы тела пациентов (средняя: 33,9 кг, диапазон 25-39,5 кг) данное увеличение составляет 18 мг меди на кг массы тела в течение 8,7 месяцев. Результаты приведены на фиг.1.

Фармакокинетический анализ

Ниже приведены фармакокинетические параметры, рассчитанные исходя из концентраций цинка в плазме, измеренных у двух собак после перорального введения 10 мг/кг (собака 1) и 5 мг/кг (собака 2) элементарного цинка:

Собака 1 (10 мг/кг): V_F: объем распределения=2937,872 мл/кг массы тела, K01: константа скорости абсорбции=0,567212 л/час, K10: константа скорости элиминации=0,053728 л/час, AUC: площадь под кривой=63,35272 ч*мкг/мл, Cl_F: клиренс в связи с биодоступностью=157,8464 мл/ч/кг, Tmax: время достижения максимальной концентрации=4,589813 часов, Cmax: максимальный клиренс=2,659924 мкг/мл)

Собака 2 (5 мг/кг): V_F: объем распределения=2538,689 мл/кг массы тела, K01: константа скорости абсорбции=1,160647 л/час, K10: константа скорости элиминации=0,037886 л/час, AUC: площадь под кривой=51,98513 ч*мкг/мл, Cl_F: клиренс в связи с биодоступностью=96,18135 мл/ч/кг, Tmax: время достижения максимальной концентрации=3,047974 часов, Cmax: максимальный клиренс=1,754728 мкг/мл).

Рассчитанный период полужизни цинка t½ составляет 15,1 часов. Скорость накопления R, рассчитанная по формуле: R=1/(1-exp(-k10*24), составляет 1,52. Интервал дозирования составляет 12 часов. Оценка дозирования, рассчитанная исходя из среднего значения Cl_F обоих собак, составляет 127,0139 мл/ч/кг. Оценка соответствующего дозирования, основанная на предполагаемой максимальной концентрации цинка в плазме, составляет 5 мкг/мл. Доза=Cl_F×предполагаемая концентрация в крови×интервал дозирования=7,62 мг/кг q 12 часов

Диетарное испытание и рандомизированное, плацебо-контролируемое применение цинка

В начале диетарного испытания концентрация меди в печени 20 собак превышает нормальный диапазон 400 мг/кг сухой массы (среднее: 894, диапазон: 70-2810 мг/кг сухой массы). Результаты полуколичественного анализа меди варьируют от 0 до 4,5. Гистопатологический анализ образцов, полученных в результате биопсии печени 17 собак, показывает, что в печени наблюдается повышенный уровень меди (выше 2), которая локализуется в центрилобулярных гепатоцитах. Окрашивание на медь является нормальным у 5 собак, и интенсивно нормальным в биопсийных образцах 2 собак, имеющих повышенный уровень меди в печени по данным количественного анализа. У семи собак присутствует хронический гепатит. CH характеризуется разной степенью гепатоцеллюлярного апоптоза и некроза, мононуклеарным воспалением, регенерацией и фиброзом. Активность печеночного воспаления измеряют путем количественного определения воспаления и степени гепатоцеллюлярного апоптоза и некроза. Стадию заболевания определяют по степени и характеру фиброза и по наличию цирроза. Легкий гепатит наблюдается у 4 пациентов, средний - у 2 собак и цирроз диагностируют у 1 собаки. У тринадцати собак отсутствуют гистологические симптомы воспаления в печени, и гистопатологический анализ биопсийных образцов показывает реактивные изменения у 4 собак.

В начале исследования средний возраст собак в 1 группе составляет 4,1 года (диапазон 2,7-8,3). Шесть собак представляют собой стерилизованных самок и шесть являются самцами (2 кастрированные, 4 интактные). Средняя масса тела составляет 33 кг (диапазон 26,2-37,5). Средняя концентрация меди в печени собак 1 группы составляет 961 мг/кг сухой массы (диапазон 340-2810). Средняя оценка содержания меди, полученная путем полуколичественного метода гистологического окрашивания, составляет 2-3+(диапазон 0-4,5).

Средний возраст собак во 2 группе составляет 4,8 года (диапазон 3,6-11,2). Шесть собак представляют собой самок (4 стерилизованные, 2 интактные), и 6 являются самцами (2 кастрированные, 4 интактные). Средняя масса тела составляет 32,3 кг (диапазон 25-41,9). Средняя концентрация меди в печени собак 2 группы составляет 861 мг/кг сухой массы (диапазон 70-1680). До лечения различия в концентрации меди в печени среди двух групп отсутствуют (p=0,73). Средняя оценка содержания меди, полученная путем полуколичественного метода гистологического окрашивания, составляет 2-3+(диапазон 0,5-3).

До конца исследования не доходят три собаки из 1 группы. Причина прекращения участия в эксперименте всех трех собак не связана с лечением (один владелец решил, что его собака стала слишком старой, другой владелец имеет личные причины, и у одной собаки развилась тучноклеточная опухоль). Двадцать одна собака доходит до конца исследования по меньшей мере с одним контрольным анализом (контрольная проверка 1). У шестнадцати собак проводят биопсию печени в дополнительный более поздний момент времени (контрольная проверка 2).

У трех собак из 1 группы наблюдаются побочные эффекты, такие как рвота и анорексия. Одна из этих собак также имеет тонкокишечную диарею. Побочные эффекты наблюдаются сразу после применения таблеток и исчезают, если таблетки смешивают с кормом.

Анализы крови

Концентрация желчных кислот уменьшается от среднего значения 14 мкмоль/л (диапазон: 3-101) до среднего значения 7,8 (диапазон: 1-39) при контрольной проверке 1 и 7,1 (диапазон: 0-21) при контрольной проверке 2. Средняя концентрация щелочной фосфатазы (ALP) и аланинаминотрансферазы (ALT) остается на нормальном уровне во всех анализах. Средняя концентрация ALP до лечения составляет 41 ед./л (диапазон: 8-111), при контрольной проверке 1: средняя концентрация ALP=37 ед./л (диапазон 12-143), при контрольной проверке 2: средняя концентрация ALP=37 ед./л (диапазон: 19-152). Средняя концентрация ALT до лечения составляет 28 ед./л (диапазон: 10-234), при контрольной проверке 1: средняя концентрация ALT=47 ед./л (диапазон: 11-78), при контрольной проверке 2: Средняя концентрация ALT=51 ед./л (26-68).

В начале исследования средняя концентрация цинка в плазме составляет 95 мкг/дл и 96 мкг/дл в группе 1 и группе 2, соответственно. Различие в концентрациях цинка в плазме во всех группах отсутствует при контрольной проверке 1 и при контрольной проверке 2 (значения p находятся в интервале от 0,11 до 0,79). Различие в концентрациях цинка в плазме между группой 1 и группой 2 отсутствует во всех трех анализах (значения p находятся в интервале от 0,34 до 0,5). Единственным моментом времени, когда может быть обнаружена разница в концентрациях цинка в плазме, является анализ крови после первого месяца приема цинка в группе 1. Образцы крови берут через 2-6 часов после приема цинка. В данном контрольном анализе средняя концентрация цинка в плазме повышается до 165 мкг/дл (диапазон 117-249, p=0,02).

Измерение содержания меди в печени

Результаты количественного определения содержания меди в печени улучшаются в процессе лечения в обеих группах. При контрольной проверке 1 и при контрольной проверке 2 концентрации меди в печени значительно уменьшаются в обеих группах собак по сравнению с исходными значениями (в группе 1 при контрольной проверке 1: среднее значение 286 мг/кг, диапазон 84-700, p<0,001; в группе 1 при контрольной проверке 2: среднее значение 421 мг/кг, диапазон 220-790, p=0,03, в группе 2 при контрольной проверке 1: среднее значение 277 мг/кг, диапазон 80-450, p=0,001, в группе 2 при контрольной проверке 2: среднее значение 401 мг/кг, диапазон 118-850, p=0,04). Различие в концентрации меди в печени среди двух групп отсутствует при контрольной проверке 1 (p=0,52) и при контрольной проверке 2 (p=0,79). Кроме того, отсутствует дополнительное уменьшение концентрации меди в печени от контрольной проверки 1 к контрольной проверке 2 (в группе 1 p=0,44, в группе 2 p=0,25). Результаты приведены на фиг.2.

Гистология

Результаты гистологического окрашивания на медь улучшаются в процессе лечения. Гистологические оценки, полученные в результате полуколичественного анализа меди, уменьшаются в группе 1 и в группе 2 при контрольной проверке 1 и при контрольной проверке 2 по сравнению с исходными значениями (в группе 1 при контрольной проверке 1: p=0,031, в группе 1 при контрольной проверке 2: p=0,01, в группе 2 при контрольной проверке 1: p=0,01, в группе 2 при контрольной проверке 2: p=0,001). Во все моменты времени различия между группами отсутствуют (p=0,16-0,75).

Гистологические оценки тяжести воспаления в печени остаются неизменными на протяжении всех обследований собак из обеих групп (p=0,25-0,45).

Заключение

Чтобы обеспечить пациентам с CACH более сбалансированный долговременный контроль за концентрацией меди в печени, предпринимают данное исследование, целью которого является определение эффективности влияния диеты на концентрацию меди в печени лабрадоров после лечения пеницилламином и целесообразности дополнительного применения. Результаты данного исследования показывают, что диета может приводить к существенному снижению концентрации меди в печени. Дополнительное применение цинка не усиливает эффект снижения концентрации меди.

Пример 7

При исследовании влияния цинка на концентрацию меди в печени данную концентрацию измеряют у 18 чистопородных лабрадоров ретриверов. Половине собак дают цинксодержащую добавку, а другой половине дают плацебо. Все собаки получают корм, описанный в примере 6. Концентрацию меди в печени измеряют с помощью способа примера 6 в 3 момента времени: (1) до лечения пеницилламином; (2) после лечения пеницилламином, но перед применением корма, описанного в примере 6; и (3) после применения корма. Как и в примере 6, у собак, получающих цинк и плацебо, отсутствуют существенные различия в уровнях меди (данные не показаны). Однако применение корма оказывает значительное влияние на уровень меди. Объединенные результаты для собак, получающих цинк и плацебо, приведенные на фиг.3, демонстрируют, что диета с низким содержанием меди оказывает более существенное влияние на уменьшение уровня меди в печени, чем один пеницилламин.

Пример 8

Ниже приведен пример корма настоящего изобретения:

Ингредиент (%) 100
Вода 47,4
Крупы 28,5
Растительные субпродукты 1,7
Яйца и яичные субпродукты 1,5
Мясо и животные субпродукты 17
Масла и жиры 2
Минералы и витамины 1,9

В нижеследующей таблице приведены результаты стандартного анализа содержания минералов и следовых элементов в указанном корме наряду с используемыми методами анализа:

Ингредиент Содержание (массовый % в корме или мг/кг сухого вещества) Примечания
Влага 63% Потеря в результате сушки при 105°С в течение 5 часов
Белок 6,5% Содержание белка определяют по Кьельдалю, используя азотный коэффициент 6,25
Жир 4,2% Кислый гидролиз и экстракция петролейным эфиром
Зола 2,2% Режим линейного увеличения температуры в течение 16 ч, конечную золу получают после обработки при 550°С в течение 5 часов
Сырая клетчатка 1,4% Метод EC OJL34426/11/92 P35, директива 92/89
Медь 5,4 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Цинк 229 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Железо 62 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Кальций 9460 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Фосфор 5405 Колориметрический анализ

Пример 9

Ниже приведен пример другого корма настоящего изобретения:

Ингредиент (%) 100
Крупы 39,7
Растительные субпродукты 8,0
Экстракт растительных белков 5,0
Мясо и животные субпродукты 35,6
Масла и жиры 7,5
Минералы и витамины 4,2

В нижеследующей таблице приведены результаты стандартного анализа содержания минералов и следовых элементов в указанном корме наряду с используемыми методами анализа:

Ингредиент Содержание (массовый % в корме или мг/кг сухого вещества) Примечания
Влага 8,0%% Потеря в результате сушки при 105°С в течение 5 часов
Белок 30,0% Содержание белка определяют по Дюма, используя азотный коэффициент 6,25
Жир 13,0% Кислый гидролиз и экстракция петролейным эфиром
Зола 6,3% Режим линейного увеличения температуры в течение 16 ч, конечную золу получают после обработки при 550°С в течение 5 часов
Сырая клетчатка 4,1% Метод EC OJL34426/11/92 P35, директива 92/89
Медь 10,9 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Цинк 245 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Железо 217 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Кальций 1087 мг/кг Метод пламенной атомно-абсорбционной спектрофотометрии
Фосфор 760 Колориметрический анализ

1. Способ тестирования собаки с целью определения вероятности наличия у собаки защиты от накопления меди в печени или предрасположенности к накоплению меди в печени, включающий:
(i) генотипирование образца ДНК собаки по одному или более полиморфизмов, выбранных из:
(a) полиморфизма одиночных нуклеотидов (SNP) ATP7a_Reg3_F_6 гена ATP7a (представленного положением 102 SEQ ID NO: 142), причем аллель Т указывает на наличие защиты от накопления меди в печени, а аллель С указывает на наличие предрасположенности к накоплению меди в печени, и
(b) одного или более полиморфизмов, находящихся в неравновесном сцеплении с полиморфизмом (a), который составляет 680 т.п.о. и располагается на той же хромосоме, что и полиморфизм (a), и рассчитанный показатель неравновесного сцепления, R2, между полиморфизмом (a) и полиморфизмом, находящимся в неравновесном сцеплении с указанным полиморфизмом (a), больше или равен 0,85;
с использованием специфического связующего средства, которое выбрано из зонда или комбинации праймеров, и которое способно детектировать указанный выбранный полиморфизм или помогать его детекции; и
(ii) определение, из результатов указанной стадии генотипирования, присутствует ли у собаки защита от накопления меди в печени или предрасположенность к накоплению меди в печени.

2. Способ по п.1, включающий генотипирование образца по (a) SNP ATP7a_Reg3_F_6 гена ATP7a (представленному положением 102 SEQ ID NO: 142) или (b) SNP ATP7a_Reg16_F_42 гена ATP7a (представленному положением 68 SEQ ID NO: 143).

3. Способ по п.1, где собака находится на первом году жизни.

4. Способ по п.1, где собака наследует генетические признаки породы Лабрадор ретривер, золотистый ретривер или карликовый пудель.

5. Способ по п.4, где собака наследует генетические признаки породы Лабрадор ретривер.

6. Применение (a) SNP ATP7a_Reg3_F_6 гена ATP7a (представленного положением 102 SEQ ID NO: 142), где аллель Т указывает на наличие защиты от накопления меди в печени, а аллель C указывает на наличие предрасположенности к накоплению меди в печени, или (b) полиморфизма, находящегося в неравновесном сцеплении с полиморфизмом (a), который составляет 680 т.п.о. и располагается на той же хромосоме, что и полиморфизм (a), и рассчитанный показатель неравновесного сцепления, R2, между полиморфизмом (a) и полиморфизмом, находящимся в неравновесном сцеплении с указанным полиморфизмом (a), больше или равен 0,85, для определения вероятности наличия у собаки защиты от накопления меди в печени или предрасположенности к накоплению меди в печени.

7. Способ отбора собаки для получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени, включающий:
- генотипирование образца ДНК первой собаки-кандидата по одному или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени, в соответствии со способом по п.1, и, как следствие, определение пригодности первой собаки-кандидата для получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени;
- необязательно генотипирование образца ДНК второй собаки, имеющей пол, противоположный полу первой собаки, по одному или более полиморфизмов, указывающих на наличие защиты от накопления меди в печени, в соответствии со способом по п.1; и
- необязательно спаривание первой собаки со второй собакой с целью получения потомства, с большой вероятностью обладающего защитой от накопления меди в печени.

8. Способ по п.7, где собака наследует генетические признаки породы Лабрадор ретривер, золотистый ретривер или карликовый пудель.

9. Способ по п.8, где собака наследует генетические признаки породы Лабрадор ретривер.

10. Способ предотвращения заболевания, связанного с накоплением меди в печени собаки, имеющей генетическую наследственность породы Лабрадор ретривер, где вероятность наличия у собаки защиты от накопления меди в печени или предрасположенности к накоплению меди в печени определяют согласно способу по п. 1, который включает кормление собаки кормом, содержащим медь в концентрации от 4,5 до 10 мг/кг сухого вещества.

11. Способ по п.10, где корм дополнительно содержит цинк в концентрации, составляющей по меньшей мере 120 мг/кг сухого вещества.

12. Способ по п.10, где корм содержит медь в концентрации от 4,5 до 8 мг/кг сухого вещества; и/или содержит цинк в концентрации от 120 до 250 мг/кг или от 150 до 250 мг/кг сухого вещества.

13. Способ по п.10, для предотвращения заболевания, связанного с накоплением меди в печени собаки:
(i) по меньшей мере один родитель которой представляет собой чистопородного Лабрадора ретривера;
(ii) которая не имеет клинических симптомов накопления меди в печени;
(iii) у которой концентрация меди в печени составляет менее 400 мг/кг сухой массы печени; и/или
(iv) у которой не диагностировано заболевание печени.

14. Способ по п.10, который предназначен для профилактики связанного с медью хронического гепатита.

15. Способ по п.10, дополнительно включающий предоставление собаке корма или добавки, содержащих цинк в концентрации, составляющей по меньшей мере 120 мг/кг.



 

Похожие патенты:

Группа изобретений относится к области биотехнологии. Способ диагностики наличия гломерулонефрита у кошки предусматривает измерение уровня экспрессии одного или нескольких биомаркеров, выбранных из группы, состоящей из люмикана; цепи коллагена альфа 1 (III), варианта 12; декорина; секретируемого родственного frizzled белка 2; ретинол-связывающего белка 5; MMP-2; MMP-7 и MMP-19, в биологическом образце, полученном от кошки.
Изобретение относится к области медицины и предназначено для детекции гриба Trichophyton mentagrophytes. Осуществляют выделение тотальной нативной ДНК из образца кожи и волос, проводят полимеразную цепную реакцию и амплификацию фрагмента гена 5.8S рРНК Trichophyton mentagrophytes с использованием специфических праймеров.

Изобретение относится к области биотехнологии. Предложены способы диагностики пациентов с рассеянным склерозом (PC).

Изобретение относится к области биохимии, в частности к выделенному антителу, которое специфически связывается с TAT211, или его функциональному фрагменту. Также раскрыты конъюгат, содержащий указанное антитело и который специфически связывает TAT211, нуклеиновая кислота, кодирующая заявленное антитело, и клетка, которая продуцирует заявленное антитело.

Изобретение относится к области биоинженерии и касается генетической конструкции, предназначенной для введения в хромосому Yarrowia lipolytica гена RecA из Bacillus subtilis. Представленная конструкция характеризуется последовательностью SEQ ID NO 1.

Изобретение относится к биотехнологии, а именно к способу обнаружения ДНК возбудителя туберкулеза - микобактерий туберкулезного комплекса с одновременным установлением генотипа возбудителя и определением генетических детерминант устойчивости к широкому спектру противотуберкулезных препаратов, включая рифампицин, изониазид, фторхинолоны, канамицин, капреомицин, амикацин, этамбутол, в клиническом образце на дифференцирующем олигонуклеотидном микрочипе.

Изобретение относится к области биохимии, в частности к способу определения присутствия или отсутствия локуса устойчивости к пыльной головне в растении маиса, а также к способу определения растения маиса, которое проявляет устойчивость к пыльной головне, где способ включает обнаружение в идиоплазме растения маиса, по меньшей мере, одной аллели маркерного локуса, расположенного на хромосомном участке хромосомы 2 маиса, включающем и фланкированном umc1736 и umc2184.

Группа изобретений относится к области медицины и может быть использована для диагностических исследований. Группа изобретений характеризует автоматическую систему количественной амплификации в реальном времени, способ автоматической очистки нуклеиновой кислоты и количественного определения амплификации гена с использованием указанной системы, способ автоматического измерения количества жизнеспособных клеток патогенных бактерий, анализа патогенных бактерий на чувствительность к антибиотикам и автоматического получения антигенной плотности с использованием указанной системы, а также способ очистки связывающей нуклеиновой кислоты-мишени, которой мечен антиген-мишень, содержащийся в биологическом образце, с использованием указанной автоматической системы.
Изобретение относится к области медицины, а именно к способу прогнозирования депрессии тяжелой степени у мужчин с ишемической болезнью сердца (ИБС). Сущность способа состоит в том, что у мужчин с ИБС устанавливают временную и структурную связь между ИБС и признаками депрессии, измеряют уровень личностной тревожности с помощью теста Спилбергера-Ханина.
Изобретение относится к области генетической инженерии, молекулярной биологии и медицины. Предложен набор биомаркеров старения сердца, включающий множество полинуклеотидов, которые дифференциально экспрессируются в ткани сердца у старых субъектов по сравнению с молодыми субъектами, в котором полинуклеотиды выбирают из двух или более генов, вовлеченных в передачу Wnt-сигнала в ткани сердца, где гены представляют собой Dlgh1, Magi3, Akt1, Dab2, Rac1, Ctnnb1, Camk2d, Mapk1, Senp2, Smad3, Mark2, Ccnd1 и Pias4, а также соответствующая композиция и способ скрининга средства или режима на их способность замедлять старение сердца.

Изобретение относится к области генетики и молекулярной биологии и касается способа анализа генетического полиморфизма в полиморфных точках генов. Охарактеризованное изобретение включает генотипирование локусов, ответственных за предрасположенность к шизофрении и алкоголизму, с помощью технологии ДНК-биочипов и набора реагентов. Изобретение обеспечивает возможность определения нуклеотидного состава в десяти полиморфных позициях: HTR2A (rs6311, rs6314, rs7997012), BDNF (rs6265), DISC1 (rs3737597), ZNF804A (rs1344706), RELN (rs7341475), COMT (rs165599), SLC18A (rs2270641), PLXNA2 (rs1327175), ADH1B (rs1229984, rs1042026), ALDH2 (rs671), DRD2 (rs1800497, rs1799732), COMT (rs4680), NPY (rs16139), ADH1C (rs1693482), NKR1 (rs6715729) и AUTS2 (rs6943555), что, в свою очередь, позволяет охарактеризовать потенциальную предрасположенность к шизофрении и алкоголизму. Изобретение позволяет упростить анализ генетического полиморфизма для определения предрасположенности к шизофрении и алкоголизму. 2 з.п. ф-лы, 3 ил., 4 табл., 2 пр.

Изобретение относится к области биотехнологии. Предложен способ скрининга на появление, предрасположенность к появлению и/или развитие неоплазмы. Способ предусматривает скрининг в отношении модуляции ДНК или РНК или профиля экспрессии белка одного или нескольких маркеров молекул нуклеиновой кислоты. Изменения ДНК или РНК или профилей экспрессии белков являются показателями появления и/или развития неоплазмы толстой кишки, такой как аденома или аденокарцинома. Изобретение может быть использовано в медицине для диагностики или мониторинга колоректальных неоплазм, таких как колоректальные аденокарциномы. 2 н. и 11 з.п. ф-лы, 3 ил., 8 табл., 6 пр.

Изобретение относится к биотехнологии, а именно к способу захвата и амплификации избранной последовательности и набору для его осуществления. Способ включает получение субстрата, представленного твердофазной подложкой, содержащего первую и вторую популяции связанных с поверхностью олигонуклеотидов, где данные олигонуклеотиды распределены случайным образом относительно друг друга на субстрате. Гибридизируют первый член первой популяции с синтетическим олигонуклеотидом отбора, содержащим участок, который гибридизируется с первым членом, и участок, который содержит геномную последовательность. Удлиняют первый член первой популяции для получения дуплекса, который содержит связанный с подложкой праймер отбора, содержащий последовательность, комплементарную геномной последовательности. Удаляют олигонуклеотид отбора путем денатурации, оставив удлиненный, связанный с подложкой праймер отбора. Гибридизируют связанный с подложкой праймер отбора с фрагментированным геномом, содержащим фрагмент нуклеиновой кислоты, включающий геномную последовательность. Удлиняют связанный с подложкой праймер отбора для получения продукта удлинения, который содержит последовательность, комплементарную фланкирующей последовательности, где фланкирующая последовательность фланкирует геномную последовательность. Амплифицируют геномный продукт на субстрате с помощью мостиковой ПЦР с использованием неудлиненных членов первой и второй популяции связанных с поверхностью олигонуклеотидов, для получения продукта ПЦР. Предложенное изобретение позволяет осуществить обогащение мишени непосредственно на субстрате, используемом для секвенирования. 2 н. и 17 з.п. ф-лы, 18 ил., 4 табл., 1 пр.

Изобретение относится к области биотехнологии и касается способа дифференциации биоваров и геновариантов штаммов Yersinia pestis основного подвида с помощью полимеразной цепной реакции. Способ предусматривает выделение ДНК исследуемого штамма, последовательное проведение ПЦР с праймерами на ДНК мишени «Med24», «glpD», «pCKF» и с праймерами «1.ANT/1.ORI», «2.ANT/2.MED следующего состава: Дифференциацию осуществляют путем сравнения наличия и размеров образуемых амплифицированных фрагментов исследуемого штамма с размерами фрагментов типичных штаммов античного (геноварианты 0.ANT, 1.ANT, 2.ANT), средневекового (геноварианты 2.MED, 2.MED0) и восточного (геновариант 1.ORI) биоваров. Представленное изобретение позволяет быстро и эффективно разделить штаммы возбудителя чумы по их биоварной и внутрибиоварной принадлежности. 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способам детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот в анализе с РТОСЕ (расщеплением и удлинением РТО). Способ включает детекцию нуклеиновокислотной последовательности-мишени, при этом PTO (зондирующий и метящий олигонуклеотид), гибридизованный с нуклеиновокислотной последовательностью-мишенью, расщепляется с высвобождением фрагмента. Фрагмент гибридизуется с CTO (захватывающим и матричным олигонуклеотидом) с образованием удлиненного дуплекса. Детектируют присутствие удлиненного дуплекса. Удлиненный дуплекс обеспечивает получение сигналов от меток, указывающих на присутствие удлиненного дуплекса, и имеет регулируемую величину Tпл, что хорошо подходит для детекции присутствия нуклеиновокислотной последовательности-мишени. Предложенное изобретение позволяет проводить детекцию нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с высокой эффективностью. 4 н. и 53 з.п. ф-лы, 30 ил., 7 пр.

Группа изобретений относится к области биотехнологии и касается зонда пептидных нуклеиновых кислот (PNA) для обнаружения рода Salmonella в различных типах проб, набора, включающего такой зонд, способа обнаружения Salmonella и применений указанных зонда и набора в обнаружении Salmonella. PNA представляет собой синтетическую молекулу, аналогичную ДНК, имеющую последовательность SEQ ID No. 1 - 5′-AGG AGC TTC GCT TGC-3′. PNA-зонды комбинируют с флуоресцентной in situ гибридизацией (FISH), для обеспечения прямой визуализации микроорганизма в пробе. Такая комбинация делает процедуру FISH более быстрой, более простой и более эффективной. PNA-зонд может быть применен к большому разнообразию проб, таким как пробы крови, пищевых продуктов, биопсий, фекалий, воды и другим клиническим пробам, имеющим отношение к окружающей среде или сельскому хозяйству и пищевой промышленности. Представленная группа изобретений обеспечивает более быстрый анализ с более высокой чувствительностью, чем ДНК-зонды при обнаружении Salmonella. 5 н. и 4 з.п. ф-лы, 1 ил., 2 пр., 1 табл.

Изобретение относится к области биотехнологии и может быть использовано для хранения препаратов ДНК в жидком виде. Получают композицию, содержащую буферный раствор, включающий 0,5-4% N-лаурилсаркозина, 5-20 мМ ЭДТА, 30-200 мМ Трис (гидроксиметил) аминометана и воду - остальное. Варианты композиции могут содержать 0,04-0,4% NaN3 (азида натрия) вместо Трис либо совместно с ним. Полученные композиции применяют для пропитки пористых носителей для хранения и/или транспортировки ДНК-содержащих препаратов или ДНК. Изобретение обеспечивает стабильность ДНК биообразцов в широком диапазоне температур в течение длительных периодов времени. 4 н. и 15 з.п. ф-лы, 4 ил., 6 табл., 4 пр.

Группа изобретений относится к биотехнологии. Предложен способ определения наличия штамма молочнокислых бактерий, включающего IS-элемент, в молочном продукте. Способ включает получение образца нуклеиновых кислот из молочного продукта, предоставление пары праймеров, специфичных для области IS-элемента и области последовательности нуклеиновых кислот, прилежащей к IS-элементу, реакцию ПЦР с парой указанных праймеров, выявление наличия штамма молочнокислых бактерий путем детекции наличия указанного продукта амплификации. В качестве штамма молочнокислых бактерий и праймеров используют соответственно штамм Pediococcus acidilactii DSM 22981 и пару праймеров, охарактеризованных SEQ ID NO: 1 и SEQ ID NO: 2 и/или штамм Lactobacillus delbrueckii subsp.lactis DSM 24025 и пару праймеров, охарактеризованных SEQ ID NO: 6 и SEQ ID NO: 7. Вышеуказанные штаммы молочнокислых бактерий предназначены также для маркировки молочного продукта. Предложены также применение штаммов в производстве или идентификации молочных продуктов, а также молочный продукт, содержащий указанные штаммы. Предложен также набор для специфической детекции штамма молочнокислых бактерий, включающий пару вышеуказанных праймеров. Группа изобретений обеспечивает быструю и эффективную идентификацию молочных продуктов. 9 н. и 6 з.п. ф-лы, 2 пр.

Изобретение относится к области биотехнологии и касается способа прогнозирования устойчивого вирусологического ответа у человеческого индивида, инфицированного вирусом гепатита С с генотипом 1, на лечение с помощью интерферона. Представленный способ включает предоставление образца от человеческого индивида, выявление наличия однонуклеотидного полиморфизма в хромосоме 4 и определениЕ того, что указанный индивид имеет высокую вероятность устойчивого вирусологического ответа на лечение интерфероном в случае, если указанный однонуклеотидный полиморфизм присутствует и выбран из группы, включающей G в rs10009948, G в rs10023606 и Т в rs7673763. Изобретение позволяет различать потенциальных пациентов, реагирующих и не проявляющих ответ на стандартное медицинское лечение. 1 з.п. ф-лы, 3 ил., 4 табл., 1 пр.

Изобретение относится к биотехнологии, а именно к способу комбинирования определения генотипа IL28B вместе с измерением сывороточного уровня IFN-γ-индуцируемого белка 10 (IP-10) для прогнозирования получения устойчивого вирусологического ответа (SVR) или отсутствия ответа на пегинтерферон и рибавирин для индивидуальных пациентов, инфицированных HCV, а также к диагностическому набору для применения в данном способе. Способ включает определение генотипа IL28B с помощью полиморфного маркера rs12979860 и сывороточного уровня IP-10 в группах с генотипом IL28B, который обеспечивает дополнительную и независимую информацию в отношении вероятности SVR. Носители СС с IP-10<600 пг/мл имеют вероятность SVR 100% и вероятность 75%, когда IP-10>600 пг/мл. Носители СТ с IP-10<600 пг/мл имеют вероятность SVR 79% и вероятность 34%, когда IP-10>600 пг/мл. Носители ТТ с IP-10<600 пг/мл имеют вероятность SVR 50% и вероятность 10%, когда IP-10>600 пг/мл. Предложенное изобретение позволяет получить информацию об устойчивом вирусологическом ответе на пегинтерферон и рибавирин у индивидуальных пациентов, инфицированных HCV. 2 н. и 5 з.п. ф-лы, 15 ил., 4 табл.
Наверх