Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием



Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием
Микроорганизмы, имеющие улучшенную орнитин-продуцирующую способность, и способ получения орнитина с их использованием

 


Владельцы патента RU 2567669:

СиДжей ЧЕИЛДЗЕДАНГ КОРПОРЕЙШН (KR)

Изобретение относится к биотехнологии и представляет собой микроорганизм, имеющий орнитин-продуцирующую способность, где активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата (NCgl1221), модифицированы таким образом, что они являются делетированными в сравнении с их эндогенными активностями. Изобретение относится также к способу получения орнитина с использованием этого микроорганизма. Изобретение позволяет получать L-орнитин с высокой степенью эффективности. 2 н. и 9 з.п. ф-лы, 3 ил., 6 табл., 4 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к микроорганизму, имеющему улучшенную орнитин-продуцирующую способность, и способу получения орнитина с его использованием.

Известный уровень техники

Орнитин является веществом, широко обнаруживаемым в растениях, животных и микроорганизмах, и используется в качестве предшественника в биосинтезе аргинина, пролина и полиаминов. В качестве незаменимой аминокислоты, орнитин не обнаруживается в белках, но присутствует в пептидных антибиотиках, таких как тирозин и грамицидин. Орнитин играет важную роль в пути экскреции мочевины, продуцируемой из аминокислоты или аммиака через орнитиновый цикл в метаболизме in vivo высших животных.

Орнитин способствует образованию мышц и уменьшению жира тела и, следовательно, используется в качестве пищевой добавки. Орнитин-альфа-кетоглутарат (OKG), содержащий орнитин и альфа-глутаровую кислоту в соотношении 2:1, используется в качестве иммунного энхансера. Орнитин используется также в качестве лекарственных средств при лечении цирроза печени и нарушений функций печени, так как он способствует удалению вредного аммиака из печени. Известными способами получения орнитина являются обработка казеина молока пищеварительными ферментами и использование трансформированной E. coli или промышленных микроорганизмов, принадлежащих к Corinebacterium sp., которые широко используются в продуцировании аминокислот, нуклеиновых кислот и антибиотик-подобных веществ.

В микроорганизмах, принадлежащих к Corinebacterium sp., L-аргинин синтезируется из глутамата ферментом, экспрессируемым из гена оперона аргинина, в форме argCJBFRGH. Эти гены оперона аргинина, которые играют наиболее важную роль в биосинтезе аргинина, синтезируют аргинин с использованием внутриклеточного глутамата (L-глутамата) в качестве субстрата, и орнитин продуцируется в виде промежуточного продукта во время синтеза аргинина. Конкретно, как на Фиг. 2, схематически иллюстрирующем синтетический путь аргинина из глутамата в микроорганизме, принадлежащем к Corinebacterium sp., известно, что argJ кодирует фермент, превращающий глутамат в N-ацетилглутамат, argB кодирует фермент, превращающий N-ацетилглутамат в N-ацетилглутамилфосфат, argC кодирует фермент, превращающий N-ацетилглутамилфосфат в N-ацетилглутамат-полуальдегид, argD кодирует фермент, превращающий N-ацетилглутамат-полуальдегид в N-ацетилорнитин, argJ кодирует фермент, превращающий N-ацетилорнитин в орнитин, argF кодирует фермент, превращающий орнитин в цитруллин, argG кодирует фермент, превращающий цитруллин в аргининосукцинат, и argH кодирует фермент, превращающий аргининосукцинат в аргинин в синтетическом пути аргинина, и синтетический путь орнитина включен в синтетическом пути аргинина.

Известные аргининпродуцирующие штаммы были разработаны введением мутации в оперон аргинина или мутацией промотора для увеличения уровней экспрессии ферментов, участвующих в биосинтезе аргинина. Из них, argR, регулирующий и супрессирующий экспрессию оперона аргинина, и argB, ингибируемый уровнем аргинина, были широко исследованы в качестве мишеней для увеличения продуцирования аргинина (Публикация патента Кореи № 2010-0060909).

В отношении улучшения продуктивности орнитина, известно, что продуцирование орнитина увеличивается действием орнитинциклодеаминазы (ocd) культивированием микроорганизма Corinebacterium в среде, дополненной пролином, или модификацией импеллеров и условий культивирования во время культивирования этого микроорганизма. При использовании трансформированной E. coli продуктивность орнитина также улучшается культивированием argF- и argR-делетированных штаммов в среде, дополненной глутаматом, или использованием трансформированного штамма с делецией гена proB, кодирующего γ-глутамилкиназу, участвующую в первой стадии синтетического пути пролина из глутамата, а не синтетического пути орнитина из глутамата.

Кроме того, Corinebacterium glutamicum последовательно исследовали на продуцирование с высоким выходом глутамата в качестве предшественника орнитина. Известно, что экскреция глутамата из Corinebacterium glutamicum увеличивается лимитированием биотина или обработкой пенициллином G или содержащим эфир жирной кислоты поверхностно-активным веществом. Поскольку эти обработки коррелируют с повреждением клеточной стенки, ранее считали, что глутамат просачивается пассивно через поврежденную клеточную стенку.

Белок NCgl1221, происходящий из Corinebacterium glutamicum (Cgl 13032), облегчает истечение бетаина, и его аминокислотная последовательность является сходной с аминокислотной последовательностью механочувствительного белка канала, yggB (Публикация патента Кореи № 2010-001758).

Техническая проблема

В этих предпосылках создания изобретения, авторы данного изобретения предприняли многие попытки для развития штамма, способного продуцировать полезный орнитин с более высоким выходом. В результате, они обнаружили, что орнитин-сверхпродуцирующий штамм может быть разработан блокированием биосинтетического пути аргинина из орнитина, блокированием белка, участвующего в экспорте глутамата, для увеличения внутриклеточного уровня глутамата и усилением биосинтетического пути орнитина из глутамата, с завершением посредством этого данного изобретения.

Техническое решение

Целью данного изобретения является обеспечение микроорганизма, имеющего улучшенную орнитин-продуцирующую способность. Другой целью данного изобретения является обеспечение способа получения орнитина с использованием этого микроорганизма.

Преимущество изобретения

Микроорганизм данного изобретения, имеющий улучшенную орнитин-продуцирующую способность, может более эффективно использоваться в большом разнообразии приложений для продуцирования орнитина.

Краткое описание фигур

Фиг.1 показывает биосинтетический путь орнитина и относящиеся к нему гены трансформированной Corinebacterium glutamicum этого изобретения;

фиг.2 показывает известный биосинтетический путь аргинина Corinebacterium glutamicum; и

фиг.3 показывает вектор pDZ для инсертирования в хромосому микроорганизма, принадлежащего к Corinebacterium sp.

Лучший вариант осуществления изобретения

В одном аспекте для достижения вышеуказанных целей данного изобретения, данное изобретение обеспечивает микроорганизм, имеющий улучшенную орнитин-продуцирующую способность, в котором активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата (NCgl1221) модифицированы таким образом, что они являются аттенуированными в сравнении с их эндогенными активностями.

В этом контексте, “орнитинкарбамоилтрансфераза (OCT)” относится к каталитическому ферменту, который опосредует реакцию между карбамоилфосфатом и орнитином для синтеза цитруллина и фосфорной кислоты. OCT присутствует в печени мочевину-экскретирующих животных, а также в растении и микроорганизме, и в микроорганизме он участвует в синтезе аргинина. Этот фермент OCT содержит каталитический домен и регуляторный домен, и при связывании орнитина с этим регуляторным доменом активность этого фермента ингибируется.

Штамм E. coli K12 имеет два типа OCT (ArgF и ArgI) и кишечный микроорганизм, включающий в себя В- и W-штаммы E. coli, имеет белок OCT, сходный с ArgI. OCT, кодируемые argF и argI, имеют различные аминокислотные последовательности в сравнении друг с другом, но они рассматриваются как изоферменты, имеющие одну и ту же функцию. (EMBO J. (1982) 1:853-857). Штамм Corinebacterium sp. имеет только OCT, кодируемый геном argF. OCT действует только в синтетическом пути от орнитина к аргинину, и, следовательно, если активность OCT ослабляется, уровень внутриклеточного орнитина может быть увеличена.

Для накапливания внутриклеточного орнитина, данное изобретение обеспечивает микроорганизм Corinebacterium, в котором синтетический путь аргинина из орнитина является блокированным. Для достижения этого, получали трансформированный штамм с делецией гена, кодирующего орнитинкарбамоилтрансферазу. В этом отношении, орнитин-карбамоилтрансфераза может быть, но конкретно не ограничивается этим, белком, имеющим аминокислотную последовательность SEQ ID NO:18, или белком, имеющим 70% или более высокую гомологию с этой последовательностью, более предпочтительно 80% или более высокую гомологию с этой последовательностью и, гораздо более предпочтительно, 90% или более высокую гомологию с этой последовательностью.

В этом контексте, “гомология” относится к сходству в нуклеотидных последовательностях или аминокислотных последовательностях гена, кодирующего белок. При достаточно высокой гомологии, продукты соответствующего гена могут быть одинаковыми или могут иметь сходную активность.

В этом контексте, “белок, участвующий в экспорте глутамата” относится к типу механочувствительных каналов, которые функционируют для экспорта внутриклеточно продуцируемого глутамата во внеклеточную среду. Данное изобретение обеспечивает микроорганизм Corinebacterium, имеющий улучшенную продуктивность орнитина. Для этого исследования, трансформированный штамм, способный поддерживать высокий уровень внутриклеточного глутамата, получают делетированием гена, кодирующего белок, который функционирует для экскреции глутамата, который является сырьем для синтеза орнитина.

Увеличением внутриклеточного уровня глутамата, т.е. предшественника орнитина, может быть стимулирован биосинтетический путь орнитина. В этом изобретении, экспорт глутамата может быть уменьшен или ингибирован уменьшением активности NCgl1221.

Удаляемый белок, участвующий в экспорте глутамата, может быть белком, имеющим аминокислотную последовательность SEQ ID NO:30 или аминокислотную последовательность, имеющую 70% или более высокую гомологию с ней и, более предпочтительно, имеющим 80% или более высокую гомологию, даже более предпочтительно имеющим 90% или более высокую гомологию с ней, но не ограничивающимся ими.

Активность орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата, может быть уменьшена способом, выбранным из группы, состоящей из (1) частичной или полной делеции гена, кодирующего этот белок, (2) модификации регуляторной последовательности экспрессии для супрессии экспрессии этого гена, (3) модификации этой нуклеотидной последовательности на хромосоме для уменьшения активности этого белка и (4) их комбинации, но не ограничивающейся ими.

Частичная или полная делеция полинуклеотида, кодирующего этот белок, может выполняться введением вектора для хромосомной инсерции в микроорганизм, с заменой тем самым полинуклеотида, кодирующего эндогенный белок-мишень на хромосоме, частично удаленным полинуклеотидом или маркерным геном. Эта “частичная” длина может варьироваться в зависимости от типа полинуклеотида, но, конкретно, этот термин относится к длине 1-300 нуклеотидов, предпочтительно 1-100 нуклеотидов и, более предпочтительно, к длине 1-50 нуклеотидов.

Модификация регуляторной последовательности экспрессии для уменьшения экспрессии этого полинуклеотида может также выполняться индуцированием модификации на регуляторной последовательности экспрессии посредством делеции, инсерции, неконсервативной или консервативной замены нуклеотидной последовательности или их комбинации для уменьшения активности регуляторной последовательности экспрессии, или заменой регуляторной последовательности экспрессии нуклеотидной последовательностью, имеющей более слабую активность. Регуляторная последовательность экспрессии включает в себя промотор, операторную последовательность, последовательность, кодирующую сайт связывания рибосом, и последовательность, регулирующую терминацию транскрипции и трансляции.

Кроме того, модификация полинуклеотидной последовательности на хромосоме, которая кодирует фермент данного изобретения, может быть произведена индуцированием мутации на этой последовательности посредством делеции, инсерции, неконсервативной или консервативной замены полинуклеотидной последовательности или их комбинацией для уменьшения ферментативной активности, или заменой этой последовательности полинуклеотидной последовательностью, которая модифицирована таким образом, что она имеет более слабую активность.

В этом контексте, “эндогенная активность” относится к активности фермента, которую микроорганизм имеет в его нативном состоянии. В данном изобретении, эндогенная активность относится к активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата, т.е. NCgl1221, который природно содержит микроорганизм. Кроме того, в этом контексте, “модифицированный для приобретения более слабой активности, чем эндогенная активность” относится к состоянию, в котором орнитинкарбамоилтрансфераза и белок, участвующий в экспорте глутамата, т.е. NCgl1221, не функционируют должным образом вследствие делеции гена или мутации и, следовательно, активность орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата, т.е. NCgl1221, который природно имеет микроорганизм, является ослабленной.

В этом контексте, термин “микроорганизм, имеющий улучшенную орнитин-продуцирующую способность” относится к микроорганизму, имеющему более высокую орнитин-продуцирующую способность, чем родительский штамм, и этот микроорганизм, имеющий улучшенную орнитин-продуцирующую способность, дополнительно трансформирован таким образом, что он имеет более высокую активность ацетилглутаматсинтазы (ArgJ), превращающей глутамат в ацетилглутамат (N-ацетилглутамат), или орнитинацетилтрансферазы (ArgJ), превращающей ацетилорнитин в орнитин, ацетилглутаматкиназы (ArgB), превращающей ацетилглутамат в ацетилглутамилфосфат (N-ацетилглутамилфосфат), ацетил-гамма-глутамилфосфатредуктазы (ArgC), превращающей ацетилглутамилфосфат в ацетилглутамат-полуальдегид (N-ацетилглутамат-полуальдегид), ацетилорнитинаминотрансферазы (ArgD), превращающей ацетилглутамат-полуальдегид в ацетилорнитин (N-ацетилорнитин) или т.п., чем эндогенная активность, для усиления биосинтетического пути орнитина из глутамата.

Этот трансформированный микроорганизм получали способом, отличающимся от известного способа разработки орнитин-продуцирующего штамма, то есть этот известный способ выполняют элиминированием или аттенуированием функции ArgR, который действует в качестве транскрипционного ингибитора в биосинтетическом пути аргинина для увеличения продуцирования орнитина, и дополнительным делетированием гена орнитинкарбамоилтрансферазы и введением устойчивой к обратной связи N-ацетилглутаматсинтазы для увеличения продуцирования орнитина (Публикация патента Кореи № 2010-0060909).

В этом отношении, ацетил-гамма-глутамилфосфатредуктаза (ArgC), ацетилглутаматсинтаза или орнитинацетилтрансфераза (ArgJ), ацетилглутаматкиназа (ArgB) и ацетилорнитинаминотрансфераза (ArgD) могут предпочтительно иметь, но не ограничиваются ими, аминокислотные последовательности SEQ ID NO:23, 25, 27 и 29 или 70% или более высокую гомологию с этой последовательностью, более предпочтительно 80% или более высокую гомологию с этой последовательностью, и, гораздо более предпочтительно, 90% или более высокую гомологию с этой последовательностью соответственно. Увеличение в их активности может выполняться любым одним или несколькими способами, выбранными из группы, состоящей из 1) увеличения в копийности полинуклеотида, кодирующего этот белок, и 2) увеличения в экспрессии полинуклеотида модификацией регуляторной последовательности экспрессии, 3) усиления активности фермента модификацией последовательности полинуклеотида на хромосоме и 4) усиления посредством их комбинации.

Конкретно, различные способы могут быть использованы обычно для увеличения ферментативной активности в микроорганизме. Например, уровень экспрессии полинуклеотида может быть увеличен увеличением числа копий этого полинуклеотида посредством трансформации, включающей в себя инсертирование плазмиды, гомологичную рекомбинацию, конъюгацию и транслокацию; модификацию экспрессии регуляторной последовательности полинуклеотида; амплификацией гена, кодирующего регуляторный фактор, который стимулирует экспрессию этого полинуклеотида; или делецией или ингибированием гена, кодирующего регуляторный фактор, который супрессирует экспрессию этого полинуклеотида. Более конкретно, уровень экспрессии полинуклеотида может быть увеличен функциональным связыванием фрагмента гена, содержащего этот полинуклеотид, с мультикопийным вектором, который может реплицироваться в штаммах Corinebacterium sp., введением одной или множественных копий этого полинуклеотида в хромосому или заменой регуляторной последовательности экспрессии полинуклеотида регуляторной последовательностью экспрессии, имеющей улучшенную активность, в том числе сильный промотор.

Например, группа генов argCJBD может быть трансформирована в микроорганизм с использованием вектора рН139Т для получения микроорганизма со значимо улучшенной продуктивностью орнитина. Альтернативно, микроорганизм, в котором биосинтетический путь орнитина является усиленным, может быть получен улучшением района промотора, регулирующего экспрессию гена argCJBD, в хромосоме микроорганизма, или заменой района промотора промотором с более сильно улучшенной активностью. В частности, способ для улучшения района промотора может включать в себя замену промотора в хромосоме, получение фрагмента гена, содержащего нуклеотидные последовательности обоих концевых сайтов, смежных с сайтом-мишенью на этой хромосоме, и инсертированием последовательности промотора в той же самой форме, что и в исходной хромосоме, и при помощи того же самого способа делетирования с использованием вектора pDZ, опубликованного Публикацией патента Кореи № 2009-0082702, но не ограничивается ими. Здесь, этим улучшенным промотором может быть предпочтительно, но не ограничивается им, промотор pcj7 (или P(CJ7)), имеющий нуклеотидную последовательность SEQ ID NO:30 (патент Кореи с регистрационным № 0620092). Вектор pDZ может быть предпочтительно, но не ограничивается им, вектором, представленным картой расщепления фиг.3.

В этом контексте “вектор” относится к ДНК-конструкту, содержащему нуклеотидную последовательность гена, который функционально связан с подходящей регуляторной последовательностью экспрессии для экспрессии гена-мишени в подходящей клетке-хозяине. Регуляторная последовательность экспрессии содержит промотор, который может инициировать транскрипцию, необязательную операторную последовательность для регуляции транскрипции, последовательность, кодирующую подходящий мРНК-сайт связывания рибосом, и последовательность, регулирующую терминацию транскрипции и трансляции.

Примеры общепринятых векторов включают в себя природную или рекомбинантную плазмиду, космиду, вирус и бактериофаг. Например, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A и Charon21A могут быть использованы в качестве фагового вектора или космидного вектора. В качестве плазмидного вектора могут быть использованы вектор pDZ, pBR-тип, pUC-тип, pBluescriptII-тип, pGEM-тип, pTZ-тип, pCL-тип и pET-тип. Применимый вектор не имеет конкретных ограничений, и может быть использован любой известный экспрессирующий вектор, предпочтительно вектор pDZ.

Между тем, микроорганизмом данного изобретения может быть, но не ограничивается им, микроорганизм, полученный трансформацией микроорганизма, принадлежащего к Escherichia sp, Shigela sp., Citrobacter sp., Salmonella sp., Enterobacter sp., Yersinia sp., Klebsiella sp., Erwinia sp., Corynebacterium sp., Brevibacterium sp., Lactobacillus sp., Selenomanas sp., или Vibrio sp., который имеет активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата (NCgl1221).

Предпочтительно микроорганизмом данного изобретения может быть штамм Corinebacterium sp. и более предпочтительно Corinebacterium glutamicum. Более конкретно, могут быть использованы штамм Corinebacterium glutamicum АТСС 13032 или глутамат-сверхэкспрессирующий штамм КССМ-10785Р (Публикация патента Кореи № 2008-0034334), но без ограничения ими. Штамм КССМ-10785Р является глутамат-сверхэкспрессирующим штаммом, генерированным делетированием генов cg2624 (NCBI LOCUS ID_226636) и cg2115 (NCBI LOCUS ID YP_226173) в глутамат-продуцирующем штамме (KFCC-110074), который генерировали с использованием мутагена, такого как N-метил-N'-нитро-N-нитрозогуанидин (NTG). Хотя сверхпродуцирование глутамата делетированием cg2624 и cg2115 не было идентифицировано ранее относительно приведенной выше публикации, cg2624 идентифицирован как pcaR, который является регуляторным белком семейства IclR, а cg2115 идентифицирован как sugR, который является регулятором транскрипции метаболизма сахара.

Согласно одному варианту осуществления данного изобретения, получали штамм Corynebacterium glutamicum с делецией гена ARGF (ATCC 13032 ΔargF и KCCM-10785P ΔargF) (пример 1), штамм Corynebacterium glutamicum с делециями генов argF и NCgl1221 (ATCC 13032 ΔargF ΔNCgl1221 и KCCM-10785P ΔargF ΔNCgl1221) (пример 2), штамм Corynebacterium glutamicum с делециями генов argF и NCgl1221 и с введением гена argCJBD (ATCC 13032 ΔargF ΔNCgl1221/pHC139T-argCJBD(Cgl) и KCCM-10785P ΔargF ΔNCgl1221/pHC139T-argCJBD (Cgl)) (пример 3-1) и штамм Corynebacterium glutamicum с делециями генов argF и NCgl1221, и заменой промотора кластера генов argCJBD в хромосоме (ATCC 13032 ΔargF ΔNCgl1221 P (CJ7)-argCJBD and KCCM-10785P ΔargF ΔNCgl1221 P (CJ7)-argCJBD) (пример 3-2). Этот результат сравнения их продуктивностей орнитина показал, что штамм Corynebacterium glutamicum с делециями генов argF и argF и NCgl1221 и с заменой промотора кластера генов argCJBD в хромосоме (ATCC 13032 ΔargF ΔNCgl1221 P(CJ7)-argCJBD и KCCM-10785P ΔargF ΔNCgl1221 P(CJ7)-argCJBD) имеет превосходную продуктивность орнитина (таблицы 5 и 6).

Таким образом, этот орнитин-продуцирующий штамм, имеющий улучшенную орнитин-продуцирующую способность, был назван “СС01-0061 (АТТС 13032 ΔargF ΔNCgl1221 P(C7)-argVJBD)” и депонирован в соответствии с Будапештским договором в Корейский Центр Культур Микроорганизмов, который имеет адрес Hongje-1-dong, Seodaemun-gu, Seoul, Korea, 24 ноября 2010 года с номером доступа Accession No. KCCV11137P.

В другом аспекте данного изобретения для достижения вышеуказанных целей, данное изобретение обеспечивает способ получения орнитина, предусматривающий стадии (i) культивирования микроорганизма, имеющего улучшенную орнитин-продуцирующую способность, для получения культуры; и (i) выделения орнитина из культивируемых микроорганизмов или этой культуры.

В этом способе культирование этого микроорганизма может выполняться предпочтительно с использованием периодической культуры, непрерывной культуры и культуры с подпиткой, известных в данной области, но не ограничивающихся ими. Кроме того, что касается условий культивирования, можно было поддерживать оптимальный рН 5-9, предпочтительно рН 6-8 и наиболее предпочтительно рН 6,8 с использованием щелочного химиката (например: гидроксида натрия, гидроксида калия или аммиака) или кислотного химиката (например: фосфорной кислоты или серной кислоты). Кроме того, аэробные условия могут поддерживаться добавлением кислорода или смеси кислородсодержащих газов в клеточную культуру. Температура культивирования может поддерживаться при 20-45ºС, и предпочтительно при 25-40ºС. Кроме того, предпочтительным является культивирование в течение приблизительно 10-160 часов. Продуцированный вышеописанным культивированием орнитин может экскретироваться в культуральную среду или оставаться внутри клетки.

Кроме того, среда для культивирования может содержать сахар и углевод (например: глюкозу, сахарозу, лактозу, фруктозу, мальтозу, мелассу, крахмал и целлюлозу), масло и жир (например: соевое масло, подсолнечное масло, арахисовое масло и кокосовое масло), жирную кислоту (например: пальмитиновую кислоту, стеариновую кислоту и линолевую кислоту), спирт (например: глицерин и этанол), и органическую кислоту (например: уксусную кислоту), по отдельности или в комбинации в качестве источника углерода; азотсодержащее органическое соединение (например: пептон, дрожжевой экстракт, мясной сок, экстракт солода, кукурузный раствор, порошок соевой муки и мочевину) или неорганическое соединение (например: сульфат аммония, хлорид аммония, фосфат аммония, карбонат аммония и нитрат аммония), по отдельности или в комбинации в качестве источника азота; дигидрофосфат калия, дикалийфосфат или натрий-содержащую соль, соответствующую этим солям, по отдельности или в комбинации в качестве источника фосфора; другие незаменимые стимулирующие рост вещества, в том числе соли металлов (например: сульфат магния или сульфат железа), аминокислоты и витамины.

Способ изобретения

Далее настоящее изобретение будет описано более подробно со ссылкой на примеры. Однако эти примеры приводятся только для иллюстративных целей, и не предполагается, что изобретение ограничивается этими примерами.

Пример 1: Получение argF-делетированного штамма Corinebacterium glutamicum

В этом примере, argF-делетированный штамм получали из штамма АТСС 13032 Corinebacterium glutamicum дикого типа и глутамат-сверхпродуцирующего штамма КССМ-10785Р, который генерировали делетированием генов cg2624 и cg2115 в глутамат-продуцирующем штамме KFCC-110074, генерированном с использованием мутагена, такого как NTG (Публикация патента Кореи № 2008-0034334), для блокирования синтетического пути аргинина из орнитина. Биосинтетические гены аргинина Corinebacterium glutamicum АТСС 13032 являются организованными в опероне, имеющем форму argCJBDRGH, и делеционный ген-мишень argF (SEQ ID NO:17) присутствует смежно с генами, кодирующими ферменты, участвующие в синтетическом пути орнитина на хромосоме. Таким образом, плазмиду для делетирования гена argF получали на основе нуклеотидной последовательности argD и argR, которые локализованы смежно с делеционным геном-мишенью argF.

Конкретно, на основе нуклеотидной последовательности argD и argR штамма АТСС 13032, конструировали фрагмент гомологичной рекомбинации смежно с N-концевой последовательностью argF и фрагмент гомологичной рекомбинации смежно с С-концевой последовательностью argF. Для этого фрагмент, смежный с N-концевой последовательностью argF получали при помощи ПЦР с использованием геномной ДНК из штамма АТСС 13032 в качестве матрицы, и праймеров (SEQ ID NO:1 и 2) (28 циклов денатурации в течение 30 секунд при 95ºС, отжиг в течение 30 секунд при 55ºС и удлинение в течение 30 секунд при 72ºС). Подобным образом, фрагмент, смежный с С-концевой последовательностью argF, получали при помощи ПЦР с использованием геномной ДНК из штамма АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:3 и 4) при тех же самых условиях (таблица 1).

Таблица 1
Праймеры для получения argF-делетированного штамма (ΔargF)
Название SEQ ID NO: Последовательность (5'-3')
argF-del-F1_BamHI 1 CGGGATCCTGGCCGTACCGGCGATTTCT
argF-del-R1_SalI 2 CGCGTCGACAAGTTTGAGTCCTTTATGCG
argF-del-F2_SalI 3 CGCGTCGACGACATGTCCCTTGGCTCAAC
argF-del-R2_XbaI 4 TGCTCTAGAAGTAATTCACCTAGTTCTTTACC

Этот полученный, как описано выше, фрагмент гомологичной рекомбинации, смежный с N-концевой последовательностью argF, расщепляли рестрикцией BamHI и SalI; и фрагмент гомологичной рекомбинации, смежный с С-концевой последовательностью, расщепляли рестрикцией SalI и XbaI. Затем каждый из этих расщепленных фрагментов инсертировали в вектор pDZ, который был также расщеплен рестрикцией BamHI и XbaI, с получением посредством этого плазмиды pDZ-argF(K/O).

Полученную, как описано выше, плазмиду pDZ-argF(K/O) трансформировали в штамм АТСС 13032 и штамм КССМ-10785Р. Затем эти трансформированные штаммы высевали и культивировали на чашке BHIS (инфузионный раствор для головного мозга/сердца 37 г/л, сорбит 91 г/л, агар 2%), которая содержит канамицин (25 мкг/мл) и Х-gal(5-бром-4-хлор-3-индолин-β-D-галактозид), давая колониям расти на этой чашке. Среди колоний, образованных на этой чашке, колонии синего цвета собирали для селекции штамма, инсертированного плазмидой pDZ-argF(K/O).

Отобранные, как описано выше, штаммы культивировали со встряхиванием в СМ-среде (глюкоза 10 г/л, полипептон 10 г/л, дрожжевой экстракт 5 г/л, мясной бульон 5 г/л, NaCl 2,5 г/л, мочевина 2 г/л, рН 6,8) при 30ºС в течение 8 часов. Затем каждую клеточную структуру серийно разводили от 10-4 до 10-10. Затем эти разведенные пробы высевали и культивировали на Х-gal-содержащей твердой среде, давая этим колониям расти. Среди колоний, образованных на этой чашке, только белые колонии, которые появляются при относительно низкой частоте, собирали для селекции argF-делетированных штаммов.

Успешное инсертирование плазмиды pDZ-argF(K/O) в отобранные, как описано выше, штаммы подтверждали выполнением ПЦР с использованием хромосомной ДНК из отобранного, как описано выше, штамма в качестве матрицы и праймеров SEQ ID NO:1 и 4. Посредством этого ПЦР-подтверждения, было подтверждено, что отобранный, как описано выше, штамм является argF-делетированным штаммом (например, АТСС 13032 ΔargF и KCCM-10785P ΔargF).

Пример 2: Получение argF- и NCgl1221-делетированного штамма Corinebacterium glutamicum

Ген NCgl1221, кодирующий белок, участвующий в экспорте глутамата, дополнительно делетировали в штамме АТСС 13032 ΔargF и штамме КССМ-10785P, полученных в примере 1, для увеличения внутриклеточного уровня глутамата, который является предшественником орнитина.

Конкретно, на основе нуклеотидной последовательности (SEQ ID NO:19) NCgl1221 штамма АТСС 13032, конструировали фрагмент гомологичной рекомбинации, смежный с N-концевой последовательностью NCgl1221, и фрагмент гомологичной рекомбинации, смежный с С-концевой последовательностью NCgl1221. Для этого, фрагмент, смежный с N-концевой смежной последовательностью NCgl1221, генерировали при помощи ПЦР с использованием геномной ДНК из штамма АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:5 и 6), и фрагмент, смежный с С-концевой последовательностью NCgl1221, генерировали при помощи ПЦР с использованием геномной ДНК из штамма АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:7 и 8) при тех же самых условиях, что и условия в примере 1 (таблица 2).

Таблица 2
Праймеры для получения NCgl1221-делетированного штамма
Название SEQ ID NO: Последовательность (5'-3')
NCgl1221-del-F1_BamHI 5 CGGGATCCGTCCAAGCCAAGCCGATTTCAAC
NCgl1221-del-R1_SalI 6 ACGCGTCGACCCACTCGGCGCTTGATAATAC
NCgl1221-del-F2_SalI 7 ACGCGTCGACCTGGAACAAGAACTCTCCAGC
NCgl1221-del-R2_XbaI 8 CTAGTCTAGAGGTTGGTGCTTCCACTGCTG

Полученный, как описано выше, фрагмент гомологичной рекомбинации, смежный с N-концевой последовательностью NCgl1221, расщепляли рестрикцией BamHI и SalI. Подобным образом, фрагмент гомологичной рекомбинации, смежный с С-концевой последовательностью NCgl1221, расщепляли рестрикцией SalI и XbaI. Затем каждый из этих расщепленных фрагментов инсертировали в вектор pDZ, который был расщеплен BamHI и XbaI, с получением посредством этого плазмиды pDZ-NCgl1221(K/O).

Полученную, как описано выше, плазмиду pDZ-NCgl1221(K/O) трансформировали в штамм АЕСС 13032 ΔargF и штамм KCCM-10785P ΔargF. Затем эти трансформированные штаммы высевали и культивировали на чашке BHIS (инфузионный раствор для головного мозга/сердца 37 г/л, сорбит 91 г/л, агар 2%), которая содержит канамицин (25 мкг/мл) и Х-gal(5-бром-4-хлор-3-индолин-β-D-галактозид), давая колониям расти на этой чашке. Среди колоний, образованных на этой чашке, колонии синего цвета собирали для селекции штамма, инсертированного плазмидой pDZ-NCgl1221(K/O).

Отобранные, как описано выше, штаммы культивировали со встряхиванием в СМ-среде при 30ºС в течение 8 часов. Затем каждую клеточную структуру серийно разводили от 10-4 до 10-10. Затем эти разведенные пробы высевали и культивировали на Х-gal-содержащей твердой среде, давая этим колониям расти. Среди колоний, образованных на этой чашке, только белые колонии, которые появляются при относительно низкой частоте, собирали для селекции NCgl1221-делетированных штаммов.

Успешное инсертирование плазмиды pDZ-NCgl1221(K/O) в отобранные, как описано выше, штаммы, подтверждали выполнением ПЦР с использованием хромосомной ДНК из отобранного, как описано выше, штамма в качестве матрицы и праймеров SEQ ID NO:5 и 8. Эти отобранные NCgl1221-делетированные штаммы были названы АТСС 13032 ΔargF ΔNCgl1221 или KCCM-10785P ΔargF ΔNCgl1221, соответственно.

Пример 3: Получение argCJBD-инсертированного штамма Corinebacterium glutamicum

Пример 3-1: Клонирование гена argCJBD и получение трансформанта

В этом примере, получали вектор, инсертированный генами argC, frgJ, argB и argD (SEQ ID NO:22, 24, 26 и 28, соответственно), и трансформант получали введением его, для усиления синтетического пути орнитина увеличением копийности оперона argCJBD (SEQ ID NO:21, содержащего район промотора), который кодирует ферменты, участвующие в синтетическом пути орнитина из глутамата.

Сначала выполняли ПЦР для получения гена argCJBD с использованием хромосомы штамма АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:9 и 10, таблица 3) (30 циклов денатурации в течение 40 секунд при 95ºС, отжиг в течение 40 секунд при 55ºС и удлинение в течение 150 секунд при 70ºС), с получением посредством этого фрагмента гена, имеющего размер 4900 т.п.н.

Таблица 3
Праймеры для получения фрагмента гена argCJBD АТСС 13032
Название SEQ ID NO: Последовательность (5'-3')
P_argC-5-KpnI 9 CGGGGTACCCTCCTCCAGCAGCTCTAGCTC
argD-3_XbaI 10 TGCTCTAGAAAGTTTGAGTCCTTTATGCG

Полученный, как описано выше, фрагмент гена подвергали гель-электрофорезу на 0,8% агарозном геле и полосу этого размера-мишени вырезали и выделяли из нее пробу ДНК. Эту выделенную ДНК расщепляли рестрикцией KpnI и XbaI для получения фрагмента, затем этот расщепленный фрагмент клонировали в вектор pH139T-gfp (Публикация патента Кореи № 2008-0074286), с получением посредством этого экспрессирующего вектора pHC139T-argCJBD(Cgl).

Затем этот экспрессирующий вектор pHC139T-argCJBD(Cgl), полученный для увеличения уровня продуцирования орнитина в клетке, вводили в штамм АТСС 13032 ΔargF ΔNCgl1221 и KCCM-10785P ΔargF ΔNCgl1221 электропорацией. Затем успешный трансформант отбирали посевом трансформированных клеток на чашку BHIS, содержащую 25 мкг/мл канамицина. Наконец, каждый из отобранных трансформантов был назван АТСС 13032 ΔargF ΔNCgl1221/pHC139T-argCJBD (Cgl) и KCCM-10785P ΔargF ΔNCgl1221/pHC139T-argCJBD (Cgl), соответственно.

Пример 3-2: Замена промотора гена argCJBD в хромосоме

В этом примере промотор argCJBD заменяли промотором CJ7, который был недавно разработан автором данного изобретения в хромосоме, для увеличения уровня экспрессии удалением регуляции гена argCJBD, который кодирует ферменты, участвующие в синтетическом пути орнитина из глутамата.

Сначала получали фрагмент гомологичной рекомбинации, содержащий промотор CJ7 и нуклеотидную последовательность обоих концевых сайтов этого промотора.

Конкретно, нуклеотидную последовательность 5'-концевого сайта промотора CJ7 получали выполнением ПЦР с использованием геномной ДНК из штамма АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:11 и 12) (28 циклов денатурации в течение 30 секунд при 94ºС, отжиг в течение 30 секунд при 55ºС и удлинение в течение 30 секунд при 72ºС). Подобным образом, нуклеотидную последовательность района промотора CJ7 получали при помощи ПЦР с использованием праймеров (SEQ ID NO:13 и 14) при тех же самых условиях ПЦР, и нуклеотидную последовательность 3'-концевого сайта промотора CJ7 получали при помощи ПЦР с использованием геномной ДНК из штаммов АТСС 13032 в качестве матрицы и праймеров (SEQ ID NO:15 и 16) при тех же самых условиях ПЦР.

Таблица 4
Название SEQ ID NO: Последовательность (5'-3')
argC-L-5-BamHI 11 CGGGATCCGCAACGCTTGCGGTGAGAGA
argC-L-3-EcoRI 12 CCGGAATTCCTGGAAGTGGTCGAAGAAGA
CJ7-5-EcoRI 13 CCGGAATTCGCCGGCATAGCCTACCGATG
CJ7-3-XbaI 14 TGCTCTAGAGATATCAGTGTTTCCTTTCG
argC-R-5-XbaI 15 TGCTCTAGAATGATAATGCATAACGTGTA
argC-R-3-SalI 16 ACGCGTCGACGCTTTCCGGAGGTGTTGTAC

Полученный, как описано выше, фрагмент 5'-концевого сайта промотора (argC-L) расщепляли BamHI и EcoRI, фрагмент района промотора CJ7 расщепляли EcoRI и XbaI и фрагмент 3'-концевого сайта промотора (argC-R) расщепляли XbaI и SalI. Затем каждый из расщепленных ПЦР-продуктов клонировали в вектор pDZ, который был также расщеплен BamHI и SalI, с получением посредством этого экспрессирующего вектора pDZ-CJ7)(arg), в котором промотор argCJBD был заменен промотором CJ7.

Полученный, как описано выше, экспрессирующий вектор pDZ-CJ7(arg) трансформировали в штамм АТСС 13032 ΔargF ΔNCgl1221 и штамм KCCM-10785P ΔargF ΔNCgl1221 посредством электропорации. Затем, эти трансформанты культивировали со встряхиванием в среде СМ (30ºС, 8 часов) и эту культуру клеток серийно разводили от 10-4 до 10-10. Затем эти разведенные пробы высевали и культивировали на чашке BHIS, содержащей 25 мкг/мл канамицина и Х-gal, давая этим колониям расти.

Белые колонии, которые проявляются при низкой частоте, выделяли из большинства голубых колоний, с отбором посредством этого только штамма, в котором промотор arg был успешно заменен промотором CJ7 посредством двойного кроссинговера. Успешную замену промотора argCJBD в хромосоме посредством введения экспрессирующего вектора pDZ-CJ7(arg) подтверждали выполнением ПЦР с использованием геномной ДНК из вышеотобранных штаммов в качестве матрицы и праймеров (SEQ ID NO:13 и 16) (28 циклов денатурации в течение 30 секунд при 94ºС, отжиг в течение 30 секунд при 55ºС и удлинение в течение 60 секунд при 72ºС). Наконец, подтвержденные штаммы были названы АТСС 13032 ΔargF ΔNCgl1221 Р(CJ7)-argCJBD и KCCM-10785P ΔargF ΔNCgl1221 P(CJ7)-argCJBD, соответственно.

Пример 4: Улучшение продуктивности орнитина делецией генов argF и NCgl1221 и увеличение уровня экспрессии argCJBD

Пример 4-1: Продуктивность орнитина, произведенного из штамма Corinebacterium glutamicum АТСС 13032

Для испытания, испытывает ли продуктивность орнитина действие делеции генов argF и NCgl1221 и увеличения уровня экспрессии argCJBD в штаммах, произведенных из штаммов Corinebacterium glutamicum АТСС 13032, сравнивали способность продуцирования орнитина между штаммами, полученными в примерах 2 и 3.

Подробно, каждый из штаммов, полученных в примерах 2 и 3 (АТСС 13032 ΔargF ΔNCgl1221, АТСС 13032 ΔargF ΔNCgl1221/pHC139T-argCJBD (Cgl), АТСС 13032 ΔargF ΔNCgl1221 Р(CJ7)-argCJBD), распределяли на чашке СМА, содержащей 1 мМ аргинин, и культивировали при 37ºС в течение 24 часов. Каждый из этих культивируемых штаммов инокулировали в 25 мл титрационной среды (2% (м/о) глюкоза, 1% (м/о) полипептон, 0,5% (м/о) дрожжевой экстракт, 0,5% (м/о) (NH4)2SO4, 0,15% (м/о) мочевина, 0,4% (м/о) КН2РО4, 0,8% (м/о) К2НРО4, 0,05% (м/о) MgSO4, 100 мкг/л биотин и 1 мг/л тиамин), содержащей 1 мМ аргинин, и затем культивировали с встряхиванием при 30ºС и 200 об/мин в течение 48 часов, и концентрацию орнитина, продуцируемого в каждой культуре, определяли и сравнивали друг с другом (таблица 5). В это время, штамм АТСС 13032 без геномной модификации использовали в качестве контрольной группы.

Таблица 5
Сравнение продуктивности орнитина в произведенных из АТСС 13032 штаммов
Штамм Содержание орнитина (г/л)
ATCC 13032 0,0
ATCC 13032 ΔargF ΔNCgl1221 6,0
ATCC 13032 ΔargF ΔNCgl1221/pHC139T-argCJBD(Cgl) 6,4
ATCC 13032 ΔargF ΔNCgl1221 P(CJ7)-argCJBD 7,7

Как показано в таблице 5, argF- и NCgl1221-делетированный штамм продуцировал 6,0 г/л орнитина, который не продуцировался штаммом дикого типа. Что касается увеличения уровня экспрессии argCJBD, при введении гена argCJBD в форме вектора, концентрация продуцируемого орнитина была равна 6,4 г/л, и при замене промотора argCJBD на CJ7 на хромосоме концентрация продуцированного орнитина была слегка увеличенной до 7,7 г/л.

Пример 4-2: Продуктивность орнитина глутамат-продуцирующего произведенного из штамма Corinebacterium glutamicum KCCM-10785P

Для испытания, испытывает ли продуктивность орнитина действие делеции генов argF и NCgl1221 и увеличения уровня экспрессии argCJBD в штамме Corinebacterium glutamicum KCCM-10785P, сверхпродуцирующем глутамат, предшественник орнитина, сравнивали орнитин-продуцирующую способность между штаммами, полученными в примерах 2 и 3.

Подробно, каждый из штаммов, полученных в примерах 2 и 3 (KCCM-10785P ΔargF ΔNCgl1221, KCCM-10785P ΔargF ΔNCgl1221/pHC139T-argCJBD (Cgl), KCCM-10785P ΔargF ΔNCgl1221 P(CO7)-argCJBD), инокулировали так же, как в примере 4-1, и затем культивировали с встряхиванием при 30ºС и 200 об/мин в течение 48 часов и концентрацию орнитина, продуцируемого в каждой культуре, определяли и сравнивали друг с другом (таблица 6). В это время, штамм КССМ 10785Р без генетической модификации использовали в качестве контрольной группы.

Таблица 6
Сравнение продуктивности орнитина в произведенных из КССМ 10785Р штаммов
Штамм Содержание глутамата (г/л) Содержание орнитина (г/л)
KCCM-10785P 15,5 0,0
KCCM-10785P ΔargF ΔNCgl1221 5,2 7,6
KCCM-10785P ΔargF ΔNCgl1221/pHC139T-argCJBD(Cgl) 4,8 7,9
KCCM-10785P ΔargF ΔNCgl1221 P(CJ7)-argCJBD 2,0 9,0

Как показано в таблице 6, делеции argF и NCgl1221 в сверхэкспрессирующем глутамат штамме показали 7,6 г/л продуцирования орнитина, которые не продуцировались штаммом дикого типа. Что касается увеличения уровня экспрессии argCJBD, при введении гена argCJBD в форме вектора, концентрация продуцируемого орнитина была равна 7,9 г/л, а при замене промотора argCJBD на CJ7 на хромосоме концентрация продуцированного орнитина была слегка увеличенной до 9,0 г/л.

Таким образом, можно видеть, что продуцирование орнитина может быть увеличено усилением синтетического пути орнитина увеличением уровня экспрессии гена argCJBD.

Таким образом, автор данного изобретения назвал штамм, имеющий наиболее превосходную продуктивность орнитина, полученную в примере 3-2, “СС01-0061 (АТСС 13032 ΔargF ΔNCgl1221 P(CJ7)-argCJBD)” и депонировал его в соответствии с Будапештским договором в Корейском центре культур микроорганизмов, имеющем адрес Hongie-1-dong, Seodaemun-gu, Seoul, Korea 24 ноября 2010 года с Accession No. KCCМ11137P.

Квалифицированным в данной области специалистам будет очевидно, что могут быть произведены различные модификации и изменения без отклонения от объема и идеи этого изобретения. Таким образом, должно быть понятно, что приведенные выше варианты осуществления являются не ограничивающими, а иллюстративными во всех аспектах. Таким образом, предполагается, что все изменения и модификации, которые находятся в пределах и границах формулы изобретения, или эквиваленты таких пределов и границ охватываются этой формулой изобретения.

1. Микроорганизм, имеющий орнитин-продуцирующую способность, где активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата (NCgl1221), модифицированы таким образом, что они являются делетированными в сравнении с их эндогенными активностями.

2. Микроорганизм по п. 1, где орнитинкарбамоилтрансфераза имеет аминокислотную последовательность SEQ ID NO: 18 или аминокислотную последовательность, имеющую 70% или более высокую гомологию с этой последовательностью.

3. Микроорганизм по п. 1, где белок, участвующий в экспорте глутамата, имеет аминокислотную последовательность SEQ ID NO: 20 или аминокислотную последовательность, имеющую 70% или более высокую гомологию с этой последовательностью.

4. Микроорганизм по п. 1, где активность орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата, является делетированной способом, выбранным из группы, состоящей из (1) частичной или полной делеции гена, кодирующего этот белок, (2) модификации регуляторной последовательности экспрессии для супрессии экспрессии гена, (3) модификации последовательности гена на хромосоме для удаления активности этого белка и (4) их комбинации.

5. Микроорганизм по п. 1, где активности ацетил-гамма-глутамилфосфатредуктазы (ArgC), ацетилглутаматсинтазы или орнитинацетилтрансферазы (ArgJ), ацетилглутаматкиназы (ArgB) и ацетилорнитинаминотрансферазы (ArgD) являются дополнительно усиленными в сравнении с их эндогенными активностями.

6. Микроорганизм по п. 5, где каждый из ArgC, ArgJ, ArgB и ArgD имеет аминокислотную последовательность SEQ ID NO: 23, 25, 27 и 29 или аминокислотную последовательность, имеющую 70% или более высокую гомологию с этой последовательностью.

7. Микроорганизм по п. 5, где активность белков увеличена способом, выбранным из группы, состоящей из (1) увеличения числа копий полинуклеотида, кодирующего этот белок, (2) модификации регуляторной последовательности экспрессии для увеличения экспрессии полинуклеотида, (3) модификации полинуклеотидной последовательности на хромосоме для усиления активности этого фермента и (4) их комбинации.

8. Микроорганизм по п. 1, где этот микроорганизм является микроорганизмом, принадлежащим к Corinebacterium sp.

9. Микроорганизм по п. 8, где этот микроорганизм, принадлежащий к Corinebacterium sp., является Corinebacterium glutamicum.

10. Микроорганизм по п. 8, где этот микроорганизм, принадлежащий к Corinebacterium sp., является Corinebacterium glutamicum (КССМ11137Р).

11. Способ получения орнитина, предусматривающий стадии:
(i) культивирования микроорганизма, имеющего орнитин-продуцирующую активность, где эти активности орнитинкарбамоилтрансферазы и белка, участвующего в экспорте глутамата (NCgl1221), модифицированы таким образом, что они являются делетированными; и
(ii) выделения орнитина из культивированного микроорганизма или культуры.



 

Похожие патенты:

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором.

Изобретение относится к биотехнологии и представляет собой микроорганизм рода Escherichia, продукцирующий L-аминокислоты, причем микроорганизм трансформирован так, чтобы он имел повышенную НАД-киназную активность и инактивированный фермент с аминокислотной последовательностью SEQ ID NO 2, кодируемой геном tehB, и способ получения L-аминокислот с использованием такого микроорганизма рода Escherichia.

Изобретение относится к области биотехнологии и представляет собой способ получения L-аминокислоты, включающий культивирование микроорганизма, относящегося к семейству Enterobacteriaceae, обладающего способностью продуцировать L-аминокислоту и модифицированного так, чтобы повысить активности глицериндегидрогеназы и дигидроксиацетонкиназы, в среде, содержащей глицерин в качестве источника углерода, для продуцирования и накопления L-аминокислоты в среде или в клетках, и сбор L-аминокислоты из среды или клеток, причем активности глицериндегидрогеназы и дигидроксиацетонкиназы повышают путем увеличения количества копий генов, кодирующих указанные ферменты, или замещения промотора для этих генов более сильным промотором, и ген дигидроксиацетонкиназы кодирует белок, выбранный из группы, состоящей из: а) белка, содержащего аминокислотную последовательность SEQ ID NO: 4; и б) белка, содержащего аминокислотную последовательность, гомологичную не менее чем на 95% аминокислотной последовательности SEQ ID NO: 4, и белок имеет активность дигидроксиацетонкиназы.

Изобретение относится к биотехнологии и представляет собой способ получения L-аминокислоты с использованием бактерии семейства Enterobacteriaceae, модифицированной таким образом, что экспрессия по крайней мере одного гена каскада образования флагелл и клеточной подвижности усилена.

Изобретение относится к биотехнологии и представляет собой коринеформную бактерию-продуцент L-аминокислоты семейства глутамата. Причем указанная бактерия модифицирована таким образом, что один или несколько генов, выбранных из NCgl_2067 и NCgl_2066, оперона NCgl_2067-NCgl_2065 инактивирован(ы).

Группа изобретений относится к биотехнологии, генной и белковой инженерии. Сконструирована плазмида pFLAG-sc14D5a-Rm7, обеспечивающая в клетках Escherichia coli синтез рекомбинантного белка sc14D5a-Rm7, способного связывать белок Ε вируса клещевого энцефалита и обладающего биолюминесцентной активностью.
Изобретения касаются штамма бактерий Escherichia coli-продуцента белка теплового шока (БТШ70) и способа получения такого белка. Охарактеризованный штамм депонирован 28.11.2012 во Всероссийскую коллекцию промышленных микроорганизмов (ВКПМ) ФГУП Гос-НИИГенетика под №В-11388.

Изобретение относится к биотехнологии. Способ получения рекомбинантного белка SAV-RGD, специфически узнающего клетки меланомы человека, предусматривает культивирование в питательной среде штамма Escherichia coli MG1655/pSAV-RGD, получение периплазматической фракции клеток указанного штамма, очистку рекомбинантного белка ионообменной хроматографией с последующей ультрафильтрацией и лиофилизацией.

Изобретение относится к области биотехнологии, конкретно к получению белковых каркасов, связывающихся с IgG, и может быть использовано в диагностике или лечении. Получают белковый каркас на основе консенсусной последовательности десятого повтора фибронектина типа III (FN3) человека, содержащий последовательность аминокислот SEQ ID NO: 16.

Изобретение относится к биотехнологии и представляет собой гибридный белок на основе мутантной рекомбинантной L-аспарагиназы бактерий Wolinella succinogenes с пониженной глутаминазной активностью и повышенной устойчивостью к действию трипсина, слитой с N-концевой аминокислотной последовательностью гепарин-связывающего пептида.

Группа изобретений относится к препарату для повышения мясной и молочной продуктивности сельскохозяйственных животных и вариантам способа его получения. Способ предусматривает выращивание рекомбинантного штамма Escherichia coli ВКПМ В-6519 на среде, содержащей источник аминного азота, источник витаминов, солевые компоненты и глюкозу, с перемешиванием и аэрацией.

Изобретение относится к области генной инженерии и биотехнологии и представляет собой рекомбинантную плазмиду pET40CmAP/CGL, определяющую синтез гибридного бифункционального полипептида CmAP/CGL со свойствами высокоактивной щелочной фосфатазы морской бактерии Cobetia marina (СmАР) и галактозоспецифичного лектина мидии Crenomytilus grayanus (CGL).

Изобретение относится к области биотехнологии и касается штамма Escherichia coli BL21(DE3)Gold/pETmin-CypA - продуцента рекомбинантного циклофилина А человека. Охарактеризованный штамм получен путем трансформации клеток штамма BL21(DE3)Gold плазмидой pETmin-CypA.

Изобретение относится к области биотехнологии, конкретно к получению аналогов инсулина, и может быть использовано в медицине в качестве лекарственного средства для снижения уровня глюкозы в крови у пациента.

Настоящее изобретение относится к биотехнологии и представляет собой генетически модифицированный штамм бактерии Streptomyces thermotolarences WSJ-IA, продуцирующий изовалерилспирамицин I.

Изобретение относится к области биотехнологии и раскрывает рекомбинантный экспрессионный вектор, включающий: либо последовательность, кодирующую фосфорилазу пуриновых нуклеозидов (ПНФазу из Sulfolobus solfataricus), либо последовательность, кодирующую уридинфосфорилазу (УФазу из Aeropyrum pernix), либо обе указанные последовательности. Каждая из указанных последовательностей функционально связана с одной или более регуляторной последовательностью, которая контролирует продукцию указанных фосфорилаз в хозяине (E.coli). Настоящее изобретение также раскрывает клетку-хозяина, содержащую указанный экспрессионный вектор, а также лизат, полученный путем лизирования указанной клетки-хозяина. Настоящее изобретение раскрывает способ трансгликозилирования между нуклеозидом, который является донором сахара и акцепторным основанием в присутствии фосфат-ионов и любого из указанных ферментов или их комбинации. Настоящее изобретение позволяет получать новые рекомбинантные нуклеозидфосфорилазы с повышенной термостабильностью, высокой каталитической эффективностью, которые можно использовать для проведения реакции трансгликозилирования. 4 н. и 9 з.п. ф-лы, 8 ил., 4 табл., 13 пр.
Наверх