Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля



Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля
Лечения рака и опухоли, стимулируемое высвобождением тепла, вырабатываемого различными цепочками магнитосом, выделенных из магнетотаксических бактерий и подвергнутых воздействию переменного магнитного поля

 


Владельцы патента RU 2593331:

НАНОБАКТЕРИ (FR)

Изобретение относится к фармацевтической промышленности, а именно к применению цепочек бактериальных магнитосом для лечения опухоли. Применение цепочек бактериальных магнитосом для лечения опухоли при помощи термотерапии, где указанные цепочки бактериальных магнитосом имеют следующие свойства: содержат по меньшей мере 2 магнитосомы с размерами, лежащими в диапазоне от 10 до 120 нм; кристаллографические направления большей части магнитосом, принадлежащих указанным цепочкам, ориентированы в направлении удлинения цепочки, изолированы из магнетотактических бактерий, которые культивировались в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент. Способ лечения опухоли, где цепочки магнитосом подвергают воздействию переменного магнитного поля для того, чтобы вызвать выработку тепла. Набор для лечения опухоли, содержащий цепочки бактериальных магнитосом. Способ получения цепочек бактериальных магнитосом. Цепочки бактериальных магнитосом для лечения опухоли. Лекарственное средство для лечения опухоли, содержащее цепочки бактериальных магнитосом. Применение вышеописанных цепочек бактериальных магнитосом позволяет эффективно лечить опухоли. 6 н. и 39 з.п. ф-лы, 18 ил., 7 пр.

 

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к лечению теплом in vivo клеток или тканей, главным образом опухоли (опухолей) или опухолевых клеток, с применением тепла, вырабатываемого in situ магнитными элементами, подвергнутыми воздействию переменного магнитного поля. Изобретение относится, в частности, к термотерапии с применением гипертермии или термоабляции. Тип магнитных элементов, описанных в настоящем раскрытии, представляет собой цепочку наночастиц оксида железа, синтезированных посредством биологического процесса.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение описывает термотерапию, которая может применяться для разрушения злокачественной опухоли (опухолей) или раковых клеток. Тепло вырабатывается цепочками бактериальных магнитосом, которые выделяют из магнетотактических бактерий. Цепочки магнитосом, применяемые в термотерапии, можно получать, культивируя бактерии при различных условиях, указанных далее:

(1) Магнетотактические бактерии (например АТСС 700274) культивируют в стандартной питательной среде (например, в среде АТСС 1653 или питательной среде, схожей со средой АТСС 1653, пригодной для выращивания штамма АТСС 700274).

(2) Магнетотактические бактерии культивируют в питательной среде, которая содержит стандартную питательную среду, такую как указана в п.(1), и, предпочтительно, добавку, которая является переходным металлом. Примерами переходных металлов, которые могут применяться, служат кобальт, никель, медь, цинк, магний и хром.

(3) Магнетотактические бактерии культивируют в питательной среде, которая содержит стандартную питательную среду, такую как указана в п.(1), и, предпочтительно, добавку, которая является хелатирующим агентом. Под хелатирующим агентом предпочтительно подразумевается органическое соединение, которое является монодентатным или полидентатным лигандом, способным образовывать комплекс с катионами, производными от железа или любого другого переходного металла.

(4) Магнетотактические бактерии культивируют в питательной среде, которая содержит стандартную питательную среду АТСС, такую как указана в п.(1), и две добавки, указанные в пп.(2) и (3).

Присутствие добавок в бактериальной питательной среде приводит к улучшению теплопроизводительности магнитосом (как в растворе, так и in vivo). Выделенные цепочки магнитосом, полученные путем синтеза бактериями при культивировании в одной из четырех различных питательных сред, описанных в пп.(1)-(4), также могут быть инкапсулированы внутри липидной везикулы в присутствии или в отсутствие активного компонента и применены как таковые для термотерапии.

Предпосылки:

В последнее время значительные усилия были посвящены синтезу магнитных наночастиц, которые способны индуцировать выработку тепла при воздействии на них переменного магнитного поля (Duguet et al., Nanomed., 2006, 1, 157-168) и которыми можно легко манипулировать, применяя магнитные поля. Эти особенности привели к идее, что магнитные наночастицы могут быть полезны для разрушения или уничтожения опухолей посредством гипертермии или термоабляции, или что они могут применяться для высвобождения лекарственных средств в специфически расположенных областях организма. Эту область исследований часто обозначают как гипертермию с применением переменного магнитного поля (ПМП), так как она требует приложения переменного магнитного поля для индукции выработки наночастицами тепла. В предшествующих исследованиях тепло индуцировали с применением химически синтезированных наночастиц, в основном в форме суперпарамагнитных наночастиц оксида железа (SPION), которые либо смешивали в растворе, либо смешивали с клетками, либо вводили в живой организм. Также была проведена оценка противоопухолевой активности этих нагретых наночастиц как в моделях на животных, так и в клинике с участием людей. Обзор проведенной ранее работы представлен в литературных источниках, перечисленных далее (Bae et al., J. Controlled Release, 2007, 122, 16-23; Ciofani etal., Med. Hypotheses, 2009, 73, 80-82; De Nardo, Clin. Cancer Res., 2005, 11, 7087s-7092s; De Nardo et al., J.Nucl. Med, 2007, 48, 437-444; Higler et al., Radiology, 2001, 218, 570-575; Ito et al., Cancer. Sci., 2003, 94, 308-313; Ito et al., J. Biosci. Bioeng., 2003, 96, 364-369; Ito et al, Cancer Lett, 2004, 212, 167-175; Ito et al., Cancer Immunol. Immun., 2006, 55, 320328; Johannsen et al., Int. J. Hyperthermia, 2005, 21, 637-647; Johannsen et al., Int. J. Hyperthermia, 2007, 52, 1653-1662; Jordan et al., Int. J. Hyperthermia, 1993, 9, 51-68; Kawai et al., Prostate, 2005, 64, 373-381; Kawai et al., Prostate, 2008, 68, 784-792; Kikumori et al., Breast Cancer Res. Treat, 2009, 113, 435-441, Maier-Hauff et al., J. Neurooncol., 2007, 81, 53-60; Oberdorster et al., Environ. Health Persp., 2005, 113, 823-839; Ponce et al., Int. J. Hyperthermia, 2006, 22, 205-213; Tai et al., Nanotechnology, 2009, 20, 135101; Thisen et al., Int. J. Hyperthermia, 2008, 24, 467-474).

В настоящее время имеются по меньшей мере три компании, которые занимаются разработкой терапии рака с применением тепла, вырабатываемого магнитными наночастицами при воздействии на них переменного магнитного поля. Это компании Sirtex (Австралия), Magforce (Германия) и Aspen Medisys (США, ранее: Aduro Biotech и Triton Biosystem). Образцы, опубликованные этими компаниями, описывают различные способы применения тепла, вырабатываемого химически синтезированными магнитными наночастицами, для терапии рака (Sirtex: US 2006167313 или WO 2004/064921; Triton Biosystems, сейчас - Aspen Medisys, LLC: US 2003/0028071; Magforce: US 2008/0268061).

Несмотря на то, что был достигнут существенный прогресс в области терапии рака с применением наночастиц, возникли проблемы, связанные с токсическими явлениями, которые вызывало присутствие химически синтезированных наночастиц в организме (Habib et al., J. Appl. Phys., 2008, 103, 07A307-1-07A307-3). Для минимизации возможных побочных эффектов, возникающих во время клинического применения, количество вводимых наночастиц должно быть настолько мало, насколько это возможно, в то же время с сохранением их необходимого эффекта. Для этого магнитные наночастицы должны вырабатывать достаточно большое количество тепла, т.е., обладать достаточной удельной мощностью поглощения (УМП).

Следовательно, имеется потребность в магнитных наночастицах, обладающих более высокой теплопроизводительностью, чем обычно достигается при применении химически синтезированных наночастиц. Это будет полезно для снижения количества магнитного материала, необходимого для нагревания биологической ткани или клетки. Такого эффекта можно достигнуть, применяя наночастицы либо с большими объемами, либо с высокой магнитокристаллической анизотропией (Hergt et al., J. Phys. Condens. Matter, 2006, 18, S2919-S2934).

Также имеется потребность в разработке магнитных наночастиц, которые могут обладать такими полезными особенностями и способностью нацеливаться на ткань или клетку.

Частично благодаря их большому объему, магнитосомы, синтезируемые магнетотактическими бактериями, вырабатывают большее количество тепла, чем химически синтезированные наночастицы, при воздействии на них переменного магнитного поля. Это было показано для бактериальных магнитосом, смешанных в растворе (Hergt et al., J. Phys. Condens. Matter, 2006, 18, S2919-S2934; Hergt et al., J. Magn. Magn. Mater., 2005, 293, 8086; Timko et al., J. Mag. Mag. Mat, 2009, 321, 1521-1524). В вышеуказанных литературных источниках не был явно указан тип бактериальных магнитосом, применяемых для проведения экспериментов.

Магнитосомы - это внутриклеточные, связанные с мембраной, имеющие нанометровые размеры, с единичным магнитным доменом кристаллы оксида железа (магнитида, Fe3O4) или сульфида железа (грейгита, FeS4), которые синтезируются магнетотактическими бактериями. Магнитосомы состоящие из магнетита, могут окисляться до маггемита после выделения из бактерий. Магнитосомы обычно собраны внутри бактерии в цепочку, но можно также обнаружить единичные магнитосомы. Как полагают, бактерии используют магнитосомы для навигации в геомагнитном поле Земли, и они помогают бактериям обнаруживать и поддерживать оптимальные условия для их роста и выживания (Bazylinski et al., Nat. Rev. Microbiol., 2004, 2, 217-230). Показано, что магнитосомы и кристаллы магнетита в магнитосомах полезны для ряда научных, коммерческих и лечебных применений. Например, их можно применять для обнаружения однонуклеотидного полиморфизма, для выделения ДНК или для обнаружения биомолекулярных взаимодействий с помощью магнитных свойств. Они также могут применяться при иммуноанализе и анализе связывания с рецепторами или при разделении клеток (Arakaki et al., J. R. Soc. Interface, 2005, 5, 977-999). Было высказано предположение, что бактериальные магнитосомы можно внедрить внутрь липосом для целей доставки лекарственных средств (номер образца US6251365B1). Однако в этом образце приведено очень мало экспериментальных доказательств, и не была продемонстрирована или предположена способность таких липосом к нагреванию. Противораковая активность комплекса, образованного бактериальными магнитосомами и доксорубицином, была показана экспериментально (Sun et al., Cancer Lett, 2007, 258, 109-117). В этом случае противораковую активность обеспечивало присутствие доксорубицина, а не воздействие, вызванное теплом. Наконец, не было доказано, что бактериальные магнитосомы полезны для термической обработки in vitro или in vivo опухоли или раковых клеток.

В заключение, в двух недавних исследованиях кратко рассматривается проблема, вызванная возможной токсичностью бактериальных магнитосом у крыс, и не сообщается о каких-либо признаках токсичности (Sun et al., J. Nanosci. Nanotechnol., 2009, 9, 1881-1885; Sun et al, Sun et al, Nanotoxicology, 2010, 4, 271-283).

Описание изобретения

Различные типы бактериальных магнитосом (организованных в цепочки или нет и содержащихся внутри бактерий или выделенных из бактерий) могут быть эффективны для выработки тепла в растворе при воздействии на них переменного магнитного поля. Однако, как продемонстрировано в настоящем раскрытии, только магнитосомы, организованные в цепочки и выделенные из магнетотактических бактерий, обеспечивают эффективную противоопухолевую активность. Действительно, были также изучены бактериальные магнитосомы, содержащиеся внутри сохраняющих целостность магнетотактических бактерий АМВ-1, и единичные магнитосомы (выделенные из бактерий и обработанные додецилсульфатом натрия (ДСН) при нагревании). Несмотря на их хорошую способность к выработке тепла в растворах, эти два типа бактериальных магнитосом, по-видимому, не обладают или обладают в намного меньшей степени противоопухолевой активностью in vivo, чем цепочки магнитосом по изобретению. Выявление влияния организации бактериальных магнитосом в цепочки на эффективность термотерапии является важным достижением настоящего изобретения.

Настоящее изобретение относится к лечению in vivo тканей или клеток, главным образом опухоли (опухолей) или опухолевой клетки (клеток), с применением тепла, вырабатываемого in situ цепочками магнитосом, которые изолированы и выделены из цельных магнетотактических бактерий. Опухоль, которая может быть подвергнута лечению, предпочтительно является солидной опухолью. Эти цепочки могут применяться как таковые или инкапсулированные внутри везикулы. Тепло вырабатывается путем воздействия на цепочки магнитосом переменного магнитного поля (также называемого осциллирующим магнитным полем).

Настоящее изобретение также относится к цепочкам магнитосом для применения при лечении опухоли (опухолей) путем термотерапии, предпочтительно солидной опухоли. Цепочки могут применяться как таковые или инкапсулированные внутри везикулы.

Настоящее изобретение также относится к цепочкам магнитосом, выступающих в качестве лекарственного средства, главным образом в качестве лекарственного средства для противоопухолевого лечения. Цепочки могут применяться как таковые или инкапсулированные внутри везикулы.

Изобретение также относится к применению цепочек магнитосом в качестве средства нагревания, главным образом живой ткани или живых клеток in vivo.

Изобретение также относится к применению цепочек магнитосом в качестве лекарственного средства, которое позволяет проводить лечение опухоли (опухолей) и/или опухолевых клеток посредством нагревания.

Следующее описание воплощений и особенностей относится к способу лечения и к применению цепочек магнитосом.

Важно указать, что изобретение относится к введению цепочек магнитосом пациенту, которому это необходимо. Однако возможно, что после введения в организм небольшое количество цепочек магнитосом будет изменено; изменение этих цепочек магнитосом может привести к образованию более длинных или более коротких цепочек, чем те, которые вводили, и, с меньшей вероятностью, к появлению единичных магнитосом.

Магнитосомы, вводимые во время терапии, находятся в форме цепочек магнитосом. По определению, эти цепочки магнитосом выделены из магнетотактических бактерий. Это означает, что они не находятся внутри бактерий. Предпочтительно, цепочки были выделены из бактерий, применяемых для их продукции, и отделены от фрагментов клеток. Эти цепочки магнитосом предпочтительно содержат от 2 до 30 магнитосом, в типичном случае от 4 до 20 магнитосом. Большая часть магнитосом, принадлежащих этим цепочкам, обладают кристаллографическими направлениями и предпочтительно также имеют легкую ось, ориентированную в направлении удлинения цепочки, которая обычно относится к типу осей [111] (Alphandery et al., ACS Nana, 2009, 3, 1539-1547). Следовательно, цепочки магнитосом обладают магнитной анизотропией, которая сильнее, чем магнитная анизотропия единичных магнитосом. В результате предотвращается сильно выраженная агрегация цепочек магнитосом. При взаимодействии нескольких цепочек магнитосом, содержащих в типичном случае от 4 до 20 магнитосом, происходит образование более длинной цепочки магнитосом, содержащей в типичном случае более чем 4-20 магнитосом. Длина цепочки магнитосом предпочтительно составляет менее 1200 нм, более предпочтительно - менее 600 нм, наиболее предпочтительно - менее 300 нм. Сборка магнитосом в цепочки придает несколько свойств, которые полезны для нагревания in vivo. Благодаря сборке в цепочки магнитосомы не склонны к агрегации, а также обладают стабильным магнитным моментом. Обе эти особенности способствуют вращению цепочек магнитосом и, следовательно, выработке тепла посредством этого механизма. Сборка магнитосом в цепочки также обеспечивает взаимодействие с эукариотическими клетками, что является полезным благодаря низкому уровню их агрегации. Это взаимодействие в результате приводит к интернализации цепочек магнитосом внутрь эукариотической клетки. Например, как описано более подробно в примере 4, существенный процент клеток приобретают магнитные свойства, когда цепочки магнитосом смешивают с клетками при воздействии переменного магнитного поля. В одном воплощении цепочки магнитосом проникают внутрь эукариотических клеток при приложении переменного магнитного поля, тем самым делая возможным разрушение клеток по механизму внутриклеточной гипертермии. Этот механизм потенциально является более эффективным, чем внеклеточная гипертермия, так как он разрушает клетки изнутри. С другой стороны, очень небольшой процент обладающих магнитными свойствами клеток получают, когда клетки смешивают в присутствии единичных магнитосом при воздействии переменного магнитного поля, и это указывает на то, что единичные магнитосомы остаются вне эукариотических клеток, приводя в результате к менее эффективному механизму разрушения клеток.

Магнитосомы определяют как магнитные наночастицы оксида железа, состоящие из магнетита, маггемита или композиции, которая является промежуточным продуктом превращения магнетита в маггемит.Магнитосомы также характеризуются присутствием биологической мембраны, которая их окружает.Наличие аминогрупп на поверхности мембраны магнитосом позволяет присоединять различные биоактивные макромолекулы и придает свойство биосовместимости (Xiang et al., Lett. Appl. Microbiol., 2007, 6, 75-81; Sun et al., Cancer Lett., 2007, 258, 109-117; Sun et al., Biotech. Bioeng., 2008, 101, 1313-1320).

В одном воплощении магнитосомы, находящиеся в цепочке, окружены биологической мембраной. Магнитосомы могут быть связаны друг с другом через биологические филаменты, структура которых известна лишь частично, согласно данным публикации A.Komeili, Ann. Rev. Biochem. 2007, 76, 351-366.

В одном воплощении магнитосомы биологически синтезированы магнетотактическими бактериями, такими как штамм АМВ-1 Magnetospirillum magneticum, штамм МС-1 магнетотактических кокков, три штамма факультативных анаэробных вибрионов MV-1, MV-2 и MV-4, штамм MS-1 Magnetospirillum magnetotacticum, штамм MSR-1 Magnetospirillum gryphiswaldense, штамм MGT-1 факультативной анаэробной магнетотактической спириллы Magnetospirillum magneticum и один облигатный анаэроб, Desulfovibrio magneticus RS-1.

Размеры или средние размеры единичных магнитосом, содержащихся в цепочках магнитосом, могут варьировать в зависимости, в частности, от штамма бактерий, питательной среды для бактерий и/или условий выращивания бактерий. Чаще всего магнитосомы являются монодоменными наночастицами (т.е., обладают только одним магнитным доменом) с размером в пределах от примерно 10 нм до примерно 120 нм, предпочтительно от 10 нм до 70 нм, наиболее вероятно - от 30 нм до 50 нм. Распределение размеров магнитосом может существенно варьировать в зависимости от штамма бактерий и условий выращивания бактерий. В случае штамма АМВ-1 большинство магнитосом имеют размеры в диапазоне от 30 нм до 50 нм. Увеличения размеров можно достичь, если производить получение магнитосом в присутствии одной или нескольких добавок, таких как добавки, описанные в изобретении. Большой размер магнитосом приводит к проявлению ферромагнитных свойств при температурах, достигаемых в ходе лечения. Он также обеспечивает термически стабильный магнитный момент. Следовательно, перемещение магнитосом в организме потенциально можно контролировать, прикладывая внешнее магнитное поле. Благодаря их стабильному магнитному моменту магнитосомы должны давать лучший магнитный ответ, чем более мелкие суперпарамагнитные наночастицы оксида железа (SPION), применяемые для медицинских нужд в настоящее время, которые обладают термически нестабильным магнитным моментом. Магнитосомы, которые представляют собой крупные монодоменные наночастицы, также обладают лучшими свойствами нагревания, чем большинство химически синтезированных наночастиц (обычно в форме SPION), при нахождении в суспензионном растворе и воздействии переменного магнитного поля.

В одном из вариантов воплощения магнитосомы обладают узким диапазоном распределения размеров, когда магнетотактические бактерии выращивают в оптимальных условиях.

В одном из вариантов воплощения этап выбора размера можно провести с применением либо магнитного поля с различными интенсивностями (0,05-1 Тл), либо хроматографической методики с разделением по размеру (например, с помощью колонки типа Sephacryl S1000), либо методики центрифугирования, которая позволяет освободиться от самых мелких магнитосом, остающихся в супернатанте. Применение магнитосом с размерами, лежащими в заданном диапазоне, также может быть полезно, например, для внедрения их в везикулы заданного размера.

В конкретном примере воплощения в способе по настоящему изобретению применяют цепочки магнитосом, инкапсулированные в везикуле, главным образом в липидной везикуле. Инкапсуляция цепочек магнитосом приводит к улучшению свойств нагревания, а также снижает риск возникновения токсических явлений, предотвращая прямой контакт между цепочками магнитосом и организмом. Вращение цепочек магнитосом in vivo может быть улучшено с помощью их инкапсуляции в липидную частицу или в структуру схожего типа.

В одном из вариантов воплощения липидная везикула представляет собой мелкую однослойную везикулу (SUV, диаметр 100 нм), содержащую уменьшенное количество маленьких цепочек магнитосом. По сравнению с большими везикулами, SUV обладают несколькими преимуществами. Например, они в меньшей степени узнаются макрофагами (Gene et al., Langmuir, 2009, 25, 12604-12613).

В другом варианте воплощения липидная везикула представляет собой большую однослойную везикулу (LUV, диаметр находится в диапазоне от 100 нм до 1 мкм) или крупную однослойную везикулу (GUV, диаметр>1 мкм). Более предпочтительно применять для внутривенной инъекции LUV. В случае LUV или GUV емкость поглощения магнитосом значительно больше, чем в случае SUV, и следовательно, теплопроизводительность выше.

В одном из вариантов воплощения липидная везикула является многослойной липосомой.

В одном из вариантов воплощения липидная везикула состоит из одного липида с нейтральным зарядом, такого как ДОФХ (1-олеоил-2-пальмитоил-sn-глицеро-3-фосфохолин), ДМФХ (димиристоилфосфатидилхолин), ДПФХ (дипальмитоилфосфатидилхолин), ДСФХ (1,2-дистеароил-sn-глицеро-3-фосфохолин), ДМФЭ (димиристоилфосфатидилэтаноламин) или ДПФЭ (дипальмитоилфосфатидилэтаноламин).

В другом варианте воплощения липидная везикула состоит из нейтральных липидов, таких как липиды, указанные выше, в смеси с заряженными липидами, такими как ДОФГ (1,2-диолеоил-sn-глицеро-3-[фосфо-гас-(1-глицерол)]), ДПФГ (дипальмитоилфосфатидилглицерол). Липиды с различными зарядами смешивают друг с другом для оптимизации поверхностного заряда везикулы. И действительно, последнее свойство является важным параметром для инкапсуляции цепочек магнитосом в везикулах и для интернализации везикул в клетку (Martina et al., J. Am. Спет.Soc, 2005, 127, 10676; Tai et al., Nanotechnology, 2009, 20, 13501).

Способ имеет целью обеспечение термотерапии in vivo, включая гипертермию и термоабляцию.

В одном из вариантов воплощения способ, описанный в настоящем изобретении, демонстрирует подход, позволяющий полностью или частично разрушить опухолевые клетки или опухоль путем повышения температуры в опухоли менее чем примерно на 10°C выше уровня физиологической температуры (37°C), - методику, которую обычно называют гипертермией. В предпочтительном варианте воплощения температура, достигаемая в опухоли во время гипертермии, находится в диапазоне от примерно 37°C до примерно 45°C, предпочтительно от примерно 40°C до примерно 45°C, более предпочтительно - равна примерно 43°C.

В другом варианте воплощения способ по настоящему изобретению демонстрирует подход, позволяющий разрушить опухолевые клетки или опухоль путем повышения температуры в опухоли более чем примерно на 10°C выше уровня физиологической температуры (37°C), - методику, которую обычно называют термоабляцией. Температура, достигаемая во время термоабляции, находится в диапазоне от примерно 45°C до примерно 100°C, более предпочтительно - от примерно 45°C до примерно 70°C.

В предпочтительном варианте воплощения температура, достигаемая в опухоли во время термоабляции, находится в диапазоне от примерно 45°C до примерно 55°C, предпочтительно от примерно 50°C до примерно 55°C, наиболее предпочтительно - равна примерно 53°C, 54°C или 55°C.

Так как тепло вырабатывается очень локально (в нанометровом масштабе), во время лечения локально могут быть достигнуты относительно высокие температуры.

Указанные выше температуры - это температуры, достигаемые внутри опухоли (опухолей), опухолевой ткани и/или окружающей их среды. Температура внутри опухолевых клеток (т.е., рядом с интернализированными магнитосомами) может быть выше.

Предметом настоящего изобретения является способ частичного или полного разрушения опухолевых клеток или опухоли. Опухолевые клетки могут быть уничтожены или могут потерять свою способность к неограниченному делению при применении к ним термической обработки, описанной в настоящем изобретении. Так как опухолевые клетки более чувствительны к нагреванию, чем здоровые клетки (см., например, Overgaard et al., Cancer, 1977, 39, 2637-2646), термотерапия, описанная в настоящем раскрытии, способна избирательно разрушать опухолевые клетки.

Способ по настоящему изобретению описывает термическую обработку, которая вызывает частичное или полное разрушение опухолевых клеток и/или опухоли (опухолей). Термическая обработка вызывается приложением переменного магнитного поля. Это магнитное поле индуцирует выработку тепла цепочками магнитосом (инкапсулированных в везикулу или нет).

В одном из вариантов воплощения переменное магнитное поле, применяемое во время лечения, характеризуется частотой в диапазоне от примерно 50 кГц до примерно 1000 кГц, предпочтительно - от примерно 100 кГц до примерно 500 кГц, более предпочтительно - от примерно 100 кГц до примерно 200 кГц.

В другом варианте воплощения магнитное поле характеризуется силой в диапазоне от примерно 0,1 мТл до примерно 200 мТл, предпочтительно - от примерно 1 мТл до примерно 100 мТл, более предпочтительно - от примерно 10 мТл до примерно 60 мТл, в типичном случае - от примерно 10 мТл до примерно 50 мТл.

Максимальное значение силы магнитного поля определяют по значению, при котором оно становится токсичным для организма (т.е., в существенной степени, когда оно вызывает токи Фуко). Возможно применение в терапии магнитных полей с силой выше 200 мТл, если показано, что они не являются токсичными.

В другом варианте воплощения способ по настоящему изобретению характеризуется длительностью периода времени, в течение которого применяется магнитное поле. Эта длина периода времени может находиться в диапазоне от примерно 1 с до примерно 6 ч, предпочтительно - от примерно 1 мин. до примерно 1 ч, предпочтительно - от 0,5 до 30 мин, наиболее предпочтительно - от 1 мин до 30 мин.

Термическую обработку предпочтительно применяют к анестезированному пациенту. Следовательно, время, в течение которого проводят лечение, может быть равно или менее, чем длина периода времени действия анестезии. Таким образом, термическая обработка потенциально может проводиться в течение более чем 6 ч, например, если пациент находится под действием анестезии в течение периода более 6 ч.

В другом варианте воплощения способ по настоящему изобретению характеризуется количеством магнитосом, применяемых в ходе терапии. Это количество магнитосом относится к количеству оксида железа, содержащегося в суспензии цепочек магнитосом. Данное количество вычисляют путем измерения количества оксида железа, присутствующего в инъецируемой суспензии цепочек магнитосом. Оно находится в диапазоне от примерно 0,001 мг до примерно 100 мг оксида железа, предпочтительно - от примерно 0,01 мг до примерно 100 мг оксида железа, более предпочтительно - от примерно 0,01 мг до примерно 10 мг оксида железа, более предпочтительно - от примерно 0,1 до примерно 10 мг оксида железа, в типичном случае - от 0,1 до 1 мг оксида железа. Количество магнитосом, которое необходимо ввести, в существенной степени зависит от объема обрабатываемой опухоли, температуры, необходимой во время обработки, и способа введения. Самый большой объем опухоли и самая высокая температура в опухоли требуют введения самого большого количества магнитосом. Более того, если магнитосомы вводят внутривенно (или иным способом вне области расположения опухоли (опухолей)), может потребоваться введение большего количества цепочек магнитосом, чем если их непосредственно вводят в опухоль (опухоли) или рядом с нею.

В другом варианте воплощения введение цепочек магнитосом можно проводить с различной скоростью, в зависимости от целевой опухоли (опухолей) и от концентрации вводимой суспензии цепочек магнитосом. Например, введение суспензии цепочек магнитосом непосредственно в опухоль (опухоли) головного мозга может требовать более медленной скорости инъекции, чем при внутривенной инъекции или чем при инъекции в случае локализации опухоли на поверхности кожи. Инъекция более концентрированной суспензии цепочек магнитосом может требовать более медленной скорости инъекции, чем в случае менее концентрированной суспензии цепочек магнитосом. Скорость инъекции предпочтительно составляет от 0,1 мкл/мин до 1 л/мин, более предпочтительно - от 1 мкл/мин до 100 мл/мин, наиболее предпочтительно - от 1 мкл/мин до 10 мл/мин, где указанный объем - это объем вводимой суспензии цепочек магнитосом.

В другом варианте воплощения концентрация суспензии цепочек магнитосом в типичном случае находится в диапазоне от 1 мкг/мл до 100 мг/мл, предпочтительно - от 10 мкг/мл до 50 мг/мл, где концентрация показывает количество оксида железа (предпочтительно - маггемита), содержащееся в суспензии. В другом варианте воплощения цепочки магнитосом смешаны с растворителем, который стабилизирует цепочки магнитосом. Значение pH суспензии может быть скорректировано, и/или в суспензию, содержащую цепочки магнитосом, могут быть добавлены катионы и/или анионы для стабилизации этой суспензии.

В другом варианте воплощения введение цепочек магнитосом пациенту повторяют. Количество повторов зависит от количества магнитосом, которые вводят за один раз. Если за один раз вводят лишь очень небольшое количество цепочек магнитосом, то этап введения может быть повторен несколько раз, до введения пациенту необходимого количества магнитосом.

В другом варианте воплощения повторяют термическую обработку, индуцируемую приложением переменного магнитного поля. Последовательные применения термической обработки после введения данного количества цепочек магнитосом называют тепловым циклом. Данное количество магнитосом, применяемое для каждого теплового цикла, может быть введено посредством единичного введения или посредством нескольких последовательных введений, как объяснено выше. Различные термические обработки в пределах теплового цикла отделяют друг от друга временем отсутствия импульсов. Время отсутствия импульсов может быть равно 1 с или быть более чем 1 с, предпочтительно - равно 1 мин. или более 1 мин., более предпочтительно - равно 10 мин. или более 10 мин., предпочтительно - равно или более 30 мин.

В одном воплощении различные термические обработки в пределах теплового цикла отделяют друг от друга более длительным периодом времени отсутствия импульсов, чем указано выше. Время отсутствия импульсов может находиться в диапазоне от 1 дня до 15 дней.

В одном воплощении тепловой цикл повторяют от 1 до 648 ООО раз, в частности, от 1 до 1000 раз, в частности, от 1 до 100 раз, в типичном случае - от 1 до 10 раз. Наибольшая частота повторов, составляющая 648000 раз, вычислена исходя из предположения, что обработку проводят в течение очень короткого периода времени, в типичном случае - в течение примерно одной секунды, в течение 15 дней с очень коротким периодом времени отсутствия импульсов, в типичном случае - с примерно одной секундой отсутствия импульсов между двумя обработками. Количество повторов обработки зависит от продолжительности времени обработки. Предпочтительно, чем дольше время обработки, тем меньше повторов необходимо, при условии, что другие параметры терапии (такие как сила и частота приложенного магнитного поля) остаются неизменными.

По изобретению, сеанс включает последовательности введения данного количества цепочек магнитосом пациенту и выработку тепла посредством приложения магнитного поля (а также другие необязательные последовательности, как описано далее). Разные сеансы можно проводить для одного и того же пациента. Эти сеансы могут быть отделены друг от друга достаточно длительным периодом времени. Этот период времени может быть равен 1 дню или быть более 1 дня, предпочтительно - равен 15 дням или быть более 15 дней, более предпочтительно - равен 1 мес. или быть более 1 мес.

Для оптимизации эффективности термотерапии необходимо корректировать следующие параметры: количество цепочек магнитосом, применяемое во время терапии, частоту и/или силу прилагаемого магнитного поля, период времени обработки, количество повторов обработки во время одного «сеанса» и количество «сеансов». Эти параметры могут зависеть от специфических особенностей опухоли, которая является мишенью, т.е., например, от ее размера, ее устойчивости к действию термотерапии и ее вязкости. В случае опухоли большого объема и/или с высокой устойчивостью к температуре и/или с высокой вязкостью можно рассмотреть вариант увеличения количества инъецируемых магнитосом и/или силы/частоты прилагаемого магнитного поля и/или количества повторов обработки. В этом случае также можно рассмотреть вариант инкапсулирования бактериальных магнитосом в везикулу для улучшения выработки тепла. В одном воплощении параметры термотерапии корректируют для оптимизации частоты обработки опухоли, которую планируется обрабатывать.

В еще одном воплощении значения этих параметров также зависят от количества опухолей и наличия метастазов, которые необходимо обработать. В случае пациента с раком в прогрессирующей стадии, т.е., с метастазированием и/или существенным количеством опухолей, необходимое количество цепочек магнитосом будет выше, чем в случае единичной опухоли. Вместо повышения количества вводимых магнитосом можно рассмотреть вариант увеличения периода времени обработки, силы магнитного поля, прилагаемого в ходе обработки (для достижения более высоких температур), или количества повторов обработки.

Целью способа является лечение раковых заболеваний, более предпочтительно - солидных опухолей. Примеры раковых заболеваний, которые можно лечить с применением этого типа термотерапии, включают рак простаты (Kawai et al., Prostate, 2008, 68, 784-792), рак пищевода, рак поджелудочной железы, рак груди (Kikumori et al., Breast Cancer Res. Treat, 2009, 113, 435441), рак головного мозга (Thiesen et al., Int. J. Hyperthermia, 2008, 24, 467-474) и рак кожи (Ito et al., Cancer Sci., 2003, 94, 308-313).

Еще одним предметом изобретения является способ получения цепочек магнитосом, при этом магнетотактические бактерии культивируют в питательной среде, содержащей по меньшей мере источник железа, такой как раствор хината железа, и добавки, такие как другие переходные металлы, отличные от железа, и/или хелатирующие агенты, как указано в этом документе. В качестве примера, питательная среда содержит ингредиенты, указанные в примере 1. Эти добавки приводят в специфических условиях к увеличению размеров магнитосом и/или длины цепочек магнитосом. Следовательно, они усиливают теплопроизводительность цепочек магнитосом при воздействии переменного магнитного поля.

В одном из вариантов воплощения магнетотактические бактерии культивируют в питательной среде, содержащей стандартную питательную среду для магнетотактических бактерий, такую как описана в примере 1 для штамма АМВ-1, и добавки, которые являются переходными металлами, например, такими как кобальт, никель, медь, цинк, магний, хром, или смесью двух или нескольких из этих металлов.

В одном варианте воплощения легирование магнитосом переходным металлом, например кобальтом, выполняют, добавляя примерно от 0,02 мкМ до 1 мМ, предпочтительно - от 0,02 мкМ до 200 мкМ, предпочтительно - от 1 мкМ до 100 мкМ, предпочтительно - от 2 до 20 мкМ раствора переходного металла (например, кобальта) в питательную среду для магнетотактических бактерий. Такой раствор может представлять собой, например, хинат кобальта, добавленный в стандартную питательную среду для магнетотактических бактерий, например, для штамма АМВ-1 (АТСС 70027), согласно тому способу, который применяли Станиланд с коллегами (S.Staniland et al., Nature Nanotech. 2008, 3, 158-162). Магнетотактические бактерии, росшие в присутствии кобальта, например, хината кобальта, или другого переходного металла, обладают улучшенными магнитными свойствами даже в случае, когда процентное содержание примеси кобальта менее чем 2% (S.Staniland et al., Nature Nanotech., 2008, 3, 158-162). В вышеупомянутом исследовании Станиланд с коллегами наблюдали изменение магнитных свойств в присутствии кобальта в случае сохранивших целостность магнетотактических бактерий, но не в случае цепочек магнитосом, выделенных из магнетотактических бактерий. Улучшение магнитных свойств легированных кобальтом магнитосом, собранных в цепочки и выделенных из магнетотактических бактерий, обеспечивающих улучшенную способность к нагреванию, является вкладом настоящего изобретения в усовершенствование существующей техники. В случае химически синтезированных наночастиц для того, чтобы наблюдались существенные изменения магнитных свойств, обычно необходим процент легирования кобальтом выше чем примерно 10% (A.Franco et al., J. Mag. Mag. Mat, 2008, 320, 709-713; R.Tackett et al., J. Mag. Mag Mat, 2008, 320, 2755-2759). Это указывает на то, что легированные кобальтом магнитосомы могут обладать улучшенной теплопроизводительностью, по сравнению с нелегированными магнитосомами, даже при низком процентном содержании примеси кобальта.

В другом варианте воплощения магнетотактические бактерии культивируют в присутствии хелатирующего агента. Хотя не существует теории, полностью объясняющей это явление, полагают, что хелатирующий агент связывает катионы железа или любого другого переходного металла, применяемого в качестве добавки, и, следовательно, улучшает проникновение железа и/или другого переходного металла в магнетотактические бактерии. В результате этого процесса образуются магнитосомы с улучшенными нагревательными свойствами.

В одном воплощении в питательную среду добавляют суспензию, содержащую примерно от 0,02 мкМ до 1 мМ, предпочтительно - от 0,02 мкМ до 400 мкМ, предпочтительно - от 0,02 до 200 мкМ, предпочтительно - от 1 мкМ до 100 мкМ, наиболее предпочтительно - от 2 до 20 мкМ хелатирующего железо агента.

В одном воплощении хелатирующий агент является молекулой, которая содержит одну или несколько функциональных групп карбоновых кислот, таких как АПК (альфа-липоевая кислота), кальцеин, карбоксифлуоресцин, деферазирокс, дипиколиновая кислота, ДТПА (диэтилентриаминпентауксусная кислота), ЭДТА (этилендиаминтетрауксусная кислота), фолиевая кислота или витамин В9, молочная кислота, родамин В, карбоксиметилдекстраны (полимеры), дипиколиновая кислота или щавелевая кислота, лимонная кислота или цитратные функциональные группы, такие как ВАРТА (аминофеноксиэтантетрауксусная кислота), CDTA (циклогексан-1,2-диаминтетрауксусная кислота), EDDHMA (этилендиамин-ди-(o-гидрокси-p-метилфенил) уксусная кислота), CaNa2-ЭДТА, EDTCA (этилендиаминтетрауксусная кислота с добавлением цетавлона, аммоний-содержащего поверхностно-активного вещества), EDDA (этилендиамин-N,N'-диуксусная кислота), EDDHA (этилендиамин-N,N'-бис-(2-гидроксифенилуксусная кислота), ЭГТА (этиленгликоль-бис-((3-аминоэтиловый эфир) N,N,N',N'-тетрауксусной кислоты), HEDTA (N-(2-гидроксиэтил)-этилендиаминтриуксусная кислота), HEEDTA (гидрокси-2-этилендиаминтриуксусная кислота), NTA (нитрилотриацетат) или фенолокислота.

В другом варианте воплощения хелатирующий агент является молекулой, которая содержит одну или несколько спиртовых функциональных групп, таких как катехол или его производные, или одну или несколько аминоспиртовых функциональных групп, таких как допамин, деферипрон, дефероксамин, дезферриоксамин, или одну или несколько аминокарбоксильных или кетоновых функциональных групп, таких как доксорубицин, кофеин, D-пеницилламин, пирролохинолин, HEIDA (гидроксиэтилимино-N,N-диуксусная кислота).

В варианте воплощения хелатирующий агент является молекулой, которая содержит функциональную группу фосфоната или фосфоновой кислоты, такую как AEPN (2-аминоэтилфломфоновая кислота), AMP (амино-трис-(метиленфосфоновая кислота)), АТМР (амино-трис-(метиленфосфоновая кислота)), СЕРА (2-карбоксиэтилфосфоновая кислота), DMMP (диметил-метилфосфонат), DTPMP (диэтилентриаминпента-(метиленфосфоновая кислота)), EDTMP (этилендиаминтетра-(метиленфосфоновая кислота)), HEDP (1-гидроксиэтилиден-1,1-дифосфоновая кислота), HDTMP (гексаметилендиаминтетра-(метиленфосфоновая кислота)), НРАА (2-гидроксифосфонокарбоновая кислота), РВТС (фосфонобутантрикарбоновая кислота), PMIDA (N-(фосфонометил)иминодиуксусная кислота), TDTMP (тетраметилендиаминтетра-(метиленфосфоновая кислота)), ADP (аденозиндифосфорная кислота) или 1-{12-[4-(дипиррометенборо-дифторо)бутанол]амино}додеканоил-2-гидрокси-sn-глицеро-3-фосфат, натриевая соль L-α-фосфатидной кислоты, натриевая соль 1-пальмитоил-2-(дипиррометенбородифторо)ундеканоил-sn-глицеро-3-фосфо-L-серин).

В другом варианте воплощения хелатирующий агент является молекулой, которая содержит функциональную группу бис-, трис- или тетрафосфоната или бис-, трис- или тетра-фосфоновой кислоты, такую как 1-гидроксиметилен-бис-фосфоновая кислота, пропантрифосфоновая кислота, (нитрил о-трис-(метилен))трис-фосфоновая кислота, (фосфинилидин-трис-(метилен)) трис-фосфоновая кислота. Примеры 1-гидроксиметилен-бис-фосфоновых кислот включают алендроновую кислоту (Fosamax®, (Фосамакс®)), памидроновую кислоту, золедроновую кислоту, ризедроновую кислоту, неридроновую кислоту, ибандроновую кислоту (Bondronat®, (Бондронат®)), минодроновую кислоту и другие соединения, описанные в литературных источниках (L. Wilder et al, J. Med. Chem., 2002, 45, 3721-3728; M.Neves, N.Med. Biol., 2002, 29, 329-338; H.Shinoda et al, Calcif. Tissue Int., 1983, 35, 87-89; M.A.Merrel, Eur. J. Phramacol., 2007, 570, 27-37). При добавлении 0,4 мкМ или 4 мкМ неридроновой кислоты, алендроновой кислоты и ризедороновой кислоты в бактериальную питательную среду наблюдали, что процентная доля магнитосом с размерами более 45 нм становится выше, чем в случае магнитосом, синтезированных в отсутствие бис-фосфоновой кислоты. Цепочки магнитосом, синтезированных в этих условиях, соответственно, обладали улучшенными нагревательными свойствами.

В другом варианте воплощения хелатирующий агент является молекулой, которая одержит сульфонатную или сульфоновую функциональную группу или БАЛ (димеркапрол), такую как BPDS (батофенантролиндисульфонат или 4,7-ди-(4-фенилсульфонат)-1, 10-фенантролин), DMPS (димеркаптопрона сульфонат или 2,3-димеркапто-1-пропансульфоновая кислота, сульфородамин 101, DMSA (димеркаптоянтарная кислота).

Другими примерами хелатирующих агентов являются полидентатные лиганды, например, гемоглобин, хлорофилл, порфирин и органические соединения, содержащие пиррольные кольца.

В другом варианте воплощения магнетотактические бактерии культивируют в питательной среде, которая содержит и хелатирующий агент, и переходный металл.

В предпочтительном воплощении в качестве переходного металла применяют кобальт, предпочтительно, в сочетании с хелатирующим агентом, выбранным из бисфосфоновой кислоты (неридроновой кислоты, алендроновой кислоты или ризедроновой кислоты), родамина или ЭДТА.

Способ лечения по настоящему изобретению включает следующие этапы:

(i) введение млекопитающему цепочек магнитосом;

(ii) возможно, нацеливание цепочек магнитосом на ткань, опухоль (опухоли) и/или опухолевые клетки, которые будут подвергаться обработке;

(iii) возможно, обнаружение цепочек магнитосом в ткани, опухоли (опухолях) или опухолевых клетках, которые будут подвергаться обработке;

(iv) нагревание путем приложения переменного магнитного поля;

(v) возможно, удаление цепочек магнитосом из ткани, опухоли (опухолей), опухолевых клеток и/или организма.

Во всех последующих воплощениях и предпочтительных воплощениях цепочки магнитосом могут быть инкапсулированы в везикулу или нет.

Этапы (iii) и (iv) также могут выполняться в любом порядке, например:

- этап (iii), затем этап (iv); или

- этап (iv), затем этап (iii).

Этапы (ii), (iii) и (iv) могут выполняться одновременно или последовательно.

Этапы (ii) и (iv) могут выполняться одновременно.

Этапы (iii) и (iv) могут выполняться одновременно.

Предполагается, что под млекопитающим подразумевают любое млекопитающее, включая также и человека.

В одном из вариантов воплощения цепочки магнитосом на этапе (i) могут являться цепочками магнитосом, находящимися в организме, например, таковыми, оставшимися после первого цикла обработки.

В другом варианте воплощения этапу (i) может предшествовать этап (i') - введение цепочек магнитосом млекопитающему.

В одном из вариантов воплощения этап (i') выполняют таким образом, что цепочки магнитосом вводят на удалении от клеток или ткани, которые будут подвергаться обработке. Например, их инъецируют внутривенно в кровь или вводят в другой орган, отличный от того, в котором расположена опухоль.

В одном из вариантов воплощения этап (i') выполняют таким образом, что цепочки магнитосом вводят близко к клеткам или ткани, которые будут подвергаться обработке.

В еще одном варианте воплощения этап (i') выполняют таким образом, что цепочки магнитосом вводят внутрь клеток и/или опухоли (опухолей), которые будут подвергаться обработке.

Расстояние между зоной введения суспензии цепочек магнитосом и местом расположения опухоли может варьировать в зависимости от того, представляется ли возможным произвести инъекцию магнитосом непосредственно в опухоль (опухоли) или нет. Например, опухоль (опухоли) могут располагаться слишком близко к жизненно важному органу. В этом случае прямая инъекция цепочек магнитосом в опухоль (опухоли) была бы невозможна.

Способ по настоящему изобретению также может включать второй этап нацеливания на опухолевые клетки или опухоль (опухоли), которые будут подвергаться обработке. Этот этап особенно важен, если введение цепочек магнитосом (инкапсулированных в везикулу или нет) производится не непосредственно в опухоль. Часто это происходит, когда в качестве типа инъекции выбирают внутривенную инъекцию. Задача этапа нацеливания - расположить цепочки магнитосом в непосредственной близости от опухолевых клеток и/или опухоли (опухолей) и/или внутри опухолевых клеток и/или опухоли (опухолей).

В одном из вариантов воплощения этап нацеливания выполняют, применяя магнитное поле, которое направляет цепочки магнитосом (инкапсулированные в везикулы или нет) в непосредственную близость от опухолевых клеток и/или опухоли (опухолей) и/или внутрь опухолевых клеток и/или опухоли (опухолей). Этот тип нацеливания обозначают как магнитное нацеливание.

В еще одном воплощении могут применяться два различных подхода для направления цепочек магнитосом с применением магнитного поля в непосредственную близость от опухоли (опухолей) и/или внутрь самой опухоли (опухолей). С одной стороны, магнитное поле прикладывают к телу пациента снаружи и регулируют его ориентацию, чтобы заставить цепочки магнитосом следовать нужным путем вплоть до достижения места расположения опухоли. Этот тип магнитного нацеливания называют «активным» нацеливанием, так как может быть необходимо проводить изменение и регулирование характеристик магнитного поля, применяемого во время этапа нацеливания. Для проведения этого этапа нацеливания может применяться адаптированный прибор для МРТ, в котором имеется возможность изменять в любом направлении ориентацию либо тела пациента, либо магнитного поля. С другой стороны, магнит может быть расположен внутри опухоли или в непосредственной близости от места ее расположения с целью привлечения цепочек магнитосом в опухоль и/или в непосредственную близость от опухоли. В этом случае магнитное нацеливание будет в существенной степени пассивным (т.е., в основном придется ждать, пока произойдет накопление цепочек магнитосом внутри опухоли (опухолей) и/или в непосредственной близости от нее).

В другом варианте воплощения этап нацеливания на опухоль (опухоли) реализуется путем присоединения биологической и/или химической нацеливающей молекулы, которая нацеливает на опухоль (опухоли), к цепочкам магнитосом или к везикуле, содержащей цепочки магнитосом. Такая нацеливающая молекула - это молекула, которая специфически узнает опухолевые клетки. Этот тип нацеливания обозначают как молекулярное нацеливание.

В одном варианте воплощения эта нацеливающая молекула является антителом, которое специфически узнает опухолевые клетки.

В другом варианте воплощения в качестве нацеливающей молекулы применяют ПЭГ или фолиевую кислоту.

В одном варианте воплощения осуществляют нанесение покрытия на поверхность цепочек магнитосом или на поверхность везикулы, содержащей цепочки магнитосом, с применением полиэтиленгликоля (ПЭГ) и/или фолиевой кислоты, или антитела. Присутствие этих молекул может не только позволить осуществить нацеливание на специфические клетки, но также способствует поглощению внутрь клетки и/или позволяет избежать узнавания цепочек магнитосом макрофагами (Allen et al, Trends in Pharmacological Sciences 1994, 15, 215-220; Blume et al., Biochim.Biophys. Acta 1990, 1029, 91-97; Gabizon et al., Biochim. et Biophys. Acta, 1992, 1103, 94-100; Zhang et al., Biomaterials 2002, 23, 1553-1561).

Этап нацеливания на опухоль (опухоли) может быть реализован с применением сочетания обеих вышеупомянутых методик:

- магнитного нацеливания;

- молекулярного нацеливания; или

- магнитного нацеливания и молекулярного нацеливания.

В одном варианте воплощения в способе обнаружения бактериальных магнитосом внутри организма (т.е., внутри опухоли или в другом месте) применяют либо МРТ, либо другую методику, такую как методика на основе флуоресценции. Такую методику применяют либо для того, чтобы удостовериться в том, что цепочки магнитосом (инкапсулированные в везикуле или нет) достигли нужного места перед началом обработки, индуцируемой нагреванием, и/или чтобы удостовериться в том, что цепочки магнитосом перемещаются в направлении целевой опухоли и/или чтобы удостовериться в том, что они должным образом выведены и/или чтобы удостовериться в том, что они были успешно введены.

В очень интересном варианте воплощения магнитное поле и, главным образом, магнитное поле, применяемое для нагревания, применяют для интернализации или улучшения интернализации цепочек магнитосом в опухолевые клетки.

Возможно также, когда цепочки магнитосом находятся в опухоли или в опухолевых клетках, применять магнитное поле в качестве «заключительного способа» корректировки положения цепочек магнитосом (инкапсулированных в везикуле или нет) внутри опухоли с целью достижения максимальной теплопроизводительности и/или противоопухолевой активности в ходе воздействия, вызванного теплом.

В другом варианте воплощения цепочки магнитосом (инкапсулированные в везикуле или нет) обнаруживают с помощью МРТ. Было продемонстрировано обнаружение с помощью МРТ целых магнетотактических бактерий (R.Benoit et al., Clin. Cancer. Res. 2009, 15, 5170-5177). Это воплощение относится к обнаружению цепочек магнитосом.

В одном варианте воплощения цепочки магнитосом применяют в качестве контрастных агентов, которые легко могут быть обнаружены с помощью МРТ благодаря их специфическим свойствам (тому, что они состоят из оксида железа и/или обладают хорошей кристалличностью).

В еще одном варианте воплощения цепочки магнитосом обнаруживают с применением методики обнаружения флуоресценции. В этом случае цепочки магнитосом модифицируют присоединением флуоресцентной молекулы или флуоресцентной метки, которая располагается на поверхности и/или рядом с поверхностью и/или внутри одной или нескольких бактериальных магнитосом, находящихся в составе цепочек магнитосом. Такая флуоресцентная молекула может являться родамином, кальцеином, флуоресцеином, бромидом этидия, зеленым или желтым флуоресцентным белком, кумарином, цианином или производными этих перечисленных молекул.

В другом варианте воплощения флуоресцентные молекулы расположены внутри магнитосом, на их поверхности или рядом с их поверхностью в результате культивирования магнетотактических бактерий в присутствии этих флуоресцентных молекул. Например, флуоресцентные магнитосомы получают культивированием магнетотактических бактерий в присутствии от примерно 0,1 мкМ до примерно 1 мМ раствора флуоресцентных молекул. Флуоресцентные магнитосомы могут быть получены, например, культивированием магнетотактических бактерий в присутствии от примерно 40 мкМ до примерно 400 мкМ раствора родамина.

В другом варианте воплощения флуоресцентные молекулы связаны с цепочками магнитосом. Это может быть осуществлено путем химического присоединения флуоресцентных молекул к поверхности магнитосом.

В еще одном варианте воплощения магнитосомы содержат флуоресцентные молекулы, связанные с их поверхностью и заключенные внутри них. Это может быть достигнуто с помощью применения обеих методик получения флуоресцентных магнитосом, упомянутых выше.

В еще одном варианте воплощения везикула, содержащая бактериальные магнитосомы, сделана флуоресцентной путем присоединения флуоресцентной молекулы к поверхности везикулы.

В одном варианте воплощения флуоресценцию цепочек магнитосом возбуждают и детектируют с применением схемы возбуждения/детекции, которая располагается вне пределов организма. Этот тип схемы возбуждения/детекции будет полезен, если опухоль расположена близко к поверхности кожи. Например, оптическое волокно можно расположить непосредственно над опухолью рядом с поверхностью кожи для того, чтобы возбуждать модифицированные магнитосомы и собирать испускаемый ими свет.

В другом варианте воплощения возбуждение и/или детекцию модифицированных магнитосом осуществляют путем внедрения в организм фрагментов оборудования (таких как оптическое волокно), которые достигают опухоли и/или непосредственного окружения опухоли и способны возбуждать и/или детектировать флуоресценцию от модифицированных магнитосом.

В одном варианте воплощения этап (v) является этапом удаления магнитосом из ткани, опухоли (опухолей), опухолевых клеток и/или организма. Применяется методика, позволяющая управлять перемещением цепочек магнитосом внутри организма. Бактериальные магнитосомы либо непосредственно удаляют из опухоли (опухолей) (например, делая хирургический разрез, который обеспечивает бактериальным магнитосомам путь для выхода из места расположения опухоли и позволяет им покинуть организм). Для удаления из организма бактериальные магнитосомы также можно переместить из места расположения опухоли и направить в сторону других органов, таких как печень.

В еще одном варианте воплощения в методике, описанной в вышеизложенных воплощениях, применяют магнитное поле, которое направляет магнитосомы, выводя их из опухоли (опухолей) и из организма.

В еще одном варианте воплощения удаление цепочек магнитосом из места расположения опухоли выполняют, корректируя поверхностный заряд цепочек магнитосом.

В еще одном варианте воплощения цепочки магнитосом отрицательно заряжены.

В одном варианте воплощения флуорофор также является хелатирующим агентом и применяется в качестве добавки при выращивании магнетотактических бактерий и получении магнитосом. В предпочтительном воплощении в качестве хелатирующего агента и флуорофора применяют родамин.

Далее, терапевтический способ включает собственно термическую обработку, как описано выше. Таким образом, этот способ позволяет проводить местную обработку опухолей и/или опухолевых клеток и минимизирует разрушение здоровых клеток. Следовательно, он обеспечивает улучшение по сравнению с химиотерапией или другими методиками лечения раковых заболеваний, которые обычно не нацелены специфически и приводят к разрушению не только опухолевых клеток.

В другом варианте воплощения термическая обработка скомбинирована с химиотерапией.

Такая комбинация двух типов обработки может быть осуществлена путем инкапсулирования цепочек магнитосом внутри везикулы, предпочтительно - липидной везикулы, в присутствии активного компонента, который является противоопухолевой или противораковой субстанцией. В этом случае липиды, образующие везикулы, характеризуются температурой фазового перехода (температурой, при которой липиды, образующие везикулу, теряют свою двухслойную организацию), находящейся в диапазоне от 20°C до 60°C. Активный компонент высвобождается в опухолевых клетках, или в опухолях, или в пространстве, окружающем опухолевые клетки, или в пространстве, окружающем опухоли, при нагревании цепочек магнитосом и, следовательно, везикулы при приложении переменного магнитного поля.

Везикулы, главным образом липидные везикулы, содержащие цепочки магнитосом по изобретению и, возможно, активный компонент по изобретению, также являются предметом настоящего изобретения.

Возможно также выполнение способа по изобретению в сочетании с рентгеноскопией и/или радиотерапией и/или химиотерапией и/или хирургической операцией и/или другим типом лечения рака.

В одном варианте воплощения хирургическую операцию проводят для частичного или полного удаления опухоли (опухолей) и/или окружающих опухоли (опухоли) тканей. Суспензии цепочек магнитосом вводят в полость, остающуюся после хирургической операции, и начинают термотерапию, прикладывая внешнее магнитное поле. В этом случае термотерапию применяют для разрушения части опухоли (опухолей), которую невозможно было удалить в ходе хирургической операции, и/или для предотвращения повторного роста опухоли после хирургической операции.

В еще одном варианте воплощения полость формируют во время хирургической операции внутри опухоли и/или в окружающем опухоль пространстве для создания более благоприятной окружающей среды для выработки тепла цепочками магнитосом, чем среда опухолевой ткани (т.е., например, среды с меньшей вязкостью); в этом варианте воплощения цепочки магнитосом вводят в данную полость.

Изобретение также относится к применению цепочек магнитосом и/или везикул, содержащих цепочки магнитосом, таких, как описаны выше, в качестве средства нагревания, главным образом живой ткани или живых клеток in vivo.

Изобретение также относится к применению цепочек магнитосом (инкапсулированных в везикулу или нет) в качестве лекарства, главным образом, в качестве лекарства для противоопухолевого лечения, главным образом, для противоопухолевой термической обработки.

В одном из вариантов воплощения цепочки магнитосом (инкапсулированные в везикулу или нет) применяют в качестве лекарства, что позволяет проводить обработку опухоли (опухолей) и/или опухолевых клеток посредством способа с применением нагревания.

При таком применении везикула может содержать активный компонент, который является, например, противоопухолевым лекарством.

В одном из вариантов воплощения везикулы, содержащие цепочки магнитосом и, возможно, активный компонент, применяют в качестве лекарства, что позволяет проводить обработку опухолевых клеток или опухоли посредством способа с применением нагревания, которое вызывает высвобождение активного компонента.

В другом варианте воплощения цепочки магнитосом (инкапсулированных в везикулу или нет) применяют в качестве лекарства, активируемого с применением медицинского устройства, которое является источником переменного магнитного поля.

Изобретение также относится к применению цепочек магнитосом и/или везикул, содержащих цепочки магнитосом, и, возможно, активный компонент, в качестве медицинского устройства, специально разработанного для обработки опухоли (опухолей) и/или опухолевых клеток.

В одном из вариантов воплощения цепочки магнитосом (инкапсулированных в везикулу или нет) применяют в качестве медицинского устройства, которое делает возможным магнитную обработку опухолей или опухолевых клеток.

В одном из вариантов воплощения цепочки магнитосом (инкапсулированных в везикулу или нет) применяют в качестве медицинского устройства, которое делает возможным нагревание опухолей или опухолевых клеток, либо окружающего их пространства.

В одном из вариантов воплощения цепочки магнитосом или везикула, содержащая цепочки магнитосом, скомбинированы с активным компонентом и применяются в качестве медицинского устройства, что позволяет осуществлять доставку активного компонента в опухоли, опухолевые клетки или в окружающее их пространство.

В соответствии с особенностью изобретения, для полной комплектации медицинского устройства применяют устройство, необходимое для активации магнитного возбуждения цепочек магнитосом.

Изобретение также относится к набору, содержащему цепочки магнитосом (инкапсулированных в везикулу или нет) и устройство, которое способно генерировать магнитное поле с характеристиками, необходимыми для вызванного нагреванием лечения рака или опухолей.

В одном из вариантов воплощения везикулы, входящие в состав набора, применяют в сочетании с активным компонентом, который инкапсулирован внутри везикул.

Далее изобретение будет дополнительно подробно описано с применением следующих неограничивающих примеров.

ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Фигура 1: (a) полученная с применением трансмиссионной электронной микроскопии (ТЭМ) микрофотография одной клетки штамма АМВ-1 Magnetospirillum magneticum, где стрелки указывают на расположение цепочек магнитосом; (b) ТЭМ-микрофотография цепочек магнитосом, выделенных из бактерий; (c) ТЭМ-микрофотография единичных магнитосом, отсоединенных от цепочек; (d) ТЭМ-микрофотография химически синтезированных наночастиц (SPION@Citrate (SPION@цитрат)); (е) измерение заряда на поверхности цепочек магнитосом (СМ) и единичных магнитосом (IM) как функции значения pH в суспензии, содержащей эти два типа бактериальных магнитосом; (f) инфракрасный спектр цепочек магнитосом (СМ) и единичных магнитосом (IM).

Фигура 2: (а) изменение температуры суспензии интактных клеток магнетотактических бактерий как функция времени, в течение которого суспензию подвергали воздействию переменного магнитного поля (ПМП) с частотой 108 кГц и амплитудой ПМП 23 мТл, линии соответствуют суспензии клеток в воде (суспензия) и в 2% агарозном геле (гель) соответственно; (b) то же, что в случае (a), но с амплитудой ПМП 88 мТл; (с) частные петли гистерезиса цельных бактерий, измеренные при 23 мТл (квадратики) или 88 мТл (гистерезис); (d) удельная мощность поглощения (УМП) суспензии магнетотактических бактерий, находящихся либо в воде, либо в геле, как функция амплитуды ПМП. Гистерезисные потери, измеренные по площади частных петель гистерезиса суспензии магнетотактических бактерий, находящихся в геле; (e): столбчатые диаграммы, демонстрирующие УМП интактных клеток, измеренную при 23 мТл и 88 мТл. Прямоугольники представляют вклад гистерезисных потерь в наблюдаемое повышение температуры.

Фигура 3: свойства цепочек магнитосом, выделенных из клеток штамма АМВ-1 Magnetospirillum magneticum, (а) повышение температуры цепочек магнитосом как функция времени в присутствии ПМП с частотой 108 кГц и ПМП с амплитудой 23 мТл, линии демонстрируют скорость нагревания цепочек магнитосом, суспендированных в воде (раствор) и в 2% агарозном геле (гель) соответственно; (b) то же, что в случае (а), но с амплитудой ПМП 88 мТл; (с) частные петли гистерезиса цепочек магнитосом при 23 мТл (квадратик) и 88 мТл (линия); (d) УМП, измеренная по угловому коэффициенту при 22°C графика скорости нагревания цепочек магнитосом, суспендированных в воде (суспензия) или в геле (гель), как функция от амплитуды ПМП, гистерезисные потери, измеренные по площади частных петель гистерезиса суспензии цепочек магнитосом, находящихся в геле (гистерезис); (e) столбчатые диаграммы, демонстрирующие УМП цепочек магнитосом, измеренную при 23 мТл и 88 мТл. Прямоугольники представляют вклад в наблюдаемое повышение температуры гистерезисных потерь и вращения цепочек магнитосом соответственно.

Фигура 4: свойства единичных магнитосом, выделенных из клеток штамма АМВ-1 Magnetospirillumm magneticum и дополнительно обработанных ДСН при нагревании; (а) повышение температуры единичных магнитосом как функция от времени при приложении ПМП с частотой 108 кГц и амплитудой 23 мТл, линии демонстрируют изменения температуры единичных магнитосом, суспендированных в воде (суспензия) или в 2% агарозном геле (гель) соответственно; (b) то же, что в случае (а), для ПМП с амплитудой 88 мТл; (c) частные петли гистерезиса единичных магнитосом, измеренные при 23 мТл (квадратик) или 88 мТл (линия); (d) УМП, измеренная по угловому коэффициенту при 22°C графика скорости нагревания единичных магнитосом, находящихся либо в воде (суспензия), либо в геле (гель), как функция от амплитуды ПМП, гистерезисные потери, измеренные по площади частных петель гистерезиса единичных магнитосом, находящихся в геле (гистерезис); (e) столбчатые диаграммы, демонстрирующие УМП единичных магнитосом, измеренную при 23 мТл и 88 мТл. Прямоугольники представляют вклад в наблюдаемое повышение температуры гистерезисных потерь и вращения единичных магнитосом соответственно.

Фигура 5: (a-c) свойства выделенных из магнетотактических бактерий цепочек магнитосом, которые были синтезированы в отсутствие хелатирующих агентов и/или переходных металлов, отличных от железа. Гистограммы демонстрируют распределение по размерам магнитосом, (a), и по длине цепочек магнитосом, (b), для данного типа магнитосом. (c) изменение с течением времени температуры суспензии этого типа магнитосом, содержащих 406 мкг/мл маггемита, при воздействии на эту суспензию переменного магнитного поля с частотой 183 кГц и силой магнитного поля либо 43 мТл, либо 80 мТл; (d-f) свойства цепочек магнитосом, выделенных из магнетотактических бактерий, которые были синтезированы в присутствии 0,4 мкМ ЭДТА. Гистограммы демонстрируют распределение по размерам магнитосом, (d), и по длине цепочек магнитосом, (e), для данного типа магнитосом. (f) изменение с течением времени температуры суспензии, содержащей этот тип магнитосом с концентрацией маггемита 406 мкг/мл, при воздействии на эту суспензию переменного магнитного поля с частотой 183 кГц и силой магнитного поля либо 43 мТл, либо 80 мТл.

Фигура 6: (а) зависимость от времени значения изменения температуры нескольких суспензий, содержащих различные типы цепочек магнитосом, синтезированных в присутствии разных хелатирующих агентов (4 мкМ ЭДТА, 4 мкМ родамина В, 4 мкМ допамина, 4 мкМ алендроната) и 406 мкг/мл маггемита, при воздействии на эти суспензии переменного магнитного поля с частотой 183 кГц и силой магнитного поля либо 43 мТл, либо 80 мТл, (b) зависимость от времени значения изменения температуры двух суспензий, содержащих нелегированные и легированные кобальтом магнитосомы, собранные в цепочки. Концентрация этих суспензий составляет 1,52 мг/мл, и на них действует переменное магнитное поле с частотой 183 кГц и силой поля 80 мТл.

Фигура 7: свойства суспендированных клеток MDA-MB-231, инкубированных в отсутствие или в присутствии выделенных цепочек магнитосом с различными концентрациями (0,125 мг/мл<СγFe203<1 мг/мл, где CγFe203 представляет концентрацию маггемита в суспензиях) и подвергнутых воздействию переменного магнитного поля с частотой 183 кГц и при различных значениях силы (0 мТл<B<60 мТл, где В представляет силу приложенного магнитного поля), (a) процентная доля живых клеток MDA-MB-231 как функция от силы магнитного поля при инкубации суспензий цепочек магнитосом с различными концентрациями, (b)-(d) изменения температуры суспензий, содержащих клетки MDA-MB-231, инкубируемых в отсутствие или в присутствии цепочек магнитосом с различными концентрациями (0,125 мг/мл<CγFe203<1 мг/мл), при воздействии на эти суспензии переменного магнитного поля с В=20 мТл, (b), В=43 мТл, (c), или В=60 мТл, (d).

Фигура 8: (a)-(c) процентная доля живых адгезивных клеток MDA-MB-231 как функция от силы магнитного поля (0 мТл<В<60 мТл), воздействие которым осуществляли один раз в течение 20 мин. Клетки инкубировали в течение 24 ч, D1, (a), 48 ч, D2, (b), или 72 ч, D3, (c), либо в отсутствие, либо в присутствии выделенных цепочек магнитосом с различными концентрациями (0,125 мг/мл<СγFe203<1 мг/мл). (d) процентная доля живых адгезивных клеток MDA-MB-231 как функция от силы магнитного поля (0 мТл<B<60 мТл), воздействие которым осуществляли два раза в течение 20 мин. Клетки инкубировали в течение 72 ч в отсутствие или в присутствии выделенных цепочек магнитосом с различными концентрациями (0,125 мг/мл<CγFe203<1 мг/мл).

Фигура 9: (a-c) процент подавления клеток MDA-MB-231, инкубируемых в присутствии четырех различных суспензий, содержащих цепочки магнитосом (СМ), единичные магнитосомы (IM), SPION, покрытые цитратными ионами (SPION@цитрат), SPION, покрытые молекулами ПЭГ (SPION@ПЭГ, как функция от концентрации маггемита в этих четырех суспензиях; (d) процент клеток, которые приобрели магнитные свойства, как функция от времени инкубации, при инкубации вышеупомянутых четырех суспензий (0,125 мг/мл<CγFe203<1 мг/мл) в присутствии клеток MDA-MB-231 и приложении переменного магнитного поля 183 кГц и силой 43 мТл.

Фигура 10: (а) экспериментальная установка, применяемая для обработки мышей, содержит источник питания мощностью 10 кВт EasyHeat от компании Ambrell (Soultz, Франция), оборудованный спиралью диаметром 6,7 см, внутри которой генерируется ПМП различной силы (в диапазоне от 20 мТл до 80 мТл), мышь для обработки помещают внутрь спирали; (b) схематическое изображение, демонстрирующее нагреваемую опухоль и положение внутри опухоли, в котором происходит регистрация при измерении температуры в инфракрасном диапазоне; (c)-(f) исследование мышей, обработанных суспензиями единичных магнитосом (мыши 1-4); (с) изменения температуры опухоли и ректальной температуры при приложении магнитного поля во время обработки, эти температуры являются средним значением для различных мышей, прошедших обработку (мыши 1-3); (d) в случае мыши, демонстрирующей типичное поведение, распределение температур, измеренных внутри обработанной опухоли через 10 мин после начала обработки; (е) изменение нормированного объема опухоли для опухоли, в которую была инъецирована суспензия единичных магнитосом (мыши 1-3); объемы опухолей нормированы относительно объема опухоли во время обработки; (f) то же, что и в случае (е) для так называемой контрольной опухоли, в которую инъецировали только PBS (фосфатно-солевой буфер). В случае мыши 4 инъецировали суспензию единичных магнитосом, но не оказывали воздействие магнитным полем.

Фигура 11: исследование мышей, обработанных единичными магнитосомами (мыши 1-4). (a) фотографии обрабатываемой опухоли у мыши 1 сразу после обработки (D0), через 14 дней после обработки (D14) или через 30 дней после обработки (D30); (b) микрофотография опухолевой ткани, взятой через 30 дней после обработки мыши 2; (c) увеличенный фрагмент изображения (b), демонстрирующий присутствие бактериальных магнитосом (синий цвет или контрастное затемнение); (d) увеличенный фрагмент изображения (с), демонстрирующий агрегаты магнитосом.

Фигура 12: исследование мышей, обработанных суспензиями, содержащими цепочки магнитосом (мыши 5-9), (а) изменения температуры опухоли и ректальной температуры при приложении магнитного поля во время обработки (мыши 5-8), температура является средним значением для различных мышей (мыши 5-8); (b) в случае мыши, демонстрирующей типичное поведение, распределение температур, измеренных внутри обработанной опухоли через 10 мин после начала обработки; (с) изменение нормированного объема опухоли для опухоли, в которую была инъецирована суспензия, содержащая цепочки магнитосом, объем обработанной опухоли нормирован относительно объема опухоли во время обработки; (d) то же, что и в случае (c) для контрольной опухоли, в которую инъецировали только PBS. В случае мыши 9 инъецировали суспензию, содержащую цепочки магнитосом, но не оказывали воздействие на мышь магнитным полем.

Фигура 13: исследование мышей, обработанных суспензиями цепочек магнитосом (мыши 5-9), (a) фотографии обрабатываемой опухоли у мыши 5 сразу после обработки (DO), через 14 дней после обработки (D14), через 30 дней после обработки (D30); (b) микрофотография опухолевой ткани, взятой через 30 дней после обработки мыши 5, демонстрирующая присутствие бактериальных магнитосом (синий цвет или контрастное затемнение); (c) увеличенный фрагмент изображения (b); (d) увеличенный фрагмент изображения (с), демонстрирующий клетку с ядром, окруженным бактериальными магнитосомами.

Фигура 14: (a), (c), (e), (д) изменения температуры опухоли и ректальной температуры при введении в опухоль суспензий, содержащих стандартные цепочки магнитосом, (a), магнитосом с ЭДТА, (c), SPION@цитрата, (e), или SPION@ПЭГ, (g), и приложении переменного магнитного поля с частотой 183 кГц и силой 43 мТл в течение 20 мин. Обработку повторяют 3 раза, со временем отсутствия импульсов между двумя обработками, равным 1 дню; (b), (d), (f), (h) изменения нормированного объема опухоли (т.е. объема опухоли, измеренного в период со 2 по 30 день после обработки и деленного на объем опухоли, измеренный во время дня проведения обработки) в течение нескольких дней после обработки для стандартных цепочек магнитосом, (b), магнитосом с ЭДТА, (d), SPION@цитрата, (f), или SPION@ПЭГ, (h). В случаях (b), (d), (f) и (h) планки погрешностей и стандартные отклонения вычисляли с учетом нормированного объема опухоли у каждой мыши.

Фигура 15: (a), (c), (e), (д) фотографии мыши, демонстрирующие наилучшую противоопухолевую активность через 30 дней после обработки, вызванной теплом, для случаев обработки с применением стандартных цепочек магнитосом, (а), магнитосом с ЭДТА, (c), SPION@цитрата, (е), или SPION@ПЭГ; (g). (b), (d), (f), (h) изменения нормированного объема опухоли в течение нескольких дней после обработки для мыши, демонстрирующей наилучшую противоопухолевую активность и обработанной стандартными цепочками магнитосом, (b), магнитосомами с ЭДТА, (d), SPION@цитратом, (f), или SPION@ПЭГ, (h).

Фигура 16: процентная доля наночастиц в опухоли ((a), (c), (e), (g)) и в экскрементах ((b), (d), (f), (h)) во время инъекции (DO), через 3 дня после инъекции (D3), через 6 дней после инъекции (D6) и через 14 дней после инъекции (D14) для случая введения внутрь опухоли суспензий, содержащих цепочки магнитосом, (a), (b), или единичные магнитосомы, (c), (d), или SPION@цитрат, (e), (f), или SPION@ПЭГ, (g), (h).

Фигура 17: гистограммы, демонстрирующие распределения по размеру магнитосом для случаев выращивания магнетотактических бактерий в отсутствие бисфосфоновой кислоты, (a), в присутствии 4 мкМ ризедроната, (b), или в присутствии 4 мкМ альдероната, (c), гистограммы, демонстрирующие распределения по длине цепочек магнитосом для случаев выращивания магнетотактических бактерий в отсутствие бисфосфоновой кислоты; (d), в присутствии 4 мкМ ризедроната, (e), или в присутствии 4 мкМ альдероната, (f), изменения температур как функция от времени при приложении переменного магнитного поля с силой 43 мТл или 80 мТл к суспензии, содержащей цепочки магнитосом, синтезированных в отсутствие бисфосфоновой кислоты, (g), в присутствии 4 мкМ ризедроната, (h), или в присутствии 4 мкМ альдероната, (i).

Фигура 18: изменение температуры и размера опухоли у мыши, обработанной частицами SPION (мыши 10-13), (a) изменение температуры опухоли и ректальной температуры во время обработки, температура является средним значением для различных мышей, прошедших обработку (мыши 10-12); (b) в случае мыши, демонстрирующей типичное поведение, распределение температур, измеренных внутри обработанной опухоли через 10 мин после начала обработки; (c) изменение нормированного объема опухоли для опухоли, в которую была инъецирована суспензия частиц SPION@цитрата (мыши 10-13), объем обработанной опухоли нормирован относительно объема опухоли во время обработки; (d) то же, что и в случае (с), для контрольной опухоли, в которую инъецировали только PBS. В случае мыши 14 инъецировали раствор частиц SPION, но не оказывали воздействие на мышь магнитным полем.

ОПИСАНИЕ ПРИМЕРОВ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

Пример 1

Получение различных типов частиц, применяемых в качестве источников тепла:

В этом примере описаны способы, с помощью которых были получены различные типы частиц, применяемых в качестве источников тепла. Эти частицы являются частицами, содержащимися внутри цельных магнетотактических бактерий, цепочками магнитосом, выделенными из магнетотактических бактерий, единичными магнитосомами, выделенными из магнетотактических бактерий и отделенными от цепочек с помощью нагревания и обработки ДСН, химически синтезированными суперпарамагнитными наночастицами оксида железа, покрытыми цитрат-ионами (SPION©цитрат) или имеющимися в продаже химически синтезированными наночастицами, покрытыми молекулами ПЭГ (SPION@ПЭГ). SPION@ПЭГ приобрели у компании Micromod из Германии (название продукта: Nanomag®-D-spio, номер продукта: 79-00-201).

SPION@цитрат применяли в качестве стандартных наночастиц, так как они обладают схожими размерами с большинством наночастиц, применяемых для магнитной гипертермии (см., например: Johannsen et al., European Urology 2007, 52, 1653-1662 или другие литературные источники, перечисленные в начале настоящей заявки), и имеют химическое покрытие, которое солюбилизирует наночастицы, но не должно вызывать какой-либо противоопухолевой активности. SPION@ПЭГ также применяли в качестве стандартных наночастиц, так как они доступны для приобретения и являются такими же наночастицами, что применялись группой ДеНардо для осуществления магнитной гипертермии (см., например: De Nardo et al., Clin. Cancer Res. 2005, 11, 7087s-7092s). Эффективность цепочек магнитосом при термотерапии сравнивали с эффективностью этих двух стандартов (8РЮ1Ч@цитрата и SPI0N@ПЭГ).

Штамм АМВ-1 Magnetospirillum magneticum приобрели в АТСС (АТСС 700274). Клетки выращивали в микроанаэробных условиях при комнатной температуре (примерно 25°C) в жидкой культуре в немного измененной пересмотренной среде MSGM (среде АТСС 1653). В одном литре этой питательной среды содержится 0,68 г одноосновного фосфата калия, 0,85 г сукцината натрия, 0,57 г тартрата натрия, 0,083 г ацетата натрия, 225 мкл 0,2% резазурина, 0,17 г нитрата натрия, 0,04 г L-аскорбиновой кислоты, 2 мл 10 мМ раствора хината железа, 10 мл витаминного раствора Вольфа и 5 мл минерального раствора Вольфа. Раствор хината железа приготовили растворением 0,19 г хинной кислоты и 0,29 г FeCl3·6H2O в 100 мл дистиллированной воды. Минеральный раствор Вольфа содержал в 1 литре дистиллированной воды 0,5 г нитрилтриуксусной кислоты (НТА, C6H9NO6), 1,5 г сульфата магния семиводного (MgSO4·7H2O), 1 г хлорида натрия, 0,5 г сульфата марганца (MnSO4·7H2O), 100 мг сульфата железа семиводного (FeSO4·7H2O), 100 мг нитрата кобальта (Co(NO3)2·7H2O), 100 мг хлорида кальция (CaCl2), 100 мг сульфата цинка семиводного (ZnSO4·7H2O), 10 мг сульфата меди пятиводного (CuSO4·5H2O), 10 мг сульфата алюмокалия двенадцативодного (AIK(SO4)·12H2O), 10 мг борной кислоты (H3BO3), 10 мг молибдата натрия (Na2MoO4·2H2O), 2 мг селенита натрия (Na2SeO3), 10 мг вольфрамата натрия двуводного (Na2WO4·2H2O) и 20 мг хлорида никеля (NiCl2·6H2O). Витаминный раствора Вольфа приготовили растворением в 1 литре дистиллированной воды 2,2 мг фолиевой кислоты (витамина В9), 10,2 мг пиридоксина (витамина В6), 5,2 мг рибофлавина (витамина В2), 2,2 мг биотина (витамина H или B7), 5,2 мг тиамина (витамина В1), 5,2 мг никотиновой кислоты (витамина B3 или РР), 5,2 мг пантотеиновой кислоты (витамина B5), 0,4 мг витамина В12, 5,2 мг аминобензойной кислоты, 5,2 мг тиоктовой кислоты и 900 мг фосфата калия. Значение pH питательной среды подвели до 6,85 с помощью 5 М раствора гидроксида натрия. Клетки собирали, как описано ниже, при достижении стационарной фазы. Стационарная фаза наступала, когда среда становилась полностью восстановленной, о чем свидетельствовало изменение окраски питательной среды с розовой на бесцветную.

Из интактных цельных клеток М.Magneticum приготовили три разных типа проб. Клетки собирали при достижении стационарной фазы центрифугированием при 8000 об./мин. в течение 15 мин. Супернатант (истощенную питательную среду) отбрасывали и ресуспендировали клетки в 3 мл деионизированной воды. В случае суспензий цельных интактных клеток пробу не подвергали дополнительной обработке. Полученная с помощью ТЭМ микрофотография на фиг.1(a) демонстрирует одну типичную магнетотактическую бактерию штамма МВ-1, содержащую несколько цепочек магнитосом.

Для выделения цепочек магнитосом 1 мл суспензии клеток повторно центрифугировали и ресуспендировали в 10 мМ буфере трис-HCl (рН 7,4), а затем обрабатывали ультразвуком в течение 120 мин. при 30 Вт, чтобы осуществить лизис клеток и высвобождение цепочек магнитосом. Также был протестирован и признан допустимым для выделения цепочек магнитосом из бактерий период обработки ультразвуком, равный 60 и 180 мин. В случае периода обработки ультразвуком менее 60 мин. лизису подвергались не все магнетотактические бактерии, тогда как при периоде обработки ультразвуком более 180 мин. начинала наблюдаться агрегация, вызванная присутствием единичных агрегированных магнитосом.

После обработки ультразвуком суспензию цепочек магнитосом отделяли с применением магнитных методов, помещая сильный неодимовый магнит (0,1-1 Тл) рядом с пробиркой, в которой магнитный материал собирался в виде осадка. Супернатант, содержащий клеточный детрит и другой органический материал, удаляли. Цепочки магнитосом промывали таким образом 10 раз буфером с 10 мМ трис-HCl (pH 7,4) и затем ресуспендировали в стерильной деионизированной воде. Типичный комплекс цепочек магнитосом, выделенных из цельных бактерий, показан на полученной с применением ТЭМ микрофотографии на фиг.1(b). Поверхностный заряд цепочек магнитосом измеряли как функцию от значения рН, используя показатели динамического рассеяния света (NanoZetasizer, Malvern instruments Ltd). При физиологическом значении pH видно (см. фиг.1(e)), что поверхностный заряд цепочек магнитосом является отрицательным, на уровне -22 мВ. Измерения в инфракрасном диапазоне проводили с применением спектрометра Nicolet 380 FT IR Thermo Electro. Также регистрировали инфракрасный спектр поглощения суспензии цепочек магнитосом. Он демонстрировал наличие пиков, соответствующих функциональным группам карбоновых кислот, амино-, амидо-групп, фосфатных групп (P-O), что свидетельствует о присутствии белков и фосфолипидов в суспензии цепочек магнитосом. Этот результат предполагает, что в данной пробе присутствуют как мембраны, окружающие магнитосомы, так и филаменты, образующие связи между магнитосомами (D.Faivre et al, Chem. Rev., 2008, 108, 4875-4898).

Единичные магнитосомы (т.е. магнитосомы, которые не организованы в цепочки) получали нагреванием суспензии цепочек магнитосом в течение пяти часов при 90°C в присутствии 1% додецилсульфата натрия (ДСН) в деионизированной воде для удаления большей части биологического материала, окружающего магнитосомы, т.е.,большей части мембран, окружающих магнитосомы, и элементов цитоскелета, отвечающих за выстраивание магнитосом в единичную цепочку (D.Faivre, Chem. Rev., 2008, 108, 4875-4898). Единичные магнитосомы промывали, как описано для цепочек магнитосом, и ресуспендировали в деионизированной воде. Полученная с применением ТЭМ микрофотография на фиг.1(c) демонстрирует типичный комплекс единичных магнитосом. Единичные магнитосомы обладают свойствами, отличными от свойств цепочек магнитосом. Они образуют агрегированный комплекс наночастиц (фиг.1 (c)). Они несут поверхностный заряд, который в существенной степени зависит от их уровня агрегации. Когда единичные магнитосомы обрабатывают ультразвуком и диспергируют в воде, они обладают поверхностным зарядом, схожим с таковым у цепочек магнитосом при pH 7. Однако при агрегации единичные магнитосомы приобретают положительный заряд (10 мВ при pH 7, фиг.1(e)). Единичные магнитосомы окружены фосфолипидными кислотами (присутствует пик P-O в инфракрасном спектре поглощения на фиг.1(f)), но не белками (отсутствие амида в инфракрасном спектре поглощения на фиг.(f)), и это свидетельствует о том, что биоматериал, который окружает магнитосомы, не был удален полностью, но был в достаточной степени денатурирован для образования единичных магнитосом, не организованных в цепочки.

Химически синтезированные наночастицы (SPION@цитрат) приготовили согласно протоколу, описанному ранее (Lalatonne et al., Phys. Rev. E, 2005, 71, 011404-1, 011404-10). Для приготовления частиц γFe2O3 без покрытия сперва добавили раствор основания (диметиламина) в водный мицеллярный раствор додецилсульфата железа (Fe(DS)2) и перемешали. Конечные концентрации реагентов составили 1,3×10-2 моль/л и 8,5×10-1 моль/л для Fe(DS)2 и диметиламина, соответственно. После этого раствор энергично перемешивали в течение 2 ч при 28,5°C и полученный в результате осадок нанокристаллов без покрытия выделяли из супернатанта центрифугированием. На втором этапе осадок промывали раствором кислоты (HNO3, 10-2 моль/л) до достижения в растворе значения pH 2. Для покрытия наночастиц применяли цитрат натрия, растворенный воде ([Na3C6O7H5]=1,5×10-2 моль/л). Раствор подвергали обработке ультразвуком в течение 2 ч при 90°C, и добавление ацетона вызвало осаждение нанокристаллов. После промывки большим избытком ацетона высушили осадок на воздухе. На последнем этапе нанокристаллы, покрытые ионами цитрата, диспергировали в воде. Значение pH, которое первоначально составляло примерно pH 2, постепенно повысили до pH 7,4 добавлением раствора гидроксида натрия NaOH (10-1 моль/л). Частицы SPION@цитрат состоят из маггемита и обладают средним размером примерно 10 нм. Полученная с применением ТЭМ микрофотография частиц SPION@цитрат представлена на фиг.1(d).

Подробную информацию о свойствах SPION@ПЭГ можно получить в компании Micromod. В предоставляемом компанией Micromod информационном листке (продукт №79-00-201) указано, что SPION@ПЭГ обладают намагниченностью насыщения 34 A×м2/кг, размером примерно 20 нм, полидисперсностью менее 20% и что они стабильны в водных буферных растворах со значениями pH>4.

Пример 2:

Выработка тепла бактериальными магнитосомами, подвергнутыми воздействию переменного магнитного поля.

В этом примере представлено подробное исследование механизмов выработки тепла магнитосомами, биоминерализованными магнетотактическими бактериями. Значения частоты магнитного поля (108 кГц) и амплитуды магнитного поля (от 23 до 88 мТл), применяемые для нагревания различных проб, находятся в пределах диапазона параметров магнитного поля, применяемых для проведения гипертермии с помощью высокочастотного высокоамплитудного ПМП (переменного магнитного поля) (Ivkov et al, Clin. Cancer Res., 2005, 11, 7093s-7103s; De Nardo et al, Clin. Cancer Res., 2005, 11, 7087s-7092s; De Nardo et al, The J. Nucl. Med., 2007, 48, 437-444). Для гипертермии с помощью ПМП рекомендованные значения частоты магнитного поля находятся в диапазоне от 50 кГц до 1 МГц, а амплитуду магнитного поля необходимо поддерживать на уровне ниже 100 мТл (Momet et al, J. Mater. Chem., 2004, 14, 2161-2175). Проводится сравнение теплопродуцирующих свойств трех различных типов комплексов магнитосом (Alphandery et al, J. Phys. Chem. C, 2008, 112, 12304-12309; Alphandery et al, ACS Nano, 2009, 3, 1539-1547): 1) цепочек магнитосом, содержащихся внутри интактных магнетотактических бактерий штамма АМВ-1; 2) выделенных из бактерий цепочек магнитосом, которые сохранили свои мембраны магнитосом; и 3) кристаллов единичных магнитосом, у которых мембраны магнитосом были в основном удалены. Известно, что в случае крупных ферромагнитных наночастиц имеется два основных механизма выработки тепла. Первый механизм реализуется благодаря физическому вращению магнитных наночастиц в магнитном поле, а второй является результатом гистерезисных потерь (Hergt et al, IEEE Trans. Mag., 1998, 34, 3745-3754). Для выяснения того, какой из этих механизмов отвечает за выработку тепла тремя различными типами комплексов магнитосом, упомянутыми выше, проведено сравнение скорости нагревания проб в воде, где возможно вращение клеток и магнитосом, со скоростью нагревания в геле, где вращение затруднено. Таким образом можно определить количество тепла, выработанного в результате вращения бактерий или магнитосом, и количество тепла, источником которого являются гистерезисные потери. Для того, чтобы убедиться, что источником тепла, выработанного в геле, являются гистерезисные потери, проведено независимое измерение гистерезисных потерь с применением магнитных измерений.

Материалы и методы:

Пробы исследовали с использованием трансмиссионного электронного микроскопа JEOL, модель JEM 1011 (JEOL Ltd., Токио, Япония) при 100 кВ. Пять микролитров раствора, содержащего 2×10-4 мас.% магнитосом, наносили на покрытую углеродом медную секу, и сетки перед исследованием высушивали. Для приготовления всех проб брали одинаковое относительное количество магнитосом, таким образом, агрегация в конкретной пробе не являлась результатом различий в концентрациях магнитосом.

Магнитные измерения проводили с применением магнитометра с вибрирующим образцом (VSM, Quantum design, Сан-Диего, Калифорния, США). Для проведения магнитных измерений 25 мкл жидкой суспензии клеток магнетотактических бактерий, цепочек магнитосом или единичных магнитосом, содержащей 2×103 мас.% магнитосом, наносили на поверхность кремневой подложки. После этого пробы расположили внутри капсулы, изготовленной из твердого желатина, в направлении, параллельном направлению магнитного поля. Провели три типа магнитных измерений: изотермической остаточной намагниченности насыщения (SIRM) и предельных или частных петель гистерезиса. Показатели SIRM применяли для определения композиции магнитосом, согласно способу, схожему с описанным ранее (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309), и показали, что магнетит в составе магнитосом был почти полностью окислен до маггемита. Этот результат не был неожиданным, так как наши суспензии магнитного материала не были свежеприготовленными, а известно, что магнетит в составе магнитосом с течением времени окисляется до маггемита (Chen et al., Earth Planet. Sci. Lett, 2005, 240, 790-802). Маггемит и магнетит обладают весьма схожими магнитными свойствами при комнатной температуре (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309). Тот факт, что магнетит магнитосом превратился в маггемит, не влияет в существенной степени на выводы, сделанные в данном исследовании, так как маггемит и магнетит обладают весьма схожими магнитными свойствами при комнатной температуре (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309). Измерения предельных петель гистерезиса проводили при 300 K с целью определения количества маггемита, содержащегося в пробах. Последний показатель определяют путем деления значения намагниченности насыщения проб на значение намагниченности насыщения маггемита. В случае таких крупных наночастиц, какими являются кристаллы магнитосом, намагниченность насыщения соответствует таковой основного материала (в данном случае - служащего основой маггемита). Наконец, измерения частных петель гистерезиса проводили путем регистрации намагниченности проб как функции от постоянного магнитного поля, которое прикладывали в диапазоне от -Н0 до Н0, где Н0 равно 23 мТл, 36 мТл, 66 мТл или 88 мТл.

Эти эксперименты проводили на цельных бактериях, цепочках магнитосом и единичных магнитосомах, которые были либо суспендированы в ультрачистой деионизированной воде (18.6 Mfi), либо находились в приготовленном на воде агарозном геле (2 мас.%). Концентрация маггемита составила 457 мкг/мл в случае жидкой суспензии, содержащей цельные клетки, 435 мкг/мл в случае суспензии, содержащей цепочки магнитосом, и 380 мкг/мл в случае суспензии, содержащей единичные магнитосомы. 250 мкл каждой из этих суспензий внесли в полипропиленовые пробирки и поместили в центр спирали, вырабатывающей переменное магнитное поле с частотой 108 кГц и с фиксированной амплитудой поля 23 мТл, 36 мТл, 66 мТл или 88 мТл. Для выработки переменного тока спираль подсоединили к генератору (Celes inductor С97104), и измеряли температуру с помощью волоконно-оптического зонда (Luxtron STF-2, BFi OPTiLAS SAS).

Результаты и обсуждение:

На фиг.1(a) приведена трансмиссионная электронная микрофотография (ТЭМ) клеток штамма АМВ-1 Magnetospirillum magneticum, демонстрирующая типичные цепочки магнитосом. Объем, занимаемый магнитосомами в цельной клетке, достаточно мал, в типичном случае примерно 0,02%. Водную суспензию, содержащую интактные цельные клетки M.magneticum, подвергли воздействию переменного магнитного поля с частотой ν=108 кГц и амплитудой поля H0=23 мТл и Н0=88 мТл. Скорости нагревания клеток, суспендированных в жидкости, возрастали при усилении магнитного поля с 23 мТл до 88 мТл (фиг.2(a) и 2(b)). По значениям угловых коэффициентов изменения с течением времени температуры, измеренной при 22°C (ΔT/δT), вычислили УМП (SAR) интактных клеток, суспендированных в жидкости, используя равенство 1, приведенное ниже (Mornet et al., J. Mater. Chem., 2004, 14, 2161-2175; Hergt et al., J. Magn. Magn. Matter., 2005, 293, 80-86):

где Cwater - это удельная теполемкость воды (Cwater=4,184 Дж/г×К) и xm - это концентрация железа (в граммах) на миллилитр растворителя (воды). Используя указанную выше формулу, выяснили, что УМП суспензии цельных бактерий повысилась с 108±32 Вт/гFe до 864±130 Вт/г при увеличении амплитуды магнитного поля с 23 мТл до 88 мТл. Для определения того, является ли количество тепла (УМП), вырабатываемого цельными магнетотактическими бактериями, результатом вращения цельных бактерий, гистерезисных потерь или обоих этих механизмов, измерили площади частных петель гистерезиса цельных интактных клеток (фиг.2(c)), что позволило оценить гистерезисные потери цельных клеток. С помощью метода Хергта с коллегами (Hergt et al., J. Magn. Magn. Matter., 2005, 293, 80-86) и на основании данных о площади частных петель гистерезиса, показанных на фиг.2(c), выяснили, что гистерезисные потери интактных клеток увеличились с 54±25 Вт/ГFe при 23 мТл до 810±121 Вт/г при 88 мТл. Эти значения УМП схожи со значениями, измеренными для бактериальных клеток в суспензии (фиг.2(d)). Неожиданно, значение УМП, определенное для клеток, зафиксированных в агарозном геле, было существенно меньше, чем значение площадей частных петель гистерезиса и, по-видимому, не позволяло провести точную оценку гистерезисных потерь (фиг.2(d)). Это могло быть вызвано потерей некоторого количества бактериальных клеток во время приготовления геля, что привело к снижению концентрации магнитосом, по сравнению с другими пробами. Исходя из этих результатов сделан вывод, что вращение интактных бактериальных клеток не вносит вклад в выработку тепла в данном случае. Из-за большой массы и объема интактные клетки М.magneticum не способны вращаться в достаточной степени при приложении внешнего магнитного поля, чтобы вырабатывать тепло. Отсутствие вклада вращения можно подтвердить оценкой УМП, обусловленной вращением бактериальных клеток, SARrot. Последний показатель вычисляют, используя равенство 2, приведенное ниже (Hergt et al., IEEE Trans. Mag. 1998, 34, 3745-3754).

В равенстве (2) сделано допущение, что время броуновской релаксации, τb, намного меньше, чем время неелевской релаксации τn, где τn=3ηV/KbT и τn0ехр(Еа/Kb/T). Для различных проб значение ть лежит в диапазоне от 2,5×10-5 с до 0,3 с (Mornet et al, J. Mater. Chem., 2004, 14, 2161-2175). При условии, что τ0~10-9 с и соотношение между энергией анизотропии цепочки магнитосом и тепловой энергией, Ea/KbT~480 (Alphandery et al., ACS Nano 2009, 3, 1539-1547), обнаружено, что τn~1038 с и, следовательно, τbn<<1. Это подтверждает возможность использования равенства (2) для определения УМП. В равенстве 2: ω=2πf, где f=108 кГц - это частота переменного магнитного поля, Ms - это намагниченность насыщения маггемита (Ms=390×103 А/м), Н0 - это амплитуда приложенного магнитного поля (23 мТл<Н0<88 мТл), V~20×10-17 см3 - это объем типичной цепочки магнитосом (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309), ρ~5 г/см3 - плотность маггемита, Kb~1,38×10-23 Дж/К - постоянная Больцмана и τb~10 c - время броуновской релаксации интактной бактериальной клетки в воде. Время броуновской релаксации вычисляют, используя формулу τb=3ηVh/KbT, где Vh - это гидродинамический объем. Для цельных магнетотактических бактерий приняли, что Vh=4/3πr3, где r - это половина типичной длины бактерии (1,5 мкм). Используя эти значения, установили, что значение SARrot находится в диапазоне от 5×10-2 Вт/гFe до 7×10-1 Вт/гFe для значений H0 от 23 до 88 мТл. Эти значения намного ниже, чем измеренная УМП, вызванная гистерезисными потерями, которая составляет примерно 82±58 Вт/гFe при 23 мТл и примерно 841±153 Вт/гFe при 88 мТл (фиг.2(d)), где данные значения представляют собой среднее значений УМП, определенной по скорости нагревания в растворе, и УМП, определенной по показателям частных петель гистерезиса. Таким образом, вращение цельных бактериальных клеток, по-видимому, не вносит вклада в наблюдаемое повышение температуры. Как показано на фиг.2(d), УМП, по-видимому, полностью обусловлена гистерезисными потерями. Эти потери становятся намного более существенными при более высоких амплитудах магнитного поля (УМП ~841±153 Вт/гFe при 88 мТл), чем при 23 мТл (УМП ~82±58 Вт/гFe)). Этот факт, повышение гистерезисных потерь при повышении амплитуды магнитного поля, ранее наблюдали в случае химически синтезированных магнитных наночастиц (Hergt et al., IEEE Trans. Mag., 1998, 34, 3745-3754). Значение УМП на цикл для суспензии цельных клеток, которое определяют как значение УМП, деленное на частоту переменного магнитного поля, находится в диапазоне от 0,7±0,5 Дж/кгFe до 7,8±1,4 Дж/кгFe. Эти значения выше, чем большинство значений, полученных для химически синтезированных магнитных наночастиц, которые в типичном случае находятся в диапазоне от 0,001 Дж/кгFe до 1,2 Дж/кгFe для широкого спектра размеров и композиций магнитных частиц, а также для большого выбора частот и амплитуд магнитного поля (Dutz et al, J. Magn. Magn. Mater., 2007, 308, 305-312; Ma et al., J. Magn. Magn. Mater., 2004, 268, 3339; Jordan et al., J. Nano. Res., 2003, 5, 597-600; Brusentsov et al., J. Magn. Magn. Mater., 2001, 225, 113-117; Chan et al., Scientific and clinical applications of magnetic carriers, Hafeli et al. (eds.), Plenum Pres, NY, 1997, 607-618). Сделан вывод о том, что суспензии цельных магнетотактических бактерий вырабатывают большее количество тепла, чем большая часть химически синтезированных магнитных наночастиц в использованных нами экспериментальных условиях.

Цепочки магнитосом выделили из бактериальных клеток для того, чтобы, предположительно, усилить их вращение в магнитном поле в отсутствие клеточных структур, препятствующих вращению. Для того, чтобы убедиться в том, что магнитосомы действительно были выделены из бактерий и сохранились в виде цепочек, использовали электронную микроскопию. На фиг.1(b) показан типичный комплекс цепочек магнитосом (Alphandery et al., ACS Nano., 2009, 3, 1539-1547; Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309), которые не агрегируют в комки, но расположены достаточно близко друг к другу, как цепочки, между которыми имеется магнитное взаимодействие. Скорости выработки тепла цепочками магнитосом показаны на фиг.3(a) и 3(b) для амплитуд магнитного поля 23 мТл и 88 мТл, соответственно. В растворе они характеризуются повышением примерно на 43°C в течение периода времени 1500 с при 23 мТл (фиг.3(a)) и повышением примерно на 48°C в течение того же периода времени при 88 мТл (фиг.3(b)). Эти скорости нагревания примерно в 2-10 раз выше, чем скорости, полученные для цельных клеток (фиг.2(a), 2(b), 4(a) и 4(b)). Это предполагает, что либо в случае цепочек магнитосом происходят более существенные гистерезисные потери, чем в случае интактных бактериальных клеток, либо вращение в переменном магнитном поле вносит вклад в выработку тепла, либо действуют оба этих фактора. Для выяснения того, объясняют ли данные предположения более высокие скорости выработки тепла, и если да, то какие именно из них, осуществили определение гистерезисных потерь цепочек магнитосом. Фиг.3(c) демонстрирует частные петли гистерезиса для цепочек при 23 мТл и 88 мТл. Площади частных петель гистерезиса для цепочек магнитосом были меньше, чем площади, полученные в случае интактных бактериальных клеток (фиг.2(c)). Это снижение, вероятно, происходит из-за магнитных взаимодействий между цепочками магнитосом (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309), и следовательно, сделан вывод о том, что более высокая скорость выработки тепла, наблюдаемая в случае цепочек магнитосом, по сравнению с интактными бактериальными клетками, суспендированными в жидкости, вызвана не повышением гистерезисных потерь, а вращением цепочек. Вклад вращения в выработку тепла цепочками магнитосом можно дополнительно подтвердить оценкой УМП цепочек магнитосом, суспендированных в жидкости. Используя равенство (1) и значения ΔT/δT для цепочек магнитосом в суспензии (фиг.3(a) и 3(b)), обнаружили, что УМП повышается с ~864±86 Вт/гFe при 23 мТл до -1242±124 Вт/гFe при 88 мТл (фиг.3(d)). Эти значения УМП выше, чем гистерезисные потери, определенные как по значения УМП для цепочек магнитосом в геле (УМП ~54±22 Вт/гFe при 23 мТл и УМП ~487±97 Вт/гFe при 88 мТл), так и по площадям частных петель гистерезиса (УМП ~108±41 Вт/гFe при 23 мТл и УМП ~486±97 Вт/гFe при 88 мТл). Для подтверждения вклада вращения в механизм выработки тепла цепочками магнитосом провели определение значения УМП, SARrot, используя равенство 2, которое учитывает время броуновской релаксации. Эта формула применима только в случаях, когда еще не наступило насыщение, и когда УМП демонстрирует сильную зависимость от амплитуды поля (Hergt et al., IEEE Trans. Mag., 1998, 34, 3745-3754). Так как насыщение происходит на уровнях выше ~36 мТл (фиг.3(d)), УМП измеряли только при 23 мТл. Используя значение времени броуновской релаксации τB~1,2×10-4 с, обнаружили, что SARrot составляет примерно 3600 Вт/гFe при 23 мТл, что больше, чем значение УМП, равное 774±145 Вт/гFe, полученное экспериментально путем измерения разницы между УМП цепочек магнитосом, суспендированных в жидкости (864±86 Вт/гFe), и УМП, вызванной гистерезисными потерями (90±59 Вт/гFe). Разницу между теоретическим предсказанием и экспериментальным наблюдением можно объяснить частичной агрегацией цепочек магнитосом. Сделан вывод о том, что вращение вносит вклад в механизм нагревания, вызванного цепочками магнитосом, и что этот вклад снижается с 90±10% УМП при 23 мТл до 40±10% той же УМП при 88 мТл (фиг.3(c). Это снижение можно объяснить более существенным увеличением при росте амплитуды магнитного поля гистерезисных потерь, по сравнению с УМП, вызванной вращением цепочек магнитосом в магнитном поле (Hergt et al., IEEE Trans. Mag. 1998, 34, 3745-3754).

Последняя протестированная проба представляла собой суспензию единичных магнитосом, чьи мембраны в основном были удалены с помощью сочетания нагревания и детергента, растворяющего липиды, додецилсульфата натрия (ДСН). Эти кристаллы не сохраняют организацию в цепочки, как показано на фиг.1(c). Эти нанокристаллы взаимодействуют и организуются в компактные комплексы единичных нанокристаллов (Alphandery et al., ACS Nano., 2009, 3, 1539-1547; Alphandery et al., J. Phys. Chem., 2008, 112, 12304-12309; Kobayashi et al.. Earth Planet. Sci. Lett, 2006, 245, 538-555), в отличие от магнитосом с мембранами, показанных на фиг.1(b). Скорости нагревания жидких суспензий, содержащих эти единичные магнитосомы, показаны на фиг.4(a) и 4(b) для амплитуд магнитного поля 23 мТл и 88 мТл. Они ниже, чем скорости, наблюдаемые в случае цепочек магнитосом, суспендированных в жидкости, как при 23 мТл, так и при 88 мТл (фиг.3(a), 3(b), 4(a) и 4(b)). Различие в скоростях нагревания растворов, наблюдаемое для цепочек магнитосом и для единичных магнитосом, может быть вызвано различием во вкладе вращения магнитосом или гистерезисных потерь в УМП, либо сочетанием обоих этих факторов. Гистерезисные потери оценивали либо по площадям частных петель гистерезиса (фиг.4(c)), что дало значения УМП в диапазоне от 270±100 Вт/гFe при 23 мТл до 427±85 Вт/гРе при 88 мТл, либо по скоростям нагревания для единичных магнитосом в геле (фиг.4(a) и 4(b)), что дало значения УМП в диапазоне от 135±70 Вт/гРе при 23 мТл до 432±86 Вт/гFe при 88 мТл. Значения гистерезисных потерь, полученные любым их двух вышеупомянутых способов (фиг.4(d)), схожи со значениями, полученными для цепочек магнитосом (фиг.3(d)). Следовательно, различие в значениях УМП, наблюдаемое между цепочками магнитосом и единичными магнитосомами, суспендированными в жидкости, должно быть результатом различия в способности этих структур вращаться в магнитном поле. Равенство 2 предсказывает, что УМП, обусловленная вращением единичных магнитосом, суспендированных в жидкости, должна быть такой же, как и УМП, определенная для цепочек магнитосом, SARrot ~3600 Вт/гFe при 23 мТл. Следовательно, более низкая скорость нагревания, наблюдаемая для единичных магнитосом, скорее всего, обусловлена тем фактом, что последние более склонны к агрегации в комки, чем цепочки магнитосом. Агрегация единичных магнитосом явно видна при использовании электронной микроскопии (фиг.1(c)), а также ее можно наблюдать визуально в жидкой суспензии. Этот факт мешает этим магнитосомам вращаться столь же свободно, как и цепочки магнитосом.

Исходя из этих результатов можно сделать следующие заключения:

(i) УМП каждой из трех магнитных проб (цельных магнетотактических бактерий, цепочек магнитосом и единичных магнитосом) выше, чем сообщаемая УМП для более мелких суперпарамагнитных наночастиц.

(ii) Основной вклад в выработку тепла интактными бактериальными клетками, по-видимому, принадлежит гистерезисным потерям, тогда как в случае выработки тепла цепочками магнитосом и единичными магнитосомами вклад вносят и физическое вращение, и гистерезисные потери.

(iii) В противоположность своему поведению в растворе, цепочки магнитосом и единичные магнитосомы, по-видимому, будут в меньшей степени способны вращаться in vivo. Следовательно, количество тепла, которое они будут вырабатывать in vivo, можно было бы прогнозировать путем измерения их гистерезисных потерь. Так как цепочки магнитосом и единичные магнитосомы имеют схожие гистерезисные потери, они, предположительно, в равной степени являются хорошими кандидатами для термотерапии in vivo.

Пример 3:

Улучшенная теплопроизводительность выделенных цепочек магнитосом, полученных при выращивании магнетотактических бактерий в присутствии различных хелатирующих агентов и/или переходных металлов.

В данном примере описаны различные способы улучшения теплопроизводительности выделенных цепочек магнитосом, суспендированных в воде. В этих способах применяют различные добавки, вносимые в питательную среду для штамма АМВ-1 магнетотактических бактерий. Эти добавки являются хелатирующими агентами, такими как молекулы бисфосфоната, допамин, родамин, ЭДТА, или переходными металлами, такими как кобальт.

Материалы и методы:

Питательную среду для магнетотактических бактерий сперва приготовили тем же способом, что описан в примере 1. Затем в питательную среду для магнетотактических бактерий внесли одну из следующих добавок: 0,4 мкМ, 4 мкМ или 40 мкМ различных типов бисфосфоновых кислот (алендроната, ризедроната или неридроната), 4 мкМ, 20 мкМ или 400 мкМ раствор родамина, 0,4 мкМ или 4 мкМ раствора ЭДТА, 0,4 мкМ, 4 мкМ или 40 мкМ раствора допамина, 2 мкМ или 20 мкМ раствора хината кобальта. Один миллилитр суспензии магнетотактических бактерий вносили в один литр указанной выше питательной среды и выращивали бактерии в течение 10 дней. Через 10 дней выращивания бактерии собирали и выделяли из бактерий цепочки бактериальных магнитосом, следуя тому же протоколу, что описан в примере 1. Пять микролитров суспензии цепочек бактериальных магнитосом, содержащей 2×10-4 мас.% магнитосом, наносили на поверхность углеродной сетки для анализа с применением трансмиссионной электронной микроскопии (ТЭМ). ТЭМ применяли для определения размеров магнитосом и определения длин цепочек. Для проведения оценки нагревательных свойств различных типов выделенных цепочек магнитосом последние смешивали в воде. Концентрации различных суспензий определяли как количество маггемита на миллилитр. Они составили 0,3 мг/мл для суспензии, содержащей магнитосомы, синтезированные в присутствии нескольких бисфосфоновых кислот, 1,52 мг/мл для суспензии, содержащей легированные кобальтом магнитосомы, и 0,406 мг/мл для суспензии, содержащей магнитосомы, синтезированные в присутствии ЭДТА, родамина, допамина или алендроната. Суспензии нагревали, прикладывая переменное магнитное поле с частотой 183 кГц и силой 43 мТл иди 80 мТл. Изменение температуры этих суспензий измеряли с помощью микрозондатермопары (IT-18, Physitemp, Клифтон, США).

Результаты и обсуждение:

В данном разделе проводится сравнение свойств цепочек магнитосом, которые были получены путем культивирования магнетотактических бактерий в стандартных условиях, т.е., в отсутствие хелатирующих агентов и/или переходных металлов (СМ-контроль), со свойствами магнитосом, которые были получены путем культивирования магнетотактических бактерий в присутствии 0,4 мкМ ЭДТА (СМ-ЭДТА). Приведены результаты для СМ-ЭДТА, так как они показали наиболее существенное изменение свойств магнитосом, т.е., самое большое увеличение размеров магнитосом, длин цепочек магнитосом и теплопроизводительности, при сравнении с СМ-контролем.

Как видно из гистограмм на фиг.5(a) и 5(d), как в случае СМ-контроля, так и в случае СМ-ЭДТА распределения магнитосом по размерам, по-видимому, являются бимодальными, с более высоким процентным содержанием крупных магнитосом, чем мелких. Процентное содержание крупных магнитосом выше в случае СМ-ЭДТА (фиг.5(d)), чем в случае СМ-контроля (фиг.5(a)). Более того, кривые, построенные по данным о распределении магнитосом по размерам, свидетельствуют, что размер крупных магнитосом увеличивается от примерно 42 нм в случае СМ-контроля (фиг.5(a)) до примерно 60 нм в случае СМ-ЭДТА (фиг.5(d)). Также наблюдали, что процентное содержание маленьких магнитосом (<30 нм) существенное в случае СМ-контроля (>25%, фиг.5(a)), но невелико в случае СМ-ЭДТА (<10%, фиг.5(d)). Как можно наблюдать при сравнении гистограмм, представленных на фиг.5(b) и 5(e), средняя длина цепочки магнитосом также увеличивается от примерно 150 нм в случае СМ-контроля (фиг.5(b)) до примерно 300 нм в случае СМ-ЭДТА (фиг.5(e)). Длинные цепочки магнитосом (>800 нм в длину) присутствуют только в случае СМ-ЭДТА (фиг.5(e)). При приложении переменного магнитного поля к суспензиям, содержащим СМ-ЭДТА, оно вызывает повышение температуры, которое больше в случае СМ-ЭДТА, чем в случае СМ-контроля при обоих значениях силы магнитного поля: 43 мТл и 80 мТл (фиг.5(c) и 5(f)). Более того, температуры насыщения для СМ-ЭДТА (35°C при 43 мТл и 45°С при 80 мТл, фиг.5(f)) в обоих случаях выше, чем температуры, наблюдаемые для СМ-контроля (28°C при 43 мТл и 35°C при 80 мТл, фиг.5(c)). Эти особенности выявляют более высокую теплопроизводительность СМ-ЭДТА, по сравнению с СМ-контролем, что можно объяснить увеличением размеров магнитосом и/или длин цепочек магнитосом.

В случае введения в бактериальную питательную среду ряда других хелатирующих агентов могли наблюдаться тенденции, схожие с таковыми, наблюдаемыми при применении 0,4 мкМ ЭДТА, но с менее выраженным эффектом. Как видно на фиг.6(a), температура быстрее возрастала при приложении переменного магнитного поля с силой 43 мТл или 80 мТл к цепочкам магнитосом, полученным из бактерий, культивируемых в присутствии различных хелатирующих агентов (4 мкМ родамина В, 4 мкМ допамина, 4 мкМ алендроната), чем к СМ-контролю.

Когда магнитосомы синтезировали в присутствии 4 мкМ ризедроната или 4 мкМ алендроната, процентное содержание магнитосом с размерами более чем 45 нм становится больше, чем в случае магнитосом, синтезированных в отсутствие бисфосфоновой кислоты (фиг.17(a), 17(b) и 17(c)). Процент цепочек с длиной более 400 нм также выше в случае магнитосом, синтезированных в присутствии бисфосфоновой кислоты (фиг.17(e) и 17(f)), чем магнитосом, синтезированных в отсутствие бисфосфоновой кислоты (фиг.17(d)). Благодаря этим особенностям изменение температуры, вызванное приложением магнитного поля, выше в случае магнитосом, синтезированных в присутствии 4 мкМ ризедроната (фиг.17(h)) или 4 мкМ алендроната (фиг.17(i)), чем магнитосом, синтезированных в отсутствие бисфосфоновой кислоты (фиг.17(g)). Это свойство наблюдалось для магнитного поля с силой как 40 мТл, так и 80 мТл. При добавлении в питательную среду бисфосфоновых кислот с концентрациями 0,4 мкМ наблюдали результаты, схожие с результатами, полученным для концентрации 4 мкМ. В противоположность этому, при добавлении в бактериальную питательную среду бисфосфоновой кислоты с концентрацией 40 мкМ свойства цепочек бактериальных магнитосом существенно не отличались от свойств бактериальных магнитосом, синтезированных в стандартных условиях. Эти результаты предполагают, что концентрации бисфосфоновой кислоты, необходимые для достижения оптимальной теплопроизводительности, находятся в диапазоне от 0,1 до 40 мкМ, в частности, от 0,1 до 10 мкМ, в типичном случае - от 0,4 до 4 мкМ. Третья бисфосфоновая кислота (неридроновая кислота) также была протестирована и показала результаты, схожие с результатами, полученными для алендроновой или ризедроновой кислоты.

Штамм АМВ-1 магнетотактических бактерий также культивировали в питательной среде, которая содержала химикаты их среды АТСС 1653 и 20 мкМ или 400 мкМ раствор родамина. Когда 55 мкг цепочек магнитосом, синтезированных в присутствии родамина, и смешанных в 1 мл воды, подвергли воздействию переменного магнитного поля 43 мТл, температура суспензии повысилась на 3 градуса за 30 мин. В случае цепочек магнитосом, синтезированных в отсутствие родамина, в тех же экспериментальных условиях наблюдалось повышение температуры всего на один градус.Это свидетельствует, что присутствие родамина в питательной среде приводит к улучшению теплопроизводительности цепочек магнитосом.

Также была протестирована теплопроизводительность выделенных цепочек магнитосом, синтезированных при добавлении в бактериальную питательную среду 20 мкМ раствора хината кобальта. Присутствие кобальта в составе некоторых магнитосом определили с применением спектроскопии энергетических потерь электронов (EELS). Данный результат согласуется с результатом, полученным Станиландом с соавторами (S. Staniland et al, Nature Nanotech., 2008, 3, 158-162), которые также продемонстрировали присутствие кобальта в магнитосомах магнетотактических бактерий, синтезированных в сходных условиях. Как видно из фиг.6(b), при воздействии на суспензию, содержащую легированные кобальтом магнитосомы (CγFe203=1,52 мг/мл), переменного магнитного поля с силой 80 мТл и частотой 183 кГц температура суспензии повышается сильнее, чем в суспензии, содержащей СМ-контроль. Так как показано, что размеры магнитосом и длины цепочек магнитосом у нелегированных и легированных кобальтом магнитосом очень схожи, повышенную теплопроизводительность легированных кобальтом магнитосом можно объяснить увеличением их магнитокристаллической анизотропии.

Исходя из этих результатов можно сделать следующие заключения:

(i) Введение агентов, хелатирующих ионы железа, в концентрациях, лежащих в диапазоне от 0,1 мкМ до 1 мМ, в питательную среду для штамма АМВ-1 приводит к улучшению нагревательных свойств выделенных цепочек магнитосом, смешанных в растворе. Авторы полагают, что эта особенность связана с увеличением размеров магнитосом и/или длин цепочек магнитосом при культивировании бактерий в данных условиях.

(ii) Введение хината кобальта в концентрации, лежащей в диапазоне от 0,1 мкМ до 1 мМ, в питательную среду для штамма АМВ-1 также приводит к улучшению нагревательных свойств выделенных цепочек магнитосом, смешанных в растворе. Авторы полагают, что эта особенность связана с увеличением магнитокристаллической анизотропии магнитосом, легированных кобальтом.

(iii) Введение агентов, хелатирующих ионы железа, и/или хината кобальта в бактериальную питательную среду представляет собой способ увеличения теплопроизводительности цепочек магнитосом. Это позволяет применять данные цепочки магнитосом для термотерапии в меньшем количестве, и тем самым снизить риск токсических явлений, вызванных присутствием цепочек магнитосом.

Пример 4:

Оценка эффективности термотерапии in vitro.

Материалы и методы:

Клетки MDA-MB-231 были получены в Американской коллекции типовых культур (АТСС). Клеточные линии культивировали в среде Игла в модификации Дульбекко (DMEM) с добавками, содержавшими 10% сыворотку плодов крупного рогатого скота (FCS), 2 мМ L-глутамин, 1 мМ пируват натрия, 50 E/мл стрептомицина (все приобретены в компании Life Technologies Inc.). Все эксперименты in vitro проводили при 37°C в инкубаторе с 5% CO2.

Жизнеспособность клеток оценивали с применением так называемого МТТ-анализа (анализ с тетразолием в микрокультуре, Т.Mosmann, 1983, J. Immunol. Methods, 65, 55-63). При этой методике измеряют способность ферментов митохондрий восстанавливать 3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид (приобретали в компании Sigma, Сент-Луис, Миссури, США) до фиолетовых кристаллов формазана. Клетки посеяли при плотности 2×104 клеток на лунку в 96-луночные плоскодонные планшеты (Falcon, Страсбург, Франция) и инкубировали в культуральной среде в течение 24 ч. Затем среду удаляли и заменяли средой с 10% FCS, содержащей различные наночастицы (цепочки магнитосом, единичные магнитосомы, SPION@цитрат и SPION@ПЭГ) с различными концентрациями, выраженными относительно маггемита (0,125 мг/мл<CγFe203<1 мг/мл). Эти суспензии подвергали (или не подвергали - в контроле) воздействию переменного магнитного поля с частотой 183 кГц и силой 43 мТл. Обработку проводили в течение 20 мин. один или два раза. Через 72 ч. инкубации клетки промывали фосфатно-солевым буфером (PBS, приобретенный в компании Life Technologies) и инкубировали с 0,1 мл МТТ (2 мг/мл) в течение еще 4 ч. при 37°C. Затем нерастворимый продукт (в существенной степени состоящий из формазана) растворили добавлением 100 мкл ДМСО (Sigma-Aldrich). Поглощение растворенного формазана измеряли при длине волны 570 нм с помощью спектрофотометра для прочитывания микропланшетов Labsustem Multiscan MS. Это позволило оценить количество функционально активных митохондрий, которое пропорционально количеству живых клеток. Затем оценили процент подавления как количество мертвых клеток (т.е., клеток в состоянии апоптоза), деленное на суммарное количество клеток.

Для исследования токсичности клетки посеяли на чашки Петри (диаметр 30 нм, по 50000 клеток на чашку Петри) и выращивали в течение 24 ч. По окончании этого начального периода роста клетки инкубировали в присутствии (или в отсутствие - в контроле) различных типов изучаемых наночастиц в течение 24 ч., 48 ч. или 72 ч. По окончании времени инкубации клетки подвергали (или не подвергали - в контроле) воздействию переменного магнитного поля с частотой 183 кГц и силой 20 мТл, 43 мТл или 60 мТл. Обработку проводили в течение 20 мин. один или два раза. После обработки клетки дважды промывала буфером PBS. Затем для того, чтобы собрать клетки, к адгезивным клеткам добавляли 250 мкл раствора трипсин-ЭДТА. Для получения гомогенной суспензии к собранным клеткам добавили 750 мкл жидкой среды. Затем суспензию центрифугировали при 700×g в течение 3 мин., удаляли супернатант и ресуспендировали клетки в 1 мл буфера PBS. Для оценки процентной доли живых клеток к клеточной суспензии добавили 5 мкл иодида пропидия (PI) (1 мг/мл, в этаноле, Sigma Aldrich). Так как PI проникает только в мертвые клетки, измерение его флуоресценции позволяет оценить процентную долю мертвых клеток. С учетом этой оценки можно вычислить процентную долю живых клеток. Для измерения флуоресценции PI клетки анализировали в проточном цитометре (Beckton Dickinson FACSCalibur 3C), в котором имеется источник аргонового лазера с испусканием при 488 нм и детектор FL3-H, способный детектировать флуоресценцию PI при возбуждении последнего лазером. Для определения процентной доли живых клеток проводили анализ 10000 клеток в каждой пробе.

Для измерения нагревательных свойств суспензий клеток in vitro проводили с суспензиями клеток в существенной степени такие же эксперименты, что описаны выше для адгезивных клеток. Единственным отличием в данном случае было то, что клетки сразу же смешивали с цепочками магнитосом и подвергали воздействию переменного магнитного поля. Температуру измеряли с помощью микрозонда-термопары (IT-18, Physitemp, Клифтон, США), который измеряет температуру макроскопически (т.е, температуру суспензии клеток в целом, а не температуру внутри каждой единичной клетки).

Для оценки количества магнитных клеток следовали в существенной степени тому же протоколу, что описан выше для суспензий клеток. 50 ООО клеток, содержащихся в жидкой среде, описанной выше, инкубировали в присутствии различных наночастиц в течение 5-20 мин. Во время инкубации прикладывали переменное магнитное поле с частотой 183 кГц и силой поля 43 мТл. После обработки собирали магнитные клетки, помещая сильный магнит (0,6 мТл) рядом с суспензией клеток. Супернатант, содержащий немагнитные клетки, удаляли, а клетки, которые удерживались магнитом, ресуспендировали в 1 мл буфера PBS. Затем оценивали процентную долю магнитных клеток с помощью проточного цитометра.

Результаты и обсуждение:

Для проведения обработки клеток в суспензии клетки сперва инкубировали в течение нескольких минут в присутствии суспензии магнитосом с различными концентрациями. Одновременно прикладывали переменное магнитное поле с частотой 183 кГц и различными значениями силы (0 мТл<B<60 мТл). Затем измеряли процентную долю живых клеток в проточном цитометре для различных значений силы магнитного поля. На фиг.7(a) видно, что процентная доля живых клеток высока (>80%) для различных значений силы приложенного магнитного поля, что свидетельствует о низкой токсичности. Это можно объяснить тем фактом, что клетки не достигают состояния апоптоза сразу после обработки. В случае клеток, инкубируемых в присутствии различных количеств цепочек магнитосом в течение нескольких минут, изменения температуры суспензий, вызванные приложением переменного магнитного поля, показаны на фиг.7(b), 7(c) и 7(d) для значений силы магнитного поля 20 мТл (фиг.7(b)), 43 мТл (фиг.7(c)) и 60 мТл (фиг.7(d)), соответственно. Как видно из фиг.7(b), сила магнитного поля, равная 20 мТл, слишком мала, чтобы вызвать повышение температуры. В противоположность этому, на 7(d) видно, что сила магнитного поля, равная 60 мТл, вызывает существенное увеличение температуры. Последнее происходит даже в случае клеток, инкубируемых в отсутствие цепочек магнитосом, что свидетельствует о том, что причиной повышения являются токи Фуко. Магнитное поле с силой 43 мТл - это поле, которое обеспечивает приемлемые характеристики, т.е., отсутствие изменения температуры при отсутствии цепочек магнитосом и повышение температуры, которое увеличивается с повышением количества инкубируемых цепочек магнитосом (фиг.7(c)).

В случае адгезивных клеток, инкубируемых в течение периода более чем несколько минут, процентную долю живых клеток MDA-MB-231 также измеряли как функцию от силы магнитного поля (фиг.8). Клетки инкубировали в присутствии суспензий цепочек магнитосом с различными концентрациями в течение 24 ч. (D1, фиг.8(a)), 48 ч. (D2, фиг.8(b)) или 72 ч. (D3, фиг.8(c) и 8(d)). Обработку, вызванную теплом, проводили либо один раз (фиг.8(а)-8(с)), либо два раза (фиг.8(d)). В отсутствие магнитного поля присутствие цепочек магнитосом является токсичным (менее 50% живых клеток) в случае 1 мг цепочек магнитосом, инкубируемых в течение 48 ч. или 72 ч. При всех других протестированных условиях присутствие цепочек магнитосом демонстрирует низкую токсичность (более 50% живых клеток). В присутствии магнитного поля, как видно на фиг.8(а)-8(с), процентная доля живых клеток существенно снижается в случае магнитного поля 43 мТл или более и количества инкубируемых магнитосом более 0,5 мг. На фиг.8(d) видно, что путем повторения обработки дважды можно улучшить эффективность обработки, где последняя определяется высокой процентной долей живых клеток, разрушенных с применением малого количества магнитосом. Действительно, при выполнении обработки два раза процентная доля живых клеток, равная 20%, достигается при применении 0,25 мг цепочек магнитосом (В=43 мТл) (фиг.8(d)), по сравнению с 0,5 мг при выполнении обработки один раз (В=43 мТл) (фиг.8(c)).

Процент подавления клеток MDA-MB-31, инкубируемых в присутствии различных типов наночастиц, упомянутых выше, также определяли либо в отсутствие магнитного поля (фиг.9(a)), либо в присутствии магнитного поля 43 мТл для обработки, проводимой либо один раз (фиг.9(b)), либо два раза (фиг.9(c)). При всех протестированных условиях процент подавления клеток выше в случае инкубации клеток MDA-MB-31 в присутствии цепочек магнитосом, чем в случае их инкубации в присутствии всех других типов наночастиц (единичных магнитосом, SPION@цитрата и SPION@n3l~). Наилучшие условия для обработки (т.е., условия, которые приводят к высокому проценту подавления в присутствии магнитного поля и низкому проценту подавления в отсутствие магнитного поля) получены для самого маленького применявшегося количества цепочек магнитосом, 0,125 мг, и для обработки, проводимой более одного раза (фиг.9(a) и 9(c)).

На фиг.9(d) показана процентная доля клеток MDA-MD-231, которые приобрели магнитные свойства при инкубации их в присутствии различных типов наночастиц при приложении переменного магнитного поля 43 мТл в течение 0-20 мин. Процентная доля магнитных клеток высока в случае инкубации клеток в присутствии цепочек магнитосом и 8РЮМ@цитрата. Она находится в диапазоне от 40% до 90%, в зависимости от того, насколько долго прилагали переменное магнитное поле (фиг.9(d)). На фиг.9(d) также показано, что процентная доля интернализации единичных магнитосом внутрь клеток MDA-MD-231 мала (<20%). Это можно объяснить стремлением единичных магнитосом агрегировать, что препятствует их проникновению в клетки. Как видно на фиг.9(d), частицы SPION@ПЭГ имеют очень низкую процентную долю интернализации в клетки MDA-MD-231, что свидетельствует о том, что процентная доля интернализации магнитных наночастиц в эукариотические клетки после приложения переменного магнитного поля в существенной степени зависит от типа применяемых наночастиц.

Исходя из этих результатов можно сделать следующие заключения:

(i) В отсутствие обработки цитотоксичность цепочек магнитосом низка при количестве цепочек магнитосом менее 1 мг.

(ii) Магнитное поле с силой 43 мТл обеспечивает самые лучшие нагревательные свойства в отношении клеток MDA-MB-231, суспендированных в присутствии цепочек магнитосом с различными концентрациями.

(iii) Самые лучшие условия достигаются для наименьшего количества инкубируемых цепочек магнитосом (0,125 мг) и при повторении обработки дважды.

(iv) Самый высокий процент подавления достигается в случае цепочек магнитосом, по сравнению с единичными магнитосомами, возможно, из-за лучшей интернализации цепочек магнитосом в клетки MDA-MD-231, по сравнению с единичными магнитосомами.

(v) Самый высокий процент подавления, наблюдаемый при инкубации клеток в присутствии цепочек магнитосом, по сравнению с таковым, наблюдаемым при инкубации клеток в присутствии SPION@цитрата, можно объяснить либо более высокой УМП цепочек магнитосом, либо более однородным нагреванием цепочек магнитосом, либо сочетанием обеих этих особенностей.

Пример 5:

Теплопроизводительность и противоопухолевая активность различных бактериальных магнитосом и SPION@цитрата.

В данном примере сравниваются теплопроизводительность in vivo и противоопухолевая активность цепочек магнитосом, единичных магнитосом, SPION@цитрата и цельных магнетотактических бактерий.

Материалы и методы:

Все эксперименты на животных проводили после утверждения протокола, проверенного комитетом «Центра Леона Берарда, Ecole normale superieure, Plateau de Biologie Experimental de la Souris» (Лион, Франция).

Эксперименты с нагреванием in vivo проводили на 30 «голых» мышах в возрасте 6 недель, приобретенных в компании Charles Rivers Laboratories (Арбресль, Франция). Для получения животных с опухолями сперва подвергли мышей действию гамма-излучения. Примерно 2 млн клеток рака груди человека MDA-MB-231 в 100 мкл фосфатно-солевого буфера (PBS) инъецировали подкожно в левый и в правый бок мышей с помощью шприца (игла 26G). Размеры опухолей измеряли с помощью циркуля каждые 3 дня. Затем выполняли оценку объемов опухолей, используя формулу V=А×В2/2, где A - самый длинный, а B - самый короткий латеральный диаметр опухоли (Sun et al., Cancer Lett., 2007, 258, 109-117). Опухоли росли в течение 21 дня, до достижения ими объема примерно 100 мм3.

Перед началом лечения мышам делали анестезию с применением кетамина/ксилазина (100/6 мг/кг, внутрибрюшинно), что привело к снижению их температуры тела с 37°C до 30-36°C, в зависимости от мыши. Три мыши умерли во время первых этапов лечения, вероятнее всего, из-за слишком высокой дозы анестетика. По данным аутопсии, органы этих мышей не имели явных признаков системного застоя или инфаркта. Под анестезией иглу шприца, содержащего либо химически синтезированные наночастицы, либо различные типы бактериальных магнитосом, диспергированные в стерильной воде, вводили в опухоли мышей в продольном направлении. Затем мышей помещали внутрь спирали диаметром 6,7 см, где они подвергались воздействию переменного магнитного поля. Для получения переменного магнитного поля вырабатывали переменный электрический ток с помощью спирали и с применением источника питания мощностью 10 кВт EasyHeat (Ambrell, Soultz, Франция). Схематическое изображение на фиг.10(a) демонстрирует экспериментальную установку, которую применяли для проведения исследований. Измерения температуры производили с применением имплантируемого микрозонда-термопары (IT-18, Physitemp, Клифтон, США) с получением значений ректальной температуры или местной температуры в центральной части опухоли. За изменением ректальной температуры следили для того, чтобы убедиться, что повышение температуры опухоли было местным и не затрагивало весь организм мышей. Инфракрасную фотокамеру (Moblr2, Optophase, Лион, Франция) применяли для получения более общей картины изменения температуры опухоли и областей, окружающих опухоль. Поперечный срез, вдоль которого измеряли температуру, указан на схематическом изображении на фиг.10(b) линией. Изменения размеров опухоли в течение 30 дней после первой обработки измеряли как в случае опухолей, которые не подвергали нагреванию, так и в случае опухолей, которые подвергали нагреванию.

Противоопухолевую активность исследовали, наблюдая за изменением размеров опухолей, выращенных подкожно на обоих боках тела каждой мыши. Мышей отобрали случайным способом и разделили на пять групп. Первые четыре группы получали следующее лечение. Сто микролитров суспензии, содержащей единичные магнитосомы (суспензия 1 для мышей 1-3), цепочки магнитосом (суспензия 2 для мышей 5-8), SPION (суспензия 3 для мышей 10-13) и цельные магнетотактические бактерии (суспензия 4 для мышей 15 и 16), вводили в опухоли, расположенные на правом боку тел мышей. После инъекции различных суспензий мышей подвергали воздействию переменного магнитного поля с частотой 183 кГц и силой магнитного поля примерно 43 мТл (мыши 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13) или примерно 80 мТл (мыши 15 и 16) в течение 20 мин. Обработку повторяли 3 раза с интервалом 3 дня. В случае мышей, которым вводили суспензию цепочек магнитосом, силу магнитного поля необходимо было снизить примерно на 5 мТл, чтобы избежать повышения температуры внутри опухоли выше уровня 50°C. В случае мышей, которым вводили цельных бактерий, силу магнитного поля необходимо было повысить примерно до 80 мТл, чтобы внутри опухоли наблюдалось повышение температуры. Пятую группу рассматривали как контрольную и не подвергали воздействию переменного магнитного поля. Эта группа состояла из мышей, которым вводили в опухоли, расположенные у них на правом боку, 100 мкл физиологического раствора (мыши 17 и 18), 100 мкл суспензии 1 (мыши 4, 19 и 20), 100 мкл суспензии 2 (мыши 9, 21 и 22), 100 мкл суспензии 3 (мыши 14, 23 и 24) и 100 мкл суспензии 4 (мыши 25, 26, 27). Наконец, 27 опухолей, расположенных на левом боку каждой мыши служили в качестве внутреннего контроля и в них вводили только физиологический раствор.

Концентрации различных суспензий (10 мг/мл для суспензий 1 и 3 и 20 мг/мл для суспензии 2) выбрали таким образом, чтобы они демонстрировали схожие нагревательные свойства в воде. Эти концентрации представляют количество маггемита, содержащееся в одном миллилитре водной суспензии. Их определяли тремя разными способами: либо измеряя поглощение различных суспензий при длине волны 480 нм, либо определяя массу наночастиц или магнитосом после лиофилизации, либо измеряя намагниченность насыщения для 20 мкл каждой суспензии, нанесенной на поверхность субстрата, применяя для измерения сверхпроводящий квантовый интерферометр (SQUID) (Alphandery et al., J. Phys. Chem. C, 2008, 112, 12304-12309). Эти три разных способа измерения дали одинаковую оценку концентрации для суспензий, содержащих единичные магнитосомы и SPION. В случае суспензий, содержащих цепочки магнитосом, присутствие биологического материала, окружающего бактериальные магнитосомы, привело к завышению значения концентрации маггемита, определенной по поглощению или путем лиофилизации. Следовательно, концентрацию этой суспензии определяли с применением измерений на SQUID. При лечении цельными магнетотактическими бактериями концентрация инъецируемых бактерий составляла 108 клеток в 100 мкл. Концентрация бактериальных клеток была выбрана таким образом, чтобы она имела такую же концентрацию оксида железа, что и суспензия 2.

Гистологические исследования проводили на подкожных опухолях, печени, почках и легких, взятых через 30 дней после первой инъекции. Пробы фиксировали в 10% растворе формалина, заливали в парафин и делали срезы толщиной 4 мкм. Срезы окрашивали гематоксилином-эозином (HE) и берлинской лазурью для выявления присутствия бактериальных магнитосом, окрашивающихся в синий цвет. Некроз опухолевых клеток, количество митозов на трех случайным образом выбранных полях при увеличении ×400 в не некротических областях и количество пигментированных клеток оценивали на физиологических срезах опухолей, расположенных у мышей на правом боку.

Для уточнения данных гистологических исследований и изучения интернализации магнитосом в опухолевые клетки 5×105 клеток карциномы груди (линии MDA-MB-231) посеяли на покровное стекло для микроскопии. Их выращивали в течение 48 ч. при 37°C в 5% CO2. Далее клетки обрабатывали в присутствии различных суспензий магнитосом в течение 1-24 ч. в отсутствие или в присутствии магнитного поля с силой 0,6 мТл. Использовали 2 мл двух суспензий магнитосом, содержащих либо единичные магнитосомы, либо цепочки магнитосом, смешанные в питательной среде для клеток. Для того, чтобы избежать слишком высокой цитотоксичности в отношении клеток, концентрацию оксида железа в двух суспензиях магнитосом сохраняли на низком уровне, примерно 130 мкг/мл. После обработки клетки промывали буфером PBS для удаления бактериальных магнитосом, окружающих клетки. Затем клетки фиксировали с помощью 5% параформальдегида и инкубировали в присутствии раствора, который окрашивается в результате образования берлинской лазури в присутствии железа. Этот раствор содержит 5% ферроцианат калия и 10% хлористоводородную кислоту (равные объемы). После этого клетки исследовали с применением воздушно-иммерсионного Объектива (×100). Фокусировку объектива производили таким образом, чтобы определять присутствие железа внутри клеток, а не на клеточной поверхности.

Результаты и обсуждение:

Первой группе мышей делали инъекции суспензии, содержащей единичные магнитосомы, и прикладывали переменное магнитное поле. В результате температура внутри опухоли у мыши повышалась на 4°C, с 31°C до 35°C (фиг.10(c)). Через 10 мин. нагревания измерения в инфракрасном диапазоне показали, что температура распространилась в пределах опухоли на расстояние примерно 0,5 см, при этом данное расстояние определяли измерением полной ширины пика на уровне половины высоты максимального пика распределения температур, показанного на фиг.10(d). Изменение размеров подвергнутых обработке опухолей показано на фиг.10(e). Размеры увеличивались у мышей 1-3 в течение 30 дней после обработки, что свидетельствует об отсутствии противоопухолевой активности. Увеличение размера повергнутой обработке опухоли у мыши 3 также можно было наблюдать, исследуя серию из трех фотографий, сделанных в день обработки (D0), через 14 дней после обработки (D14) и через 30 дней после обработки (D30) (фиг.11(a)). Отсутствие противоопухолевой активности у этих мышей дополнительно подтвердили характеристики опухолей, которые не обрабатывали единичными магнитосомами (фиг.10(f)). Размеры этих опухолей увеличивались со скоростью, схожей с таковой в случае подвергнутых обработке опухолей (фиг.10(e) и 10(f)). При инъекции суспензии 1 без приложения магнитного поля (у мыши 4 и двух других мышей) размер опухоли также увеличивался (фиг.10(f)). Все вместе, эти результаты свидетельствуют, что ни присутствие единичных магнитосом, ни тепло, которое они выделяют в присутствии магнитного поля, не приводят к противоопухолевой активности.

Патологические исследования опухоли, расположенной на правом боку мыши 2, дополнительно подтвердили этот вывод. Они показали наличие существенного количества некротических клеток в опухолях, взятых через 30 дней после первой обработки. Митозы были многочисленными и свидетельствовали о существенной пролиферативной активности опухоли, со средним показателем 12 митозов на выбранное поле размером 300 мкм2. Окрашивание патологических срезов, полученных из правой опухоли, берлинской лазурью показало присутствие диффузных темных пятен (фиг.11(b)). Как полагают, эти пятна возникают в результате образования агрегатов магнитосом, как показано на увеличенном фрагменте (фиг.11(c) и 11(d)). Гистологический анализ органов показал, что в печени, почках и легких единичные магнитосомы не обнаруживаются. Отсутствие единичных магнитосом в этих органах предполагает, что они остаются локализованными внутри опухоли через 30 дней после инъекции, возможно, из-за своей склонности к агрегации.

С целью изучения того, проникают ли единичные магнитосомы в клетки карциномы, эти клетки инкубировали в присутствии суспензии единичных магнитосом. После 1 ч. инкубации всего несколько единичных магнитосом располагалось внутри клеток как в присутствии магнитного поля, так и без него. После 24 ч. инкубации клеток наличия единичных магнитосом больше не наблюдалось как в присутствии магнитного поля, так и без него. Это предполагает, что единичные магнитосомы не способны легко проникать внутрь опухолевых клеток. Даже если они проникают, то не остаются внутри этих клеток в течение длительного периода времени.

Второй группе мышей делали инъекции суспензии, содержащей цепочки магнитосом. Неожиданно выяснилось, что приложение магнитного поля вызывало большую степень увеличения температуры, чем наблюдалось в первой группе мышей. Через 20 мин. температура внутри опухоли у мыши повышалась на 10°C, с 33°C до 43°C (фиг.12(a)). Кроме того, инфракрасные изображения показывают распространение температуры вдоль поперечного среза опухоли на большее расстояние. На фиг.12(b) видно, что полная ширина пика на уровне половины высоты максимального пика распределения температур составляет 0,75 см, предполагая более однородное распределение температур внутри опухолей в случае цепочек магнитосом, чем в случае единичных магнитосом. В противоположность характеристикам, наблюдавшимся в случае единичных магнитосом, в данном случае противоопухолевая активность была явно выражена. На фиг.12(c) показано, что размеры обработанных опухолей не увеличивались существенно, как это наблюдалось в случае необработанных опухолей (фиг.12(d)). Обработанная опухоль полностью исчезла у мыши 5 и существенно уменьшилась в размере у мыши 6 (фиг.12(c)). Исчезновение подвергнутой обработке опухоли у мыши 5 можно было наблюдать, исследуя серию из трех фотографий, сделанных в день обработки (D0), через 14 дней после обработки (D14) и через 30 дней после обработки (D30) (фиг.13(a)). Кроме того, гистологические исследования показали, что у мыши не наблюдалось остатков опухолевых тканей. Патологические исследования обработанных опухолей показали, что количество наблюдаемых митозов было низким (в среднем 4 на выбранном поле 300 мкм2), что свидетельствует о снижении активности процесса пролиферации опухоли. У мыши 9 и двух других мышей, которым суспензию цепочек магнитосом инъецировали без приложения магнитного поля, размер опухоли существенно увеличился в течение 30 дней после первой обработки (фиг.12(d)). Это свидетельствует о том, что противоопухолевая активность возникала благодаря теплу, вырабатываемому цепочками магнитосом под воздействием переменного магнитного поля. На микрофотографии опухолевой ткани видно более однородное распределение цепочек магнитосом, по сравнению с распределением единичных магнитосом (фиг.11(d) и 13(b)). Кроме того, на увеличенных фрагментах фиг.13(b), приведенных на фиг.13(c) и 13(d), видны черные области, окружающие ядро клетки. Это означает, что цепочки магнитосом проникли внутрь клеток (этот результат согласуется с выводом, сделанным в примере 4). Гистологические исследования органов также указывают на присутствие спорадических цепочек магнитосом, которые были обнаружены в гепатоцитах и периваскулярных клетках печени, но не в почках и легких. Несмотря на накопление цепочек магнитосом в клетках печени, в печени не наблюдалось патологических изменений.

Для подтверждения результатов, полученных при гистологических исследованиях, цепочки магнитосом инкубировали in vitro в присутствии клеток карциномы. После 1 ч. инкубации присутствие цепочек магнитосом внутри клеток наблюдалось более отчетливо, чем в случае единичных магнитосом, как в отсутствие, так и в присутствии магнитного поля. При инкубации клеток в течение 24 ч. присутствие цепочек магнитосом внутри клеток становится еще более выраженным. В присутствии магнитного поля цепочки магнитосом расположены вокруг клеточного ядра, тогда как в отсутствие магнитного поля цепочки магнитосом расположены менее упорядоченно в различных клеточных компартментах. Эти результаты свидетельствуют, что при применении цепочек магнитосом можно осуществлять нацеливание на опухолевые клетки с помощью магнитного поля.

Третьей группе мышей инъецировали суспензию SPION в опухоли, расположенные на правом боку мышей. Приложение магнитного поля вызывало немного меньшее увеличение температуры, чем наблюдалось в случае цепочек магнитосом. Через 20 мин. температура внутри опухоли у мыши повышалась на 6°C, с 36°C до 42°C (фиг.18(a)). Полная ширина пика на уровне половины высоты максимального пика распределения температур, рассчитанная согласно данным измерений в инфракрасном диапазоне (0,75 см, фиг.18(b)) была такой же, как наблюдалась в случае цепочек магнитосом. В данном случае размеры обработанных опухолей очень сильно уменьшились у мышей 10 и 12 (фиг.18(c)), но гистологические исследования показали наличие периопухолевых лимфатических узлов, что указывает на то, что противоопухолевая активность у этих мышей была лишь частичной. У мышей 11 и 13 размеры необработанных и обработанных опухолей увеличились в схожей степени, что свидетельствует об отсутствии выраженной противоопухолевой активности (фиг.18(c) и 18(d)). У мыши 14 и двух других мышей, которым SPION инъецировали без приложения магнитного поля, наблюдалось сильное увеличение размера опухоли в течение периода 30 дней после инъекции (фиг.18(d)). Как и в случае второй группы мышей, которым инъецировали суспензию цепочек магнитосом, среднее количество митозов было низким (в среднем 5 митозов на выбранном поле 300 мкм2) и некротическая активность была сопоставима с активностью, наблюдаемой в контрольной группе. Согласно данным по окрашиванию берлинской лазурью, SPION, которые окрашивались в сини цвет, были обнаружены в печени, клетках Купфера, в макрофагах и в синусе легочных лимфатических узлов. Присутствие SPION в легких уже наблюдали ранее (Zhou et al., Biomaterials, 2006, 27, 2001-2008). Это признак потенциальной токсичности и, следовательно, представляет собой недостаток с точки зрения разработки способа термотерапии, такого как описан в настоящем раскрытии.

В четвертой группе мышей 108 клеток, содержащихся в 100 мкл буфера PBS, инъецировали в опухоли, расположенные на правом боку мышей, и прилагали магнитное поле силой примерно 80 мТл. В этих условиях температура повышалась всего на 4°C, с 33°C до 37°C, за 20 мин. Повышение температуры также наблюдали с помощью измерений в инфракрасном диапазоне. Как и в группе, получавшей лечение единичными магнитосомами, размеры обработанных опухолей увеличивались в течение 30 дней после обработки. Гистологическое исследование выявило окрашенные области в обработанной опухоли с высокой митотической активностью (в среднем 15 митозов на выбранном поле 300 мкм2), что указывает на отсутствие противоопухолевой активности. В печени, почках и легких магнетотактические бактерии не обнаружены.

Исходя из этих результатов можно сделать следующие заключения:

(i) Противоопухолевой активности не наблюдалось, если суспензии, содержащие единичные магнитосомы, цепочки магнитосом и SPION@цитрат, инъецировали в опухоли мышей без приложения магнитного поля.

(ii) При введении в опухоли для начала лечения единичных магнитосом наблюдалась низкая способность к выработке тепла in vivo и не наблюдалось противоопухолевой активности. Этот результат был неожиданным, принимая во внимание теплопроизводительность, наблюдаемую в растворе (пример 2).

(iii) В противоположность этому, при введении в опухоли для начала лечения цепочек магнитосом наблюдалась существенная противоопухолевая активность при их нагревании. Это свойство можно объяснить их высокой теплопроизводительностью in vivo, их однородным распределением внутри опухоли мыши, а также их способностью проникать внутрь опухолевых клеток.

(iv) SPION, которые в настоящее время применяют для лечения с помощью повышенной температуры, также продемонстрировали противоопухолевую активность. Однако их противоопухолевая активность была менее выраженной, чем активность, полученная в случае цепочек магнитосом. Кроме того, экспериментальные данные были получены для суспензии SPION, которая имеет концентрацию оксида железа в два раза выше, чем применяется в случае суспензии, содержащей цепочки магнитосом. Если взять две суспензии со схожей концентрацией оксида железа, то при введении суспензии, содержащей SPION, наблюдается намного меньшая степень нагревания и противоопухолевой активности, чем в случае суспензии, содержащей цепочки магнитосом (пример 6).

Пример 6:

Теплопроизводительность и противоопухолевая активность цепочек магнитосом, полученных культивированием магнетотактических бактерий либо в отсутствие, либо в присутствии ЭДТА, по сравнению с таковыми показателями SPION@ПЭГ и SPION@цитрата.

В данном примере проводится сравнение теплопроизводительности и противоопухолевой активности цепочек магнитосом, выделенных из магнетотактических бактерий, которые были получены культивированием бактерий либо в отсутствие хелатирующего агента, либо в присутствии 0,4 мкМ ЭДТА. Дополнительно, теплопроизводительность и противоопухолевая активность двух этих типов бактериальных магнитосом также сравнивают с таковыми показателями SPION@ПЭГ и SPION@цитрата, применяемых другими группами для осуществления магнитной гипертермии.

Материалы и метод:

Протокол эксперимента очень похож на протокол, описанный в примере 5, за исключением того, что в данном случае инъекцию различных типов наночастиц делали только один раз - в начале лечения. Сперва 100 мкл четырех различных суспензий, содержащих 10 мг/мл (относительно оксида железа) наночастиц различных типов, инъецировали в опухоли, расположенные на правом боку мышей.

Опухоли, расположенные на левом боку мышей, использовали в качестве внутреннего контроля. Лечение, вызванное теплом, начинали, прикладывая переменное магнитное поле с частотой 183 кГц и амплитудой поля 43 мТл. В одном случае, т.е., в случае магнитосом, полученных в присутствии ЭДТА, сила магнитного поля была снижена до уровня менее 43 мТл, чтобы избежать повышения температуры до уровня выше 50°C. Лечение повторяли 3 раза с интервалом 3 дня. Размер опухоли измеряли в течение 30 дней после лечения с целью оценки эффективности терапии.

Суспензии, содержащие выделенные цепочки магнитосом, SPION@ПЭГ и SPION@цитрат, приготовили как описано в примере 1. Магнетотактические бактерии АМВ-1 культивировали либо в присутствии, либо в отсутствие 0,4 мкМ ЭДТА, и выделяли цепочки магнитосом, следуя тому же протоколу, что описан в примере 1. Цепочки магнитосом, полученные культивированием магнетотактических бактерий в отсутствие ЭДТА, называли «стандартными цепочками магнитосом» или СМ, тогда как полученные культивированием магнетотактических бактерий в присутствии 0.4 мкМ ЭДТА называли «магнитосомы-ЭДТА» или СМ (ЭДТА 0,4 мкМ). Магнитосомы-ЭДТА характеризуются более крупными магнитосомами, более длинными цепочками магнитосом и более высокой теплопроизводительностью (при смешивании в воде), чем СМ, как показано в примере 3.

Результаты и обсуждение:

Как видно на фиг.14(a), при инъекции 1 мг суспензии, содержащей СМ, в опухоль и приложении переменного магнитного поля температура внутри опухоли достигает 50°C через 4 мин. обработки. В течение 30 дней после обработки, как видно на фиг.14(b), нормированный объем опухоли, который является средним значением для различных мышей, подвергнутых обработке, увеличивается в гораздо меньшей степени, чем объем необработанной опухоли. У мыши, у которой лечение прошло наиболее эффективно, опухоль полностью исчезает, как показывает изменение размера опухоли у данной мыши (фиг.15(b)) и фотография этой опухоли, сделанная через 30 дней после обработки (фиг.15(a)). Явно выраженная противоопухолевая активность наблюдается в случае СМ, тем самым подтверждая результаты, представленные в примере 5. При введении суспензии магнитосом-ЭДТА в опухоль и приложении магнитного поля температура внутри опухоли повышается быстрее, чем после введения СМ, что видно при сравнении фиг.14(а) и 14(c). Эти свойства согласуются с тем фактом, что магнитосомы-ЭДТА обладают более высокой теплопроизводительностью, чем СМ, когда они смешаны в растворе (пример 3). Однако, несмотря на тот факт, что магнитосомы-ЭДТА демонстрируют лучшую теплопроизводительность in vivo, чем СМ, их противоопухолевая активность ниже. Действительно, на фиг.14(d) видно, что объем опухоли, обработанной магнитосомами-ЭДТА, увеличивается в большей степени, чем объем опухоли, обработанной СМ (фиг.14(b)).

На фиг.15 изображены характеристики мышей, у которых лечение оказалось наиболее эффективным в каждой группе. Полное исчезновение опухоли наблюдалось в случае СМ и магнитосом-ЭДТА (фиг.15(c) и 15(d)), что указывает на наличие противоопухолевой активности у цепочек магнитосом различной длины.

Как видно на фиг.14(е), при введении в опухоль 1 мг суспензии, содержащей SPION@цитрат, и приложении переменного магнитного поля 43 мТл температура повышается на 4°C за 2 мин., что намного меньше, чем повышение температуры, наблюдаемое в случае СМ (12°C за 2 мин.) или магнитосом-ЭДТА (20°C за 2 мин.) В данном случае объем обработанной опухоли увеличивается в той же степени, что и объем необработанной опухоли, в течение дней после обработки (фиг.14(f)), и ни у одной мыши не наблюдалось полного исчезновения опухоли в течение 30 дней после обработки. В типичном случае лечения мыши SPION@цитратом опухоль все еще наблюдается через 30 дней после обработки (фиг.15(е) и 15(f)). Это свидетельствует о меньшей эффективности лечения, чем при лечении с применением цепочек магнитосом. При инъекции SPION@ПЭГ температура внутри опухоли мыши вообще не увеличивается после приложения магнитного поля, как видно на фиг.14(g), и ни одна из опухолей не уменьшается в размере в течение дней после обработки (фиг.14(h), 15(g) и 15(h)).

Исходя из этих результатов можно сделать следующие заключения:

(i) При введении различных суспензий наночастиц, содержащих одинаковое количество оксида железа, суспензии, содержащие выделенные цепочки магнитосом демонстрируют лучшую теплопроизводительность и противоопухолевую активность, чем суспензии, содержащие SPION@ПЭГ и SPION@цитрат.

(ii) Более высокую противоопухолевую активность, которую дают СМ, по сравнению с магнитосомами-ЭДТА, можно объяснить лучшим поглощением СМ внутрь клеток, чем магнитосом-ЭДТА. Это, скорее всего, вызвано различиями длин цепочек у этих двух типов магнитосом. Так как считается, что внутриклеточная гипертермия является более эффективным механизмом разрушения клеток, чем внеклеточная гипертермия, это различие в интернализации между этими двумя типами магнитосом может объяснить различие в противоопухолевой активности.

Пример 7:

Биораспределение различных бактериальных магнитосом в организме мышей

В настоящем примере исследовали биораспределение различных типов частиц (цепочек магнитосом, единичных магнитосом, SPINON@цитрата и SPION@ПЭГ), содержащихся в различных органах мышей сразу после инъекции, через 3 дня, 6 дней или 14 дней после инъекции. Для данного исследования различные суспензии, содержащие 1 мг наночастиц каждого типа, упомянутого выше, инъецировали внутриопухолево, т.е. непосредственно внутрь опухолей мышей.

Приведена процентная доля частиц в опухолях и в экскрементах мышей, так как в основном частицы были обнаружены в них. Для вычисления процентной доли частиц в опухолях проводили магнитные измерения двух типов (MIAtek и SQUID). В дополнение к этим двум типам измерений также измеряли удельную мощность поглощения (УМП) различных частиц ex vivo в опухолях, нагретых при приложении переменного магнитного поля. Так как УМП обратно пропорциональна количеству нагретых частиц (см. пример 2), это измерение позволяет оценить количество частиц, инъецированных в опухоль.

Материалы и метод:

Индукцию образования опухоли из клеток рака груди проводили как описано ранее в примере 5. Кратко, 54 самкам «голых» домовых мышей в возрасте 6 недель (Charles River, Арбресль, Франция) ввели путем подкожной инъекции два миллиона клеток рака груди человека MDA-MB-231 (Cailleau et al., J. Natl. Cancer Inst, 1974, 53, 661-674) в левый и в правый бок. Инъекцию различных типов частиц производили через 14 дней после имплантации опухоли. Суспензию цепочек магнитосом, единичных магнитосом, SPION@цитрата и SPION@ПЭГ (Micromod, Росток-Варнемюнде, Германия) приготовили в концентрации 10 мг железа/мл. 100 мкл этих суспензий инъецировали непосредственно в опухоли, расположенные на правом боку, при дозе маггемита 1 мг. Количество маггемита, содержащееся в различных органах мышей, измеряли в течение дня введения инъекции (день 0, DO), через три дня после инъекции (день 3, D3), через шесть дней после инъекции (день 6, D6) или через 14 дней после инъекции (день 14, D14). В различные дни (D0, D3, D6 или D14) животных подвергали эвтаназии путем смещения шейных позвонков и сразу же собирали представляющие интерес ткани или органы (кровь, печень, селезенка, легкие, почки, опухоль, экскременты), взвешивали и замораживали при 4°C до проведения анализа. На первом этапе изучили теплопроизводительность ex vivo разных опухолей, содержащих частицы различных типов и собранные в разные дни. Для этого опухолевую ткань помещали в пробирку, которую затем располагали внутри спирали, где осуществляли воздействие переменным магнитным полем с частотой 183 кГц и силой поля 43 мТл в течение 20 мин. (EasyHeat 10 kW, Ambrell, Soultz, Франция). Температуру внутри опухоли измеряли с применением микрозонда-термопары (IT-18, Physitemp, Клифтон, США). На втором этапе определили количество маггемита с помощью прибора MIAtek®, который был разработан компанией Magnisense (Nikitin et al., 2007, J. Magn. Mater. 311, 445). Эта методика позволяет проводить чувствительное обнаружение и точное количественное определение магнитных наночастиц в биологическом образце. Для измерений на приборе MIAtek® ткани подготавливали путем механической гомогенизации в ультрачистой воде (16% экскрементов (масса во влажном состоянии), т.е., 16 г экскрементов, разведенных в 100 мл буфера PBS, 25% опухоли (масса во влажном состоянии), 50% ткани почек, легких, селезенки (масса во влажном состоянии) 100% ткани печени (масса во влажном состоянии)). 100 мкл приготовленных таким образом тканей помещали в систему обнаружения (MIAtek®). Градуировку проводили путем измерения сигнала MIAtek® для суспензий, содержащих цепочки магнитосом, единичные магнитосомы, 8РЮМ@цитрат и SPI0N@ПЭГ, смешанные в воде, как функции от концентрации маггемита в этих суспензиях, которая изменялась от 15 мкг/мл до 125 мкг/мл. Для подтверждения оценок концентраций маггемита, полученных с применением MIAtek®, проводили измерения на SQUID для проб, содержащих самые высокие процентные доли маггемита (проб опухолей и экскрементов). Для этого оценивали намагниченность насыщения различных проб опухолей и экскрементов, содержащих частицы разных типов. Исходя их этой оценки можно было вычислить количество маггемита, присутствующего в разных пробах, используя значение намагниченности насыщения порошка маггемита (80 А·м2/кг). Оценки, выведенные из измерений на MIAtek®, сравнили с оценками, выведенными из измерений на SQUID. Наконец, разные опухоли, содержащие частицы различных типов, нагревали ex vivo при приложении переменного магнитного поля с частотой 183 кГц и силой поля 43 мТл. По кривым нагревания можно определить УМП, измеряя угловые коэффициенты при 25°C и, следовательно, количество маггемита, содержащегося в разных опухолях (пример 2).

Количественные оценки содержания маггемита в разных опухолях получили, отбирая одну пятую часть от суммарного объема ткани опухоли после гомогенизации опухолей с частицами. Собранные пробы опухолей не содержали одну пятую от количества инъецированных частиц различных типов, скорее всего, из-за неоднородности гомогенизации. Это приводит к большим интервалам погрешности измерений и, в некоторых случаях, к выявлению в опухоли большего количества частиц, чем то количество, которое было инъецировано. Однако, несмотря на эти неточности, основные выводы, сделанные в данном исследовании, остаются достоверными.

Результаты и обсуждение:

На фиг.16(a) показано биораспределение цепочек магнитосом внутри опухолей (оцененное как процентная доля инъецированной дозы на грамм ткани) сразу после инъекции (D0), через 3 дня после инъекции (D3), через 6 дней после инъекции (D6) и через 14 дней после инъекции (D14). Три типа измерений (MIAtek®, УМП и SQUID) показывают в существенной степени схожую тенденцию: быстрое снижение процентной доли цепочек магнитосом, содержащихся внутри опухолей в течение нескольких дней после инъекции (фиг.16(a)). Действительно, более 90% цепочек магнитосом были выведены через 14 дней после инъекции. Цепочки магнитосом обнаруживали в основном в экскрементах, с показателями 10-15% в экскрементах в первый день сразу после инъекции и 15-20% через 3 дня, 6 дней и 14 дней после инъекции (фиг.16(b)). Для цепочек магнитосом было показано, что основным путем их выведения является выведение с экскрементами. Лишь незначительные следы присутствия цепочек магнитосом (<0,1% инъецированной дозы на грамм ткани) были обнаружены в легких, почках, печени и селезенке на третий и шестой день после инъекции. В крови цепочки магнитосом не обнаружены. Эти результаты означают, что цепочки магнитосом быстро выводились в своей исходной форме.

В случае инъекции единичных магнитосом процентная доля инъецированной дозы (ID) на грамм ткани представлена на фиг.16(c) для разных дней после инъекции. Как и в случае с цепочками магнитосом, имеется хорошая согласованность между тремя различными типами измерений (MIAtek®, УМП и SQUID). Процентная доля единичных магнитосом, содержащихся внутри опухоли, по-видимому, более существенно снижается в течение нескольких дней после обработки, чем процентная доля цепочек магнитосом (фиг.16(a) и 16(c)). Как и в случае с цепочками магнитосом, единичные магнитосомы были обнаружены в экскрементах, но их процентная доля была ниже (от 5 до 10% в D3, D6 и D14). Путем выведения единичных магнитосом также, по-видимому, являлось (по меньшей мере частично) выведение с экскрементами.

Также было исследовано биораспределение химически синтезированных SPION@цитрата и SPION@ПЭГ. Как показано на фиг.16(e) и 16(g), SPION@цитрат и SPION@ПЭГ, по-видимому, сохраняются внутри опухолей через 14 дней после инъекции. Процентная доля наночастиц внутри опухолей не снижается в течение нескольких дней после обработки столь же существенно, как это происходит в случае цепочек магнитосом. Более того, SPION@цитрат и SPION@ПЭГ не были обнаружены в экскрементах мышей. Эти результаты можно объяснить тем фактом, что SPION@цитрат и SPION@ПЭГ метаболизируются до свободного железа и, следовательно, не выводятся с экскрементами в виде наночастиц. Это является скорее недостатком таких химически синтезированных наночастиц, по сравнению с магнитосомами, так как свободное железо может вызывать окислительный стресс (Puntarulo et al., 2005, Mol. Aspects, Med., 299-312).

Исходя из этих результатов можно сделать следующие заключения:

Цепочки магнитосом быстро покидают опухоль и, по-видимому, выводятся с экскрементами. Обе эти особенности являются благоприятными для разработки термотерапии, описанной в настоящем раскрытии. Можно предположить, что эти особенности объясняются тем фактом, что цепочки магнитосом не подвержены существенной агрегации. В противоположность ситуации с цепочками магнитосом, существенная процентная доля единичных магнитосом сохраняется внутри опухоли через 14 дней после инъекции, что указывает на то, что организму, возможно, сложнее осуществить их быстрое выведение. Можно предположить, что эти особенности объясняются тем фактом, что единичные магнитосомы агрегируют. Существенная процентная доля химически синтезированных наночастиц (SPION@цитрата и SPION@ТЭП остается внутри опухоли через 14 дней после инъекции, и эти наночастицы не обнаруживаются в экскрементах. Это указывает на то, что данные химически синтезированные наночастицы не способны быстро покидать опухоль и что они метаболизируются до железа и/или они выводятся с мочой. Эти особенности делают их потенциально менее привлекательными кандидатами на применение в качестве лекарственного препарата, чем цепочки магнитосом.

1. Применение цепочек бактериальных магнитосом для лечения опухоли при помощи термотерапии, где указанные цепочки бактериальных магнитосом имеют следующие свойства:
(i) содержат по меньшей мере 2 магнитосомы с размерами, лежащими в диапазоне от 10 до 120 нм,
(ii) кристаллографические направления большей части магнитосом, принадлежащих указанным цепочкам, ориентированы в направлении удлинения цепочки,
(iii) изолированы из магнетотактических бактерий, которые культивировались в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент.

2. Применение по п. 1, где указанные цепочки магнитосом подвергают воздействию переменного магнитного поля для выделения тепла.

3. Применение по п. 1, где указанный хелатирующий агент выбран из бисфосфонатов, родамина и ЭДТА.

4. Применение по п. 1, где указанные цепочки магнитосом содержат агент, связанный с магнитосомами и/или включенный внутрь магнитосом, который применяют для визуализации цепочек магнитосом.

5. Применение по п. 4, где указанный агент является флуорофором.

6. Применение по п. 4, где указанный агент является флуорофором и хелатирующим агентом, предпочтительно родамином.

7. Применение по п. 1, где указанные цепочки магнитосом инкапсулированы внутри везикулы.

8. Применение по п. 7, где указанные везикулы применяют в сочетании с активным компонентом.

9. Применение по п. 1, где лечение опухолевых клеток или опухоли является гипертермией.

10. Применение по п. 9, где температура лечения находится в диапазоне от 37 до 45°С, предпочтительно от 40 до 45°С, наиболее предпочтительно равна 43°С.

11. Применение по п. 1, где лечение опухолевых клеток или опухоли является термоабляцией.

12. Применение по п. 11, где температура лечения находится в диапазоне от примерно 45 до примерно 100°С, предпочтительно от примерно 45 до примерно 70°С, более предпочтительно от примерно 45 до примерно 55°С, наиболее предпочтительно от примерно 50 до примерно 55°С.

13. Применение по п. 2, где амплитуда магнитного поля находится в диапазоне от 0,1 до 200 мТл, предпочтительно от 1 до 100 мТл, более предпочтительно от 10 до 50 мТл.

14. Применение по п. 2, где частота магнитного поля находится в диапазоне от 50 до 1000 кГц.

15. Применение по п. 2, где магнитное поле прикладывают в течение периода времени, изменяющегося от 1 с до 6 ч, предпочтительно от 1 мин до 1 ч, наиболее предпочтительно от 1 до 30 мин.

16. Применение по п. 2, где процесс нагревания повторяют.

17. Применение по п. 2, где нацеливание на опухоль (опухоли) или опухолевую клетку (опухолевые клетки) цепочек магнитосом проводят с применением магнитного поля.

18. Применение по п. 2, где нацеливание на опухоль (опухоли) или опухолевую клетку (опухолевые клетки) проводят с применением антитела и/или фолиевой кислоты и/или ПЭГ, которые связаны с цепочками магнитосом или с содержащими их везикулами и специфично узнают опухоль (опухоли) и/или опухолевую клетку (опухолевые клетки).

19. Применение по любому из пп. 1-18, где указанная опухоль выбрана из рака предстательной железы, рака пищевода, рака поджелудочной железы, рака молочной железы, рака мозга и рака кожи.

20. Способ лечения опухоли у субъекта, которому это необходимо, где лечение осуществляют с применением тепла и где применяют цепочки магнитосом, как определены в п. 1, и при этом данные цепочки подвергают воздействию переменного магнитного поля для того, чтобы вызвать выработку тепла.

21. Способ по п. 20, где магнитосомы, содержащиеся в цепочках, имеют размеры, находящиеся в диапазоне от 10 до 70 нм, наиболее предпочтительно от 30 до 50 нм.

22. Способ по п. 20, где указанный хелатирующий агент выбран из бисфосфонатов, родамина и ЭДТА.

23. Способ по п. 20, где указанные цепочки магнитосом содержат агент, связанный с магнитосомами и/или включенный внутрь магнитосом, который применяют для визуализации цепочек магнитосом.

24. Способ по п. 23, где указанный агент является флуорофором.

25. Способ по п. 24, где указанный агент является флуорофором и хелатирующим агентом, предпочтительно родамином.

26. Способ по п. 20, где указанные цепочки магнитосом инкапсулированы внутри везикулы.

27. Способ по п. 26, где указанные везикулы применяют в сочетании с активным компонентом.

28. Способ по п. 20, где лечение опухолевых клеток или опухоли является гипертермией.

29. Способ по п. 28, где температура лечения находится в диапазоне от 37 до 45°С, предпочтительно от 40 до 45°С, наиболее предпочтительно равна 43°С.

30. Способ по п. 20, где лечение опухолевых клеток или опухоли является термоабляцией.

31. Способ по п. 30, где температура лечения находится в диапазоне от примерно 45 до примерно 100°С, предпочтительно от примерно 45 до примерно 70°С, более предпочтительно от примерно 45 до примерно 55°С, наиболее предпочтительно от примерно 50 до примерно 55°С.

32. Способ по п. 20, где амплитуда магнитного поля находится в диапазоне от 0,1 до 200 мТл, предпочтительно от 1 до 100 мТл, более предпочтительно от 10 до 50 мТл.

33. Способ по п. 20, где частота магнитного поля находится в диапазоне от 50 до 1000 кГц.

34. Способ по п. 20, где магнитное поле прикладывают в течение периода времени, изменяющегося от 1 с до 6 ч, предпочтительно от 1 мин до 1 ч, наиболее предпочтительно от 1 до 30 мин.

35. Способ по п. 20, где процесс нагревания повторяют.

36. Способ по п. 20, где нацеливание на опухоль (опухоли) или опухолевую клетку (опухолевые клетки) цепочек магнитосом проводят с применением магнитного поля.

37. Способ по п. 20, где нацеливание на опухоль (опухоли) или опухолевую клетку (опухолевые клетки) проводят с применением антитела и/или фолиевой кислоты и/или ПЭГ, которые связанны с цепочками магнитосом или с содержащими их везикулами и специфично узнают опухоль (опухоли) и/или опухолевую клетку (опухолевые клетки).

38. Способ по п. 20, где переменное магнитное поле прикладывают для улучшения проникновения цепочек магнитосом внутрь опухолевых клеток.

39. Способ по любому из пп. 20-38, где указанная опухоль выбирается из рака предстательной железы, рака пищевода, рака поджелудочной железы, рака молочной железы, рака мозга и рака кожи.

40. Набор для лечения опухоли, содержащий устройство, способное генерировать переменное магнитное поле, и цепочки бактериальных магнитосом, активируемых с помощью устройства, которое способно вырабатывать переменное магнитное поле, где указанные цепочки бактериальных магнитосом имеют следующие свойства: (i) содержат по меньшей мере 2 магнитосомы с размерами, лежащими в диапазоне от 10 до 120 нм, (ii) кристаллографические направления большей части магнитосом, принадлежащих указанным цепочкам, ориентированы в направлении удлинения цепочки, (iii) изолированы из магнетотактических бактерий, которые культивировались в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент.

41. Набор по п. 40, где указанные цепочки магнитосом инкапсулированы внутри везикулы.

42. Способ получения цепочек магнитосом, имеющих следующие свойства: (i) содержат по меньшей мере 2 магнитосомы с размерами, лежащими в диапазоне от 10 до 120 нм, (ii) кристаллографические направления большей части магнитосом, принадлежащих указанным цепочкам, ориентированы в направлении удлинения цепочки, (iii) изолированы из магнетотактических бактерий, где магнетотактические бактерии культивируют в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент.

43. Способ по п. 42, где указанный хелатирующий агент является флуоресцентным хелатирующим агентом.

44. Цепочки бактериальных магнитосом для лечения опухоли, полученные способом по п. 42.

45. Лекарственное средство для лечения опухоли, содержащее цепочки бактериальных магнитосом, изолированных из магнетотактических бактерий, которые культивировались в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент, и содержащих по меньшей мере 2 магнитосомы с большинством кристаллографических направлений, ориентированных в направлении удлинения цепочки, и при этом размеры магнитосом лежат в диапазоне от 10 до 120 нм.



 

Похожие патенты:

Изобретение относится к соединению формулы I или его таутомеру, энантиомеру или фармацевтически приемлемой соли, где в указанной формуле Y представляет собой -(О)х(СН2)yR11; х выбирают из 0 и 1; у выбирают из 0, 1, 2 и 3; R11 выбирают из фенила, пиридила, морфолинила, 1-оксо-1,3-дигидроизобензофуранила и 2-оксо-тетрагидрофуранила, при этом когда х равен 0, указанный фенил или пиридинил замещен -C(O)NR1R2 или Т; R1 и R2 выбирают независимо из водорода и С1-6алкила, при этом указанный алкил необязательно замещен -С(О)О(СН2)tR12, или R1 и R2 вместе с атомом азота, к которому они присоединены, образуют насыщенный 5-членный гетероцикл, содержащий 1-4 гетероатомов, выбранных из азота, кислорода и серы; t выбирают из 0, 1, 2 и 3; R12 выбирают из С3-6циклоалкила и фенила; Т выбирают из 2-оксо-1,3-диоксолана, 2-оксотетрагидрофурана, -(CHR7)zOR9, -(О)u(СН2)sC(О)R8, -OSO2R13 и -СН(ОН)СН2ОН; R7 представляет собой Н; R8 представляет собой -OR10; R9 представляет собой Н; R10 выбирают из С1-6алкила, -(CH2)R12 и водорода, при этом указанный алкил необязательно замещен галогеном или диС1-6алкиламином; R13 представляет собой CF3; u выбирают из 0 и 1; z выбирают из 1, 2 и 3; s выбирают из 1 и 2; R5 выбирают из -NR3R4 и -OR10; R3 и R4 выбирают независимо из Н, С1-12алкила, -(О)q(СН2)rP; при этом указанный алкил необязательно замещен -ОН; q выбирают из 0 и 1; r выбирают из 0, 1, 2 и 3; Р выбирают из фенила, -SO2R6, пиперидинила и пирролидинила; и R6 представляет собой -NH2, при условии, что когда R11 представляет собой фенил или пиридил, тогда a) х+у≥1; или b) R11 замещен Т; или c) R5 представляет собой NR3R4, и по меньшей мере один из R3 или R4 представляет собой -(О)q(СН2)rP-, и q+r≥1; или d) по меньшей мере один из R1 или R2 представляет собой алкил, замещенный -С(О)О(СН2)R12.

Изобретение относится к соединению формулы I, где Ph представляет собой фенил; R1 представляет собой C3-7циклоалкил; каждый R2, R3, R4, R5 и R6 независимо в каждом случае представляет собой H или C1-6алкил; или его фармацевтически приемлемой соли.

Настоящее изобретение относится к области преобразования химических элементов и источникам радиоактивности, предназначенным для медицинских целей, в частности к способу получения радиофармацевтического препарата «Астат-211» из облученной мишени, включающему возгонку радионуклида при температуре 700÷850°C в течение 4÷6 минут, с его осаждением в слабощелочном буферном физиологическом растворе с pH от 7.5 до 9, где в качестве мишени используют Bi естественного изотопного состава, который облучается α-частицами с энергией 29÷31 МэВ.

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

Группа изобретений относится к комбинированной терапии солидной опухоли или рака. Предложены: фармацевтический продукт в виде комбинированного препарата указанного назначения, содержащий в качестве активного агента {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его фармацевтически приемлемую соль и пег-интерферон альфа-2а; набор того же назначения, включающий вышеперечисленные активные агенты; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а в лечении солидной опухоли или рака; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а для производства лекарственного средства для лечения солидной опухоли или рака.

Изобретение относится к новым соединениям формулы 10 и способу их получения. Соединения обладают свойствами ингибиторов рецепторной тирозинкиназы типа I и могут быть использованы при лечении гиперпролиферативных нарушений.

Данное изобретение относится к соединениям или их фармацевтически приемлемым солям общей формулы I, где R1 представляет собой ;R2 выбирают из группы, состоящей из замещенного или незамещенного фенила и , и ; и R3, R4, R5 и R6 все представляют собой Н, также к соединениям II и III.

Изобретение относится к химиотерапии. Предложен способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток.

Изобретение относится к медицине, а именно к онкологии, и касается лечения рака у человека. Для этого вводят соединение формулы в интервале суточных доз от 20 мг до 1500 мг.
Изобретение относится к медицине, а именно к онкологии. Сочетают хирургический метод лечения с интраоперационной внутриартериальной химиотерапией.

Изобретение относится к фармацевтической промышленности и представляет собой топическую композицию в форме порошкового аэрозоля для лечения и/или профилактики инфицирования повреждений кожи, содержащую сульфадиазин серебра и по меньшей мере один силикат, отличающуюся тем, что указанная композиция содержит сульфадиазин серебра в количестве от 0,1% до 5% масс.

Настоящее изобретение относится к способу получения фармацевтической композиции, содержащей деферазирокс. Способ включает стадии получения дисперсии деферазирокса с по меньшей мере одним эксципиентом в воде, гомогенизирования деферазирокса и по меньшей мере одного эксципиента до получения гомогенной дисперсии деферазирокса и измельчения указанной гомогенной дисперсии до получения взвеси со средним размером частиц менее или равным 2000 нм.

Группа изобретений относится к медицине и касается фармацевтической микросферной композиции, включающей ротиготин или его фармацевтически приемлемую соль; по крайней мере один полилактид-гликолид (ПЛГлА) с молекулярной массой 5000-100000 Да и полимеризационным соотношением лактид:гликолид от 95:5 до 5:95; и, по меньшей мере, одну жирную кислоту, имеющую 8-24 атомов углерода, где ротиготин или его фармацевтически приемлемая соль составляет 20-40%, ПЛГлА составляет 45-79%, и, по меньшей мере, одна жирная кислота составляет 1-15% по весу относительно общего веса композиции.

Изобретение описывает способ введения фармацевтически активного соединения пациенту. Способ включает получение порошкообразной композиции, смешивание композиции с жидкостью или полутвердым продуктом с получением стабильного раствора или дисперсии и пероральное введение раствора или дисперсии пациенту.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано для лечения немелкоклеточного рака легких (НМРЛ). Для этого пациенту вводят a) эффективное количество композиции, включающей наночастицы, содержащие паклитаксел и альбумин, и b) средство на основе платины для изготовления комбинации лекарственного средства для лечения НМРЛ.

Изобретение относится к фармацевтической промышленности, а именно к тонкозернистому порошку алоэ и его использованию. Способ приготовления тонкозернистого порошка экстракта алоэ, включающий дозирование сублимированного порошка алоэ, где сублимированный порошок алоэ имеет как минимум 25% полисахаридов алоэ; растворение сублимированного порошка алоэ в деионизированной воде для получения раствора; добавление органического растворителя в раствор для получения первой смеси; отстаивание первой смеси для образования осадка; извлечение части надосадочной жидкости из первой смеси и добавление органического растворителя в количестве, превышающем объем взятого надосадочного раствора, для получения второй смеси; обработку второй смеси в центрифуге; отслеживание появления осадка во второй смеси; добавление органического растворителя в первую смесь, если наблюдается образование любого осадка во второй смеси; сцеживание надосадочной жидкости первой смеси, где сцеживание происходит только в том случае, если не наблюдается никакой осадок во второй смеси; фильтрацию осадка из первой смеси; извлечение порошка экстракта алоэ; помещение порошка экстракта алоэ в колбу для сублимиционной сушки в морозильной установке; сублимирование замороженного порошка экстракта алоэ в сублимиционной сушке; и измельчение сублимированного порошка экстракта алоэ в аппарате для измельчения до тонкозернистой текстуры, при этом органический растворитель выбран из группы метанол, этанол, изопропиловый спирт, пропанол, при определенных условиях.

Настоящее изобретение относится к способу лечения аллергического заболевания путем введения субъекту терапевтически эффективного количества агониста TLR8-рецептора бензо[b]азепина VTX-378 - (1Е,4Е)-2-амино-N,N-дипропил-8-(4-(пирролидин-1-карбонил)фенил)-3Н-бензо[b]азепин-4-карбоксамида или его фармацевтически приемлемой соли.

Группа изобретений относится к области фармацевтики. Описаны частицы носителя, способ приготовления носителя для сухой порошкообразной фармацевтической композиции для ингаляций, а также фармацевтическая композиция в форме сухого порошка для ингаляций.

Изобретение относится к лекарственной дозированной форме для введения два раза в сутки, один раз в сутки или менее часто, которая содержит 6′-фтор-(N-метил- или N,N-диметил)-4-фенил-4′,9′-дигидро-3′H-спиро[циклогексан-1,1′-пирано[3,4,b]индол]-4-амин или его физиологически приемлемую соль и которая высвобождает в соответствии с Европейской фармакопеей в условиях in vitro в 900 мл искусственного желудочного сока при pH 1,2 и 37±0,5°C через 30 минут в соответствии со способом с использованием лопастной мешалки с синкером при 100 об/мин по меньшей мере 50 мас.

Изобретение относится к фармацевтической промышленности и представляет собой фармацевтическую композицию, содержащую кроскармеллозу натрия, гиалуроновую кислоту и нестероидное противовоспалительное лекарственное средство в кислотной форме для местного лечения экссудирующих кожных повреждений, где кроскармеллоза составляет по меньшей мере 90 мас.% композиции, где нестероидное противовоспалительное лекарственное средство в кислотной форме представляет собой диклофенак в концентрации от 0,4 до 3,0 мас.% по отношению к суммарной массе композиции, и где гиалуроновая кислота имеет среднемассовую молекулярную массу (MW), составляющую от 130 до 230 кДа, и концентрацию, составляющую от 0,1 до 4 мас.% по отношению к суммарной массе композиции.
Изобретение относится к порошкообразной композиции, включающей пробиотики. Высушенная порошковая композиция, содержащая твердые частицы, включает живой пробиотический микроорганизм и фазу носителя.
Наверх