Способ неинвазивной диагностики колоректального рака


 


Владельцы патента RU 2586775:

Федеральное Государственное Бюджетное Учреждение "Петербургский институт ядерной физики им. Б.П. Константинова" (ФГБУ "ПИЯФ") (RU)

Изобретение относится к области биотехнологии и предназначено для неинвазивной диагностики колоректального рака. Осуществляют забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК и определение целостности ДНК методом ПЦР-анализа. Для оценки качества и количества выделенной ДНК проводят ПЦР-анализ двух фрагментов ДНК в дуплексном режиме: первый фрагмент длиной 141 н.п., расположенный в кодирующей области гена ТР53, второй фрагмент 153 н.п., расположенный в кодирующей области гена BLM. Для оценки целостности геномной ДНК методом ПЦР-анализа используют первый фрагмент длиной 800 н.п., содержащий 7, 8 и 9 экзоны гена ТР53, и второй фрагмент длиной 2340 н.п., содержащий 14 и 15 экзоны гена MLH1. Обнаружение хотя бы одного из этих двух фрагментов в продуктах ПЦР свидетельствует о наличии колоректального рака у пациента. Изобретение обеспечивает эффективную диагностику колоректального рака на ранних стадиях. 4 з.п. ф-лы, 1 пр.

 

Изобретение относится к области биотехнологии.

Колоректальный рак (КРР) является одним из самых распространенных онкологических заболеваний и приводит к высокой смертности среди пациентов. Однако при выявлении на первой стадии КРР излечим в 90% случаев [Duffy M.J. Use of molecular markers for predicting therapy response in cancer patients // J. Cancer Treatment Reviews. - 2011. - P. 151-159], из чего следует, что ранняя диагностика КРР чрезвычайно важна [1].

На сегодняшний день уже нет сомнений в необходимости скрининга населения, особенно людей, входящих в группу риска, на выявление КРР.

Фиброколоноскопия (ФКС) сегодня является основным тестом, который используется для установления или исключения колоректальной патологии [http://www.colonoscopy.ru/patient/procedure1.htm] [2]. Однако в качестве скринингового теста этот метод не всегда применим из-за своей дороговизны, неудобств, связанных с необходимостью очень тщательной подготовки кишечника пациента для получения достоверных результатов, из-за возможности осложнений.

В качестве одного из аналогов рассмотрен коммерческий тест Epi proColon, разработанный компанией Epigenomics в Германии.

Стоимость теста в Германии составляет 99-161 евро, длительность анализа составляет 1 неделю.

Чувствительность теста колеблется от 68% до 80%, а специфичность в пределах 70-90% по оценкам разных исследований.

Тест на наличие колоректального рака основан на обнаружении в плазме крови метилированного гена Septin9.

Фрагменты ДНК попадают в кровоток из колоректальных карцином проксимального и дистального отдела толстой кишки и из прямой кищки (свободно циркулирующая ДНК - цДНК). Данные фрагменты характеризуются присутствием маркеров онкогенов и специфическими мутациями онкосупрессоров.

Эпигенетические эффекты канцерогенеза включают ДНК метилирование еще на ранних стадиях. Ген Septin9 кодирует белок septin-9, который является онкосупрессором и регулирует деление цитоплазмы в клетках. Метилирование ДНК этого гена прекращает его активную работу и «выключает» синтез белка-супрессора ракового роста [Church TR, Wandell M, Lofton-Day С et al. Prospective evaluation of methylated SEPT9 in plasma for detection of asymptomatic colorectal cancer. Gut. 2014 Feb; 63(2): 317-25] [3].

Техника выполнения.

Epi proColon тест состоит из трех частей: кит для выделения ДНК из плазмы крови, кит, содержащий положительные и отрицательные контроли, и кит для Real time PCR.

У пациента отбирается 10 мл цельной крови в тубу Vacutainer K2EDTA (рекомендованы к использованию исключительно эти тубы). В течение 4х часов после отбора из крови извлекается около 3, 5 мл плазмы методом центрифугирования (1800 g). Плазма хранится 72 часа при температуре от 2°С до 8°С или 14 дней при температуре от 15°С до 25°С.

Выделение ДНК основано на методе сорбции на магнитные шарики. После элюирования конечный объем составляет 55 мкл.

Методом бисульфитной конверсии все деметилированные остатки цитозина, обнаруженные в образце крови цДНК, переходят в тимин. Анализ метелирования осуществляется методом дуплексной Real time PCR. Амплифицируется последовательность в промоторной области гена Septin9 (SEPT9_v2). Одновременно с Septin9 производится амплификация фрагмента гена β-актина для внутреннего контроля. Для одного пациента проводится три ПЦР-анализа для повышения точности, далее оцениваются ПЦР-кривые. Если кривая превысила предустановленный порог в течение 50 циклов ПЦР, реакция считается положительной. Если хотя бы одна ПЦР от субъекта была положительным, анализ считается положительным.

При положительном ответе рекомендовано пройти колоноскопию

[http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/Medical Devices/MedicalDevicesAdvisoryCommittee/MolecularandClinicalGeneticsPanel/UCM390234.pdf] [4].

Недостатки способа:

1) неполнота конверсии, что может приводить к ошибочным результатам анализа;

2) значительные потери ДНК на этапе конверсии;

3) высокая ресурсоемкость методов, что негативно сказывается на качестве и стоимости проводимой диагностики;

4) проведение анализа требует высокой квалификации персонала.

В качестве еще аналога рассмотрен Cologuard от корпорации Exact Sciences. Стоимость Cologuard составляет 600 долларов, заявленная чувствительность составляет 92% для колоректального рака и 69% для доброкачественных опухолей кишечного тракта

[http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/MedicalDevices/MedicalDevicesAdvisoryCommittee/MolecularandClinicalGeneticsPanel/UCM391101.pdf] [5].

Это многоцелевой тест, где происходит анализ пробы по трем категориям биомаркеров:

1) анализ на скрытую кровь в фекалиях методом FIT, то есть обнаружение молекул гемоглобина иммунохимическим методом;

2) анализ гиперметилирования ДНК по двум маркерам NDRG4 и ВМР3;

3) выявление мутаций по 7 точкам во втором экзоне гена KRAS (что охватывает 98% мутаций, характерных для данного гена) и анализ гена β-actin для контроля состояния геномной ДНК.

Техника выполнения.

Пробы отбираются в домашних условиях и помещаются в два контейнера: для анализа ДНК и для выявления глобулина.

В течение 72 часов с момента отбора образец доставляется для анализа.

Этапы анализа:

1) выделение ДНК из стула;

2) автоматизированная очистка ДНК и конверсия для эпигенетической оценки;

3) анализ ДНК методом QuARTS - (Quantitative allele-specific real-time target and signal amplification - количественная аллель - специфическая ПЦР в реальном времени);

4) количество молекул гемоглобина в образце определяется методом количественного иммуноферментного анализа (quantitative ELISA).

Заключение готово через 2 недели после получения образца.

При положительном ответе рекомендовано пройти колоноскопию [Thomas F. Imperiale, M.D., David F et al. Multitarget Stool DNA Testing for Colorectal-Cancer Screening N Engl J Med 2014; 370:1287-1297] [6].

Недостатки метода.

Данный тест отличается повышенной сложностью, высокими технологическими требованиями, очень высокой себестоимостью и относительной длительностью анализа.

В фекалиях человека обнаруживается небольшое количество клеток кишечного эпителия как следствие физиологического слущивания. Клетки кишечного эпителия быстро обновляются. Отшелушенные эпителиальные клетки при прохождении через кишечный тракт могут полностью или частично разрушаться под действием ферментов, ДНК этих клеток деградирована, как правило, до размеров 180-210 н.п. [Kerr JF, Wyllie АН, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 1972; 26:239-57] [7].

Несколько иная картина наблюдается у пациентов с колоректальными опухолями. Колоректальные раковые клетки наряду с нормальными попадают в стул человека, причем у пациентов с новообразованиями кишечного тракта количество ДНК в кале может быть даже увеличено по сравнению со здоровыми лицами. Значительное количество ДНК опухолевых клеток может сохранять свою стабильность в связи с нарушением механизма апоптоза или из-за устойчивости подобных клеток к различным деградирующим ферментам.

Показано [Boynton K.А., Summerhayes I.С., Ahlquist D.Α., Shuber A.P. DNA integrity as a potential marker for stool_based detection of colorectal cancer // Clin. Chem. - 2003. - Vol. 49. - P. 1058-1065] [8], что фрагменты ДНК, выделенные из стула больных с колоректальными опухолями, имеют большую молекулярную массу, нежели фрагменты, полученные из стула здоровых индивидуумов.

Следовательно, анализ целостности фрагментов ДНК, выделенной из образцов стула, предоставляет большие возможности для диагностики КРР.

Поэтому в качестве прототипа рассмотрен способ неинвазивной диагностики колоректального рака на основе ПЦР-анализа целостности фекальной ДНК [Yehya А.Н., Yusoff N.M., Khalid I.A. et al. Pilot study of the sensitivity and specificity of the DNA integrity assay for stool-based detection of colorectal cancer in Malaysian patients // Asian Pac J Cancer Prev. - 2012. - Vol. 13(5). - P. 1869-1872] [9].

Способ включает операции: забор и транспортировка образцов стула пациента, выделение из стула пациента общей ДНК, контроль качества и количества выделенной ДНК (т.е. достаточна ли ее концентрация для проведения ПЦР и хорошо ли она очищена от примесей, которые могут являться ингибиторами для полимеразы - фермента, с помощью которого синтезируются ПЦР-фрагменты) и проведение ПЦР-анализа протяженных фрагментов ДНК (т.е. установление целостности ДНК), по присутствию которых судят о наличии колоректального рака у пациента.

ПЦР-анализ фрагментов ДНК осуществляется путем последовательного проведения полимеразной цепной реакции и визуализации ее продуктов методом электрофореза.

Образцы стула были отобраны у 64 индивидуумов, включая 32 пациента с колоректальным раком и 32 здоровых волонтера.

Для пациентов с колоректальным раком диагноз был подтвержден гистологически. Фекалии собирали через 4-5 дней после колоноскопии или перед подготовкой пациента к хирургическому вмешательству, чтобы избежать травматических артефактов. Здоровые волонтеры имели негативный результат по анализу на скрытую кровь.

Образцы стула (~5 г) транспортировали от места забора до лаборатории во льду и выделение геномной ДНК производили в тот же день.

Для выделения общей ДНК из стула был применен QIAamp DNA Stool Mini Kit (Qiagen 51504), в соответствии с протоколом производителя.

Для контроля качества выделенной ДНК применяли УФ спектроскопию при 260/280 нм, а также электрофорез в агарозном геле.

Количество ДНК оценивали с использованием флюориметра Invitrogen Qubit и BR Assay Kit (Invitrogen Q32853) для двунитевой ДНК. Выделенную ДНК хранили в малых аликвотах при -20°С.

Для анализа протяженных фрагментов ДНК использовали фрагмент размером 1476 н.п., содержащий с 6 по 9 экзоны гена TP53. Для проведения ПЦР использовали набор праймеров, опубликованных ранее [Beroud С & Soussi Τ (1998). р53 gene mutation: software and database. Nucleic Acids Res, 1, 200-4] [10]. (Прямой = 5′ GCCTCTGATTCCTCACTGAT 3′ и обратный = 5′ AAGACTTAGTACCTGAAGGGT 3′).

Использовали ПЦР-реагенты фирмы Invitrogen (10342-020), в том числе Taq ДНК полимеразу.

Температурные режимы ПЦР:

первоначальная денатурация при 95°С/ 3 мин; 35 циклов 95°С/ 30 с; 58°С/ 2 мин; 72°С/ 2 мин; конечная полимеризация 72°С/ 5 мин в аппарате Eppendorf Mastercycler® pro.

5 мкл продукта ПЦР подвергали электрофорезу в 0,7% агарозном геле и фотографировали с использованием FluorChem M Fluorescent Imaging System.

Из 32 пациентов с колоректальным раком у 18 были выявлены протяженные фрагменты ДНК размером 1476 н.п., тогда как ни у одного из здоровых индивидуумов аналогичные фрагменты в стуле выявлены не были. Таким образом, чувствительность и специфичность метода при выявлении колоректального рака составили соответственно 56,3% и 100%.

Недостатком данного способа является невысокая чувствительность выявления колоректального рака. В данной работе выявлена достоверная корреляция между размером опухоли и чувствительностью теста. Так, для опухолей размером менее 3 см чувствительность метода составляет 38%, а более 3 см - 78,5% (р=0,0356), то есть выявление опухоли на ранних стадиях затруднено.

Невысокая чувствительность, в первую очередь, определяется использованием только одного мишенного гена (ТР53), поскольку делеция в этом гене может приводить к ложноотрицательному заключению.

Кроме того, способ связан с применением дорогостоящей высокочувствительной импортной аппаратурой. Для определения качества выделенной ДНК применяют УФ спектроскопию при 260/280 нм, а количество ДНК оценивали с использованием флюориметра Invitrogen Qubit и BR Assay Kit (Invitrogen Q32853). Применение такой аппаратуры ограничивает возможность массового скрининга населения.

Задачей настоящего изобретения является разработка метода ранней неинвазивной диагностики колоректального рака, обеспечение масштабного скрининга населения при экономической доступности.

Технический эффект заключается в повышении чувствительности способа, упрощении способа при сохранении 100% специфичности без применения дорогостоящей, сложной аппаратуры.

Технический эффект достигается тем, что в известном способе неинвазивной диагностики колоректального рака, основанном на анализе целостности ДНК из стула пациента, включающем забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК, контроль качества выделенной ДНК и проведение ПЦР-анализа протяженных фрагментов ДНК, т.е. установление целостности ДНК, по присутствию которых судят о наличии колоректального рака у пациента, новым является то, что образцы стула транспортируют в среде, содержащей 0,5 M ЭДТА, а для оценки качества и количества выделенной ДНК проводят ПЦР-анализ двух коротких фрагментов ДНК длиной менее 200 н.п. в дуплексном режиме: первый фрагмент длиной 141 н.п., расположенный в кодирующей области гена ТР53, второй фрагмент 153 н.п., расположенный в кодирующей области гена BLM, и для оценки целостности геномной ДНК методом ПЦР-анализа используют два протяженных фрагментов ДНК: первый фрагмент длиной 800 н.п., содержащий 7, 8 и 9 экзоны гена ТР53, второй фрагмент длиной 2340 н.п., содержащий 14 и 15 экзоны гена MLH1, причем для обоих данных фрагментов полимеразную цепную реакцию проводят при помощи кита "Evrogen Encyclo PCR", в состав которого входит Encyclo-полимераза, и обнаружение этих фрагментов либо хотя бы одного из этих двух фрагментов в продуктах ПЦР свидетельствует о наличии колоректального рака у пациента.

При этом ПЦР-анализ первого короткого фрагментов ДНК длиной 141 н.п. осуществляют, используя прямой праймер 5′-ATTCACTTTTATCACCTTTCCTTGCC-3′, обратный праймер: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3, ПЦР-анализ второго короткого фрагментов ДНК длиной 153 н.п. осуществляют, используя прямой праймер 5′-CTCTGCCACCAGGAAGAATC-3′, обратный праймер: 5′-ACAGCAGTGCTTGTGAGAAC-3′; и наличие первого протяженного фрагмента длиной 800 н.п. при анализе целостности ДНК определяют с использованием выбранного прямого праймера: 5′-GCCTCATCTTGGGCCTGTGTTATCTC-3′, обратного праймера: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3′, а наличие второго протяженного фрагмента длиной 2340 н.п. при анализе целостности ДНК определяют с использованием выбранного прямого праймера: 5′-AAGTGGGGTTGGTAGGATTCT-3′, обратного праймера: 5′-ACTATACAATACAGCAACTATCCT-3′.

В заявляемом способе качество и количество выделенной ДНК оценивается путем проведения ПЦР-анализа коротких фрагментов 141 н.п. и 153 н.п. с подбором определенной разработанной авторами тест-системы, детектирующей геномную ДНК в дуплексном режиме.

Под качеством выделенной ДНК понимается, хорошо ли она очищена от примесей, которые могут являться ингибиторами для полимеразы - фермента, с помощью которого синтезируются ПЦР - фрагменты, а под количеством - достаточна ли ее концентрация для проведения последующей ПЦР протяженных фрагментов. Поскольку геномная ДНК в норме при прохождении через желудочно-кишечный тракт расщепляется до фрагментов 190-210 н.п., то при оптимальных условиях для ПЦР фрагменты длиной 141 и/или 153 н.п. обнаруживаются в стуле как здоровых, так и больных колоректальном раком.

В прототипе для определения качества выделенной ДНК применяют УФ спектроскопию при 260/280 нм, а количество ДНК оценивают с использованием флюориметра Invitrogen Qubit и BR Assay Kit (Invitrogen Q32853). Данные операции требуют использования дорогостоящего оборудования и высокой квалификации специалистов.

Кроме того, в предлагаемом способе (в отличие от прототипа) для определения целостности геномной ДНК используются в качестве маркеров вместо одного протяженного фрагмента гена ТР53 два протяженных фрагмента ДНК (фрагменты генов TP53 и MLH1), которые обеспечивают более высокую чувствительность теста.

Дело в том, что к настоящему времени для колоректального рака из литературы известны два основных пути развития, в которых повреждаются две разные группы генов [Fearon, E.R. Molecular genetics of colorectal cancer. Annu. Rev. Pathol. Mech. Dis. 2011, 6, 479-507] [11].

Поэтому авторы заявляемого способа выбрали как для анализа качества и количества ДНК, так и для анализа целостности ДНК по одному фрагменту гена из каждой группы, одновременное повреждение которых встречается с небольшой вероятностью:

короткий и длинный фрагменты гена TP53 принадлежат к первой группе генов,

короткий фрагмент гена BLM и длинный фрагмент гена MLH1 принадлежат ко второй группе генов.

Ведь если при КРР у пациента поврежден ген ТР53, фрагмент этого гена (как в прототипе) может не выявляться при ПЦР-анализе, зато в заявляемом способе будет выявляться фрагмент гена MLH1, что повышает чувствительность теста, т.к. исключается вероятность ложноотрицательного заключения, что имеет место в прототипе.

Таким образом, выбор длины этих фрагментов, локализации их в геноме человека, структуры праймеров и условий проведения ПЦР-анализа являются теми моментами, которым были посвящены эксперименты при разработке заявляемого способа.

Данные фрагменты длиной 800 н.п. гена ТР53 и фрагмент длиной 2340 н.п. гена MLH1 не использовались ранее для анализа целостности ДНК, что свидетельствует об определенном изобретательском уровне.

ПЦР-анализ фрагментов ДНК осуществляется путем последовательного проведения полимеразной цепной реакции и визуализации ее продуктов методом электрофореза.

Совокупность всех признаков (операций) в заявляемом способе обеспечивает повышение чувствительности.

Пример конкретной реализации.

В течение трех дней до взятия пробы не проводились колоноскопия и иные инвазвные манипуляции с прямой кишкой пациента. В исследовании участвовало 60 человек, из них 42 пациента с колоректальным раком и 18 человек, не имеющих новообразований желудочно-кишечного тракта. Наличие или отсутствие опухоли было установлено методом фиброколоноскопии. Были получены демографические (в том числе и для контрольной группы) и клинико-патологоанатомические данные пациентов. После хирургической операции все опухоли были гистологически охарактеризованы.

Сразу после дефекации отбирается около 1 мл стула и помещается в герметичный пластиковый контейнер, содержащий 1 мл 0,5 M ЭДТА. Такой раствор позволяет сохранять фекальную ДНК неповрежденной в течение 24 часов, защищая от действия разнообразных ферментов. Отбор можно производить в домашних условиях. Выделение общей ДНК производится в следующие 24 часа после отбора пробы. Выделение проводится с использованием кита «ДНК-сорб-В» (АмплиСенс). Метод выделения основан на специфической обратимой сорбции ДНК в присутствии хаотропных солей на частицы силикагеля [http://www.interlabservice.ru/catalog/reagents/index.php?sid=l402&id=8693)] [12].

Оценка качества и количества ДНК, выделенной из стула пациента.

Для оценки качества и количества выделенной ДНК предварительно производили ПЦР-анализ двух коротких фрагментов длиной менее 200 н.п. Была разработана тест-система, детектирующая данные фрагменты ДНК в дуплексном режиме, что позволило снизить трудозатраты на проведение ПЦР в два раза, а также в 1.5 раза уменьшить расход реагентов. Первый фрагмент длиной 141 н.п. расположен в кодирующей области гена ТР53 (экзон 9). Прямой праймер: 5′-ATTCACTTTTATCACCTTTCCTTGCC-3′; обратный праймер: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3′. Второй фрагмент длиной 153 н.п. расположен в кодирующей области гена BLM. Прямой праймер: 5′-CTCTGCCACCAGGAAGAATC-3′; обратный праймер: 5′-ACAGCAGTGCTTGTGAGAAC-3′.

В реакционную смесь брали 6-10 нг ДНК; 1 ед. Taq-полимеразы (НПО "СибЭнзим").

Температурный режим реакции: первоначальная денатурация 4 мин / 95°С; 30 циклов, 40 с/ 94°С, 40 с /55°С, 40 с /72°С; конечная полимеризация 7 мин / 72°С в амплификаторе «Терцик» («ДНК-Технология»).

После этого проводили электрофорез продуктов ПЦР в полиакриламидном геле и окрашивали гель нитратом серебра.

Наличие в продуктах ПЦР обоих фрагментов длиной менее 200 н.п. или хотя бы одного из них свидетельствует о том, что выделенная ДНК пригодна по своему качеству и количеству для дальнейшего анализа на ее целостность.

Для анализа целостности ДНК при проведении ПЦР-анализа были также выбраны два протяженных фрагмента ДНК.

Первый фрагмент - длиной 800 н.п., содержащий 7, 8 и 9 экзоны гена ТР53. Праймеры были выбраны нами с помощью программы Primer Premier 6. Прямой праймер: 5′-GCCTCATCTTGGGCCTGTGTTATCTC-3′; обратный праймер: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3′.

Температурный режим реакции: первоначальная денатурация 4 мин / 95°С; 10 циклов 50 с/ 95°С, 40 с /63°С, 90 с /72°С; 30 циклов, 50 с/ 95°С, 40 с /56°С, 90 с /72°С; конечная полимеризация 7 мин /72°С в амплификаторе «Терцик» («ДНК-Технология»).

(В отличие от прототипа при отжиге праймеров на матрице используется температурная «ступенька», сначала применяется 10 циклов при 63°С, а затем 30 циклов при 56°С). Использование температурной «ступеньки» повышает чувствительность и специфичность ПЦР-анализа.

Второй фрагмент длиной 2340 н.п., содержащий 14 и 15 экзоны гена MLH1. Прямой праймер: 5′-AAGTGGGGTTGGTAGGATTCT-3′, обратный праймер: 5′-ACTATACAATACAGCAACTATCCT-3′.

Температурный режим реакции: первоначальная денатурация 3 мин / 95°С; 40 циклов, 30 с/ 95°С, 40 с /60°С, 2 мин /72°С; конечная полимеризация 7 мин /72°С в амплификаторе «Терцик» («ДНК-Технология»).

Для обоих длинных фрагментов полимеразную цепную реакцию проводили при помощи кита "Evrogen Encyclo PCR". В реакционную смесь брали 1-9 нг ДНК; 1 ед. Encyclo-полимеразы (В прототипе используется Taq ДНК-полимераза, Encyclo-полимераза предпочтительна для амплификации длинных фрагментов ДНК).

Для визуализации продуктов ПЦР проводили электрофорез в полиакриламидном геле с последующим окрашиванием нитратом серебра.

Фрагменты ДНК длиной 800 н.п. и/или 2340 н.п. были обнаружены в стуле 32 из 42 пациентов с колоректальным раком. В контрольной группе такие фрагменты ДНК в стуле отсутствовали.

Для анализа данных использовали программу Graphpad Instat [http://www.keygenguru.com/serial/graphpad_instat_3_0.html] [13]. Различия между группами считали достоверными на уровне 95% вероятности при р<0,05.

Чувствительность и специфичность метода составили соответственно 76% и 100%. С уровнем статистической достоверности более 95% не выявлено статистически значимых различий (р=1) между чувствительностью метода для пациентов с I-II (73%) и III-IV (70%) стадиями, что демонстрирует возможности метода для ранней диагностики КРР.

Результаты анализа могут быть получены в течение 3-х дней после доставки пробы в лабораторию.

Способ целесообразно применять в условиях массового обследования населения, т.к. не связан с применением дорогостоящей, сложной аппаратуры и высококвалифицированного персонала, и позволяет выявлять КРР на ранних стадиях.

Список литературы

1. Duffy M.J. Use of molecular markers for predicting therapy response in cancer patients // J. Cancer Treatment Reviews. - 2011. - P. 151-159.

2. http://www.colonoscopy.ru/patient/procedure1.htm.

3. Church TR, Wandell M, Lofton-Day С et al. Prospective evaluation of methylated SEPT9 in plasma for detection of asymptomatic colorectal cancer. Gut. 2014 Feb; 63(2):317-25.

4. http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/MedicalDevices/MedicalDevicesAdvisoryCommittee/MolecularandClinicalGeneticsPanel/UCM390234.pdf.

5. http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/MedicalDevices/MedicalDevicesAdvisoryCommittee/MolecularandClinicalGeneticsPanel/UCM391101.pdf.

6. Thomas F. Imperiale, M.D., David F et al. Multitarget Stool DNA Testing for Colorectal-Cancer Screening N Engl J Med 2014; 370:1287-1297.

7. Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 1972; 26:239-57.

8. Boynton K.A, Summerhayes I.C, Ahlquist D.Α., Shuber A.P. DNA integrity as a potential marker for stool_based detection of colorectal cancer // Clin. Chem. - 2003. - Vol. 49. - P. 1058-1065.

9. Yehya A.H., Yusoff N.M., Khalid I.A. et al. Pilot study of the sensitivity and specificity of the DNA integrity assay for stool-based detection of colorectal cancer in Malaysian patients // Asian Pac J Cancer Prev. - 2012. - Vol. 13(5). - P. 1869-1872. - прототип.

10. Beroud С & Soussi Τ (1998). p53 gene mutation: software and database. Nucleic Acids Res, 1, 200-4.

11. Fearon E.R. Molecular genetics of colorectal cancer. Annu. Rev. Pathol. Mech. Dis. 2011, 6, 479-507.

12. http://www.interlabservice.ru/catalog/reagents/index.php?sid=1402&id=8693).

13. http://www.keygenguru.com/serial/graphpad_instat_3_0.html.

1. Способ неинвазивной диагностики колоректального рака, основанный на анализе целостности ДНК из стула пациента, включающий забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК, контроль качества и количества выделенной ДНК и выявление протяженных фрагментов для определения целостности ДНК методом ПЦР-анализа, по присутствию которых судят о наличии у пациента колоректального рака, отличающийся тем, что образцы стула транспортируют в среде, содержащей 0,5 М ЭДТА, а для оценки качества и количества выделенной ДНК проводят ПЦР-анализ двух коротких фрагментов ДНК длиной менее 200 н.п. в дуплексном режиме: первый фрагмент длиной 141 н.п., расположенный в кодирующей области гена ТР53, второй фрагмент 153 н.п., расположенный в кодирующей области гена BLM, и для оценки целостности геномной ДНК методом ПЦР-анализа используют два протяженных фрагмента: первый фрагмент длиной 800 н.п., содержащий 7, 8 и 9 экзоны гена ТР53, второй фрагмент длиной 2340 н.п., содержащий 14 и 15 экзоны гена MLH1, причем для обоих протяженных фрагментов полимеразную цепную реакцию проводят при помощи кита "Evrogen Encyclo PCR", в состав которого входит Encyclo-полимераза, и обнаружение этих фрагментов либо хотя бы одного из этих двух фрагментов в продуктах ПЦР свидетельствует о наличии колоректального рака у пациента.

2. Способ неинвазивной диагностики колоректального рака по п.1, отличающийся тем, что ПЦР-анализ первого короткого фрагмента ДНК длиной 141 н.п. осуществляют, используя прямой праймер 5′-ATTCACTTTTATCACCTTTCCTTGCC-3′, обратный праймер: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3.

3. Способ неинвазивной диагностики колоректального рака по п.1, отличающийся тем, что ПЦР-анализ второго короткого фрагмента ДНК длиной 153 н.п. осуществляют, используя прямой праймер 5′-CTCTGCCACCAGGAAGAATC-3′, обратный праймер: 5′-ACAGCAGTGCTTGTGAGAAC-3′.

4. Способ неинвазивной диагностики колоректального рака по п.1, отличающийся тем, что наличие первого фрагмента длиной 800 н.п. при анализе целостности ДНК определяют с использованием выбранного прямого праймера: 5′-GCCTCATCTTGGGCCTGTGTTATCTC-3′, обратного праймера: 5′-CCACTTGATAAGAGGTCCCAAGACTT-3′.

5. Способ неинвазивной диагностики колоректального рака по п.1, отличающийся тем, что наличие второго фрагмента длиной 2340 н.п. при анализе целостности ДНК определяют с использованием выбранного прямого праймера: 5′-AAGTGGGGTTGGTAGGATTCT-3′, обратного праймера: 5′-ACTATACAATACAGCAACTATCCT-3′.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области медицины. Предложен способ оценки чувствительности субъекта к возникновению рака предстательной железы, включающий определение в образце уровня фрагментов MR-pro-ADM, MR-pro-ANP и копептина длиной по крайней мере 12 аминокислот и соотнесение указанного уровня фрагментов с риском возникновения рака предстательной железы у субъекта, где субъект еще не был диагностирован как такой, который имеет рак, и/или не имеет рака.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для повышения лечебного действия режима химиотерапии на пациента, страдающего раком поджелудочной железы, путем добавления бевацизумаба к режиму химиотерапии.

Изобретение относится к биотехнологии, конкретно к стоматологии и медицинской генетике, и может быть использовано для прогнозирования злокачественной трансформации эрозивно-язвенной формы красного плоского лишая (КПЛ) слизистой оболочки полости рта (СОПР).

Изобретение относится к области медицины, а именно к способу диагностики острого лимфобластного лейкоза у пациента, включающий выявление признаков лейкоза, тестирование клеток крови на лейкоз, инкубирование клеток крови фактором, идуцирующим лейкоз, с тем, чтобы индуцировать экспрессию клеточных поверхностных маркеров, которые являются признаком лейкоза, где фактор, индуцирующий лейкоз - это супернатант Aspergillus flavus, EBV-инфицированный CCL87 супернатант, очищенная EBV культура или их комбинации.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована для анализа того, будет ли пациент отвечать терапевтически на способ лечения рака, включающий введение иммуногенной композиции.

Настоящее изобретение относится к набору для применения в in vitro прогностическом способе для определения или предсказания in vivo терапевтического ответа в пораженных клетках или тканях на лечение заболевания, имеющего этиологию, связанную с избыточной пролиферацией клеток, с использованием сердечного гликозида.

Группа изобретений относится к медицине, а именно к исследованию органокомплекса после проведения гастро-/панкретодуоденальной или дистальной резекции по поводу протоковой аденокарциномы поджелудочной железы.

Настоящее изобретение предоставляет способ предсказания ответа трижды негативного рака молочной железы на терапию противоопухолевым средством. Способ включает: (a) лизирование опухолевых клеток, взятых от трижды негативной опухоли молочной железы, для получения клеточного экстракта; (b) определение уровня экспрессии VEGFR2 в клеточном экстракте; и (c) сравнение уровня экспрессии VEGFR2 в клеточном экстракте, полученном на стадии (b), с эталонным уровнем экспрессии VEGFR2.

Изобретение относится к области медицины, в частности онкологии, и предназначено для прогнозирования гематогенного метастазирования при трипл негативной инвазивной карциноме неспецифического типа молочной железы.

Группа изобретений относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС) и способу выявления ЭДС.

Изобретения относятся к области биотехнологии и касаются набора синтетических олигонуклеотидных праймеров и способа его использования. Представленный набор включает две пары праймеров, имеющих следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′.

Изобретение относится к биотехнологии и молекулярной генетике. Способ предусматривает картирование положений ряда метилированных нуклеотидных последовательностей Pu(5mC)GPy в протяженной ДНК для построения эпигенетического профиля и выявления аномально метилированных участков ДНК.

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области биотехнологии, конкретно к влиянию мутаций гена KRAS на восприимчивость к химиотерапии, и может быть использовано в предсказании терапевтического эффекта химиотерапии.

Изобретение относится к области биохимии и может быть использовано при разработке методов молекулярно-генетической диагностики. Заявлен способ селективного отбора целевых участков ДНК.

Изобретение относится к области медицины, в частности к травматологии, и предназначено для прогнозирования нарушения консолидации при переломах костей конечностей.

Изобретение относится к биохимии. Описана выделенная молекула нуклеиновой кислоты для обнаружения вируса иммунодефицита человека (ВИЧ), которая содержит: 5′-agg pnn tgn atg pan tgg atg-3′ (SEQ ID NO: 10) или 5′-agg pnn tgn ntg ptn tgg atg-3′ (SEQ ID NO: 11) и набор, содержащий данную молекулу и инструкцию, где p = универсальный нуклеотид, который представляет собой 3-нитропиррол, 2′-дезоксинуклеозид и 5-нитроиндол или 6Н,8Н-3,4-дигидропиримидо[4,5-с][1,2]оксазин-7-он, и n = аналог цитидина, имеющий модификацию С-5.

Изобретение относится к области молекулярной генетики и микологии и предназначено для диагностики онихомикоза. Осуществляют выделение ДНК из биологического материала ногтей, проведение ПЦР и детекцию полученных результатов с помощью электрофореза в агарозном геле.

Изобретение относится к области медицины и предназначено для ПЦР-детекции Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens и Eggerthella spp. в клиническом материале.

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для диагностики плоскоклеточного рака легкого (ПКРЛ). Осуществляют получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй - из прилегающей гистологически нормальной ткани, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК, амплификацию фрагмента гена CALL и сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани. Уменьшение содержания мРНК гена CALL от 3 до 44 раз служит диагностическим признаком ПКРЛ. Изобретение обеспечивает раннюю диагностику ПКРЛ. 4 з.п. ф-лы, 1 ил., 4 табл., 6 пр.
Наверх