Способ диагностики плоскоклеточного рака легкого и набор для его осуществления



Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления
Способ диагностики плоскоклеточного рака легкого и набор для его осуществления

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2586779:

Федеральное государственное бюджетное учреждение науки Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН) (RU)

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для диагностики плоскоклеточного рака легкого (ПКРЛ). Осуществляют получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй - из прилегающей гистологически нормальной ткани, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК, амплификацию фрагмента гена CALL и сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани. Уменьшение содержания мРНК гена CALL от 3 до 44 раз служит диагностическим признаком ПКРЛ. Изобретение обеспечивает раннюю диагностику ПКРЛ. 4 з.п. ф-лы, 1 ил., 4 табл., 6 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области медицины, в частности онкологии и молекулярной биологии, и может быть использовано для ранней диагностики плоскоклеточного рака легкого (ПКРЛ).

Уровень техники

Рак легкого (РЛ) остается одной из основных причин смерти онкологических больных в мире. Смертность от этого заболевания превышает смертность от рака молочной железы, толстой кишки и предстательной железы, вместе взятых [Jemal A., Siegel R., Ward E., Murray T., Xu J., Smigal C., Thun M.J. 2006. Cancer statistics. CA Cancer J Clin. 56, 6-30]. В России показатели смертности от рака легкого у мужчин 68,2 случая на 100 тысяч населения, у женщин - 6,8 случая [Заридзе Д.Г. 2004. Эпидемиология и этиология злокачественных новообразований, стр. 29-85 - в кн. Канцерогенез / под ред. Д.Г. Заридзе. - М.: Медицина]. Различают два основных гистологических типа РЛ: мелкоклеточный (МРЛ) и немелкоклеточный (НМРЛ), составляющих 15-20% и 75-80%, соответственно. К НМРЛ относят наиболее распространенный плоскоклеточный рак легкого (ПКРЛ), аденокарциному легкого (АК), которая занимает второе место по встречаемости, крупноклеточный рак легкого (ККРЛ), бронхо-альвеолярную аденокарциному (БААК) и карциноид (К). Диагноз НМРЛ в половине случаев устанавливают на далеко зашедшей стадии опухолевого процесса, что делает малоэффективным радикальное вмешательство. Современные методы лечения повышают среднюю пятилетнюю продолжительность жизни больных НМРЛ не более чем на 15%. Этот показатель может быть существенно улучшен с помощью разработки методов ранней диагностики. Основными методами диагностики РЛ служат инструментальные - рентгеновские и эндоскопические. Используют также анализ мокроты на атипичные клетки, биопсию тканей легких, компьютерную томографию, флуоресцентную фиброскопию. Иммунологические методы диагностики находят пока ограниченное клиническое применение. На практике применяют следующие опухолевые маркеры: СЕА - раково-эмбриональный антиген - онкомаркер рака прямой кишки, но может использоваться в оценке РЛ; NSE - нейрон-специфическая энолаза - в ряде случаев используют в оценке состояния пациентов с РЛ; ТРА - тканевой полипептидный антиген - фрагмент цитокератина, более специфичный маркер РЛ. Эти маркеры применяют для контроля лечения, выявления рецидивов, но не для ранней диагностики РЛ. Для диагностики НМРЛ используют маркеры SCCA или SCC (squamous cell carcinoma) - антиген плоскоклеточной карциномы и фрагмент цитокератина 19 (CYFRA 21-1 - cytokeratin fragment), которые, однако, не очень эффективны для диагностики на ранних стадиях РЛ [Blankenburg F, Hatz R, Nagel D, Ankerst D, Reinmiedl J, Gruber C, Seidel D, Stieber P. 2008. Preoperative CYFRA 21-1 and СEА as Prognostic Factors in Patients with Stage I Non-Small Cell Lung Cancer. External Validation of a Prognostic Score. Tumour Biol. 29(4), 272-277; Nisman B, Biran Н, Heching N. Barak V, Ramu N. Nemirovsky I, Peretz T. 2008. Prognostic role of serum cytokeratin 19 fragments in advanced non-small-cell lung cancer: association of marker changes after two chemotherapy cycles with different measures of clinical response and survival. Br J Cancer. 98(1), 77-79].

Согласно данным литературы при НМРЛ снижение уровня мРНК показано для нескольких генов [Liu Y, Wang В, Wang J, Wang W, Sun R, Zhao Y, Zhang N. 2009. Down-regulation of PKCzeta expression inhibits chemotaxis signal transduction in human lung cancer cells, Lung Cancer, 63(2), 210-218]. Для гена pim-1 показано существование взаимосвязи между уровнем мРНК и наличием метастазов в регионарные лимфоузлы [Warnecke-Eberz U, Bollschweiler E, Drebber U, Pohl А, Baldus SE, Hoelscher AH, Metzger R. 2008. Frequent down-regulation of pim-1 mRNA expression in non-small cell iung cancer is associated with lymph node metastases. Oncol Rep. 20(3). 619-624]. Показано, что снижение экспрессии гена VILIP-1 можно использовать для обнаружения НМРЛ с быстрым течением и неблагоприятным прогнозом [Fu J, Fong K, Bellacosa А, Ross E, Apostolou S, Bassi D.E, Jin F, Zhang J, Cairns P, Ibañez de Caceres I, Braunewell K.Н, Klein-Szanto AJ. 2008. VILIP-1 downregulation in non-small cell lung carcinomas: mechanisms and prediction of survival, PLoS ONE. 3(2), е1698]. Однако практически отсутствуют данные о генах, для которых определение снижения содержания мРНК используют для ранней диагностики НМРЛ.

Диагностическими признаками злокачественной трансформации клеток могут служить геномные изменения в опухолевых клетках: точечные мутации, микросателлитная нестабильность, аллельные потери, эпигеномные изменения (метилирование промоторных участков генов), а также изменения функциональной активности многих генов на уровне мРНК и белка. В отличие от белковых, молекулярно-генетические маркеры обладают значительно большей чувствительностью. В числе перспективных потенциальных маркерных генов, вовлеченных в развитие разных форм рака легкого, рассматривают новые гены, потенциальные супрессоры опухолевого роста (TSG, tumor suppressor genes) на коротком плече хромосомы 3 человека [Zabarovsky ER, Lerman MI, Minna JD. 2002. Tumor suppressor genes on chromosome 3p involved in the pathogenesis of lung and other cancers. Oncogene. 21(45), 6915-6935; Wistuba II, Behrens C, Virmani AK, Mele G, Milchgrub S, Girard L, Fondon JW 3rd, Garner HR, McKay B, Latif F, Lerman MI, Lam S, Gazdar AF, Minna JD. 2000. High resolution chromosome 3p allelotyping of human lung cancer and preneoplastic/preinvasive bronchial epithelium reveals multiple, discontinuous sires of 3p allele loss and three regions of frequent breakpoints, Cancer Res. 60(7), 1949-60; Angeloni D. 2007. Molecular analysis of deletions in human chromosome 3p21 and the role of resident cancer genes in disease. Brief Funct Genomic Proteomic. 6(1), 19-39].

На коротком плече хромосомы 3 идентифицирован ген CALL (другие обозначения CHL1; cell adhesion molecule with homology to L1CAM (close homolog of L1); FLJ44930; L1САМ2; МGС132578; L1 cell adhesion molecule 2; cell adhesion molecule L1-like; cell adhesion molecule with homology to L1CAM), который открыт при исследовании генов, связанных с задержкой умственного развития у пациентов с 3p-синдромом [Wei MH, Karavanova I, Ivanov S.V, Popescu N.C, Keck C.L, Pack S, Eisen J.A, Lerman M.I. 1998. In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Hum Genet. 103(3), 355-364]. Этот ген относится к семейству L1 нейральных молекул клеточной адгезии и кодирует мультидоменный белок, содержащий сигнальный пептид, 6 иммуноглобулиновых доменов, 4 домена фибронектина типа III, трансмембранный участок и цитоплазматический домен, состоящий из 105 аминокислотных остатков. Цитоплазматический домен консервативен у представителей L1 семейства и именно благодаря ему эти молекулы участвуют в сигнальных путях. Методом Нозерн-гибридизации показано, что ген CALL экспрессируется в нервной ткани, некоторых других тканях взрослого организма, в том числе легкого, а также в некоторых клеточных линиях, полученных из образцов злокачественных опухолей. Ген CALL экспрессируется, главным образом, как транскрипт из 8 т.п.н. В некоторых тканях и клеточных линиях выявлен более короткий транскрипт длиной 4,5 т.п.н. и соответствующий белок. Поскольку 3p-синдром связан с риском развития карцином, предполагали участие гена CALL в процессах канцерогенеза.

Изобретение, предлагающее способ диагностики различных карцином человека, в том числе РЛ, а также лимфом и лейкемий, основано на выявлении цитогенетических изменений и аллельных потерь для 10-ти генов-супрессоров опухолевого роста, расположенных в критичной области LUCA хромосомы 3 [Ji L., Minna J., Roth J., Lerman M. Chromosome 3p21.3 genes are tumor suppressors. 2002. Международные патенты № WO 0204511, № US 2004016006].

Изобретение, относящееся к способу диагностики рака молочной железы, толстой кишки, мочевого пузыря, основано на обнаружении методом ПЦР с радиоактивно меченными праймерами повышения уровня мРНК множественных сплайсированных форм гена поверхностного гликопротеина CD44 в опухолевых тканях, соответствующих метастазах и биоптатах по сравнению с нормальными тканями [Tarin D., Matsumura Y. Diagnostic method. 1994. Международный патент № WO 94/02633].

Изобретение, предлагающее способ диагностики лимфом, основано на сравнении относительного уровня мРНК генов легких λ- и κ-иммуноглобулинов, вовлеченных в развитие лимфом, методом ПЦР-РВ [Stalberg A., Kubista M. Method to measure gene expression ratio of key genes. 2002. международный патент № WO 02/09913].

В работе [Cheng M., Chen Y., Yu X., Tian Z., and Wei H. 2008. Diagnostic utility of LunX mRNA in peripheral blood and pleural fluid in patients with primary non-small cell lung cancer. ВМС Cancer. 8, 156] методом ПЦР в реальном времени (ПЦР-РВ) оценили уровень мРНК генов LunX, CK19, CEA, VEGF-C and hnRNP А2/В1 в периферической крови и плевральной жидкости у больных с диагнозом НМРЛ, рак пищевода, рак молочной железы и у здоровых добровольцев. В крови мРНК гена LunX обнаружили у 75.0% (33/44) больных только с НМРЛ. Помимо этого, мРНК всех других генов обнаружили как у всех исследованных больных, так и у здоровых людей. Содержание мРНК гена LunX уменьшалось у больных после лечения. Сделан вывод, что уровень мРНК гена LunX - специфический маркер для рака легкого, который может иметь применение для диагностики НМРЛ. Данный аналог наиболее близок по технической сущности заявленному изобретению и принят за прототип.

Проведен поиск для гена CALL по базам данных с учетом следующих различных обозначений и вариантов написания названия гена: CALL; CHL1; cell adhesion molecule with homology to L1CAM (close homolog of L1); FLJ44930; L1САМ2; МGС132578; L1 cell adhesion molecule 2; cell adhesion molecule L1-like; cell adhesion molecule with homology to L1CAM. Ни для одного из перечисленных вариантов не обнаружено охранных документов и/или патентных заявок, ограничивающих возможность использования снижения содержания мРНК гена CALL, определяемого различными методами, для диагностики рака легкого. Таким образом, в перечисленных выше, а также других изобретениях не использовали снижение содержания мРНК гена CALL, в том числе с использованием метода ПЦР-РВ, для диагностики НМРЛ.

Для оценки содержания мРНК генов используют различные методы. Современный высокочувствительный метод ПЦР-РВ отличается от традиционных качественных и полуколичественных методов тем, что позволяет быстро и точно определить количество копий ДНК или кДНК в широком диапазоне концентраций [Livak K.J., Flood S.J., Marmaro J., Giusti W., Deets K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide aquenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 4, 357-362]. Метод широко используют в мире как для научных, так и для клинических целей, благодаря высокой производительности - обычно проводят 96 или 384 реакций. В отличие от обычной ПЦР, когда количество продуктов определяют на конечной стадии реакции, метод позволяет следить за накоплением продуктов в экспоненциальной фазе реакции. В этой системе наряду с праймерами используют меченный флуоресцентным красителем зонд (пробу), который является олигонуклеотидом и гибридизуется с последовательностью ДНК/кДНК между двумя фланкирующими праймерами. ПЦР-РВ состоит из двух основных этапов: 1) гибридизации исследуемой матрицы с зондом и 2) ПЦР, катализируемой TaqДНК-полимеразой, обладающей 5′-экзонуклеазной активностью и способной расщеплять зонд, что приводит к появлению и нарастанию флуоресцентного сигнала. На мировом рынке представлены различные модели приборов для ПЦР-РВ, разработанные известными фирмами-изготовителями - Applied Biosystems, Bio-Rad, Invitrogene, Eppendorf и др., а также отечественные приборы DTprime (ДНК-Технология), АНК-32 (Институт Аналитического Приборостроения РАН, http://www.syntol.ru/productank.htm). В России этот метод пока не достаточно востребован для количественной оценки содержания мРНК генов как в фундаментальных исследованиях, так и в клинике. Появление на отечественном рынке недорогих приборов, разработанных российскими фирмами, а также недорогих отечественных реактивов («Синтол», «ДНК-Технологии», «Изоген» и др.), сравнимых по эффективности с зарубежными наборами, обеспечит более широкое распространение этого технологичного метода [Манзенюк О.Ю., Малахо С.Г., Пехов В.М., Косорукова И.С, Полтараус А.Б. 2006. Характеристика универсальных отечественных наборов реагентов для ПЦР в реальном времени. Опыт использования в молекулярной онкодиагностике. Молекулярная биология. 40, 349-356]. Методики и протоколы, описанные в данной заявке, предполагают, в основном, использование отечественных наборов и хотя выполнены на приборе ABI Prism 7000 (Applied Biosystems, США), могут быть адаптированы для отечественных приборов. Сочетание недорогих приборов и отечественных наборов реактивов позволит сделать доступным этот технологичный метод для отечественных научных и клинических лабораторий.

Из изложенного ясно, что изменение содержания мРНК онкозначимых генов в опухолях по сравнению с нормальными тканями в качестве молекулярного маркера для диагностики рака легкого пока не нашло широкого практического применения в клиниках. В данной области существует потребность в поиске новых диагностических маркеров, позволяющих достоверно и уже на ранних стадиях диагностировать заболевания, а также в разработке на их основе чувствительного, надежного, применимого в условиях клинических или поликлинических медицинских учреждений способа диагностики РЛ, в частности ПКРЛ.

Раскрытие изобретения

Данное изобретение стало возможным в результате проведенного авторами сравнительного анализа содержания мРНК гена CALL в различных гистологических типах НМРЛ на разных клинических стадиях и открытия того факта, что уже на ранних стадиях развития основного типа НМРЛ-ПКРЛ происходит значительное и частое снижение содержания мРНК гена CALL.

Настоящее изобретение в своем первом аспекте относится к новому способу диагностики ПКРЛ, который представляет собой измерение содержания мРНК гена CALL. Сниженное содержание мРНК гена в предположительно пораженных раком тканях легкого человека по сравнению с его содержанием в нормальных/здоровых тканях служит диагностическим маркером ПКРЛ.

В одном из воплощений рак легкого, в отношении которого снижение содержания мРНК гена CALL служит в качестве диагностического маркера, является ПКРЛ.

В еще одном аспекте настоящее изобретение относится к способу диагностики ПКРЛ.

Данный способ включает следующие стадии:

а) получение исходной пары образцов тканей от пациента, где один из образцов получен из предположительно пораженных раком тканей, а второй получен из прилегающих гистологически нормальных («условно-нормальных») тканей;

б) выделение и очистка препаратов РНК из исходной пары образцов;

в) синтез одноцепочечной кДНК на матрице РНК с использованием олигонуклеотидных праймеров;

г) проведение количественной реакции амплификации фрагмента гена CALL с использованием кДНК, полученной на стадии в), в качестве матрицы и пары геноспецифичных олигонуклеотидных праймеров и зонда;

д) сравнение количества амплифицированного фрагмента ДНК CALL в образце, полученного из предположительно пораженных раком тканей легкого, с количеством амплифицированного фрагмента ДНК в образце, полученного из нормальных тканей, где указанные количества амплифицированного фрагмента ДНК отражают содержание мРНК гена CALL, причем его уменьшение служит диагностическим маркером ПКРЛ.

В отдельном предпочтительном воплощении данного изобретения последовательность праймеров и зонда представлена SEQ ID NO: 1, 2 и 3.

Еще одним аспектом настоящего изобретения является набор праймеров и зонда для осуществления полимеразной цепной реакции с целью определения содержания мРНК гена CALL, имеющий последовательности SEQ ID NO: 1, 2 и 3.

В следующем воплощении заявленного способа для ПКРЛ на стадии д) в качестве контрольного гена используют ген GAPDH, кодирующий белок глицеральдегид-3-фосфат-дегидрогеназу.

В следующем воплощении способа настоящего изобретения количественная реакция амплификации фрагмента гена CALL представляет собой ПЦР в режиме реального времени.

В отдельном предпочтительном воплощении данного изобретения в качестве дополнительных образцов сравнения использовали ткани легкого от доноров, не имеющих онкологических заболеваний.

Перечень фигур

Далее изобретение будет более подробно раскрыто со ссылкой на отдельные иллюстративные примеры и фигуры, где

Фиг. 1. Относительное содержание мРНК (R) гена CALL в образцах НМРЛ (№1-16 - образцы ПКРЛ, №17-29 - образцы других типов НМРЛ) и нормальных тканях легкого от здоровых доноров (№30-35). Фигура показывает, что снижение содержания мРНК гена CALL обнаружено в большинстве исследованных образцов ПКРЛ по сравнению с «условной нормой». Фигура также показывает, что в нормальных тканях содержание мРНК гена CALL, рассчитанное относительно усредненной «условной нормы» - Nср, изменялось незначительно и в среднем составило 1.0±0.5. Данные нормированы относительно контрольного гена GAPDH.

Таблица 1. Патоморфологическая характеристика исследованных опухолей легкого и данные ПЦР в реальном времени по изменению уровня мРНК (1/R) гена CALL в образцах НМРЛ (ПКРЛ и других типов) по сравнению с нормой.

Таблица 2. Частота (FD) и средний уровень снижения мРНК (LDср) гена CALL при НМРЛ.

Осуществление изобретения

Данное изобретение предлагает способ диагностики ПКРЛ на разных стадиях развития злокачественной трансформации, включая начальные, основанный на определении снижения содержания мРНК гена CALL. Достоверно обнаруживаемое различие содержания мРНК гена CALL в нормальных и опухолевых тканях может быть использовано для обнаружения ПКРЛ.

Образцы тканей для анализа

В качестве образцов легкого для проведения анализа могут быть использованы биоптаты, пунктаты или операционные образцы ткани.

Выделение РНК из образцов тканей

Способы выделения суммарной РНК из образцов тканей млекопитающих хорошо известны специалистам и, как правило, включают следующие стадии: измельчение в жидком азоте образцов опухолевых и нормальных тканей, лизис клеток, выделение РНК и ее очистку, проверку качества РНК электрофорезом в 1%-ном агарозном геле в присутствии красителя бромида этидия или в денатурирующем полиакриламидном геле, а также спектрофотометрическое определение количества РНК. Гомогенизацию кусочков тканей можно проводить вручную, растирая пестиком в керамической ступке, или с помощью механических гомогенизаторов, например, Omni Mixer или Micro-Dismembrator фирмы Sartorius (Германия). Для выделения РНК могут быть использованы различные протоколы, широко известные специалистам в данной области. В классических методах выделения РНК используют сильные хаотропные агенты, такие как гуанидинхлорид и гуанидинизотиоцианат, растворяющие белки, и последовательные экстракции фенолом и хлороформом для денатурации и удаления белков [Sambrook J., Fritsch E.F., Maniatis Т. 1989. Molecular Cloning. A laboratory Manual. 2nd Edition ed. Cold Spring Harbour: CSHL Press]. Широко используют также метод с использованием реагента Trizol [GIBCO/Life Technologies]. Для предотвращения разрушения РНК РНКазами могут быть использованы ингибиторы, такие как ингибитор RNAsin плацентарного или рекомбинантного происхождения или, например, ванадил-рибозидный комплекс - неспецифический ингибитор РНКаз широкого спектра действия.

Быстрое и качественное выделение РНК можно проводить с использованием ряда коммерчески доступных наборов (Клоноген, Санкт-Петербург; RNeasy kits, Qiagen, Голландия; SV Total RNA Isolation System, Promega, США и т.д.). Использование различных приборов, например, QuickGene-810 (Life Science, Япония), позволяет исключить работу с агрессивными агентами, ускорить и упростить выделение РНК. Для экстракции РНК в этом приборе используют 80 мкм пористую мембрану, которая в 12,5 раза тоньше обычно используемого в подобных приборах стеклянного фильтра (1000 мкм), что позволяет уменьшить деградацию РНК и увеличить ее выход.

Реакция обратной транскрипции: синтез кДНК на матрице РНК, выделенной из образцов тканей

Реакция обратной транскрипции, в результате которой на РНК-матрице синтезируют одноцепочечную цепь ДНК, при необходимости, с достройкой второй цепи, позволяет перейти от нестабильных молекул РНК к более стабильным молекулам ДНК. Дальнейшая ПЦР-амплификация позволяет использовать очень малые количества исходной РНК (на уровне нескольких нанограмм), а следовательно, и количества исследуемых легочных тканей, из которых выделяют РНК.

Реакцию обратной транскрипции можно проводить с использованием коммерчески доступных препаратов обратных транскриптаз, таких как обратная транскриптаза вируса лейкоза мышей Молони (M-MLV), вируса миелобластоза птиц (AMV), PowerScript (точечная мутация М-MLV-RT), C. Therm Polymerase и др., с помощью которых можно получать продукты амплификации длиною до нескольких тысяч и даже несколько десятков тысяч пар нуклеотидов (т.п.н.). Может быть использована термостабильная ДНК-полимераза Thermus thermophilus (Tth), обладающая обратной транскриптазной активностью в присутствии ионов Mn2+.

Для обратной транскрипции могут быть использованы различные праймеры, например:

1) Олиго(dT)n-содержащие праймеры связываются с эндогенным полиА-хвостом на 3′-конце мРНК (число n обычно равно 12-18, но может достигать и большей величины). Эти праймеры наиболее часто используют для получения полноразмерных кДНК. К олиго(dT)-последовательности часто добавляют на 3′-конце нуклеотиды А, С или G, чтобы «заякорить» праймер на границу транскрипта и поли-А тракта;

2) Случайные гексануклеотидные праймеры (статистические затравки) гибридизуются с РНК в многочисленных участках. При обратной транскрипции с этими праймерами получают короткие кДНК. Случайные гексамеры используют для преодоления трудностей, связанных с вторичной структурой РНК, они более эффективны при обратной транскрипции 5′-областей мРНК;

3) Гексамеры или другие короткие олигонуклеотиды (10-12 нуклеотидов) случайного состава могут быть также использованы в комбинации с олигоdT-содержащими праймерами;

4) Специфические олигонуклеотидные праймеры используют для транскрипции участка мРНК, представляющего интерес для исследования. Эти праймеры успешно применяют для диагностических целей.

Анализ содержания мРНК гена можно проводить, используя одноцепочечную или двуцепочечную амплифицированную кДНК. Для синтеза второй цепи и ее амплификации наиболее часто используют специфичные праймеры. В продаже имеются наборы для синтеза кДНК, основанные на применении различных обратных транскриптаз и различных праймеров для затравки. Для получения кДНК разработан также SMART-метод (switching mechanism at the 5′ end of RNA templates of reverse transcriptase), в основе которого лежит свойство обратных транскриптаз добавлять на 3′-конец синтезированной первой цепи кДНК несколько нуклеотидных остатков, преимущественно dC. Эта олиго(dC)-последовательность служит местом отжига олигонуклеотидного адаптера, имеющего комплементарную олиго(dG)-последовательность на 3′-конце. Обратная транскриптаза воспринимает праймер как продолжение РНК-матрицы и продолжает синтез первой цепи [Schmidt W.M., Mueller M.W. 1999. CapSelect: a highly sensitive method for 5′ CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs. Nucleic Acids Res. 27, е31]. Таким образом, первая цепь кДНК оказывается фланкирована с одной стороны последовательностью 3′-праймера с олиго(dT) на 3′-конце, а с другой - последовательностью, комплементарной адаптеру. Эти праймеры имеют одинаковые внешние последовательности, отличаясь только на 3′-конце. Затем первую цепь амплифицируют в ПЦР с праймером, соответствующим внешней части 3′-праймера и адаптера. Нуклеотидную последовательность общей части этих праймеров подбирают в зависимости от дальнейших целей, например получения клонотек, применения вычитающей гибридизации и т.д. В результате получают двухцепочечную ДНК, обогащенную полноразмерными последовательностями. За счет использования адаптера с заблокированным 3′-концом достигается существенное снижение фоновой амплификации. При использовании модифицированного SMART-метода за короткое время происходит амплификация исходного материала более чем в 105 раз, что позволяет работать с очень небольшими количествами РНК (меньше 1 нанограмма) и, следовательно, с небольшим количеством исследуемых тканей [Zhu Y.Y., Machleder Е.М., Chenchik А., Li R., Siebert P.D. 2001. Reverse transcriptase template switching: а SMART approach for full-length cDNA library construction. Biotechniques. 30, 892-897]. Наборы для получения кДНК этим способом выпускают различные фирмы, например, Евроген, Россия (набор MINT), Clontech, США и т.п.

Выбор специфических праймеров и зондов

Выбор специфических праймеров и зондов осуществляют способом, хорошо известным специалистам в данной области, для чего используют имеющиеся программы, многие из которых находятся в свободном доступе в Интернете. Среди таких программ можно упомянуть Oligo, PrimerSelect из пакета Lasergene (www.dnastar.com), Primer Express (Applied Biosystems, USA), Primer Designer (ИМБ РАН), FastPCR (http://www.biocenter.nelsinki.fi/bi/Programs/fastpcr.htm), PrimerQuest (http://scitools.idtdna.com/Primerquest/) и др. С учетом сложности анализируемого генома, длина праймеров может быть выбрана в диапазоне от 18 до 25 н. Оптимальный размер ампликона около 150 н. Подбор зондов для проведения ПЦР-РВ осуществляется в соответствии со стандартными рекомендациями и требованиями метода.

В предпочтительном воплощении используют праймеры и зонд:

Оценка содержания мРНК гена CALL методом ПЦР-РВ

Количественная оценка содержания мРНК достигается с помощью параллельного проведения ПЦР-РВ с тестируемым и контрольным образцами. Выбору подходящего контрольного гена для нормализации количественных данных посвящено много обзоров [Radonic А., Thulke S., Mackay I.M., Landt O., Siegert W., Nitsche А. 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochem Biophys Res Commun. 313, 856-862; Huggett J., Dheda K., Bustin S., Zumla A. 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes and Immunity. 6, 279-284; Wong М.L., Medrano J.F. 2005. Real-time PCR for mRNA quantification. BioTechniques. 39, 1-11]. Чаще всего в качестве контрольных выбирают гены «домашнего хозяйства», хотя для этой цели может быть использован любой ген с относительно постоянным уровнем транскрипции в исследуемых образцах. Однако вариабельность содержания мРНК необходимо проверять для каждой исследуемой выборки образцов данного типа тканей. Решение о выборе того или иного гена в качестве контрольного зависит также от степени выбранной/требуемой точности. Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов необходимо выбрать контрольный ген, имеющий незначительную вариабельность содержания мРНК в опухолевых и нормальных тканях легкого по сравнению с исследуемым геном.

В настоящем изобретении для образцов рака легкого в качестве контрольного гена выбран традиционный и часто используемый ген GAPDH (глицеральдегид-3-фосфат-дегидрогеназы). Согласно данным литературы и нашим данным, этот ген наиболее приемлем в качестве контрольного для образцов НМРЛ и нормальных тканей легкого [D.W. Liu, S.T. Chen, Н.Р. Liu. 2005. Choice of endogenous control for gene expression in nonsmall lung cancer. Eur. Respir. J. 26, 1002-1008; Е.А. Анедченко, А.А. Дмитриев, Г.С.Краснов, Т.Т. Кондратьева, Е.П. Копанцев, Т.В. Виноградова, М.В. Зиновьева, И.Б. Зборовская, Б.Е. Полоцкий, О.В. Сахарова, В.В. Кашуба, Е.Р. Забаровский, В.Н. Сенченко. 2008. Подавление экспрессии генов RBSP3/CTDSPL, NPRL2/G21, RASSF1А, ITGA9, HYAL1 и HYAL2 при немелкоклеточном раке легкого. Мол. биол., 42, №6, стр. 960-970].

Оценка содержания мРНК генов может быть основана на абсолютном и относительном измерении количества копий исследуемых транскриптов - абсолютный метод (метод абсолютной стандартной прямой) и относительный количественный анализ (ΔΔCt-метод). Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов в качестве основного метода измерений выбран второй из них, позволяющий проводить двойное сравнение данных для исследуемого и контрольного генов в опухоли и норме и не требующий выравнивания концентраций опухолевых и нормальных образцов РНК/кДНК, которое необходимо при использовании других методов, например, ОТ-ПЦР.

Выбор образцов сравнения

Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов важно проверить пригодность образцов сравнения, в данном случае «условных норм».

«Условной нормой» принято считать образец ткани с отсутствующими макро- и микроскопическими признаками опухолевого роста. При «непригодности» образца условно-нормальной ткани (т.е. в случаях, когда при микроскопии обнаруживали опухолевые клетки, или материал был трудно интерпретируемый) использовали усредненные нормы нескольких имеющихся «условных норм». Поскольку не для всех опухолевых образцов имелись пригодные парные «условные нормы», расчеты относительного количества копий транскрипта гена CALL (RкДНК) проводили, используя разные образцы сравнения - парные «условные нормы» и/или усредненные «условные нормы» от нескольких больных. Для рака легкого в качестве дополнительных образцов сравнения использовали также 6 образцов тканей легкого от здоровых доноров, для этих образцов усредняли значение ΔCt=Ct(CALL)-Ct(GAPDH) и далее проводили расчеты RкДНК.

Учет эффективностей реакций

Согласно предпочтительной форме осуществления количественной оценки изменения содержания мРНК генов необходимо учитывать значения эффективности проводимых реакций, которые могут оказать заметное влияние на конечный результат. Для этого нами разработана программа математической обработки экспериментальных данных ПЦР-РВ с расчетом эффективностей реакций [Программа для ЭВМ «Анализ транскрипции генов». Свидетельство о государственной регистрации №2008612585, 2008, Роспатент]. Программа совместима с файлами экспериментальных данных (Ct, ΔRn и др.) из программного обеспечения RQ, Relative Quantification (Applied Biosystems, АВI Prism SDS Software) и также позволяет проводить статистическую оценку достоверности измеряемых изменений и оценку пригодности выбранного контрольного гена.

Далее настоящее изобретение будет подробно проиллюстрировано со ссылкой на конкретные примеры, представляющие собой наиболее предпочтительные воплощения изобретения. Изобретение не ограничивается описанными воплощениями, напротив, предполагается, что оно включает любые альтернативы, модификации или эквиваленты, допустимые с учетом сущности и объема изобретения.

Пример 1. Образцы тканей

Образцы опухолевых тканей (Т), прилегающие к опухолям морфологически нормальные ткани (N) (т.н. «условные нормы») собраны и охарактеризованы в ФГБУ РОНЦ им Н.Н. Блохина РАМН. Образцы опухолевых тканей (опухоль, «условная норма») получены непосредственно после удаления опухоли. Каждый образец делили примерно на 3 равные части и хранили в жидком азоте.

Коллекция образцов тканей легкого подлежащих исследованию составила 29 образцов НМРЛ (10 - АК, 2 - БААК, 1 - ККРЛ, 16 - ПКРЛ), а также 29 образцов «условной нормы». Кроме того, использовали ткани легких, полученные постмортально от 6-ти человек, не имевших в анамнезе заболеваний раком (норма). Средний возраст больных с диагнозом НМРЛ, среди которых 24 мужчины и 5 женщин, составляет 60 лет (31-76 лет). Среди больных 15 человек имели метастазы в регионарные лимфатические узлы.

Пример 2. Выделение РНК из образцов тканей

РНК из нормальных и опухолевых тканей человека выделяли с использованием набора реагентов RNeasy Mini Kit («Qiagen», Голландия) согласно протоколу. Основные этапы включали: 1) разрушение ткани, замороженной в жидком азоте, с использованием микро-десмембратора («Sartorius», Германия) и гомогенизацию разрушенного образца в лизирующем буфере RLT в расчете 600 мкл на 30 мкг ткани. 2) центрифугирование 3 минуты при 14000 об/мин (4°C); 2) добавление равного объема водного 70% этилового спирта к супернатанту; 3) нанесение на колонку; 4) промывание колонки после сорбции РНК один раз буфером RW1 объемом 700 мкл и дважды буфером RPE объемом 500 мкл; 5) элюцию РНК водой, свободной от РНКаз. Концентрацию РНК определяли на спектрофотометре «NanoDrop ND1000», («NanoDrop Technologies Inc.», США) при длине волны 260 нм. Качество выделенной РНК проверяли с помощью электрофореза в 1% агарозе в присутствии бромистого этидия, а также на приборе Bioanalyser Agilent 2100 («Agilent Technologies», США).

Нуклеотидный состав ампликонов подтверждали секвенированием на автоматическом секвенаторе 3730 DNA Analyzer («Applied Biosystems», США). Секвенирование проводили отдельно с 5′ и 3′-концевого праймеров с использованием реактивов DYEnamic ET Terminator Cycler Sequencing Kit («Amersham», UK). Все праймеры и зонды были специфичны в условиях ПЦР-РВ, ампликоны имели ожидаемые нуклеотидные последовательности и размер.

Пример 3. Реакция обратной транскрипции

Для проведения реакции обратной транскрипции брали по 1 мкг РНК, полученной одним из двух вышеописанных методов с использованием наборов реагентов Trizol RNA Prep («Лаборатория Изоген») или реагентов RNeasy Mini Kit («Qiagen», Голландия), предварительно обработанной не содержащей РНКаз ДНКазой I (Invitrogene), 100 нг гексануклеотидных праймеров, 1 мМ dNTP, 1× реакционный буфер («Fermentas», Литва), содержащий 250 мМ Tris-HCl (pH 8.3, 25°C), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT, и 200 единиц обратной транскриптазы M-MuLV («Fermentas», Литва). Реакцию проводили в объеме 20 мкл при следующем температурном режиме: 25°C - 10 мин, 42°C - 60 мин, 50°C - 10 мин, 70°С -10 мин.

Пример 4. Подбор условий для количественной оценки содержания мРНК гена CALL в опухолях легкого

Использовали специфичные праймеры и зонды для гена CALL (SEQ ID NO: 1, 2, 3).

Последовательности выбранных праймеров и зондов для контрольного гена:

Прямой GAPDH_F 5′ - GGAGTCAACGGATTTGGTC - 3′

Обратный GAPDH_R 5′ - TGGGTGGAATCATATTGGAACAT - 3′

Зонд GAPDH_Z 5′ - [FAM] - CCCTTCATTGACCTCAACTACATGGTTTACAT - [RTQ1] - 3′

Для проведения ПЦР-РВ подобраны оптимальные концентрации праймеров и зондов исследуемого и контрольного генов. Концентрации праймеров варьировали в диапазоне 100-500 нМ при постоянной концентрации зондов равной 100 нМ, затем концентрацию зондов варьировали от 100 до 500 нМ при оптимальной концентрации праймеров. Для гена CALL оптимальные концентрации праймеров составили 300 нМ и зонда 400 нМ, для гена GAPDH концентрация праймеров - 300 нМ, зонда - 150 нМ.

Пример 5. Количественная оценка содержания мРНК гена CALL

Для количественных измерений использовали прибор ABI PRISM® 7000 Sequence Detection System, Applied Biosystems, США.

Протокол определения содержания мРНК гена CALL методом ПЦР-РВ

1. Готовили реакционные смеси для генов CALL и GAPDH, осторожно смешав все компоненты реакции, кроме матрицы (кДНК), из расчета 1 реакция объемом 25 мкл для каждого образца + 1 дополнительная реакция по 25 мкл.

Состав реакционной смеси для гена CALL:

Состав реакционной смеси для гена GAPDH:

2. В 96-луночную планшету добавляли по 20 мкл приготовленных реакционных смесей без матрицы.

3. Вносили по 5 мкл матрицы, плотно закрывали планшету пленкой.

4. Помещали планшету в приборное отделение, задавали названия ячеек, температурный режим для 40 циклов: 95°C - 10 мин - денатурация и активация фермента, 95°C - 15 сек - денатурация, 60°C - 1 мин - отжиг зонда и полимеризация, затем запускали прибор.

5. Реакции проводили в режиме относительных количественных измерений (программное обеспечение RQ, Relative Quantification, Applied Biosystems).

6. Нуклеотидный состав ампликонов подтверждали секвенированием на автоматическом секвенаторе 3730 DNA Analyzer («Applied Biosystems», США). Секвенирование проводили отдельно с 5′- и 3′-концевого праймеров с использованием реактивов DYEnamic ET Terminator Cycler Seguencing Kit («Amersham», UK).

Проводили математическую обработку данных ПЦР-РВ и представляли результаты в графическом и/или табличном виде.

Пример 6. Математическая обработка данных ПЦР-РВ

Данные ПЦР-РВ переносили в виде текстового файла в Microsoft Excel и проводили математическую обработку данных. Относительное содержание мРНК RкДНК (далее R), представляющее отношение количества копий исследуемой последовательности кДНК к количеству копий контрольной последовательности в опухоли (Т) по сравнению с нормой (N), связана с основными параметрами ПЦР-РВ пороговым циклом Ct и эффективностью реакции Е общим выражением [Бюллетень 2, http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf]

Интервал крайних значений R вычисляли с учетом рассчитанных отклонений Е для значений Ct:

i=1, 2, …, n, где n - число повторов реакции (в нашем случае n=3). При суммировании величин отклонения вычисляют по формуле:

j=1, 2, …, k, где k - число суммируемых величин.

Сравнивали частоту снижения содержания мРНК гена и уровень снижения мРНК-LD, равный 1/R и показывающий во сколько раз содержание мРНК гена снижено в опухоли по сравнению с нормой. Эффективность ПЦР-РВ (Е) для генов GAPDH и CALL рассчитывалась с помощью программы «Анализ Транскрипции Генов» [А.А. Дмитриев, Л.Л. Киселев, Г.С. Краснов, Н.Ю. Опарина, В.Н. Сенченко Программа для ЭВМ "Анализ транскрипции генов" (АТГ) Свидетельство о регистрации №2008612585, Роспатент]. В данной программе эффективность реакции рассчитывается по тангенсу угла наклона прямой, которая аппроксимирует кинетическую кривую на ее линейном участке с помощью метода наименьших квадратов. При дальнейшей обработке данных учитывали полученные значения эффективностей, которые составили в образцах легкого для гена CALL Еопухольнорма=(84±9)%, для гена GAPDH Еопухольнорма=(89±8)%. Статистическую значимость наблюдаемых изменений оценивали при помощи непараметрических тестов Уилкоксона и Манна-Уитни. Данные считали достоверными при Р<0,05, где Р - показатель статистической значимости данных.

Оценку содержания мРНК гена CALL выполнили на образцах кДНК, полученных из опухолей легкого, характеристика которых приведена в таблице 1. Вначале оценили содержание мРНК в образцах кДНК, полученных из нормальных тканей от здоровых доноров. Как видно из фиг. 1 (образцы №30-35), содержание мРНК (R) гена CALL, рассчитанное относительно усредненной «условной нормы» - Ncp, изменялось незначительно и в среднем составило 1.0±0.5. Далее оценили уровень снижения мРНК гена (LD, Level Decrease of mRNA), показывающий во сколько раз содержание мРНК гена снижено в опухоли по сравнению с нормальными тканями, а также частоту снижения уровня мРНК генов (FD, Frequency of Decrease of mRNA level).

ПКРЛ

В большинстве образцов ПКРЛ (81%, 13/16, Р<0.02) выявлено снижение содержания мРНК гена CALL (от 3-х до 44 раз) по сравнению с нормальными тканями (фиг. 1, образцы №1-16), табл. 2). Вариабельность уровня мРНК контрольного гена и уровня мРНК гена CALL в парных «условных нормах» не превышает 2-х раз, таким образом снижение уровня мРНК гена CALL от 3-х до 44-х раз позволяет достоверно детектировать снижение экспрессии в первичных образцах ПКРЛ и является надежным диагностическим маркером. Значение LDcp для всей выборки образцов ПКРЛ составило 11 раз. Значительное и частое снижение уровня мРНК гена обнаружено в опухолях от больных без метастазов в регионарные лимфоузлы, так и с метастазами. При ПКРЛ не обнаружено достоверных корреляций между частотой, степенью снижения содержания мРНК гена CALL и опухолевой прогрессией (размер опухоли, клиническая стадия, наличие метастазов в регионарные лимфатические узлы).

Другие типы НМРЛ

В отличие от ПКРЛ, в большинстве образцов (других типов НМРЛ (АК, БААК, ККРЛ, №17-29), снижение содержания мРНК гена CALL - не частое событие, и в большинстве образцов других типов НМРЛ в 54% (7/13) случаев наблюдали сохранение (фиг. 1, табл. 2), а также обнаружены редкие случаи превышения содержания его мРНК.

Сравнение уровня и частоты снижения мРНК гена CALL при ПКРЛ и других типах НМРЛ

Анализ данных показал, что подавление экспрессии гена CALL в образцах ПКРЛ более существенное и частое, чем в образцах других типов НМРЛ (11 раз и 81% против 7 раз и 38%, Р=0.01, тест Манна-Уитни). Таким образом, существенное и частое снижение содержания мРНК гена CALL является специфическим признаком ПКРЛ и не характерно для других типов НМРЛ.

Представленное выше подробное описание изобретения и его конкретных воплощений, приведенных в примерах со ссылкой на фигуры, предназначено исключительно для более полного уяснения сущности заявленного изобретения, но не для его ограничения. Специалисту будет ясно, что могут быть сделаны различные изменения, которые, тем не менее, будут соответствовать сущности и объему настоящего изобретения, которые определяются прилагаемой формулой изобретения.

Перечень последовательностей

SEQ ID NO 1

Прямой праймер

ДНК, 25 нуклеотидов

5′-GAACTATCCTTGCCAATGCCAATAT-3′

SEQ ID NO 2

Обратный праймер

ДНК, 21 нуклеотид

5′-CTTCTGCCAGGACACGACTGC-3′

SEQ ID NO 3

Зонд

ДНК, 31 нуклеотид

5′-[FAM]-TAAGAAAGCACTGTACCCAACCACTGTAGCG-[RTQ1]-3′

1. Способ диагностики плоскоклеточного рака легкого, включающий следующие стадии:
а) получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй получен из прилегающей гистологически нормальной ткани («условной нормы»);
б) выделение и очистка препаратов РНК из исходной пары образцов;
в) синтез одноцепочечной или двуцепочечной кДНК на матрице РНК с использованием олигонуклеотидных праймеров;
г) проведение количественной реакции амплификации фрагмента гена CALL с использованием кДНК, полученной на стадии в), в качестве матрицы, и пары геноспецифичных олигонуклеотидных праймеров и зонда с последовательностями SEQ ID NO: 1, 2 и 3;
д) сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани, где указанные количества амплифицированного фрагмента ДНК отражают изменение содержания мРНК гена CALL, причем уменьшение содержания мРНК гена CALL от 3-х до 44-х раз служит диагностическим признаком плоскоклеточного рака легкого.

2. Способ по п. 1, в котором последовательность праймеров и зонда представлена SEQ ID NO: 1, 2 и 3.

3. Способ по п. 1, в котором на стадии г) количественная реакция амплификации фрагмента гена CALL представляет собой ПЦР в режиме реального времени.

4. Способ по п. 1, в котором на стадии д) используется нормирование количества амплифицированного фрагмента гена CALL на количество амплифицированного фрагмента контрольного гена GAPDH, кодирующего белок глицеральдегид-3-фосфат-дегидрогеназу.

5. Способ по п. 1, отличающийся тем, что в качестве дополнительных образцов сравнения использовали ткани легкого от доноров, не имеющих онкологических заболеваний.



 

Похожие патенты:

Изобретение относится к аналитической химии и касается способа обнаружения наличия микробной биомассы земного типа. Сущность способа заключается в том, что получают тестируемый образец, о котором известно, что он содержит или может содержать микроорганизмы, помещают тестируемый образец в контейнер, отделяют от тестируемого образца компоненты тестируемого образца с микроорганизмами, проводят масс-спектрометрическое исследование компонентов тестируемого образца с микроорганизмами.
Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для оценки угрозы формирования фетоплацентарной системы и развития плода на фоне обострения цитомегаловирусной инфекции в третьем триместре гестации.

Изобретение относится к медицине, а именно к способу оценки риска развития патологии беременности. Сущность способа состоит в том, что в качестве биомаркеров оценки риска развития патологии беременности используют концентрацию гипоксантина, ксантина, мочевой кислоты, для чего сыворотку крови разводят дистиллированной водой, освобождают от белков, маскирующих определение биомаркеров риска развития патологии беременности.

Изобретение относится к медицине, а именно к диагностике, и может быть использовано для диагностики нарушения трансаминирования глутаминовой кислоты в синцитиотрофобласте плаценты беременных при обострении цитомегаловирусной инфекции на третьем триместре гестации.
Изобретение относится к медицине и касается способа получения продукта, содержащего иммуноглобулины G, A, M, при котором в качестве исходного сырья используют осадки фракции Кона, которые гомогенизируют с получением суспензии, которую обрабатывают хлороформом, перемешивают, выдерживают, центрифугируют, формируют осадок с последующим удалением балластных фракций дополнительным центрифугированием, выделяют целевой продукт с последующим розливом, замораживанием и высушиванием.

Изобретение относится к медицине, а именно к способу определения наследственной предрасположенности к нарушению барьерной функции кожи. Сущность способа состоит в том, что из венозной крови осуществляют выделение генетического материала.

Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для раннего иммунологического прогнозирования возникновения «малых повреждений миокарда» (МПМ) в послеоперационный период после проведения чрескожных коронарных вмешательств (ЧКВ) и стентирования коронарных артерий у пациентов с ишемической болезнью сердца (ИБС).

Изобретение относится к медицине, к актуальной проблеме современного здравоохранения, разделу педиатрии и может быть использовано для оценки тяжести поражения гепато-билиарной системы у младенцев и детей раннего возраста и степени выраженности фиброза печени.

Изобретение относится к области медицины, а именно к способу прогнозирования риска формирования хронической истинной экземы (ХИЭ) в зависимости от наследственной отягощенности у индивидуумов русской национальности, уроженцев Центрального Черноземья РФ.

Изобретение относится к медицине и представляет собой способ прогнозирования течения рассеянного склероза (PC) путем исследования крови, отличающийся тем, что из крови, взятой из вены, выделяют лейкоцитарную взвесь, затем из лейкоцитарной взвеси выделяют ДНК и методом ПЦР в режиме реального времени определяют наличие или отсутствие патологических аллелей в полиморфных вариантах генов rs1800629 (TNFα) и rs6074022 (CD40), причем при выявлении аллеля G полиморфного локуса rs1800629 (TNFα) и аллеля С полиморфного локуса rs6074022 (CD40) прогнозируют повышенную среднюю скорость прогрессирования рассеянного склероза.
Изобретение относится к области биотехнологии и предназначено для неинвазивной диагностики колоректального рака. Осуществляют забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК и определение целостности ДНК методом ПЦР-анализа.

Группа изобретений относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС) и способу выявления ЭДС.

Изобретения относятся к области биотехнологии и касаются набора синтетических олигонуклеотидных праймеров и способа его использования. Представленный набор включает две пары праймеров, имеющих следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′.

Изобретение относится к биотехнологии и молекулярной генетике. Способ предусматривает картирование положений ряда метилированных нуклеотидных последовательностей Pu(5mC)GPy в протяженной ДНК для построения эпигенетического профиля и выявления аномально метилированных участков ДНК.

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области биотехнологии, конкретно к влиянию мутаций гена KRAS на восприимчивость к химиотерапии, и может быть использовано в предсказании терапевтического эффекта химиотерапии.

Изобретение относится к области биохимии и может быть использовано при разработке методов молекулярно-генетической диагностики. Заявлен способ селективного отбора целевых участков ДНК.

Изобретение относится к области медицины, в частности к травматологии, и предназначено для прогнозирования нарушения консолидации при переломах костей конечностей.

Изобретение относится к биохимии. Описана выделенная молекула нуклеиновой кислоты для обнаружения вируса иммунодефицита человека (ВИЧ), которая содержит: 5′-agg pnn tgn atg pan tgg atg-3′ (SEQ ID NO: 10) или 5′-agg pnn tgn ntg ptn tgg atg-3′ (SEQ ID NO: 11) и набор, содержащий данную молекулу и инструкцию, где p = универсальный нуклеотид, который представляет собой 3-нитропиррол, 2′-дезоксинуклеозид и 5-нитроиндол или 6Н,8Н-3,4-дигидропиримидо[4,5-с][1,2]оксазин-7-он, и n = аналог цитидина, имеющий модификацию С-5.

Изобретение относится к области молекулярной генетики и микологии и предназначено для диагностики онихомикоза. Осуществляют выделение ДНК из биологического материала ногтей, проведение ПЦР и детекцию полученных результатов с помощью электрофореза в агарозном геле.

Изобретение относится к биохимии. Описан способ ПЦР-секвенирования, включающий следующие стадии: получение образца; амплификация; смешивание; фрагментация; секвенирование и сплайсинг. Настоящее изобретение также относится к праймерным меткам, используемым в указанном способе, а также к способу генотипирования, в частности, в анализе HLA. Настоящее изобретение также относится к ПЦР-праймерам для HLA-A/B, HLA-C и HLA-DQB1. Изобретение позволяет повысить длину продукта ПЦР, который может быть секвенирован секвенатором, без повышения цены и/или редукции. 3 н. и 16 з.п. ф-лы, 18 ил., 13 табл., 12 пр.
Наверх