Способ определения функции ошибок спаривания днк



Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк
Способ определения функции ошибок спаривания днк

 


Владельцы патента RU 2597290:

ХЕЛЬСИНГИН УЛИОПИСТО (FI)

Настоящее изобретение относится к количественному способу определения, обладает ли обследуемый человек нарушенной функцией репарации ошибочно спаренных оснований ДНК. Способ предусматривает получение ядерных экстрактов с нормальной функцией MMR и утраченной функцией MMR в качестве положительного и отрицательного контроля из диагностического образца. Далее осуществляют смешивание каждого ядерного экстракта с субстратом-молекулой ДНК, включающим по меньшей мере одну ошибку спаривания оснований, выполняют анализ репарации ошибочно спаренных оснований. В заключении определяют, способен ли указанный ядерный экстракт образца к репарации указанного субстрата-молекулы ДНК; причем указанный образец включает нормальные незлокачественные конститутивные клетки, например, фибробласты. Изобретение дополнительно относится к набору, включающему необходимые реагенты для применения в указанном способе. 4 н. и 16 з.п. ф-лы, 6 ил., 2 табл., 9 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к диагностике рака и предлагает способы, основанные на анализе репарации ошибочно спаренных оснований ДНК, определения, нарушена ли у обследуемого человека функция репарации ошибочно спаренных оснований ДНК; а также определения дефектного гена репарации ошибочно спаренных оснований ДНК, и, следовательно, определения повышения риска развития наследственных видов рака, в частности, колоректального рака. Указанный способ обеспечивает также новый способ диагностики синдрома Линча. В заявленном способе используется образец, происходящий из нормальной ткани, например фибробластов.

УРОВЕНЬ ТЕХНИКИ

Колоректальный рак (КРР) представляет собой вторую по распространенности причину смертности от онкологических заболеваний в США и Европе. Согласно недавней обзорной статье Pino, M.S. и Chung, D.D. (Expert Rev Mol Diagn, 10(5): 651-665, 2010), КРР приводит к приблизительно 52000 смертям в год в США и 146000 смертям в год в Европейском Союзе. Приблизительно 2-5% впервые диагностированных КРР могут быть связаны с синдромом Линча.

Синдром Линча (СЛ), или наследственный неполипозный колоректальный рак (НПКРР) отличается ранним развитием колоректального рака и рака эндометрия, а также увеличенным риском развития некоторых других видов рака, помимо рака толстой кишки, в том числе других опухолей желудочно-кишечного тракта (желудка, тонкого кишечника, желчевыводящих путей), выделительной системы (лоханки почки, мочеточников) и женской половой системы (яичников).

В некоторых исследованиях отдельных семей с синдромом Линча риск развития рака толстой кишки в течение жизни оценивается как 70-80% при этом диагноз ставится в среднем в 40-50 лет. Вторым по распространенности видом рака при СЛ является рак эндометрия; у женщин с синдромом Линча имеется суммарный риск развития рака эндометрия и рака яичников в течение жизни, со средним возрастом постановки диагноза на 10 лет ранее, чем в случае спорадического рака. Риск развития рака желудка у пациентов с ЛС отличается в зависимости от популяции, он особенно высок частотой в таких регионах как Китай или Корея, где имеется высокий эндемический риск развития рак желудка - приблизительно 30% в течение жизни. В таких регионах, риск рака желудка превышает риск рака эндометрия.

Синдром Линча тесно связан с наследуемыми по аутосомному доминантному типу мутациями генов, играющих основную роль в механизме репарации ошибочно спаренных оснований ДНК (mismatch repair, далее MMR), и вызван генеративными мутациями в одном из генов репарации ошибочно спаренных оснований ДНК (гены MMR): MLH1, MSH2, MSH6 и PMS2. Помимо этого, нарушения MMR отмечаются в 25% спорадических опухолей толстой кишки, а также в ряде опухолей эндометрия, яичника и некоторых других органов и тканей. В норме, белки MMR распознают и исправляют неправильно спаренные нуклеотиды и петли, возникшие в результате инсерций и делеций, вызванных «проскальзыванием» ДНК-полимеразы в процессе репликации коротких повторов, так называемых микросателлитов.

В механизме репарации ошибочно спаренных оснований (MMR), направленном на сохранение генома в неизменном виде, у человека участвуют пять белков, функционирующих в форме гетеродимеров: MutLa (MLH1 + PMS2), MutSa (MSH2 + MSH6) и MutSp (MSH2 + MSH3). Белки MMR исправляют ошибки спаривания оснований и небольшие инсерционно-делеционные петли (IDL), появляющиеся в заново синтезированной цепи ДНК при репликации и рекомбинации.

Чаще всего затронутыми оказываются гены MLH1, MSH2, MSH6 и PMS2, случаи генеративной изменчивости которых имеются в открытой базе данных по изменчивости LOVD (http://www.insight-qroup.org/; http://www.lovd.nl/). Большинство мутаций в генах MMR приводят к синтезу «усеченных» форм белка, тем не менее значительная часть мутаций генов MMR приводит к замене одной аминокислоты или делециям внутри рамки считывания, и такие мутации сложно отличить от безвредного полиморфизма. Такие изменения часто описывают как варианты с неопределенными значением (VUS), поскольку влияние таких вариантов изменчивости на функцию полипептида не описан.

Опухоли с нарушением функции MMR тесно связаны с микросателлитной нестабильностью (MSI). Однако, степень и тип MSI различаются в зависимости от того, какой именно MMR-ген затронут мутацией (Kantelinen et al., British J Cancer, 1-6, 2010).

Средний возраст возникновения рака при СЛ значительно ниже, чем средний возраст возникновения спорадического колоректального рака; это связано с тем, что пациент уже унаследовал предрасположенность, связанную с мутантным аллелем, и для потери активности MMR и образования опухоли необходима лишь вторая мутация того же гена в соматической клетке. Поэтому опухоли при СЛ отличаются отсутствием или сниженным уровнем соответствующего MMR белка, а также нарушенной репарацией ДНК, которая и приводит к MSI.

Своевременная диагностика СЛ необходима для выявления пациентов, относящихся к группе риска, которым требуется интенсивная профилактика рака. Скрининг и удаление предраковых нарушений, аденом, существенно снижает заболеваемость и смертность у носителей мутацией в гене MMR (Järvinen et al., Gastroenterology 118: 829-834, 2000). Анализ соотношения эффективности и затрат, показывает, что скрининг и профилактика колоректального рака у носителей мутации в гене MMR эффективны и значительно менее затратны, чем последствия в случае их отсутствия. Согласно рекомендациям центров контроля и профилактики заболеваний (CDC) в США всем пациентам, у которых впервые диагностирован колоректальный рак, независимо от возраста и семейного анамнеза, предлагается пройти генетический тест на синдром Линча. В отчете CDC также указано, что имеющиеся в настоящее время данные не позволяют выбрать какую-либо конкретную стратегию скрининга из известных альтернативных стратегий.

При этом, большое разнообразие клинических фенотипов затрудняет диагностику СЛ и к настоящему времени разработано несколько клинических протоколов, направленных на то чтобы различить семьи с СЛ и общую заболеваемость КРК. В настоящее время, клинический диагноз СЛ основан преимущественного на Амстердамских критериях и уточненных протоколах Бетезда, которые учитывают возраст возникновения рака, число и распределение лиц с этим заболеванием в семье, а также уровень MSI (Pino & Chung, Supra). Однако многие семьи с СЛ не соответствуют этим критериям и могут быть распознаны как семьи с СЛ только при описании в этих семьях патогенной генеративной мутации гена MMR.

Традиционная схема диагностики для выявления носителей мутаций генов MMR, т.е. лиц с синдромом Линча, состоит из нескольких стадий, в том числе исследование опухоли, анализе ДНК, тестах патогенности мутации in vitro, от выявления генетического нарушения до последующим исследования связи такого нарушения с способностью к MMR. Первая клиническая стадия диагностики опухолей, связанных с синдромом Линча, включает иммуногистохимический анализ (IHC) и анализ MSI с последующим скринингом мутаций на основании результатов IHC и MSI. Одной из стратегий скрининга мутаций является анализ всех четырех генов MMR (MLH1, MSH2, MSH6 и PMS2). При обнаружения патогенной мутации, диагноз СЛ может быть подтвержден, а в отсутствии изменений генов MMR такой диагноз можно считать маловероятным, но нельзя исключить (поскольку ни один из методов, ни по отдельности, ни в комбинации, не обладает 100% специфичностью и чувствительностью).

В недавней публикации авторов настоящего изобретения (Kansikas et al., Hum Mutat 32: 107-115, 2011) раскрыто, что оценка патогенности может быть основана на тестировании эффективности MMR для синтезированных in vitro мутантных белков. В опубликованном анализе MMR in vitro исследование фенотипические последствия мутаций СЛ в гомологичной человеческой системе MMR. Конструирование белка с искусственными мутациям СЛ требует обнаружения и полного описания соответствующего генетического дефекта на уровне последовательности ДНК.. Было предложено трехступенчатое дерево принятия решения (Couch et al., Hum Mutat 29: 1314-1326, 2008):

Однако современные тесты, применяемые для постановки клинического диагноза, обладают несколькими недостатками:

Исследование MSI требует значительных трудозатрат и экспертного уровня диагностики молекулярных патологий, при этом, хотя MSI и является отличительным признаком ЛС, это не специфический признак. Приблизительно в 10-25% спорадических случаев колоректального рака и многих видов рака, не связанных с толстым кишечником, отмечается MSI. Кроме того, случи связанного с ЛС и спорадического колоректального рака имеют много сходных гистопатологических признаков, однако различаются тем, что спорадические случае колоректального рака с MSI не связаны с семейным анамнезом.

Потенциальный неустранимый недостаток теста IHC состоит в том, что его методика отчасти субъективна и зависит от качества изготовления препарата ткани, окрашивания и интерпретации результатов. Интересно, что аномальная картина окрашивания может быть связана с сохранностью ткани и микроокружением опухоли. Так, например, гипоксия ткани или окислительный стресс могут снижать функцию белков MMR даже в тканях с эффективной функций MMR, что приводит к потере окраски или слабой окраске. Вторичные аномалии генов MMR также могут приводить к необычной картине окрашивания.

Однако, наиболее очевидное ограничение современных способов диагностики ЛС связано с тем, что эти тесты основаны на генетическом исследовании и мутационном анализе лиц из семей с известным или предполагаемым СЛ в семейном анамнезе, или же пациентов, уже страдающим от рака. Этот факт делает современные способы диагностики неприменимыми при рутинном скрининге здоровых людей, которые предположительно могут быть носителями СЛ. Кроме того, схемы исследования требуют больших трудозатрат, хорошо оборудованных лабораторий и высококвалифицированного лабораторного персонала. По оценками, стоимость всех стадий, включая IHC, MSI и мутационный анализ составляет порядка 3500 евро за каждый тест, что слишком дорого для рутинного тестирования.

Таким образом, существует определенная и признанная потребность в точном, более простом, но при этом более дешевом и применимом в условиях клиники тесте для определения того, является ли человек носителем мутаций в генах MMR, связанных с синдромом Линча, и, соответственно, относится ли он к группе повышенного риска развития колоректального рака, а также других видов рака.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Целью настоящего изобретения является создание новых способов и средств выполнения аккуратных, простых, дешевых и походящих для клинического применения тестов выявления снижения эффективности MMR без предварительного знания анамнеза СЛ или рака у исследуемых лиц, и, таким образом, преодоление недостатков существующих способов диагностики. Настоящее изобретение относится к количественному способу определения, обладает ли обследуемый человек нарушенной функцией репарации ошибочно спаренных оснований ДНК, причем указанный способ включает а) получение ядерного экстракта образца, полученного у обследуемого человека, б) получение экстрактов ядерных белков, способных к MMR и неспособных к MMR в качестве положительного и отрицательного контроля, соответственно, в) комбинирование в отдельных сосудах каждого ядерного экстракта с гетеродуплексным ДНК-субстратом, включающим по меньшей мере одну ошибку спаривания оснований г) выполнение анализа репарации ошибочно спаренных оснований с указанным образцом и указанным субстратом и контрольными экстрактами ядерных белков и указанным субстратом, и д) определение, способен ли указанный ядерный экстракт к репарации указанного субстрата - молекулы ДНК. Предпочтительно, указанный образец включает нормальные клетки, полученные из конститутивной ткани, более предпочтительно фибробласты или клетки, полученные из крови.

В одном варианте осуществления изобретения, указанный субстрат получают из плазмиды, включающей последовательность SEQ ID N0: 1, и предпочтительно указанный субстрат дополнительно включает нуклеотидную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID N0: 2 и SEQ ID N0: 3.

В другом варианте осуществления изобретения, ядерный экстракт с дефектной функцией MMR получен из линии клеток, выбранной из группы, состоящий из клеток НСТ116 и LoVo. В конкретном варианте осуществления изобретения, количество ядерного экстракта в каждом сосуде находится в диапазоне 50-500 мкг, предпочтительно 50-200 мкг, более предпочтительно 75-100 мкг.

Настоящее изобретение дополнительно относится к количественному способу выявления гена репарации ошибочно спаренных оснований, обладающего дефектной функцией, причем указанный способ включает а) получение ядерного экстракта образца, полученного у обследуемого человека, б) получение экстрактов ядерных белков с нормальной функцией MMR и дефектной функцией MMR в качестве положительного и отрицательного контроля, соответственно в) смешивание по крайней мере одного экстракта ядерных белков, с нормальный функцией MMR, с указанным ядерным экстрактом образца, г) комбинирование в отдельных сосудах каждого ядерного экстракта, полученного на стадиях а)-в) с гетеродуплексным ДНК-субстратом, включающим по меньшей мере одну ошибку спаривания оснований, д) выполнение анализа репарации ошибочно спаренных оснований с указанными ядерными экстрактами и указанным субстратом и е) выявление указанного дефектного гена путем определения того, способен ли указанный образец ядерного экстракта к репарации указанного субстрата и комплементации указанного ядерного экстракта с дефектной функцией MMR. Предпочтительно, указанный образец включает нормальные клетки, полученные из конститутивной ткани, более предпочтительно фибробласты или клетки, полученные из крови.

В одном из вариантов осуществления изобретения, указанный субстрат получают из плазмиды, включающей последовательность SEQ ID N0: 1, и предпочтительно указанный субстрат дополнительно включает нуклеотидную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID N0: 2 и SEQ ID N0: 3.

Еще в одном варианте осуществления изобретения, ядерный экстракт с дефектной функцией MMR получен из линии клеток, выбранной из группы, состоящий из клеток НСТ116 и LoVo. В конкретном варианте осуществления изобретения, количество ядерного экстракта в каждом сосуде находится в диапазоне 50-500 мкг, предпочтительно 50-200 мкг, более предпочтительно 75-100 мкг.

Дополнительно, настоящее изобретение относится к новому способу диагностики синдрома Линча у человека, основанному на выявлении дефектного гена репарации ошибочно спаренных оснований ДНК, на основании клинического образца, полученного из конститутивной ткани человека.

Настоящее изобретение относится также к набору для применения в способах, согласно настоящему изобретению, который включает, по меньшей мере, один гетеродуплексный ДНК субстрат, включающий ошибку спаривания оснований, по меньшей мере один ядерный экстракт с дефектной функцией MMR, и ядерный экстракт с нормальной функцией MMR в качестве положительного контроля. Предпочтительно, указанные ядерные экстракты с дефектной функцией MMR получены из линии клеток, с потерей способности к MMR, обусловленной дефектами генов MLH1, MSH2 или MSH6, предпочтительно из клеток НСТ116 или LoVo.

B конкретном варианте осуществления настоящего изобретения, указанный набор включает по меньшей мере два ядерных экстракта с дефектной функцией MMR.

Еще в одном варианте осуществления, указанный набор может включать также дополнительные реактивы, необходимые для выполнения анализа MMR, например 10-кратный MMR буфер, включающий 200 мМ Трис-HCl с рН 7,6, 400 мМ KCl, 50 мМ MgCl2, 10 мМ глутатиона, 500 мкг/мл БСА, 1 мМ каждого дНТФ и 15 мМ АТФ; а также СТОП раствор для анализа MMR, включающий 42 мМ ЭДТА, 1,2% СДС и 50,4 мкг/мл протеиназы К. Необязательно, указанный набор может также включать реактивы для осветления образца, например ТЭ буфер, фенол/хлороформ/изамиловый спирт и хлороформ; реагены для осаждения указанного образца, например NaCl и этиловый спирт; а также реагенты для выявления репарации, например РНКазу и ферменты рестрикции BglW и Eco31I с буфером и загрузочной краской.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Ниже изобретение будет описано более подробно с указанием предпочтительных вариантов воплощения изобретения и со ссылками на прилагаемые фигуры, на которых:

Фиг. 1: обзор способа согласно настоящему изобретению;

Фиг. 2: анализ функции MMR в ядерном экстракте здоровых фибробластов (FB-WT, дикий тип) в сравнении с ядерным экстрактом, полученным из клеток с нормальной функцией MMR (HeLa) и контролем с дефектной функцией (MOCK) без ядерных белков;

Фиг. 3: анализ Вестерн-блот, который показывает а) содержание белка MMR (MLH1 и его партнер PMS2) в ядерном экстракте здоровых фибробластов (FB-WT, дикий тип) в сравнении с полученной из фибробласта клеточной линией FB-M1 с частичной подавленной экспрессией MLH1 и б) содержание белка MMR (MSH2 и его партнера MSH6) в FB-WT в сравнении с полученной из фибробласта клеточной линией FB-SH13 с частичным подавленной экспрессией MSH2.

Фиг. 4: количественный анализ функции MMR, показывающий, что дефицит MLH1 a FB-M1 и MSH2 a FB-SH13 выявляется по снижению эффективности репарации различной степени выраженности. Сравнительная доля успешной репарации показана в сравнении с эффективностью репарации в FB-WT; и

Фиг. 5 количественный анализ функции MMR где показано, что различная эффективность MMR клеток FB-WT и FB-M1 может выявляться при применении ядерного экстракта НСТ116 с дефицитом MLH1); и

Фиг. 6 представляет собой схематическое изображение получения субстрата, в том числе показаны плазмиды pGEM-IDL40, pGEM-IDLGT и pGEM-IDL39, и их производные конструкции 5′IDLGT и 54DL1.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Неожиданно было обнаружено, что функциональный анализ эффективности репарации ошибочно спаренных оснований ДНК (MMR) может применяться для выявления индивидуумов с наследственным нарушением MMR, у которых существует связанный с таким нарушением существенный риск развития рака. В настоящем изобретении предложен новый анализ функции MMR, направленный на выявление нарушенной способности к MMR (Фиг. 1). Анализ, согласно настоящему изобретению, применим в отсутствии предварительной информации о последовательности соответствующего гена MMR или регуляторного изменения, семейного анамнеза, онкологического анамнеза или результатов иммуногистохимического анализа, и поэтому представляет собой новый подход к диагностике. Заявленный способ анализа идеально подходит для скрининга носителей MMR мутаций в больших популяциях и, таким образом, для обнаружения лиц с высоким риском развития рака.

Настоящее изобретение относится к простому протоколу теста, включающему только один анализ, в то время как стандартная схема диагностики для выявления носителей мутаций гена MMR (синдрома Линча) включает несколько тестов, от выявления генетического дефекта до оценки того, связан ли выявленный дефект со сниженной способностью к MMR. В настоящем изобретении предложен одностадийный способ, позволяющий оценить, является ли индивидуум носителем дефекта MMR с помощью количественного анализа функции MMR. Способ согласно настоящему изобретению основан на выявлении сниженной способности к MMR в образце нормальной ткани, например, крови, слизистой или фибробластов, предпочтительно фибробластов или лимфобластов, полученных у обследуемого пациента.

В настоящей заявке, термин «нормальная» ткань подразумевает любую здоровую, незлокачественную ткань, предпочтительно конститутивную ткань.

В настоящей заявке, термин «конститутивная ткань», обозначает ткань, состоящую из незлокачественных клеток, которые по существу отражают генетический состав, унаследованный при рождении, которая может быть получена из любой доступной для взятия образца части тела человека, например слизистую оболочку или фибробласты.

Протокол теста, согласно настоящему изобретению, относится к количественному способу. В настоящей заявке, термин «количественный способ» означает способ, при применении которого получают данные о различной степени эффективности MMR, т.е. не тест с ответом «да» или «нет». Заявленный анализ функции MMR выявляет нарушения белков MMR по снижению эффективности репарации (см. Фигуру 4 в отношении MLH1 и MSH2). В настоящей заявке гены MMR или белки MMR означают любые гены или белки, участвующие в процессе MMR, например, выбранные из группы, состоящей из MLH1, MSH2, MSH6, MLH3, MSH3, PMS1, PMS2 и ЕХ01. В конкретном варианте воплощения, нарушения белков MMR MLH1, MSH2 и/или MSH6 выявляются способом или средствами согласно настоящему изобретению. Действительно, некоторая способность к исправлению ошибочно спаренных оснований сохраняется, например, в том случае, если имеется лишь один нормальный аллель гена MMR, что имеет место в любых нормальных клетках носителей мутации MMR в семьях с СП, или же в том случае, если ген MMR частично потерял активность. Для сравнения, в известных из уровня техники тестах, в которых используются раковые клетки, определяют, присутствует или отсутствует функция MMR, (т.е. присутствуют оба аллеля дикого типа) или (отсутствуют оба аллеля дикого типа), представляющие тесты MMR с ответом «да» или «нет».

Репарация ошибочно спаренных оснований (MMR) ДНК происходит в ядре клетки, и в процессе репарации принимают участие только MMR белки ядра. С помощью способа согласно настоящему изобретению возможен анализ функциональности участвующих в MMR белков, которые направляются в ядро для осуществления репарационной активности in vivo, поскольку в этом способе в качестве исходного материала применяется ядерный экстракт. В отличие от этого при традиционной схеме анализ функции MMR применяется для исследования эффективности MMR мутантных белковых продуктов MMR, сконструированных in vitro. В этих испытаниях in vitro, тестируемые белки искусственно добавляют к ядерному экстракту, что не позволяет возможность изучать только белки, имеющиеся в ядрах в естественной ситуации. Таким образом, тест патогенности, согласно настоящему изобретению, отличается от функциональных тестов, известных из уровня техники, тем, что в нем раскрывается природная способность ядра к MMR. Таким образом, с помощью способа согласно настоящему изобретению, возможно обнаружить проблемы внутриядерной локализации MMR белков.

В способах, известных из уровня техники, используются клеточные экстракты, например цитоплазматические экстракты (СЕ), а не ядерные экстракты. Тесты с использованием цитоплазматических экстрактов не дают правильной информации о количествах и долях MMR белков, которые в реальности способны осуществлять процесс репарации. Таким образом, тесты с цитоплазматическими экстрактами применимы лишь как тесты с ответом «да» или «нет», но не как количественное тестирование MMR.

При способах согласно настоящему изобретению, способность к MMR непосредственно выявляется в агарозном геле, без применения косвенных способов определения, таких как комплементационный анализ в E.coli, где выявление осуществляется по экспрессии гена lacZα.

Одностадийный анализ согласно настоящему изобретению может необязательно включать стадии идентификации гена с генетическим или эпигенетическим дефектом, с которым связано нарушение MMR, или дополняться такими стадиями; однако эти стадии необязательны для постановки клинического диагноза. В отличие от традиционных тестов, способ согласно настоящему изобретению позволяет выявить лиц с повышенной предрасположенностью к раку, связанной с нарушенной MMR даже в том случае, если ни у одного из членов семьи еще не развился рак, если мутационные тесты не показывают выявляемых различий и в тех случаях, когда причиной является не генетическое а эпигенетическое (регуляторное) изменение.

Основной принцип, а также различные варианты осуществления предлагаемого анализа показаны в виде схемы в Таблице 1, где Y обозначает экстракт ядерных белков с нарушенной MMR, X обозначает экстракт ядерных белков из тестируемого образца и Z обозначает экстракт ядерных белков с нормальной функцией, MMR применяемый в качестве положительного контроля.

В одном варианте осуществления настоящего изобретения экстракт ядерных белков тестируемого образца (X) получают из культуры нормальных клеток, например фибробластов, взятых у тестируемого пациента, и анализ функции MMR, согласно настоящему изобретению, выполняется в сосудах, содержащих Y (ядерный экстракт с дефектной функцией MMR), X и Z (ядерный экстракт с нормальной функцией MMR в качестве положительного контроля), соответственно. Реакция репарации превращает гетеродуплексы, устойчивые к расщеплению эндонуклеазами рестрикции в гомодуплексы, которые могут быть расщеплены. В случае, если образец X способен к MMR, субстратный гетеродуплекс будет, таким образом, расщеплен и линеаризован с получением трех фрагментов, при этом если X неспособен к MMR, при линеаризации образуется только один фрагмент. Таким же образом, Y даст только один фрагмент, в то время как Z даст три фрагмента. Этот вариант осуществления настоящего изобретения, +/- анализ MMR (+/- обозначает, что один из аллелей гена MMR является функциональным, а второй - дефектным), позволяет определить, обладает тестируемый пациент нарушенной/дефектной функцией MMR или нормальной функцией MMR.

В другом варианте осуществления настоящего изобретения, ядерный экстракт образца (X) применятся для комплементации нормальной функции MMR в ядерном экстракте (Y), с образованием смеси X+Y. Дополненные тестируемые образцы (X+Y), а также положительный (Z) и отрицательный (Y) контроли, применяются затем при анализе функции MMR согласно настоящему изобретению для исследования способности к репарации ошибочно спаренных оснований. Эффективность репарации выражают количественно, измеряя эффективность расщепления, используя при этом в качестве уровня отсчета эффективность репарации нормального ядерного экстракта фибробластов (Z), что проиллюстрировано в Примере 8 и на Фиг. 4.

Число включенных в анализ ядерных экстрактов с дефектом MMR (Yn) может изменяться в зависимости от того, нужно ли выявить конкретный дефект(ы). В одном из предпочтительных вариантов осуществления способа, согласно настоящему изобретению, Υ1 имеет дефицит MLH1, Υ2 имеет дефицит MSH2/MSH6. Еще в одном варианте осуществления настоящего изобретения Υ3 имеет дефицит PMS2. Однако любой их указанных ядерных экстрактов с дефектом MMR (Υn) может быть исключен или добавлен в способ или применен в любой комбинации. Специалист в данной области техники способен сформировать тест-панель, подходящую для конкретной клинической ситуации.

Выполнение типичного диагностического анализа согласно настоящему изобретению подробно описано ниже.

А. Образцы ткани

Тестируемый образец ткани может представлять собой любую нормальную ткань, удобную для взятия и обработки. В одном из конкретных вариантов осуществления настоящего изобретения, выбранный образец ткани представляет собой образец кожи, полученный с помощью пункции или иссечения, любым способом, хорошо известным специалистам в области медицины.

Другие образцы ткани, которые могут применяться в способе согласно настоящему изобретению, включают образцы крови и мазки слизистых оболочек.

Б. Размножение клеток образца

Для исследования способности клеток к репарации ошибочно спаренных оснований (MMR), до экстракции ядерных белков необходимо нарастить достаточное количество клеток. Клетки выращивают в стандартных условиях клеточной культуры, подходящих для данного типа клеток и хорошо известных в данной области техники, затем собирают центрифугированием в мягких условиях.

В способе согласно изобретению может применяться любой тип клеток, полученный из клинического образца, взятого у пациента-человека, в том числе злокачественные клетки, полученные из опухоли. При этом предпочтительно использовать в тесте человеческие фибробласты. Еще один предпочтительный тип клеток представляет собой клетки, полученные из крови человека, например лимфоциты.

Наиболее предпочтительно, клетки, применяемые в тесте согласно настоящему изобретению представляют собой нормальные первичные клетки или трансформированные нормальные клетки.

В. Экстракция ядерных белков из фибробластов человека

MMR белки экстрагируют из ядер клеток. Клетки осаждают центрифугированием, подсчитывают и промывают солевым буфером для удаления остатков триписна. Клетки дополнительно промывают изотоническим раствором, затем осаждают центрифугированием и подвергают набуханию путем промывки гипотоническим раствором. Мембраны клеток разрушают тонкой иглой до тех пор, пока большая часть клеток не будет лизирована (что проверяется под микроскопом). После осаждения клеток, удаляют супернатант, содержащий цитоплазматическую фракцию. Ядерные белки экстрагируют из оставшейся ядерной фракции путем инкубации в холодном буфере для экстракции с солью, после чего оставшийся ядерные частицы отделяют центрифугированием, удалив полученную пеллету осадка. Экстрагированный образец ядерных белков затем подвергают диализу в присутствии ингибиторов протеиназ, затем очищают центрифугированием и хранят при -80°С. Содержание в образцах белка измеряют с помощью флоуориметра.

Г. Приготовление субстрата

Кольцевой гетеродуплексный субстрат-плазмиду для применения при анализе Анализ функции MMR согласно настоящему изобретению получают путем ренатурации одноцепочечной ДНК (оцДНК) и денатурированной комплементарной плазмидной ДНК с одним негомологичным сайтом.

оцДНК получают из плазмиды с помощью бактериальных клеток и коммерческого хелперного фага, с сильным отбором с антибиотиком. Клеточные остатки удаляют центрифугированием, затем собирают частицы фага путем осаждения и дополнительного центрифугирования. Бактериальные клетки также удаляют центрифугированием и оставшуюся ДНК бактериального происхождения удаляют ферментативной обработкой. После очистки образца, оцДНК очищают от капсидных белков фага ферменативно с помощью протеиназы.

Двуцепочечную (дц) плазмидную матрицу, включающую ошибочно спаренные основания, амплифицируют и очищают из бактериальных клеток. Для получения 5′ разрыва, расположенного перед сайтом с ошибкой, применяется специфическая рестриктаза, которая линеаризует конструкцию, после чего образец осаждают и растворяют в соответствующем объеме буфера.

Для того чтобы получить включающий ошибку гетеродуплексный субстрат для анализа функции MMR согласно настоящему изобретению, оцДНК и описанную выше комплементарную ДНК денатурируют и повторно ренатруируют вместе. Чистоту конечного продукта, в том числе удаление солей и негибридизованной линейной дцДНК, а также негибридизованной оцДНК обеспечивают стадий отмывки с последующим осаждением этанолом. Концентрацию измеряют с помощью спектрофотометра и гель-электрофорезом, который также служит для проверки чистоты образца.

Д. Анализ функции MMR согласно настоящему изобретению

Как указано выше анализ функции MMR согласно настоящему изобретению может применяться не только для определения того, дефектна или нет функция MMR в тестируемом образце, но позволяет также различать способность к MMR ядерных белков, выделенных из клеток с дефектной функцией MMR, и ядерных белков, выделенных из клеток с утраченной функией MMR. Для выявления гена, с которых связан дефект MMR, полученные из образцов ядерные экстракты (X) применяются для дополнения ядерных экстрактов с дефицитом MLH1 (Y1) и MSH2/MSH6 (Υ2).

Анализ функции MMR согласно настоящему изобретению выполняется путем смешивания 50-500 мкг, предпочтительно приблизительно 50-200 мкг, более предпочтительно приблизительно 75-100 мкг, экстракта ядерных белков с избыточным количеством субстрата - кольцевой (гетеродуплексной), плазмиды; при этом в случае комплементации хорошо известной клеточной линии с дефицитом MMR для выявления гена, вызывающего недостаточность функции MMR, общее количество двух используемых при анализе субстратов не должно превышать 200 мкг. Реакция репарации активируется в присутствии MMR буфера, обеспечивающего оптимальные концентрации солей, и в то же время обеспечивающего присутствие АТФ и дезоксирибонуклеотидов. Реакция репарации завершается ферментативно, затем белки удаляются из образца с помощью экстракции фенолом/хлороформом/изоамиловым спиртом.

После осаждения образец подвергают двойному расщеплению, при этом, если репарация прошла успешно, гетеродуплексная ДНК-субстрат расщепляется на два фрагмента меньшего размера. Эти два фрагмента меньшего размера выявляют с помощью электрофореза в агарозном геле. Поскольку ДНК-субстрат добавляют в избытке, во всех случаях на геле виден также линеаризованный продукт полной длины. В его отсутствии виден только этот полноразмернаый фрагмент линеаризованной ДНК плазмиды.

Еще одна задача настоящего изобретения состоит в создании набора, включающего необходимые реагенты для способа, согласно настоящему изобретению. Набор, согласно настоящему изобретению, включает стандартные реагенты, например необходимый гетеродуплексный(-ые) ДНК субстрат(ы), включающие ошибочно спаренные нуклеотилы; по меньшей мере один, но предпочтительно два, ядерных экстракта утраченной функцией MMR; и ядерный экстракт с нормальной функцией MMR в качестве положительного контроля. В конкретных вариантах осуществления настоящего изобретения, указанные ядерные экстракты с дефектной функцией MMR получены из линий клеток с дефицитом MLH1 и MSH2/MSH6, соответственно. А именно, такие, указанные ядерные экстракты с утраченной функцией MMR получены из клеток НСТ116 и LoVo.

Входящие в набор, согласно настоящему изобретению, реагенты должны быть выбраны согласно основным принципом, раскрытым в Таблице 1. В одном из вариантов осуществления изобретения, первый ядерный экстракт (Y1) имеет дефицит MLH1, а второй ядерный экстракт (Y2) имеет дефицит MSH2/MSH6. В случае, если тестируемый образец не обеспечивает комплементацию указанного первого ядерного экстракта, однако обеспечивает комплементацию указанного второго ядерного экстракта, тестируемый образец демонстрирует дефицит MLH1. В случае, если тестируемый образец обеспечивает комплементацию указанного первого ядерного экстракта, однако не обеспечивает комплементацию указанного второго ядерного экстракта, тестируемый образец демонстрирует дефицит MSH2 или MSH6.

Набор, согласно настоящему изобретению, может необязательно дополнительно включать ядерные экстракты с дефицитом MMR, которые позволяют специфически различать дефекты генов MSH2 и MSH6. Такие ядерные экстракты могут быть получены из линий клеток, например дефектных по MSH6 HCT-15/DLD-1 (АТСС CCL-225/221).

Набор, согласно настоящему изобретению, может необязательно включать также дополнительные реагенты, необходимые для анализа функции MMR, например, необходимые буферы и нуклеотиды.

Один пример набора, согласно настоящему изобретению, приведен в примерах ниже.

ПРИМЕРЫ

Следующие примеры приведены для дополнительной иллюстрации вариантов осуществления настоящего изобретению, однако они предназначены для ограничения объема притязаний. Для специалиста в данной области техники очевидно, что по мере развития технологии, изобретательский замысел может осуществляться различными способами. Таким образом, изобретение и варианты его осуществления не ограничены приведенными здесь примерами, но могут меняться в пределах объема притязаний.

Пример 1. Культивирование фибробластов, полученных у тестируемого пациента

Фибробласты выращиваются в Модифицированной по Дульбекко среде Игла (Invitrogen, САТ# 31966-021) при 37°С в инкубаторе с 5% CO2. Культуральная среда дополняется 10% фетальной бычьей сывороткой (Invitrogen, САТ# 10106-169), 2х средой с заменимыми аминокислотами (Invitrogen, САТ# 10370-070) и 2% раствором пенициллин-стрептомицин (Invitrogen, САТ# 15070-063). Клетки пересеиваются с помощью трипсина, 0,25% ЭДТА (Invitrogen, САТ# 25200-072) в соотношении 1:2-1:6 при достижении сливающегося на 80-90% слоя клеток. Для сохранения подавления экспрессии в производных клеточных линиях FB-M1 или производных клеточных линиях FB-SH13 с дефицитом MSH2, к культуральной среде добавляются 150 мкг/мл гидромицина В (Invitrogen, САТ# 10687-010). Клетки выращиваются в обработанных культуральных флаконах Т175 с крышкой с фильтром (NUNC, CAT# 145-178883) до получения 5×108-109 для экстракции ядерных белков.

Пример 2. Линии клеток и ядерные экстракты

Адгезивные линии раковых клеток человека HeLa, LoVo и НСТ116 (American Type Culture Collection, Manassas, VA, USA) культивируются согласно указаниям производителя. Клетки HeLa (АТСС CCL-2) представляют собой эпителиальные клетки с нормальный функцией MMR, полученные из шейки матки женщины; клетки НСТ116 (АТСС CCL-247) и LoVo (АТСС CCL-229) представляют собой эпителиальные клетки, с дефектной MMR, полученные из толстой кишки мужчины. В клетки НСТ116 не включают MLH1, а в клетках LoVo ген MSH2 инактивирован, что приводит к дефициту белков MSH2, MSH3 и MSH6. Была показана связь отсутствия MSH2 с протеолитическим разложением его белков-партнеров MSH3 и MSH6.

Клетки HeLa выращиваются в среде DMEM, с добавлением 2% L-глутамина, 10% фосфатно-солевого буфера и 5% пенициллина-стрептомицина. LoVo cells выращивают в среде F12 (или F12:DMEM) (Invitrogen, САТ# 31765-027/31331-028) с добавлением 2% L-глутамина, 10-20% фосфатно-солевого буфера и 5% пенициллина-стрептомицина; клетки НСТ116 выращивают в среде McCoys 5А (Invitrogen, САТ# 22330-021) с добавлением 2% L-глутамина, 10-20% фосфатно-солевого буфера и 5% пенициллина-стрептомицина.

Линию клеток FB-M1 получили, как описано в публикации McDaid et al, BJC, 101: 441-451, 2009. Вкратце, были сконструированы перекрывающиеся олигонуклеотиды, продуцирующие короткую интерферирующую РНК (киРНК) направленную на MLH1 в сайте AACTGTTCTACCAGATACTCA и лигированы с коммерческим вектором кшРНК Silencer™ (Ambion САТ# АМ7209). Конструкцию затем проверили секвенированием, после чего линеаризовали и поместили 1 мкг ДНК 1×107 клеток с помощью электропорации. Немедленно после этого добавляли обогащенную сывороткой среду и клетки были высеяны на чашки (в количестве) 5×105 с последующей гигромициновой селекцией (150 мкг/мкл) в течение 10-14 дней. Клетки FB-SH13 получали сходным образом с помощью перекрывающихся олигонуклеотидов, дающих киРНК, направленную на MSH2 в сайте TCTGCAGAGTGTTGTGCTT в векторе pSilencer™ кшРНК.

Таким же образом, линии фибробластов с мутациями других генов MMR, например с подавлением экспресии MSH6 могут быть приготовлены с кшРНК вектором pSilencer™ 4.1 - CMV Hygro (Cat# АМ5777). Ядерные экстракты фибробластов получали согласно следующему протоколу (Lahue et al, Science, 245: 160-164, 1989):

1. Собрать 5×108-109 клеток в лог-фазе с помощью трипсина.

2. Подсчитать клети.

3. Центрифугировать при 500×g в течение 10 мин при +4°С.

4. Ресуспендировать пеллетты клеток в 20-30 мл холодного 1 × изотонического буфера (20 мМ Hepes рН 7,5, 5 мМ KCl, 1,5 мМ MgCl, 250 мМ сахарозы, 0,2 мМ ФМСФ, 1 × полная смесь ингибиторов протеаз без ЭДТА- (Roche Diagnostics GmbH, Mannheim, Germany), 0,25 мкг/мл апротинина, 0,7 мкг/мл пепстатина, 0,5 мкг/мл леупептина, 1 мМ ДТТ) и центрифугировать так же, как на предыдущей стадии.

5. Оценить объем сконцентрированных клеток и ресуспендировать в 20-30 мл холодного 1 × гипотонического буфера (изотонического буфера без сахарозы) и немедленно центрифугировать как указано ниже.

6. Удалить супернатант и ресуспендировать пеллету в 1 × холодном гипотоническом буфере для получения плотности 1-2×108 клеток/мл. Объем сконцентрированных клеток вычесть из объема ресуспендирования.

7. Разрушить клетки с помощью шприца, медленно втянув их в шприц с тонкой иглой и затем вытолкнув их из шприца одним резким движением. Разрушение клеток следует продолжать до того, как будут лизированы 80-90% клеток, что контролируется под микроскопом (50 мкл 0,4% трипанового синего в фосфатно-солевом буфере с 45 мкл фосфатно-солевого буфера и 5 мкл клеток).

8. Центрифугировать разрушенные клетки при 3000 g в течение 10 мин при +4°С и удалить супернатант.

9. Оценить объем ядерной пеллеты и добавить 1/3-1/5 буфера для холодной экстракции (25 мМ Hepes рН 7,5, 10% сахарозы, 1 мМ ФМСФ, 0,5 мМ ДТТ, 1 мкг /мл леупептина) от объема пеллеты. Ресуспендировать пеллету тщательным пипетированием.

10. измерить новый объем и добавить NaCl до конечной концентрации 0,155 M при помешивании.

11. Перемешивать смесь вращением в течение 60 мин при температуре 4°С.

12. Центрифугировать при 14500×g в течение 20 мин при температуре 2°С.

13. Провести диализ образца 2 раза по 50 мин в кассете 3,500 MWCO в одном литре холодного буфера для диализа (25 мМ Hepes рН 7,5, 50 мМ KCl, 0.1 мМ ЭДТА рН 8, 10% сахарозы, 1 мМ ФМСФ, 2 мМ ДТТ, 1 мкг /мл леупептина). Заменить буфер после первых 50 минут.

14. Осветлить экстракт центрифугированием при 20000×g в течение 15 мин при температуре 2°С.

15. Мгновенно заморозить ядерные белки в жидком азоте и хранить при -80°С.

Пример 3. Вестерн-блот

Уровень экспрессии белков в ядерных экстрактах ядерные экстракты (ЯЭ) исследовали с помощью вестерн-блота 50 мг ЯЭ и 0,1-5 мкл общего белкового экстракта дикого типа с помощью СДС-электрофореза в полиакриламидном геле. Белки наносили на цепроцеллюлозную мембрану (Amersham Hypond™, PVDF, Amersham Pharmacia Biotech, Uppsala, Sweden), которую затем инкубировали с моноклональными антителами против MSH2 (Calbio-chem, San Diego, СА, USA, MSH2-AM, NA-26, 0,2 мг/мл), против MSH3 (BD Transduction Laboratories, Lexington, KY, USA, M94120, 250 мг/мл), против MSH6 (BD Transduction Laboratories, клон 44, 0,02 мг/мл), против PMS2 (Cal-biochem/ОпсодеЯЭ Research, San Diego, CA, USA, Ab-1, 0,2 мг/мл) и против MLH1 (BD Biosciences/Pharmingen, San Diego, CA, USA, клон 168-15, 0,5 мг/мл). В качестве (загрузочного) контроля использовали повсеместно экспрессируемый α-тубулин для оценки уровня MMR белка в экстрактах (анти-α-тубулин; Sigma, Louis, МО, USA, DM1A, 0,2 мг/мл).

Пример 4. Получение гетеродимерных белковых комплексов дикого типа.

Клетки насекомого Spodoptera frugiperda (Sf9) (Invitrogen, Carlsbad, CA, USA) трансфецировали бакмидной ДНК, несущих фрагменты «ДНК MSH2, MSH3, MSH6, PMS2 или MLH1 дикого типа, после чего клетки повторно инфицировали для получения большего выхода рекомбинантных бакуловирусов (Nystrom-Lahti et al, 2002). Эти рекомбинантные бакуловирусы дикого типа применялись для коинфицирования клеток Sf9 для продукции белков, образующих анализируемые гетеродимерные комплексы: MutLa (MLH1 + PMS2), MutSa (MSH2 + MSH6) и MutSp (MSH2 + MSH3). Эти гетеродимерные комплексы экстрагировали в виде общего экстракта белка (ОЭ) в течение 50 часов (MutLa) или 72 часов (MutSa и MutS(3)) путем лизирования клеток и осаждения центрифугированием.

Пример 5. Получение субстрата.

Получение гетеродуплексных молекул. Гетеродуплексная молекула ДНК представляет собой кольцевую молекулу длиной 3192 bp с одноцепочечным разрывом длиной 445 bp, расположенного перед сайтом с ошибочно спаренными нуклеотидами. Эта молекула включает полный сайт рестрикции BglW. Молекулу получают ренатурацией одноцепочечной ДНК из плазмиды pGEM-IDL40 (Фигура 6) вместе с несущей ошибку плазмидой на основе той же конструкции (pGEM-IDL GT, для 5′GT субстрата или pGEM-IDL-39 для 54DL1 субстрата).

Одноцепочечная ДНК (оцДНК) была приготовлена путем инфицирования трансформированных pGEM IDL40 бактериальных клеток XL1-blue бактериофагом M13K07 (Amersham Biosciences, Piscataway, NJ, USA), реплицируюшего антисмысловую цепь, которую затем можно экстрагировать из клетки. Последовательности нижней (-) цепи, ампилифицируемой фагом М13, показана как SEQ ID NO: 1, с обозначенным сайтом рестрикции BglW.

Были получены две различные гетеродуплексные конструкции; с ошибочно спаренными G-T (5′GT) и одиночным нуклеотидом 54DL1. Направленный сайт-специфический мутагенез выполнен в pGEM-IDL40 согласно указаниям производителя (Quik-Change® Site-directed mutagenesis, Stratagene, La Jolla, CA, USA) для получения содержащих ошибки плазмид pGEM IDLGT и pGEM IDL39.

Субстрат 5′GT получен путем ренатурации оцДНК с содержащей ошибочно спаренные основания GEM-IDLGT. Эта плазмида длиной 3192bp (pGEM-IDLGT) для линейной дцДНК содержит неполный сайт рестрикции BglW (GGATCT). Верхняя (+) цепь, комплементарная оцДНК полученной из IDL40, за исключением G, замещающего А, который был бы комплементарным в сайте BglW. Последовательности pGEM-IDLGT обозначена как SEQ ID NO: 2, где аннотирован неполный сайт рестрикции BglW.

Субстрат 54DL1 был получен путем ренатурации оцДНК с содержащей ошибку pGEM-IDL1. Эта плазмида длиной 3191 bp (pGEM-IDL39) линейной дцДНК включает неполный сайт рестрикции BglW (-GATCT). Верхняя (+) цепь комплементарна оцДНК, полученной из IDL40, за исключением делеции А в сайте BglW. Для получения 5′ разрыва кольцевой субстрат линеаризовали BamII или DraIII до повторной ренатурации. Последовательность pGEM-IDL39 показана как SEQ ID NO: 3, где обозначен неполный сайт рестрикции BglW.

Пример 6. Анализ функции MMR согласно настоящему изобретению

Настоящее изобретение представляет собой модификации ранее описанного анализа функции MMR in vitro (Nystrom-Lahti et al, 2002), позволяющая непосредственного проанализировать способность ядерного экстракта к MMR. Кроме того, комплементация может применяться для определения дефектного гена MMR в образце путем комплементации экстракта с определенным дефектом MMR так, как это описано в Таблице 1. Реакции репарации стандартизована так, что в них используются 75-100 мкг ЯЭ. Избыточное количество гетеродуплексного ДНК-субстрат (5′GT или 54DL1) составляет 100 нг. Реакция репарации выполняется в объеме 20 мкл со следующими реагентами:

- 100 нг гетеродуплексного субстрата

- 75-100 мкг ядерного экстракта

- 2 мкл of 10х буфера MMR (200 мМ Трис-HCl с рН 7,6, 400 мМ KCl, 50 мМ MgCl2, 10 мМ глутатиона, 500 мкг/мл БСА, 1 мМ каждого дНТФ, 15 мМ АТФ)

- KCl до получения конечной концентрации 110 мМ

- добавить Н2О до 20 мкл.

Поскольку реакция должна проводиться в общем объеме 20 мкл и с конечной концентрацией KCl 110 мМ, следует учитывать содержание KCl в ядерном экстракте (2 мкл 10х MMR буфера доводит содержание KCL в реакционной смеси до 40 мМ). Содержание KCl в ядерный экстракт принимается за 75 мМ/мкл.

Типичный протокол анализа функции MMR, согласно настоящему изобретению:

1. Смешать пипетированием компоненты реакция репарации на льду и инкубировать в течение 30 мин при температуре 37°С.

2. Остановить реакцию, добавив 30 мкл СТОП-раствора (42 мМ ЭДТА, 1,2% СДС, 50,4 мкг/мл протеиназы К). Инкубировать при 37°С в течение 20 мин.

3. Добавить 1 объем (50 мкл) ТЭ буфера с рН 8,0.

4. Добавить 1 объем смеси фенол-хлороформ-изоамиловый спирт (25:24:1) и встряхивать на вортексе в течение 10 с. Центрифугировать на максимальной скорости в течение 10 мин при комнатной температуре.

5. Перенести верхнюю фазу (приблизительно 90 мл) в новую пробирку и добавить равный объем хлороформа. Встряхивать на вортексе в течение 10 с и центрифугировать на максимальной скорости в течение 10 мин при комнатной температуре.

6. Перенести 85 мл верхней фазы в новую пробирку для осаждения этиловым спиртом.

7. Добавить NaCl до получения конечной концентрации 150 мМ, а затем 2,5 объема холодного абсолютного этилового спирта. Инкубировать при -20°С в течение 30 минут.

8. Получить пеллету ДНК центрифугированием образца на максимальной скорости в течение 30 минут при +4°С.

9. Промыть пеллету 150 мкл 70% этанола, центрифугировать на максимальной скорости в течение 10 минут, высушить и ресуспендировать пеллету в 6 мкл дистиллированной деминерализованной H2O.

10. Добавить 4 мкл свежеприготовленной 10 × смеси для расщепления (2,5 мкл FastDigest® BglW (Fermentas, САТ# FD0083), 2,5 мкл FastDigest® Eco31I (Fermentas, САТ# FD0293), 10 мкл FastDigest® Буфер и 25 мкл ddH20) и инкубировать при 37°С в течение 10 минут.

11. Добавить РНКазу А до концентрации 40 мкг/мл и инкубировать при 37°С в течение 10 минут.

12. Загрузить образцы на 1,0% агарозный гель, приготовленный на 1х ТАЕ, с тем чтобы определить, произошла ли репарация.

Процент репарации определяют с помощью ПО Image-Pro® 4,0 (Media Cybernetics, Silver Spring, MD, USA).

В качестве положительного контроля используют ЯЭ клеток HeLa с нормальной функцией MMR, при этом ЯЭ без комплементации (с утраченной функцией MMR) применяется в качестве отрицательного контроля. Субстраты линеаризуют с помощью рестрикции Eco31I рестриктазой. Поскольку реакция репарации превращает GT гетеродуплекс в AT гомодуплекс или заполняет 1 или 2-нуклеотидные петлевые структуры, восстанавливая сайт рестрикции BglW, эффективность репарации может быть измерена по эффективности двойного расщепления.

Пример 7. Фибробласты, применяемые при анализе функции MMR согласно настоящему изобретению

Этот пример предназначен для того, чтобы показать, что анализ функции MMR может применяться к нормальной ткани, например фибробластам. Ядерный экстракт фибробластов дикого типа (FB-WT), приготовленный согласно примеру 2, ядерный экстракт клеток HeLa с нормальной функцией MMR и отрицательный контроль (MOCK), не содержащий никаких белков, были подвергнуты анализу функции MMR согласно настоящему изобретению так, как это описано в примере 3.

После того, как прошла реакция репарации, двойное расщепление ДНК субстрата дает одну полосу большего размера, длиной приблизительно 3000 bp в случае, если не прошла репарация, и два дополнительных меньших фрагмента (приблизительно 1800 и 1300 bp) если репарация произошла. Поскольку субстрат ДНК всегда добавляется в избыточном количестве, даже экстрактах с нормальной функцией MMR помимо двух фрагментов, полученных при двойном расщеплении, сохраняется линеаризованный субстрат.

Результаты анализа приведены на Фигуре 2, где показано, что на дорожке 1, (клетки MOCK) имеется только одна полоса, соответствующая фрагменту большой длины (= отсутствие репарации), но на дорожках 2 и 3 (ядерные экстракты FB-WT и HeLa, соответственно), видны две дополнительные полосы фрагментов меньшего размера, которые указывают на прошедшую реакцию репарации.

Таким образом, это пример без сомнения показывает, что ядерные экстракты из нормальных фибробластов обладают способностью к MMR, сравнимой с таковой экстрактов клеточных линий (HeLa) с нормальной функцией MMR, что можно подтвердить с помощью анализа согласно настоящему изобретению.

Пример 8. Человеческие фибробласты с частично подавленной экспрессией генов MMR демонстрируют сниженную способность к MMR в анализе функции MMR, согласно настоящему изобретению

Этот пример показывает, что человеческие фибробласты клеточных линий FB-M1 и FB-SH13 (раскрытые в примере 2), в которых частично подавлена экспрессия гена MLH1 или гена MSH2, соответственно, с помощью технологии РНК шпилек (кшРНК), обладают ясно выраженной сниженной способностью к MMR.

Во-первых, был выполнен вестерн-блот с равными количествами ядерных экстрактов из фибробластов дикого типа (FB-WT) и клеток FB-M1 или FB-WT и клеток FB-SH13. В результате (Фигура 3) видно, что количество белка MLH1 было определенно снижено в клетках FB-M1 в сравнении FB-WT, так же как и уровень MSH2 в клетках FB-SH13, α-использовали в качестве контроля загрузки.

Во вторых, был выполнен анализ функции анализ функции MMR так, как описано в примере 6, с применением тех же ядерных экстрактов в тех же количествах:

MOCK - не содержащий ядерного экстракта отрицательный контроль анализа;

FB-WT - ядерный экстракт человеческого фибробласта дикого типа (положительный контроль); и

FB-M1 - ядерный экстракт из человеческих фибробластов с частично подавленной экспрессией MLH1;

или

FB-SH13 - ядерный экстракт из человеческих фибробластов с частично подавленной экспрессией MSH2.

Результат анализа показывает, что сниженная концентрация одного из ключевых белков MMR связана с дефектным механизмом MMR. Результат показан на Фиг. 4 и ясно демонстрирует, что анализ функции MMR, согласно настоящему изобретению, определенно выявляет дефекты MLH1 и MSH2 в ядерном экстракте человеческого фибробласта дикого типа как снижение эффективности репарации. Кроме того, способность к MMR может быть дифференциально восстановлена в неспособном к MMR ядерном экстракте при совместном анализе с ядерным экстрактом дикого типа, или ядерным экстрактом с частично подавленной функцией MMR, что показано на Фиг. 5 (в данном случае НСТ116 с FB-WT или FB-M1) и описано в тесте в Таблице 1 и на стр. 13-14.

Эффективность репарации при анализе функции MMRe согласно настоящему изобретению определяется как процент репарированной ДНК от всего субстрата ДНК в составе реакции. Недостаток ключевых белков MMR в различной степени снижает эффективность репарации, в том время как отсутствие MMR белков снижает эффективность репарации до неопределяемых уровней.

Пример 9. Набор для применения при диагностическом анализе дефектов MMR

Набор согласно настоящему изобретению предпочтительно имеет форму сосудов с готовой смесью всех реагентов для выполнения анализа функции MMR. В него необходимо добавить только ядерный экстракт тестируемого образца. В одном из вариантов осуществления настоящего изобретения в набор входят отдельные сосуды для тестирования различных вариантов нарушения MMR.

В этом примере описан набор для определения того, имеется или нет у тестируемого человека синдром Линча, путем определения того, имеется ли у указанного человека дефект в гене MLH1 или в любом из генов MSH2 или MSH6, без разделения последних. Такой набор включает, по меньшей мере, пять отдельных сосудов.

В указанные сосуды входят следующие реагенты:

- Гетеродуплексный субстрат

- Ядерный экстракт (НСТ116, LoVo или FB-WT)

- 10Х буфер ММК (200 мМ Трис-HCl рН 7,6, 400 мМ KCl, 50 мМ MgCl2, 10 мМ глутатион, 500 мкг/мл БСА, 1 мМ каждого из дНТФ, 15 мМ АТФ).

Помимо этого необходим СТОП-раствор для анализа функции ММР (42 мМ ЭДТА, 1,2% СДС, 50.4 мкг/мл протеиназы K), который также может входить в указанный набор.

Дополнительно, указанный набор может необязательно включать реагенты, необходимые для осветления образца (ТЕ буфер, фенол/хлороформ/изоамиловый спирт и хлороформ), для его осаждения (NaCl и этиловый спирт) и для выявления репарации (РНКаза А и рестриктазы BglW и Eco31I с буфер и загрузочный краситель).

Дополнительные компоненты указанного набора включают реагенты, необходимые для культивирования клеток, из которых должны быть экстрагированы ядерные белки, а также реагенты, необходимые экстракции из таких клеток ядерных белков (см. пример 2).

Набор, согласно настоящему изобретению, не ограничен никакой конкретной формой или типом сосудов. Для набора подходят любые типы сосудов, подходящие для манипуляций и инкубаций, описанных в примере 6, например пробирки eppenodorf®.

1. Количественный способ для определения у человека наследственно нарушенной функции репарации ошибочно спаренных оснований ДНК (+/-), где указанный способ включает
а) получение первичных клеток из нормальной конститутивной ткани указанного человека,
б) культивирование указанных первичных клеток в культуральных условиях, подходящих для культивирования фибробластов,
в) получение экстракта ядерных белков из указанных культивированных первичных фибробластов указанного человека,
г) получение экстрактов ядерных белков с нормальной функцией репарации ошибочно спаренных оснований +/+ и дефектной функцией репарации ошибочно спаренных оснований -/- из клеточных линий в качестве положительного и отрицательного контроля соответственно,
д) смешивание в отдельных сосудах экстракта ядерных белков первичных фибробластов, полученного на стадии в), и экстракта ядерных белков с нормальной функцией репарации ошибочно спаренных оснований белков и экстракта ядерных белков с дефектной функцией репарации ошибочно спаренных оснований, полученных на стадии г), с по меньшей мере одним гетеродуплексным ДНК-субстратом, включающим ошибочно спаренные основания;
е) выполнение анализа репарации ошибочно спаренных оснований экстракта ядерных белков первичных фибробластов и контрольных экстрактов ядерных белков с указанным ДНК субстратом, и
ж) количественное определение способности экстракта ядерных белков первичных фибробластов к репарации указанной молекулы ДНК-субстрата,
и, таким образом, определения того, обладает ли человек наследственно нарушенной функцией репарации ошибочно спаренных оснований ДНК +/-.

2. Способ по п. 1, в котором указанный субстрат получен из плазмиды, имеющей последовательность SEQ ID NO: 1.

3. Способ по п. 2, в котором указанный субстрат дополнительно включает последовательность нуклеиновой кислоты, выбранную из группы, которая состоит из последовательностей SEQ ID NO: 2 and SEQ ID NO: 3.

4. Способ по п. 1, в котором указанный экстракт ядерных белков с дефектной функцией репарации ошибочно спаренных оснований получен из клеточной линии, выбранной из группы, которая состоит из клеток НСТ116 и LoVo.

5. Способ по п. 4, в котором общее количество экстракта ядерных белков в расчете на один сосуд находится в диапазон 50-500 мкг, предпочтительно 50-200 мкг, более предпочтительно 75-100 мкг.

6. Количественный способ для выявления гена репарации ошибочно спаренных оснований с наследственно дефектной функцией (+/-), где указанный способ включает
а) получение первичных клеток из образца нормальной конститутивной ткани указанного человека,
б) культивирование указанных первичных клеток в культуральных условиях, подходящих для культивирования фибробластов,
в) получение экстракта ядерных белков из указанных культивированных первичных фибробластов указанного человека,
г) получение экстрактов ядерных белков с нормальной функцией репарации ошибочно спаренных оснований +/+ и дефектной функцией репарации ошибочно спаренных оснований -/- из клеточных линий в качестве положительного и отрицательного контроля соответственно и последующее смешивание по меньшей мере одного экстракта ядерных белков с дефектной функцией репарации ошибочно спаренных оснований, полученного на стадии г), с указанным экстрактом, полученным на стадии в),
д) смешивание в отдельном сосуде по меньшей мере одного экстракта ядерных белков с дефектной функцией репарации ошибочно спаренных оснований, полученного на стадии г), и указанного экстракта ядерных белков первичных фибробластов, полученного на стадии в), с по меньшей мере одним гетеродуплексным ДНК-субстратом, включающим ошибочно спаренные основания, и дополнительно включает
е) выполнение анализа репарации ошибочно спаренных оснований экстрактом ядерных белков первичных фибробластов и контрольными экстрактами ядерных белков с указанным ДНК-субстратом,
ж) количественное определение способности экстракта ядерных белков первичных фибробластов к репарации указанной молекулы ДНК-субстрата,
з) комплементацию экстракта ядерных белков с дефектной функцией репарации ошибочно спаренных оснований, полученного на стадии г), указанным экстрактом первичных фибробластов, полученным на стадии в), и выявление дефектного гена путем определения того, способен ли комплементированный экстракт ядерных белков к репарации указанного ДНК-субстрата.

7. Способ по п. 6, в котором указанный субстрат получен из плазмиды, имеющей последовательность SEQ ID NO: 1.

8. Способ по п. 7, в котором указанный субстрат дополнительно включает последовательность нуклеиновой кислоты, выбранную из группы, которая состоит из последовательностей SEQ ID NO: 2 и SEQ ID NO: 3.

9. Способ по п. 6, в котором указанный экстракт ядерных белков с дефектной функцией репарации ошибочно спаренных оснований получен из клеточной линии, выбранной из группы, которая состоит из клеток НСТ116 и LoVo.

10. Способ по п. 9, в котором общее количество экстракта ядерных белков в расчете на один сосуд находится в диапазон 50-500 мкг, предпочтительно 50-200 мкг, более предпочтительно 75-100 мкг.

11. Способ диагностики синдрома Линча у человека путем выявления гена репарации ошибочно спаренных оснований ДНК с наследственно нарушенной функцией репарации ошибочно спаренных оснований ДНК с помощью способа по любому из пп. 6-10, при котором первичные фибробласты получены из клинического образца, взятого из незлокачественной конститутивной ткани человека.

12. Способ по п. 11, где ген репарации ошибочно спаренных оснований ДНК выбран из группы, которая состоит из MLH1, MSH2, MSH6, MLH3, MSH3, PMS1, PMS2 and ЕХ01.

13. Применение набора в способе по любому из пп. 1-12, в котором каждый сосуд включает по меньшей мере один гетеродуплексный ДНК-субстрат, включающий ошибочно спаренные основания, и один экстракт ядерных белков с дефектной функцией репарации ошибочно спаренных оснований или экстракт ядерных белков с нормальной функцией репарации ошибочно спаренных оснований в качестве положительного контроля.

14. Применение набора по п. 13, в котором указанные экстракты ядерных белков с дефектной функцией репарации ошибочно спаренных оснований получены из линий клеток с дефектом функции репарации ошибочно спаренных оснований в любом из (генов) MLH1, MSH2, MSH6 или PMS2.

15. Применение набора по п. 14, включающего по меньшей мере два экстракта ядерных белков с дефектной функцией репарации ошибочно спаренных оснований.

16. Применение набора по п. 15, в котором указанные экстракты ядерных белков с дефектной функцией репарации ошибочно спаренных оснований получены из линий клеток с дефектом функции репарации ошибочно спаренных оснований в (генах) MLH1 и MSH2/MSH6 соответственно.

17. Применение набора по п. 16, в котором указанные экстракты ядерных белков с дефектной функцией репарации ошибочно спаренных оснований получены из клеток НСТ116 и LoVo соответственно.

18. Применение набора по п. 17, который также включает дополнительные реагенты, необходимые для выполнения анализа функции репарации ошибочно спаренных оснований.

19. Применение набора по п. 18, который дополнительно включает 10х буфер для репарации ошибочно спаренных оснований, который включает 200 мМ Трис-HCl рН 7,6, 400 мМ KCl, 50 мМ MgCl2,10 мМ глутатиона, БСА 500 Мг/мл, 1 мМ каждого дНТФ и 15 мМ АТФ; и СТОП-раствора для анализа MMR, состоящего из 42 мМ ЭДТА, 1,2% СДС, 50,4 мкг/мл протеиназы К.

20. Применение набора по п. 18, включающего реагенты для осветления образца, например ТЕ буфер, фенол/хлороформ/изоамиловый спирт и хлороформ; для осаждения указанного образца, например NaCl и этиловый спирт; и для выявления репарации, например РНКаза А и рестриктазы BglWu Есо31 l с буфером и загрузочной краской.



 

Похожие патенты:

Изобретение относится к области медицины и касается способа, тест-системы диагностики диабетической нефропатии. Сущность способа заключается в том, что в образце от субъекта определяют биомаркер, который представляет собой подобный антигену CD5.

Группа изобретений относится к области молекулярной биологии и может быть использована в молекулярно-генетической диагностике онкологических заболеваний. Способ предусматривает проведение биоинформационного анализа предшествующих публикаций о генах-онкомаркерах колоректального рака и отбор генов, метилирование сайтов PuCGPy регуляторных областей которых происходит с высокой частотой в ДНК клеток колоректального рака, с учетом возможности выявления метилирования гена на ранних стадиях заболевания и формирование панели из следующих генов-онкомаркеров колоректального рака: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1.

Изобретение относится к области медицинской микробиологии и касается способа дифференциации токсигенных и атоксигенных штаммов холерных вибрионов О1 серогруппы по ингибирующей активности.

Изобретение относится к области биотехнологии. Описан диагностический способ in vitro диагностики рака эндометрия.

Изобретение касается способа диагностики волчанки у человека. Представленное изобретение включает определение наличия вариации по меньшей мере в одном локусе риска SLE, причем указанная вариация по меньшей мере в одном локусе представляет собой аллель риска однонуклеотидного полиморфизма (SNP).

Изобретение относится к молекулярной биологии и может быть использовано при проведении медико-биологических исследований. Предложен способ подготовки суспензии лимфоцитов человека в этанол-уксусном фиксаторе для выделения ДНК, включающий центрифугирование указанной суспензии и удаление надосадочной жидкости.

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики, ветеринарной медицины, в частности к набору олигодезоксирибонуклеотидов для амплификации и детекции видоспецифичного фрагмента ДНК Anaplasma marginale методом полимеразной цепной реакции (ПЦР) в режиме «реального времени».

Изобретение направлено на композиции и способы выделения, обнаружения, амплификации и количественной оценки патоген-специфичных нуклеиновых кислот в биологическом образце.

Группа изобретений относится к биохимии. Описан набор реагентов для выявления ДНК Neisseria gonorrhoeae в образце, включающий по меньшей мере два олигонуклеотидных праймера для полимеразной цепной реакции и, при необходимости, олигонуклеотидный зонд, термостабильную ДНК-полимеразу, буферный раствор для ПЦР, дезоксинуклеозидтрифосфаты, отличающийся тем, что первый олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 1, второй олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 2.

Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ). У индивидуумов русской национальности, являющихся уроженцами Центрального Черноземья России, из периферической венозной крови выделяют ДНК, после чего проводят анализ полиморфизмов генов TNFα, Ltα, TNFR1 и TNFR2. Среди индивидуумов без сопутствующей патологии глаз в случае выявления комбинации -308G TNFα и +1663G TNFR2 либо комбинации +36G TNFR1 и +1663G TNFR2 или при наличии сопутствующей патологии глаз как миопия, катаракта или возрастная макулярная дегенерация сетчатки в случае выявления +36A TNFR1 либо комбинации +36AA TNFR1 и +1663A TNFR2 либо +250G Ltα и +36AA TNFR1 прогнозируют повышенный риск развития ПОУГ. У индивидуумов с сопутствующей патологией глаз при выявлении +250A Ltα и +36G TNFR1 либо -308G TNFα и +36G TNFR1 прогнозируют низкий риск развития ПОУГ. Изобретение обеспечивает раннее выявление больных с ПОУГ, что позволит предупредить прогрессирование заболевания. 6 ил., 2 табл., 7 пр.

Группа изобретений относится к области биотехнологии. Предложены способ и система для определения нуклеотидной последовательности в заданной области генома плода. Способ включает следующие этапы: конструирование библиотеки для секвенирования из образца геномной ДНК из периферической крови беременной женщины; секвенирование библиотеки для секвенирования с целью получения результата секвенирования. Результат секвенирования плода включает множество полученных при секвенировании данных. Нуклеотидную последовательность в заданной области генома определяют посредством использования скрытой марковской модели на основании результата секвенирования последовательностей плода в сочетании с генетической информацией о родственнике с помощью алгоритма Витерби. Система состоит из аппарата конструирования библиотеки, секвенатора и анализатора. Использование изобретений позволяет произвести генотипирование с высокой точностью. 2 н. и 12 з.п. ф-лы, 2 ил., 1 табл., 1 пр.

Изобретение относится к области биотехнологии. Способ предусматривает приготовление реакционной смеси, содержащей буферный раствор и исследуемый образец ДНК. Добавляют к смеси ДНК-метилтрансферазу с активностью 2 е.а./мкл, модифицирующую цитозин в положении С5, выбранную из группы: Fsp4HI, НаеIII, HspAI, AluI, в зависимости от того, какой сайт необходимо расщепить, смесь инкубируют в течение часа, полученную С5-метилированную ДНК обрабатывают MD-эндонуклеазой ElmI с активностью 2 е.а./мкл или PkrI с активностью 2 е.а./мкл в зависимости от того, в какой позиции необходимо гидролизовать ДНК. С помощью данного способа можно осуществить исчерпывающий сайт-специфический гидролиз ДНК по шести- и восьминуклеотидным последовательностям, не расщепляемым традиционно используемыми эндонуклеазами рестрикции. 2 з.п. ф-лы, 3 ил., 6 пр.

Изобретение относится к области биотехнологии и представляет собой способ сайт-специфического гидролиза С5-метилированной последовательности ДНК. Готовят реакционную смесь, содержащую буферный раствор и образец С5-метилированной ДНК, добавляют к смеси диметилсульфоксид до конечной концентрации 15-25%, а затем MD-эндонуклеазу, смесь инкубируют в течение часа при 30-37°C с последующим анализом результата гидролиза ДНК методом гель-электрофореза, при этом в качестве MD-эндонуклеазы используют GlaI с концентрацией 4-8 е.а./мкл или PcsI с концентрацией 1-2 е.а./мкл. Изобретение позволяет повысить эффективность сайт-специфического гидролиза С5-метилированной последовательности ДНК. 3 з.п. ф-лы, 3 ил., 4 пр.
Наверх