Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции



Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции
Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции
Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции
Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции
Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции
Набор синтетических олигонуклеотидных праймеров и способ его применения для индикации вирусов иммунодефицита и лейкемии кошек в клиническом материале методом мультиплексной полимеразной цепной реакции

 


Владельцы патента RU 2586504:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Саратовский государственный аграрный университет имени Н.И. Вавилова" (RU)

Изобретения относятся к области биотехнологии и касаются набора синтетических олигонуклеотидных праймеров и способа его использования. Представленный набор включает две пары праймеров, имеющих следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′. Представленные праймеры не содержат полиндромные повторы нуклеотидов, не образуют выраженные вторичные структуры и не имеют протяженных G-C участков, а температуру отжига имеют 55°C для обеих пар олигонуклеотидов. Охарактеризованный способ включает подготовку реакционной смеси путем смешения буфера 10-кратного для ПЦР - 2,5 мкл, дНТФ (25 мМ) - 0,4 мкл, праймеров FIV F, FIV R, FeLV F и FeLV R (15 пмоль/мкл) по 1 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl2 (50 мМ) - 1,5 мкл, бидистиллированной воды - 11,4 мкл и пробы ДНК - 5 мкл, при этом амплификацию проводят в следующем режиме: тотальная денатурация 95°C - 3 мин, цикл денатурация (95°C - 20 или 60 сек) - отжиг (55°C - 20 или 60 сек) - элонгация (72°C - 40 или 60 сек), причем цикл денатурация-отжиг-элонгация повторяется 35 раз, заключительная элонгация 72°C - 5 мин, хранение 4°C - 10 мин, а детекция полученных результатов осуществляется методом электрофореза в 1,5%-ном агарозном геле. По наличию или отсутствию амплифицируемых фрагментов нуклеотидных последовательностей длиной 397 п.н. для FIV (feline immunodeficiency virus) и 221 п.н. для FeLV (feline leukemia virus) судят о наличии или отсутствии вирусов в организме кошки. Изобретения могут быть использованы в научных исследованиях для обнаружения генетического материала вирусов иммунодефицита - FIV и лейкемии FeLV кошек методом мультиплексной полимеразной цепной реакции (ПЦР) в крови животных. 2 н.п. ф-лы, 3 ил., 3 табл.

 

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярно-генетической диагностики вирусных болезней животных, и может быть использовано в научных исследованиях для обнаружения генетического материала вирусов иммунодефицита FIV (feline immunodeficiency virus) и лейкемии FeLV (feline leukemia virus) кошек методом мультиплексной полимеразной цепной реакции (ПЦР) в крови животных.

Возбудителей заболеваний - FIV и FeLV - относят к семейству Retroviridae. Данные вирусы характеризуются высокой степенью гомологии и сходным строением геномов: имеют три основных структурных гена, кодирующих вирусные протеины в следующем порядке: 5′-gag-pol-env-3′: gag (group specificanti gen - кодируют белки сердцевины), pol (кодируют обратную транскриптазу - polymerase и интегразу) и env (кодируют белки оболочки - envelope).

Внутри группы штаммов FIV, изолируемых от домашних кошек, можно различить 5 генетических вариантов, обладающих определенной вариабельностью геномов. Разделение на типы и подтипы осуществляется на основании анализа модификаций структуры гена env (Martins A.N. et all, 2008). FeLV также характеризуется значительной вариабельностью в структуре генов. По результатам анализа вирусных геномов наименее вариабельными оказались: ген gag FIV и область, расположенная непосредственно перед геном gag-pro-pol FeLV.

Схема жизненного цикла ретровирусов включает: связывание вириона с рецептором клетки хозяина, вход в клетку, обратное транскрибирование с образованием кДНК интеграцию в геном хозяина (формирование провируса) (Супотницкий М.В. Эволюционная патология. К вопросу о месте ВИЧ-инфекции и ВИЧ/СПИД-пандемии среди других инфекционных, эпидемических и пандемических процессов. - М.: Вузовская книга, 2009. - 400 с.). В соответствии с биологическими особенностями вирусов методы, направленные на выявление антител, менее информативны, чем те, что позволяют обнаружить сам вирус.

Вирусы лейкемии и иммунодефицита кошек могут долгие годы не проявлять себя в зараженном организме, делая его источником инфекции. Они передаются горизонтальным путем и вертикально, от матери к плоду. Часто данные болезни протекают сочетано, то есть одно животное является носителем обоих вирусов. Эти инфекции широко распространены как среди домашних, так и среди бродячих кошек (Красников А.В., Ларионова О.С., Марушева Ю.А. Анализ инфицированности кошек ретровирусными инфекциями в Саратовской области // Аграрный научный журнал №2, 2015. С. 14-16).

Вирусы являются лимфонейротропными, инфицирование приводит к глубокой иммуносупресии, проявляющейся развитием вторичных инфекций и опухолевых процессов. Животное всю жизнь находится на поддерживающей терапии. При этом схемы лечения вирусных лейкемии и иммунодефицита кошек различны, так как несмотря на то что вирусы поражают преимущественно лимфоциты, FIV вызывает иммунное заболевание - снижение популяции CD4-Т-лимфоцитов, а FeLV провоцирует онкологическое заболевание - клонирование вирусмодифицированных В-лимфоцитов (Сулимов А.А. Вирусные болезни кошек. - М.: КолосС, 2004. - С. 40-48, 66-70).

В России для диагностики этих инфекций есть две ПЦР-тест-системы, одна для выявления лейкоза, другая - иммунодефицита кошек (ООО ИнтерЛабСервис, Россия). Обе предназначены для проведения ПЦР в реальном времени. Прибор, на котором можно провести анализ, стоит от 2 миллионов рублей и выше. Это делает недоступной диагностику данных заболеваний для рядовых ветеринарных лечебниц и лабораторий. Там же, где есть такой прибор, один анализ стоит от 600 рублей. Учитывая то, что инфекционных агентов два и в ряде случаев исследование требуется повторить, владельцы не в состоянии оплатить качественную диагностику. Поэтому возникает необходимость разработки и внедрения в практику более доступных и экономичных методов.

Метод ПЦР является прямым высокочувствительным и высокоспецифичным методом, с помощью которого можно идентифицировать фрагменты провирусной ДНК FIV и FeLV в лимфоцитах периферической крови кошек. Специфичность метода обуславливают праймеры - олигонуклеотиды, которые фланкируют искомый участок, присоединяясь по принципу комплиментарности на денатурированную ДНК (отжиг), и, являясь затравкой для полимеразы, инициируют элонгацию новой цепи на искомом фрагменте ДНК. Основными параметрами эффективного прохождения реакции амплификации, обеспечивающими специфичность и чувствительность, являются правильный выбор области генома идентифицируемого агента, структура и температурный режим отжига праймеров.

Известен способ определения антител к FIV и FeLV в крови животных методом твердофазного иммуноферментного анализа (ELISA), основанный на обнаружении специфического комплекса антиген-антитело с помощью цветной реакции вследствие ферментирования субстрата энзимом, связанным с коньюгатом (BMC Vet Res. 2013; 9: 2. Comparison of the geographical distribution of feline immunodeficiency virus and feline leukemia virus infections in the United States of America (2000-2011). Bimal К Chhetri, Olaf Berke, David L Pearl, and Dorothee Bienzle). Недостатком метода является невысокая информативность в случае обследования вакцинированного животного (ложноположительные результаты) и на ранних этапах заражения, когда в крови не достаточно высокий уровень антител (ложноотрицательные результаты).

Известен способ выявления FIV в крови кошек методом one-step PCR, основанный на обнаружении ДНК провируса иммунодефицита кошек, а также способ выявления FeLV в крови кошек методом one-step RT-PCR, основанный на обнаружении РНК вируса лейкемии кошек (Vet Res Forum. 2014 Fall; 5(4): 255-61. Molecular and clinical study on prevalence of feline herpesvirus type 1 and calicivirus in correlation with feline leukemia and immunodeficiency viruses. Hamideh Najafi, Omid Madadgar, Shahram Jamshidi, Arash Ghalyanchi Langeroudi, and Mahdieh Darzi Lemraski). Недостатками метода являются многооперационность анализа, то есть необходимость постановки как минимум трех последовательных реакций на одном биоматериале для выявления вышеуказанных патогенов, причем каждого в отдельности.

Известен способ выявления FIV и FeLV в крови кошек методом Real-time PCR, основанный на обнаружении каждого из патогенов по отдельности с помощью двояко меченых флуоресцентных зондов (Красникова Е.С., Красников А.В., Агольцов В.А. Оценка диагностической ценности полимеразной цепной реакции и иммунохроматографического анализа при некоторых превалирующих ретровирусных инфекциях кошек // Аграрный научный журнал. 2013. №2. С. 23-25). Недостатками данного способа является невозможность выявления FIV и FeLV одновременно, что приводит к увеличению времени исследования и повышенному расходу материалов, кроме того, необходимость применения флуоресцентных зондов для учета результатов способствует удорожанию.

Наиболее близким к заявленному изобретению является способ, описанный в патенте RU №2340673 от 10.04.2007, опубликован 10.12.2008 г.: «Набор олигонуклеотидных праймеров для идентификации РНК вируса бешенства в образцах». В котором конструирование праймеров осуществлялось путем сравнения нуклеотидных последовательностей различных штаммов лиссавирусов, депонированных в международной базе данных GeneBank (http://www.ncbi.nlm.nih.gov/genbank). При этом были рассчитаны и синтезированы две пары олигонуклеотидных праймеров на консервативный район гена нуклеопротеина: Rab134F ATCGTRGAYCAATATGAGTACAAGTA, Rab1292R CNTCCATTCATCATGATTCG, Rab299F GCAATGCAGTTCTTTGAGGG и Rab857R TATCTCTTCTTCAAAGTTCTT, которые не имеют полиндромных повторов нуклеотидов, не образуют выраженных вторичных структур, не имеют протяженных G-C участков и имеют расчетную температуру плавления 52°C. Для апробации праймеров использовали следующие параметры ПЦР: 94°C 10 сек, 56°C 30 сек с понижением температуры на 1°C за цикл, 72°C 1 мин - 6 циклов, затем 94°C 10 сек., 50°C 15 сек, 72°C 30 сек. 35 циклов, завершающий синтез - 7 мин 72°C, обеспечивает синтез фрагментов ДНК рассчитанного размера (558 п.о.) в условиях ОТ-ПЦР. Специфичность продуктов амплификации подтверждали методом прямого секвенирования.

Но данный способ не предназначен для выявления вирусов бешенства у животных методом мультиплексной ПЦР и не может быть использован для обнаружения вирусов иммунодефицита и лейкемии из-за неспецифичности праймеров для FIV и FeLV, а также необходимо осуществлять реакцию обратной транскрипции перед постановкой ПЦР и секвенирование для учета результатов, что достаточно трудоемко и затратно.

Технической задачей является разработка эффективного, быстрого и недорогого способа обнаружения ДНК провирусов иммунодефицита и лейкемии кошек методом мультиплексной ПЦР путем конструирования двух специфических пар олигонуклеотидных праймеров и подбора условий для проведения мультиплексной ПЦР с ними.

Технический результат предлагаемого изобретения достигается за счет конструирования диагностического набора праймеров на консервативную область геномов FIV и FeLV и разработка способа их применения в мультиплексной ПЦР с учетом результата методом электрофореза в агарозном геле, что обеспечивает простоту, информативность и доступность исследований для рядовых лабораторий.

Указанный технический результат достигается созданием набора олигонуклеотидных праймеров для идентификации вирусов иммунодефицита и лейкемии кошек путем сравнения нуклеотидных последовательностей различных штаммов FIV и FeLV, депонированных в международной базе данных GeneBank. При этом на консервативных районах геномов FIV и FeLV, которые не имеют полиндромных повторов нуклеотидов, были рассчитаны и синтезированы две пары олигонуклеотидных праймеров, которые не образуют выраженных вторичных структур, не имеют протяженных G-C участков и отличаются тем, что имеют температуру отжига - 55°C для обоих пар олигонуклеотидов и следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′, с образованием в результате работы одной пары (FIV) фрагмента длиной 397 п.н., в результате работы другой пары (FeLV) - длиной 221 п.н. Для применения праймеров используют мультиплексную ПЦР, отличающуюся от прототипа тем, что отсутствует необходимость проводить ОТ, а также составом реакционной смеси, которая готовится путем смешения буфера 10-кратного для ПЦР - 2,5 мкл, дНТФ (25 мМ) - 0,4 мкл, праймеров FIV F, FIV R FeLV F и FeLV R (15 пмоль/мкл) по 1 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl2 (50 мМ) - 1,5 мкл, бидистиллированной воды - 11,4 мкл и пробы ДНК - 5 мкл. При этом амплификацию проводят в следующем режиме: тотальная денатурация 95°C - 3 мин, цикл денатурация (95°C - 20 или 60 сек) - отжиг (55°C - 20 или 60 сек) - элонгация (72°C - 40 или 60 сек), причем цикл денатурация-отжиг-элонгация повторяется 35 раз, заключительная элонгация 72°C - 5 мин., хранение 4°C - 10 мин. При этом детекция полученных результатов осуществляется методом электрофореза в 1,5%-ном агарозном геле, где по наличию или отсутствию амплифицируемых фрагментов нуклеотидных последовательностей длиной 397 п.н. для FIV и 221 п.н. для FeLV судят о наличии или отсутствии вирусов в организме кошек.

На фигуре 1 представлены схемы строения геномов вирусов иммунодефицита и лейкемии кошек, где показано, что вирусы содержат аналогичные гены и имеют примерно одинаковый размер геномов. На фигуре 1 овалом выделены области, на которых осуществлялось конструирование праймеров.

На фигуре 2 представлена электрофореграмма результатов исследования крови FIV и FeLV позитивных кошек методом мультиплексной ПЦР с использованием разработанных праймеров для определении размеров амплифицируемых фрагментов. Пробы 1, 4, 5, 7 и 8 являются FIV и FeLV положительными, а пробы 2, 3 и 6 содержат только ДНК FeLV.

На фигуре 3 представлена электрофореграмма результатов исследования клинического материала от кошек разработанным способом. Пробы 1, 2, 3, 4, 5, 9 - FIV и FeLV - положительные, пробы 6, 7, 10 содержат только ДНК FeLV, проба 8 - отрицательная.

Конструирование двух пар синтетических олигонуклеотидных праймеров, применяемых для выделения ДНК провирусов иммунодефицита и лейкемии кошек, и разработка способа диагностики вирусного иммунодефицита и лейкемии кошек с их использованием осуществлялись в пять этапов:

- анализ структуры геномов FIV и FeLV;

- конструирование праймеров;

- подбор оптимально сочетающихся между собой двух пар праймеров;

- моделирование состава реакционной смеси способа диагностики вирусных иммунодефицита и лейкемии кошек с использованием подобранных пар праймеров;

- проверка эффективности работы подобранных праймеров с клиническим материалом.

Анализ структуры геномов FIV и FeLV. Анализ геномных последовательностей FIV и FeLV, размещенных на ресурсе NCBI, осуществлялись методом компьютерного моделирования с применением авторских компьютерных программ: «Нуклеотидные последовательности и характеристики геномов, вариабельных тандемных повторов, олигонуклеотидных праймеров и зондов штаммов возбудителей бактериальных и вирусных инфекций I-II групп патогенности» (Свидетельство о госрегистрации базы данных №2011620585 (авторы - Яшечкин Ю.И., Найденова Е.В., Щербакова С.А.)) и «Программа расчета олигонуклеотидных праймеров на гомологичных геномах РНК-содержащих вирусов для их выявления в ПЦР и формирования базы данных» (Свидетельство о госрегистрации программ для ЭВМ №2013613699 (авторы - Яшечкин Ю.И., Найденова Е.В., Щербакова С.А.)). Выравнивание геномных последовательностей осуществлялось методом ClustaW, кластерное дерево моделировали методом UPGMA.

Конструирование праймеров. С помощью компьютерной программы GeneRunner, геном вирусов в формате FASTA применяли для подбора праймеров на участке гена gag FIV и на участке, расположенном непосредственно перед геном gag-pro-pol FeLV, как наиболее консервативных областях геномов данных вирусов.

Подбор оптимально сочетающихся между собой двух пар праймеров. Проверку качества и термодинамический анализ выбранных праймеров выполняли с помощью программ OLIGO DNA/RNA primer analysis software, v. 5.0. (http://molbiol-tools.ca/molecular_biology_freeware.htm#Primer%20design) и BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). При дизайне праймеров основными требованиями были: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри праймеров и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига и плавления праймеров.

На основании проведенного компьютерного анализа была подобраны две пары праймеров, характеристики которых приведены в таблице 1.

Подобранные две пары олигонуклеотидных праймеров (FIV F и FIV R; FeLV F и FeLV R) имеют оптимальные размер (22-24 н.) и структуру (отсутствие само- и взаимокомплементарности), о чем свидетельствуют показатели энергии Гиббса на 3′ конце (0 cal/mol) и энергии Гиббса димерных структур (-1 cal/mol), оптимальный GC состав (42%) и температуру отжига для обоих пар праймеров 55°C. В результате работы одной пары (FIV F и FIV R) образуется фрагмент длиной 397 п.н., в результате работы другой пары (FeLV F и FeLV R) - длиной 221 п.н., GC состав продуктов 40% и 56% соответственно, температура плавления продукта 74°C и 79°C соответственно.

Моделирование состава реакционной смеси способа диагностики вирусных иммунодефицита и лейкемии кошек с использованием подобранных пар праймеров. Выделение и очистку нуклеиновых кислот из крови кошек осуществляли методом нуклеосорбции на силикогеле с использованием набора «ДНК-сорб-В» (ООО ИнтерЛабСервис, Россия). ПЦР проводили в объеме реакционной смеси - 25 мкл на 1 пробу. Состав реакционной смеси представлен в таблице 2.

Состав реакционной смеси подбирали таким образом, чтобы концентрация ионов MgCl2 (1,5 мМ) обеспечивала оптимальную скорость и точность работы фермента Taq-полимеразы, концентрация дНТФ - 0,4 мМ, концентрация праймеров - 15 пмоль/мкл и объем пробы - 5 мкл, что способствует повышению специфичности реакции. При использовании амплификатора с крышкой без нагрева на смесь наслаивают 20 мкл минерального масла для ПЦР. При использовании амплификатора с нагревающейся крышкой минеральное масло не используется.

Проведение ПЦР с использованием разработанных праймеров осуществляли на амплификаторах «АМПЛИ 4» («Биоком», Россия) и «Т100» («BioRad», США). Температурно-временной режим проведения реакции для амплификаторов представлен в таблице 3.

Для амплификаторов с активным регулированием температуры по раствору в пробирке, например «Т100», время прохождения всех этапов амплификации (денатурация-отжиг-элонгация) короче, чем для амплификатора с матричным регулированием температуры, например «АМПЛИ 4».

Учет осуществляли методом гельэлектрофореза в 1,5% агарозном геле с добавлением бромистого этидия в качестве интерколирующего красителя для ДНК. Результат учитывали на оборудовании фирмы «BioRad» (США). Для определения размера ампликонов после проведения ПЦР с разработанными праймерами использовали маркер молекулярных масс «1 kb DNA ladder» («Stratagene», США) (фиг. 2). В электрофоретических дорожках проб 1, 4, 5, 7 и 8 присутствуют светящиеся полосы на уровнях 397 п.н. и 221 п.н., что свидетельствует о наличии в пробах ДНК провирусов FIV и FeLV. В электрофоретических дорожках проб 2, 3 и 6 присутствуют светящиеся полосы только на уровне 221 п.н., что свидетельствует о присутствии в пробах только ДНК провируса FeLV.

Проверка эффективности работы подобранных праймеров с клиническим материалом. В качестве положительного контроля использовали ДНК, выделенную из крови кошек, у которых наличие FIV и FeLV были подтверждены методом иммунной хроматографии (Animal Genetics, inc., Корея) и Real-time PCR (ООО ИнтерЛабСервис, Россия). Для исследования брали пробы крови от кошек, подозрительных в заражении вирусным иммунодефицитом и лейкемией (фиг. 3). Пробы 1, 2, 3, 4, 5, 9 - содержат ДНК провирусов FIV и FeLV, электрофоретическая подвижность ампликонов которых 397 п.н. и 221 п.н. соответственно и совпадает с размерами ампликонов положительного контроля (К+). Пробы 6, 7, 10 содержат только ДНК провируса FeLV, электрофоретическая подвижность ампликонов которого 221 п.н., проба 8 - отрицательная. В электрофоретической дорожке, соответствующей отрицательному контролю (К-), полосы отсутствуют.

Заявленное изобретение является доступным по стоимости, достоверным, высокочувствительным и высокоспецифичным способом выявления фрагментов провирусной ДНК вирусов иммунодефицита и лейкемии кошек в лимфоцитах крови животных в короткие сроки. При этом компьютерный анализ показал отсутствие реакции на гомологичные и гетерологичные организмы.

Предложенный способ апробирован с положительными результатами и регулярной воспроизводимостью этих результатов в 2015 году на 18 пробах ДНК, полученных из крови кошек, принадлежащих частным владельцам и обращавшимся в УНИЦ «Ветеринарный госпиталь» ФГБОУ ВПО «Саратовский ГАУ». Работу проводили на базе межкафедральной учебно-научно-исследовательской лаборатории «Геном» ФГБОУ ВПО «Саратовский ГАУ» и ФКУЗ РосНИПЧИ «Микроб» (г. Саратов).

1. Набор синтетических олигонуклеотидных праймеров, применяемых для выделения ДНК провирусов иммунодефицита и лейкемии кошек, полученных с помощью компьютерных программ, путем анализа структуры вирусов, выбора консервативных участков вирусных геномов, подбора двух оптимальных пар праймеров, у которых отсутствуют полиндромные повторы нуклеотидов, которые не образуют выраженных вторичных структур, и не имеют протяженных G-C участков и отличаются тем, что имеют температуру отжига - 55°С для обоих пар олигонуклеотидов и следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′, с образованием в результате их использования фрагмента длиной 397 п.н. для FIV и 221 п.н. для FeLV.

2. Способ диагностики вирусных иммунодефицита и лейкемии кошек с использованием двух пар синтетических олигонуклеотидных праймеров, заключающийся в проведении мультиплексной ПЦР, отличающийся тем, что отсутствует необходимость проводить ОТ, реакционная смесь готовится путем смешения буфера 10-и кратного для ПЦР - 2,5 мкл, дНТФ (25 мМ) - 0,4 мкл, набора праймеров по п. 1 (15 пмоль/мкл) по 1 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl2 (50 мМ) - 1,5 мкл, бидистиллированной воды - 11,4 мкл и пробы ДНК - 5 мкл, при этом амплификацию проводят в следующем режиме: тотальная денатурация 95°С - 3 мин, цикл денатурация (95°С - 20 или 60 сек) - отжиг (55°С - 20 или 60 сек) - элонгация (72°С - 40 или 60 сек), причем цикл денатурация-отжиг-элонгация повторяется 35 раз, заключительная элонгация 72°С - 5 мин, хранение 4°С - 10 мин, а детекция полученных результатов осуществляется методом электрофореза в 1,5%-ном агарозном геле, где по наличию или отсутствию амплифицируемых фрагментов нуклеотидных последовательностей длиной 397 п.н. для FIV и 221 п.н. для FeLV судят о наличии или отсутствии вирусов в организме кошки.



 

Похожие патенты:

Изобретение относится к биотехнологии и молекулярной генетике. Способ предусматривает картирование положений ряда метилированных нуклеотидных последовательностей Pu(5mC)GPy в протяженной ДНК для построения эпигенетического профиля и выявления аномально метилированных участков ДНК.

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области биотехнологии, конкретно к влиянию мутаций гена KRAS на восприимчивость к химиотерапии, и может быть использовано в предсказании терапевтического эффекта химиотерапии.

Изобретение относится к области биохимии и может быть использовано при разработке методов молекулярно-генетической диагностики. Заявлен способ селективного отбора целевых участков ДНК.

Изобретение относится к области медицины, в частности к травматологии, и предназначено для прогнозирования нарушения консолидации при переломах костей конечностей.

Изобретение относится к биохимии. Описана выделенная молекула нуклеиновой кислоты для обнаружения вируса иммунодефицита человека (ВИЧ), которая содержит: 5′-agg pnn tgn atg pan tgg atg-3′ (SEQ ID NO: 10) или 5′-agg pnn tgn ntg ptn tgg atg-3′ (SEQ ID NO: 11) и набор, содержащий данную молекулу и инструкцию, где p = универсальный нуклеотид, который представляет собой 3-нитропиррол, 2′-дезоксинуклеозид и 5-нитроиндол или 6Н,8Н-3,4-дигидропиримидо[4,5-с][1,2]оксазин-7-он, и n = аналог цитидина, имеющий модификацию С-5.

Изобретение относится к области молекулярной генетики и микологии и предназначено для диагностики онихомикоза. Осуществляют выделение ДНК из биологического материала ногтей, проведение ПЦР и детекцию полученных результатов с помощью электрофореза в агарозном геле.

Изобретение относится к области медицины и предназначено для ПЦР-детекции Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens и Eggerthella spp. в клиническом материале.

Изобретение относится к области молекулярной биологии и медицины, в частности к онкологии. Из образца опухолевой ткани головного мозга выделяют суммарный пул РНК (в том числе содержащий и микроРНК) любым из известных способов.

Предложенная группа изобретений относится к области медицины. Предложен способ неинвазивной пренатальной диагностики анеуплоидий плода, включающий выделение внеклеточной ДНК из образца крови беременной женщины, приготовление геномных библиотек и их обогащение регионами генома, секвенирование, картирование полученных чтений на референсный геном, корректировку полученного значения покрытия для каждого региона генома на общее покрытие генома, сравнение скорректированного значения покрытия со значениями покрытий, полученных для обучающей выборки и определение наличия анеуплоидий плода.

Изобретение относится к области биотехнологии, в частности к генетической инженерии, и может быть использовано в медико-биологической промышленности. .

Изобретение относится к области биохимии, в частности к трансгенному растению, которое демонстрирует увеличенную биомассу по сравнению с аналогом дикого типа или нетрансформированным растением, содержащему трансген глутамин-фенилпируват-трансаминазы и трансген глутаминсинтетазы, где каждый GPT трансген и GS трансген операбельно связан с растительным промотором, а также к семени для его получения.

Изобретение относится к области биохимии. Заявлена генная экспрессионная кассета, которая содержит ДНК-конструкт, в котором промотор, ген, который должен быть экспрессирован, и последовательность добавления поли А связаны в таком порядке; а также содержит энхансер(ы) или энхансер(ы) с UAS, лигированным с его частью выше по ходу транскрипции, которые включают, по меньшей мере, один энхансер hTERT, где указанный(указанные) энхансер(ы) или указанный(указанные) энхансер(ы) с UAS лигирован(ы) непосредственно ниже по ходу транскрипции от последовательности добавления поли А.

Группа изобретений относится к области биохимии. Предложена конструкция нуклеиновой кислоты, содержащая кластер генов биосинтеза пирипиропена и маркерный ген.

Изобретение относится к иммунологии. Предложено гуманизированное антитело против Аβ-олигомера, которое не связывается с Аβ-мономерами, характеризующееся наличием вариабельной области тяжелой цепи и вариабельной области легкой цепи.

Изобретение относится к биотехнологии. Предложена рекомбинантная ДНК, обеспечивающая в составе плазмидного вектора синтез в клетках E.coli химерного белка аполипопротеина Α-I человека, размером 852 п.н.

Группа изобретений относится к области биохимии. Предложен способ окисления органического вещества.

Изобретение относится к области биотехнологии, конкретно к химерным полипептидам фактора роста фибробластов (FGF), и может быть использовано в медицине для лечения ожирения, диабета, высокого содержания глюкозы в крови, метаболического синдрома и гиперхолестеринемии.

Группа изобретений относится к биохимии. Предложена липидная частица для доставки нуклеиновой кислоты (варианты), способ введения нуклеиновой кислоты в клетку, способ изготовления липидных частиц, включающих нуклеиновую кислоту.

Настоящее изобретение относится к области биохимии. Предложены способы скрининга антитела IgG, обладающего повышенной способностью элиминировать антиген в плазме, основанные на отборе IgG, антигенсвязывающая активность которого при рН от 6,7 до 10,0 выше антигенсвязывающей активности при рН от 4,0 до 6,5.
Наверх