Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и олигонуклеотидные праймеры и флуоресцентно-меченые зонды для осуществления указанного способа

Авторы патента:

 


Владельцы патента RU 2596404:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор"" (ФБУН ГНЦ ВБ "Вектор") (RU)

Группа изобретений относится к области молекулярной биологии и может быть использована в молекулярно-генетической диагностике онкологических заболеваний. Способ предусматривает проведение биоинформационного анализа предшествующих публикаций о генах-онкомаркерах колоректального рака и отбор генов, метилирование сайтов PuCGPy регуляторных областей которых происходит с высокой частотой в ДНК клеток колоректального рака, с учетом возможности выявления метилирования гена на ранних стадиях заболевания и формирование панели из следующих генов-онкомаркеров колоректального рака: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1. Затем проводят гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 в исследуемой ДНК, и гибридных праймеров, 3'-концы которых комплементарны 5'-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности. Заключение о наличии последовательности Pu(5mC)GPy (где 5mC - 5-метилцитозин, Pu - A или G, Py - T или C) в регуляторных областях генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 делают по появлению флуоресцентного сигнала. В качестве адаптерной последовательности используют универсальный олигонуклеотидный адаптер 5'-CCTGCTCTTTCATCG-3'/3'-p-GGACGAGAAAGTAGC-p-5'. Использование изобретений позволяет упростить и повысить точность определения метилирования сайтов PuCGPy. 2 н. и 1 з.п. ф-лы, 1 ил., 4 табл., 3 пр.

 

Изобретение относится к областям молекулярной биологии, биотехнологии и медицины, и может быть использовано в молекулярно-генетической диагностике онкологических заболеваний и для оценки эффективности противораковой терапии, а именно для анализа метилирования генов-онкомаркеров колоректального рака в образцах биологического материала.

Одним из наиболее перспективных инструментов молекулярно-генетической диагностики и мониторинга онкологических заболеваний сегодня представляется эпигенетическая диагностика, то есть идентификация болезни путем выявления эпигенетических маркеров. Эпигенетические маркеры представляют собой химические группы, которые присоединяются к геномной ДНК человека (метилирование цитозиновых оснований с образованием 5-метилцитозина, 5mC) либо к ассоциированным с ней гистоновым комплексам и оказывают влияние на функциональную активность генов. Наиболее распространенным эпигенетическим нарушением при канцерогенезе является локальное гиперметилирование отдельных участков ДНК, так называемых CpG-островков, в регуляторных областях генов-онкосупрессоров, которые в норме лишены метильных групп. В настоящее время показано, что подобное аберрантное метилирование характерно для начальных стадий большинства ненаследственных (спорадических) форм рака, которые в среднем составляют более 90% всех случаев злокачественных новообразований.

Для осуществления эпигенетической диагностики злокачественных новообразований необходимо решить два ключевых вопроса:

а) какой метод детекции следует использовать для определения статуса метилирования генов?

б) метилирование регуляторных участков каких генов ассоциировано с конкретным онкологическим заболеванием?

Для решения первого вопроса, а именно для анализа статуса метилирования генов, применяется ряд методов, которые можно разделить на четыре группы.

Первая группа методов основана на бисульфитной конверсии ДНК, влекущей изменения ее нуклеотидного состава. В дальнейшем нужный участок конвертированного генома может быть амплифицирован в ПЦР и секвенирован для определения всех метилированных цитозиновых остатков. Если исследователя интересует статус метилирования конкретного CG-динуклеотида, то используются более простые способы анализа. Так, возможно проведение метилчувствительной ПЦР (другой употребляемый термин - «метилспецифическая ПЦР»), в которой проводятся две реакции с использованием праймеров, подобранных для случаев прохождения или непрохождения конверсии в исследуемом динуклеотиде. Другим широко используемым способом определения метилирования является обработка конвертированной ДНК эндонуклеазами рестрикции (метод COBRA, основанный на появлении или исчезновении сайтов узнавания ферментов в измененной ДНК). К недостаткам описанных методов относятся существенная деградация и значительные потери нуклеиновых кислот при проведении бисульфитной конверсии, что делает проблематичным анализ малого количества материала, трудоемкость, дороговизна исследования и значительные затраты времени [Umer M, Herceg Z. Deciphering the epigenetic code: an overview of DNA methylation analysis methods // Antioxid Redox Signal. - 2013. - V. 18. - P. 1972-1986].

Вторая группа методов включает в себя процедуры гидролиза ДНК метилчувствительными эндонуклеазами. Анализ статуса метилирования генов основан на том, что данные рестриктазы не способны распознавать и расщеплять последовательности, содержащие метилированные CG-сайты (например, фермент HpaII, узнающий и гидролизующий лишь неметилированный тетрануклеотид CCGG). Результаты реакции гидролиза могут быть проанализированы с помощью ПЦР с фланкирующими праймерами. Существенным ограничением для широкого применения этих методов является относительно небольшое число известных эндонуклеаз рестрикции, распознающих последовательности, содержащие CG-динуклеотиды, и при этом чувствительных к метилированию цитозиновых остатков в них [Shen L, Waterland RA. Methods of DNA methylation analysis // Curr Opin Clin Nutr Metab Care. - 2007. - V. 10. - P. 576-581]. Данный подход также не позволяет выявлять частично метилированную ДНК, тогда как именно такой паттерн метилирования CpG-островков характерен для самых ранних стадий канцерогенеза.

Третья группа методов базируется на использовании метилсвязывающих белков (methyl binding domain containing proteins, MBD-белки) для изоляции метилированной ДНК и ее последующей амплификации. Известна, например, технология MethylMeter, разработанная специалистами американской компании RiboMed (патент Канады №2724343, опубл. 15.05.2008 г.), позволяющая достигать высоких показателей чувствительности и специфичности. Данная технология используется производителями некоторых тест-систем, например, G-CIMP DecisionDX американской компании Castle Biosciences. Для защиты данной тест-системы подана заявка США №2014272986, опубликованная 18.09.2014 г. Тем не менее, подобные методы остаются весьма трудоемкими, а для четкого количественного анализа результатов требуется сложное дорогостоящее оборудование.

Четвертая группа методов базируется на использовании сайт-специфических метилзависимых эндонуклеаз. После их открытия и начала коммерческого производства их препаратов появилась возможность использования этого нового класса ферментов в эпигенетических исследованиях. В отличие от обычных эндонуклеаз рестрикции, метилзависимые ферменты узнают только метилированные последовательности ДНК, что делает их еще одним удобным инструментом изучения статуса метилирования генов. В число ферментов данного класса входят производимые в России компанией ООО «СибЭнзайм» эндонуклеазы GlaI, BisI, BlsI, MteI и ряд других [http://russia.sibenzyme.com/products/m2_type].

Благодаря совпадению последовательности ДНК, являющейся продуктом метилирования de novo, и субстратной специфичности фермента GlaI исследователями ООО «СибЭнзайм» был разработан метод, названный GLAD-ПЦР (GlaI hydrolysis and Ligation Adapter Dependent PCR), который позволяет определять наличие сайтов Pu(5mC)GPy в исследуемом участке ДНК [Кузнецов В.В. с соавт. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК // Патент РФ №2525710 С1, опубл. 20.08.2014, Бюл. №23]. Метод включает гидролиз ДНК ферментом GlaI, присоединение специфического адаптера к концам гидролизованной ДНК и последующую реакцию ПЦР в режиме реального времени с праймеров, окружающих целевой участок ДНК. Метод позволяет определить наличие одного или нескольких сайтов Pu(5mC)GPy внутри изучаемого фрагмента ДНК. Таким образом, метод GLAD-ПЦР может быть использован для определения статуса метилирования регуляторных участков генов.

Данный метод обладает рядом преимуществ, заключающихся в простоте выполнения, способности выявлять лишь метилированные сайты в сложных смесях ДНК и возможности количественно оценивать их число. Следует также отметить, что метод обладает значительной универсальностью и может быть применен для анализа любых сложных смесей ДНК, например, ДНК из опухолей, содержащей нуклеиновые кислоты не только из малигнантных, но и из нормальных клеток (клетки сосудов, соединительной ткани и т.д.). Апробация GLAD-ПЦР показала, что метод обладает высокой чувствительностью, позволяя детектировать метилированные сайты в сильноразбавленных растворах.

Указанный метод является универсальным методом детекции метилирования сайтов Pu(5mC)GPy, позволяющим сформировать и описать конкретную панель генов, специфичную, например, для колоректального рака. Но в самом описании метода специфичные для различных видов онкологии панели генов отсутствуют.

Рак толстого кишечника и прямой кишки (колоректальный рак) - один из наиболее часто встречающихся видов злокачественных новообразований. В развитых странах мира ежегодно диагностируется более миллиона случаев этого заболевания, а летальность от рака этой локализации составляет более 33% даже в странах с высоким уровнем онкологической помощи [Walther A. et al. Genetic prognostic and predictive markers in colorectal cancer // Nat. Rev. Cancer. - 2009. - V. 9. - P. 489-499]. Как и в случае большинства других онкологических заболеваний, выявление данного вида рака на ранних стадиях во многом определяет успешность лечения, ввиду чего развитие чувствительных молекулярно-генетических, в том числе эпигенетических, методов диагностики колоректального рака несомненно является актуальной задачей. Однако начальные стадии патологии внутренних органов зачастую не сопровождаются определяемыми при наружном осмотре аномалиями или ощущаемыми пациентами нарушениями функций организма, что делает раннюю диагностику в этих случаях крайне затруднительной. Таким образом, использование биохимических и генетических анализов для диагностики колоректального рака является предпочтительным способом выявления заболевания, тем более, что такая диагностика возможна еще на бессимптомной стадии [Gyparaki MT, Basdra EK, Papavassiliou AG. DNA methylation biomarkers as diagnostic and prognostic tools in colorectal cancer // J Mol Med (Berl). - 2013. - V. 91. - P. 1249-1256].

Для разработки соответствующей диагностической системы необходимо найти ответ на второй вопрос: метилирование регуляторных участков каких именно генов ассоциировано с развитием колоректального рака?

Одна из первых масштабных работ по поиску маркерных генов для эпигенетической диагностики колоректального рака была проведена в 2008 году сотрудниками компании Epigenomics AG (Германия) [Lofton-Day C et al. DNA methylation biomarkers for blood-based colorectal cancer screening // Clin Chem. - 2008. - V. 54. - P. 414-423]. На первом этапе работы были использованы метилчувствительные ферменты рестрикции для анализа более 600 кандидатных фрагментов геномной ДНК, выделенной из опухолей и нормальной ткани. Были выбраны 56 участков ДНК, которые достоверно различались по степени метилирования в здоровых и малигнантных клетках. Далее эти участки дополнительно проверялись на микрочипах и в ПЦР в реальном времени. Это позволило сократить число генов, наиболее пригодных для использования в качестве эпигенетических маркеров колоректального рака, до семи (SEPT9, NGFR, TMEFF2, ALX4, EYA4, FOXL2, SIX6).

В дальнейшем большое число авторов опубликовало результаты своих исследований по поиску генов-онкомаркеров для эпигенетической диагностики колоректального рака, проведенных различными методами, включая такие современные подходы, как применение ДНК-микрочипов (например, серии Infinium HumanMethylation, Illumina, США), ограниченное (RRBS, Reduced Representation Bisulfite Sequencing) и полногеномное бисульфитное секвенирование (WGBS, Whole Genome Bisulphite Sequencing) секвенирующими системами нового поколения (Next Generation Sequencing, NGS) [Reinders J. et al. // Epigenomics. - 2010. - V. 2. - P. 209-220; Kaneda A., Yagi K. // Cancer Sci. - 2011. - V. 102. - P. 18-24; Kibriya M.G. et al. // BMC Med Genomics. - 2011. - 4:50; Kim Y.H. et al. // Ann Surg Oncol. - 2011. - V. 18. - P. 2338-2347; Gu H. et al. // Nat Protoc. - 2011. - V. 6. - P. 468-481; Yi J.M. et al. // Tumour Biol. - 2012. - V. 33. - P. 363-372; Hinoue T. et al. // Genome Res. - 2012. - V. 22. - P. 271-282; Lange C.P. et al. // PLoS One. - 2012. - 7:e50266; Li H. et al. // Oncol Rep. - 2012. - V. 28. - P. 99-104; Roperch J.P. et al. // BMC Cancer. - 2013. - P. 13-566; Naumov V.A. // Epigenetics. - 2013. - V. 8. - P. 921-934; Chen Y.A. et al. // Epigenetics. - 2013. - V. 8. - P. 203-209; Harper K.N. et al. // Cancer Epidemiol Biomarkers Prev. - 2013. - V. 22. - P. 1052-1060; Mitchell S.M. et al. // BMC Cancer. - 2014. - P. 14-54; Melson J. et al. // Int J Cancer. - 2014. - V. 134. - P. 2656-2662; Papadia C. et al. // Inflamm Bowel Dis. - 2014. - V. 20. - P. 271-277].

Некоторые из обнаруженных генов-онкомаркеров уже применяются в коммерческих тест-системах для диагностики колоректального рака. В 2008-2012 годах в компании Epigenomics AG (Германия) была разработана и запатентована тест-система «Epi proColon kit 2.0» для диагностики колоректального рака (международная заявка № WO 2005001142, опубл. 06.01.2005 г.; заявка США №2014179563, опубл. 26.06.2014 г.) на основе выявления специфического эпигенетического маркера SEPT9 в периферической крови [Heichman KA. Blood-based testing for colorectal cancer screening // Mol Diagn Ther. 2014. - V. 18. - P. 127-135]. Метилирование другого гена (VIM, виментин) в малигнантных клетках послужило основой для создания тест-системы «ColoGuard assay» от компании LabCorp (США) [Lao VV, Grady WM. Epigenetics and colorectal cancer // Nat Rev Gastroenterol Hepatol. - 2011. - V. 8. - P. 686-700]. Однако подобные моно-тест-системы не предназначены для постановки окончательного диагноза, и их показатели могут служить лишь дополнительными индикаторами развития или отсутствия заболевания.

В совокупности полученные исследователями данные свидетельствуют о ненадежности диагностики, построенной на анализе одного гена и, соответственно, об актуальности разработки и внедрения тест-систем, основанных на определении статуса метилирования ДНК регуляторных областей ряда генов-онкомаркеров, позволяющих проводить диагностику более надежно и точно. Известна работа Lind с соавт., создавших диагностический набор для анализа метилирования шести генов: CNRIP1, FBN1, INA, MAL, SNCA и SPG20 [Lind G.E. et al. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas // Mol Cancer 2011. - V 10. - P. 85].

Наиболее близким аналогом (прототипом) является способ определения диагноза рака у индивидуума с подозрением на колоректальный рак (Международная заявка № WO 2014062218, МПК C12Q 1/68, опубл. 24.04.2014 г.), включающий: получение образца от индивидуума с подозрением на рак; гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала с использованием бисульфитной конверсии ДНК; определения наличия или отсутствия высокого уровня экспрессии генов (определение уровня метилирования регуляторных областей генов-онкомаркеров с использованием цифровой ПЦР) по отношению к нормальному базовому стандарту для одной диагностической панели, включающей следующие биомаркеры: TFPI2, THBD, C9ORF50, ADHFE1, FGF12, PTPRT, ZNF568, KIAA1026, SFMBT2, и / или AUTS2; и диагностики рака при наличии высокого уровня экспрессии по отношению к нормальному базовому стандарту по меньшей мере одного биомаркера.

Недостатком известных аналогов и прототипа является использование бисульфитной конверсии ДНК, для которой характерны трудоемкость, дороговизна исследования и значительные затраты времени, а также деградация и значительные потери нуклеиновых кислот, что ведет к снижению точности и делает проблематичным анализ малого количества материала.

Техническим результатом предлагаемого изобретения является упрощение и повышение точности способа определения метилирования сайтов PuCGPy регуляторных областей генов-онкомаркеров колоректального рака и расширение его функциональных возможностей.

Указанный технический результат достигается тем, что способ определения метилирования сайтов PuCGPy регуляторных областей генов-онкомаркеров колоректального рака методом GLAD-ПЦР-анализа, согласно изобретения, включает биоинформационный анализ предшествующих публикаций о генах-онкомаркерах колоректального рака. Отбор генов-онкомаркеров колоректального рака при биоинформационном анализе осуществляют путем рассмотрения нуклеотидных последовательностей предположительных регуляторных участков этих генов, выявление располагающихся в них CpG-островков, анализ первичной структуры CpG-островков и их соответствие следующим критериям выбора:

- наличие данных из опубликованных работ, показывающих высокую частоту метилирования регуляторного участка гена в исследованных выборках образцов ДНК от больных колоректальным раком при низкой частоте метилирования данного участка у здоровых доноров или в прилегающих нормальных тканях толстой и прямой кишки онкопациентов;

- присутствие CpG-островка в области начала гена или в районе точки старта кодирования альтернативной изоформы белка - продукта гена;

- присутствие потенциального сайта узнавания эндонуклеазы GlaI (PuCGPy) в нуклеотидной последовательности на выбранном участке;

- достаточное расстояние (50 п. н. и более) между двумя потенциальными сайтами узнавания эндонуклеазы GlaI для одновременного отжига на этом участке флуоресцентно-меченого зонда и геномного праймера и возможность подбора для этого участка праймера и зонда, не подверженных теоретической кросс-гибридизации между собой и с последовательностью адаптера;

- значение G+C состава на кандидатном участке, не превышающее 80%;

- уникальность нуклеотидной последовательности кандидатного участка анализа (невхождение его в число повторяющихся элементов генома).

Окончательно отбирают гены, метилирование регуляторных областей которых имеют наибольшую частоту метилирования в ДНК клеток колоректального рака, с учетом возможности выявления метилирования гена на ранних стадиях заболевания и формируют панель из следующих генов-кандидатов в эпигенетические маркеры колоректального рака: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1. Далее осуществляют гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 в исследуемой ДНК, и гибридных праймеров, 3′-концы которых комплементарны 5′-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и делают заключение о наличии последовательности Pu(5mC)GPy (где 5mC - 5-метилцитозин, Pu - A или G, Py - T или C) в регуляторных областях генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 по появлению флуоресцентного сигнала. В качестве адаптерной последовательности используют универсальный олигонуклеотидный адаптер 5′-CCTGCTCTTTCATCG-3′/3′-p-GGACGAGAAAGTAGC-p-5′, где p - фосфат. Праймеры и зонды содержат последовательности, которые имеют структуру, представленную в независимом п. 3 формулы изобретения.

Указанный технический результат достигается также созданием набора олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов PuCGPy в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР (независимый п. 3 формулы изобретения), имеющих следующую структуру:

- для специфических праймеров и зонда на участок регуляторной области гена CNRIP1 (5`→3`):

CNRIP1_g GCCAGACCCTCGCCCAGACA

CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1

CNRIP1_h CCTGCTCTTTCATCGGCGA;

- для специфических праймеров и зонда на участок регуляторной области гена ELMO1 (5`→3`):

ELMO1_g GGGTCGCCGGAGCTCTGA

ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1

ELMO1_h CCTGCTCTTTCATCGGCCG;

- для специфических праймеров и зонда на участок регуляторной области гена ESR1 (5`→3`):

ESR1_g CGCAGGGCAGAAGGCTCAGAA

ESR1_z FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1

ESR1_h CCTGCTCTTTCATCGGTGT;

- для специфических праймеров и зонда на участок регуляторной области гена FBN1 (5`→3`):

FBN1_g GTAGCGGCCACGACTGGGA

FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1

FBN1_h CCTGCTCTTTCATCGGCGG;

- для специфических праймеров и зонда на участок регуляторной области гена RXRg (5`→3`):

RXRg_g GCCGCCGTCACCGCTACT

RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1

RXRg_h CCTGCTCTTTCATCGGCCG;

- для специфических праймеров и зонда на участок регуляторной области гена RYR2 (5`→3`):

RYR2_g GGGGACCACGGAGGCGACT

RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1

RYR2_h CCTGCTCTTTCATCGGCGT;

- для специфических праймеров и зонда на участок регуляторной области гена SEPT9b (5`→3`):

SEPT9b_g GCAGGAGGCTGTATTTGGG

SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1

SEPT9b_h CCTGCTCTTTCATCGGCGG;

- для специфических праймеров и зонда на участок регуляторной области гена SOCS3 (5`→3`):

SOCS3_g CAGTCCCGGGGGCCCTTCT

SOCS3_z FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1

SOCS3_h CCTGCTCTTTCATCGGCGG;

- для специфических праймеров и зонда на участок регуляторной области гена UCHL1 (5`→3`):

UCHL1_g GCAGAACCAAGCGAGGGGGAA

UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1

UCHL1_h CCTGCTCTTTCATCGGCTG,

где g - геномный праймер (genome); z - флуоресцентно-меченый зонд (zond); h - гибридный праймер (hybrid); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).

Учет результатов анализа проводится методом гибридизационно-флуоресцентной детекции продуктов ПЦР-амплификации в режиме реального времени.

Изобретение иллюстрируется следующим графическим материалом.

На фиг. 1 приведены данные анализа статуса метилирования сайтов PuCGPy на участке регуляторной области гена RYR2. На панели А представлен фрагмент нуклеотидной последовательности; показаны участки связывания геномного праймера, зонда и геном-специфичных 3′-тетрануклеотидов гибридных праймеров. На панели Б приведены кривые накопления флуоресценции в ходе ПЦР с использованием семи различных гибридных праймеров. Заглавными буквами «GCGT» обозначен выбранный гибридный праймер, соответствующий точке гидролиза ДНК по наиболее часто метилированному седьмому сайту PuCGPy в ампликоне.

Сущность изобретения поясняется следующими примерами 1-3, реализующими способ определения метилирования сайтов PuCGPy регуляторных областей генов-онкомаркеров колоректального рака методом GLAD-ПЦР-анализа, а также состав олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа.

Пример 1. Разработка специфических праймеров и флуоресцентно-меченых зондов на участки CpG-островков регуляторных областей генов-онкомаркеров колоректального рака.

Изучение опубликованных в литературе данных по метилированию генов при онкопатологиях нижних отделов кишечника, данных RRBS-секвенирования (Reduced Representation Bisulfite Sequencing, бисульфитное секвенирование ограниченных выборок локусов) в проекте ENCODE/HudsonAlpha и последующий биоинформационный анализ нуклеотидных последовательностей регуляторных участков описанных ранее генов позволил выбрать кандидатную комбинацию участков CpG-островков регуляторных областей генов-онкомаркеров колоректального рака, удовлетворяющих критериям анализа методом GLAD-ПЦР (табл. 1).

На первом этапе работы был проведен анализ литературных данных последних лет по метилированию генов при онкопатологиях нижних отделов кишечника, данных RRBS-секвенирования (Reduced Representation Bisulfite Sequencing, бисульфитное секвенирование ограниченных выборок локусов) в проекте ENCODE/HudsonAlpha и сформирован список из 57 генов-онкомаркеров, метилирование которых происходит с высокой частотой в ДНК клеток колоректального рака. Этот список включает в себя следующие гены: SEPT9, SYNE1, FGF12, GAD2, HAND1, CACNA1G, CNRIP1, TLX2, LOX, LAMA1, GAS7, SLC6A15, BOLL, TFPI2, SOCS3, TRH, MDFI, C1orf70, RUNX3, TMEFF2, SFRP2, WNT5A, IGFBP7, TFPI2, FOXE1, NPY, WIF1, CIDEB, RIC3, KCNQ5, COL4A1, SPG20, SND1, PENK, CDO1, THBD, EDIL3, DUSP26, UCHL1, STOX2, ELMO1, SLC30A10, IGF2, ESR1, EYA4, NALCN, FLI1, RXRg, RYR2, PRKAR1B, BEND5, ITGA4, ADHFE1, NGFR, GATA4, NEYROG1, FBN1. При выборе генов для данного списка учитывалось также количество проанализированных проб в описанных авторами статей экспериментах, так как достоверные данные могут быть получены лишь при большом числе образцов ДНК в выборке. Большое значение также придавалось такому описанному авторами работ свойству, как возможность выявления метилирования гена на ранних стадиях заболевания, хотя, к сожалению, число публикаций, в которых рассматривалась зависимость метилирования гена от стадии онкопатологии, очень незначительно.

На втором этапе работы были рассмотрены нуклеотидные последовательности предположительных регуляторных участков этих 57 генов и выявлены CpG-островки, располагающиеся в них. Первичные структуры CpG-островков были проанализированы на их соответствие критериям выбора:

1) Наличие данных из опубликованных работ, показывающих высокую частоту метилирования регуляторного участка гена в исследованных выборках образцов ДНК от больных колоректальным раком при низкой частоте метилирования данного участка у здоровых доноров или в прилегающих нормальных тканях толстой и прямой кишки онкопациентов.

2) Присутствие CpG-островка в области начала гена (или в районе точки старта кодирования альтернативной изоформы белка - продукта гена), что в большинстве случаев служит свидетельством регуляции активности данного гена путем метилирования этой области.

3) Присутствие потенциального сайта узнавания эндонуклеазы GlaI (PuCGPy) в нуклеотидной последовательности на выбранном участке.

4) Достаточное расстояние (50 п. н. и более) между двумя потенциальными сайтами узнавания эндонуклеазы GlaI для одновременного отжига на этом участке флуоресцентно-меченого зонда и геномного праймера и возможность подбора для этого участка праймера и зонда, не подверженных теоретической кросс-гибридизации между собой и с последовательностью адаптера.

5) Значение G+C состава на кандидатном участке, не превышающее 80%, что вызвано ограничениями системы амплификации ДНК in vitro, в которой используется HotStart Taq ДНК-полимераза.

6) Уникальность нуклеотидной последовательности кандидатного участка анализа (невхождение его в число повторяющихся элементов генома) во избежание неспецифического отжига подобранного геномного праймера в других областях генома, что может привести к значительному снижению эффективности амплификации и затруднению детекции результатов при проведении ПЦР в реальном времени.

В результате проведенного биоинформационного анализа регуляторных участков каждого из перечисленных генов для проведения экспериментального исследования были отобраны 9 областей из данных участков (табл. 1), которые удовлетворяют всем требуемым критериям проведения анализа с помощью метода GLAD-ПЦР, и подобраны специфические праймеры и зонды на выбранные участки регуляторных областей генов-онкомаркеров (табл. 2).

Таблица 1

Участки регуляторных областей генов-онкомаркеров перспективные для GLAD-ПЦР-анализа

Ген Официальное название кодируемого геном белка по номенклатуре HGNC Хромосома Координаты участка в хромосоме (версия генома человека GRCh37/hg19)
CNRIP1 Cannabinoid receptor interacting protein 1 2 68546267 - 68547417
ELMO1 Engulfment and cell motility 1 7 37487377 - 37488726
ESR1 Estrogen receptor 1 6 152128781 - 152129818
FBN1 Fibrillin 1 15 48936811 - 48938011
RXRg Retinoid X receptor, gamma 1 165414180 - 165414720
RYR2 Ryanodine receptor 2 1 237205258 - 237206918
SEPT9b Septin 9, beta 17 77372490 - 77374140
SOCS3 Suppressor of cytokine signaling 3 17 76354655 - 76355605
UCHL1 Ubiquitin carboxyl-terminal esterase L1 4 41258784 - 41259887

Используемые в работе последовательности регуляторных участков генов по версии генома человека GRCh37/hg19 были получены из международной базы данных GenBank. Для анализа и расчетов праймеров и зондов, изучения их специфичности использовали семейство компьютерных программ Vector NTI 11.5 (Invitrogen, США) и онлайн интернет-ресурсы базы данных Национального центра биотехнологической информации США (Blast NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Таблица 2

Специфические праймеры и зонды на участки регуляторных областей генов-онкомаркеров

Ген Обозначение и 5'->3' последовательность*
CNRIP1 CNRIP1_g GCCAGACCCTCGCCCAGACA
CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
CNRIP1_ih CGTCATTAGGCTGGATGCGCA
ELMO1 ELMO1_g GGGTCGCCGGAGCTCTGA
ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
ELMO1_ih CGCCAGCCCAGGAAACTTTAC
ESR1 ESR1_g CGCAGGGCAGAAGGCTCAGAA
ESR1_z FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1
ESR1_ih CGGGACATGCGCTGCGTC
FBN1 FBN1_g GTAGCGGCCACGACTGGGA
FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
FBN1_ih CCGGCTGCACCCACTGGA
RXRg RXRg_g GCCGCCGTCACCGCTACT
RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1
RXRg_ih GTGCCACCCGGTAGGGACC
RYR2 RYR2_g GGGGACCACGGAGGCGACT
RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
RYR2_ih CGGGGGTGATGGTGCAGGA
SEPT9b SEPT9b_g GCAGGAGGCTGTATTTGGG
SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
SEPT9b_ih CGCTGCCGTTTAACCCTTG
SOCS3 SOCS3_g CAGTCCCGGGGGCCCTTCT
SOCS3_z FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1
SOCS3_ih CAAGGGCGCAGCGTGGGA
UCHL1 UCHLl_g GCAGAACCAAGCGAGGGGGAA
UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
UCHLl_ih GGGGCCCGGCCGTACCAC

*Примечание: g - геномный праймер; z - флуоресцентно-меченый зонд; ih - дополнительный геномный праймер (instead of hybrid), впоследствии заменяемый в GLAD-ПЦР гибридным праймером (пример 2); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).

Реакцию ПЦР в режиме реального времени проводили в объеме 20 мкл в трех повторах на детектирующем амплификаторе CXF-96 («Bio-Rad», США) по универсальной для всех амплифицируемых участков программе: 95°С 3 мин, далее 5 циклов без детекции: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек; затем 50 циклов с детекцией по каналу FAM на стадии отжига: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек. Концентрации реакционных компонентов ПЦР были аналогичны указанным в примере 2. В экспериментах использовали лейкоцитарную ДНК здорового донора, полученную и очищенную, как описано ранее [Абдурашитов М.А. с соавт. Рестрикционный анализ ДНК человека - новые возможности в ДНК-диагностике. Медицинская генетика. 2007. - Т. 6. - С. 29-36]. Результаты амплификации соответствовали ожидаемым. Последовательности разработанных праймеров и зондов представлены в таблице 2. Впоследствии, при проведении GLAD-ПЦР, один из праймеров, обозначенный в таблице как «ih» (instead of hybrid), заменяли на отобранный гибридный праймер (пример 2).

Пример 2. Поиск метилированных сайтов PuCGPy для GLAD-ПЦР-анализа

Изучен статус метилирования сайтов PuCGPy в пределах выбранных участков ДНК с целью выбора оптимальных сайтов для дальнейшего GLAD-ПЦР-анализа клинических образцов. Для поиска перспективных сайтов Pu(5mC)GPy в пределах выбранных для анализа участков регуляторных областей генов-онкомаркеров использовали препарат ДНК из клеток колоректального рака линии SW837 (линия клеток аденокарциномы ободочной кишки), выделенный известным методом [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.]. Поиск проводили методом подбора гибридных праймеров под близлежащие сайты PuCGPy на протяжении не более 400 п. о. от положения геномного праймера. Использовали методологию, структуры олигонуклеотидного адаптера и гибридных праймеров согласно известному способу [Кузнецов В. В. с соавт. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК // Патент РФ №2525710 С1, опубл. 20.08.2014, Бюл. № 23].

Структура гибридного праймера представляет собой 19-звенную последовательность следующего состава: 5′-CCTGCTCTTTCATCGgYNN-3′, где подчеркиванием выделена 15-звенная часть праймера, комплементарная универсальному олигонуклеотидному адаптеру, а gYNN - 4-звенник, комплементарный геномной последовательности в точке гидролиза ДНК метилзависимой эндонуклеазой GlaI. Данная структура предполагает 32 варианта гибридных праймеров, соответствующих различным точкам гидролиза ДНК по сайту Pu(5mC)GPy.

К 45 нг препарата ДНК добавляли метилзависимую сайт-специфическую ДНК-эндонуклеазу GlaI в количестве 1,5 е.а. и компоненты буфера для достижения следующего состава в объеме 21,7 мкл: 20 мМ Tris-SO4, pH 8.0, 4 мМ MgCl2, 1 мМ β-меркаптоэтанол, 100 нг/мкл БСА. Гидролиз проводили в течение 30 мин при 30°C с последующей инактивацией GlaI при 65°С в течение 20 мин.

Далее в к GlaI-гидролизату добавляли АТФ до конечной концентрации 0,5 мМ, β-меркаптоэтанол до 6,8 мМ, универсальный олигонуклеотидный адаптер 5′-CCTGCTCTTTCATCG-3′/3′-p-GGACGAGAAAGTAGC-p-5′, до конечной концентрации 0,5 мкМ и 1000 е.а. высокоактивной T4 ДНК-лигазы. Реакцию лигирования адаптера проводили в 30 мкл реакционной смеси в течение 15 мин при 25°С, затем лигазу термоинактивировали при 65°С в течение 20 мин.

Для проведения ПЦР в режиме реального времени к лигазной смеси добавляли следующие компоненты до достижения итоговых концентраций в конечном объеме, равном 60 мкл: 50 мМ Tris-SO4, pH 9,0, 30 мМ KCl, 10 мМ сульфата аммония, 3 мМ MgCl2, 0,2 мМ смеси дезоксирибонуклеозидтрифосфатов, 0,01 % Tween-20, смесь геномного праймера, гибридного праймера и зонда по 0,4 мкМ каждого и 0,05 е.а./мкл Hot Start ДНК-полимеразы. Для повышения эффективности амплификации GC-богатых участков ДНК использовали стабилизатор. Полученную реакционную смесь (60 мкл) разделяли на три равные части.

Таблица 3

Результаты поиска сайтов PuCGPy, перспективных для GLAD-ПЦР-анализа

Ген Хромо-сома Сайт PuCGPy Координаты сайта в хромосоме (версия генома человека GRCh37/hg19) № сайта в ампли-коне Гибридный праймер
(обозначение)
CNRIP1 2 GCGC 68546267 - 68547417 2 CCTGCTCTTTCATCGGCGA
(CNRIP1_h)
ELMO1 7 GCGC 37487377 - 37488726 3 CCTGCTCTTTCATCGGCCG
(ELMO1_h)
ESR1 6 GCGT 152128781 - 152129818 3 CCTGCTCTTTCATCGGTGT
(ESR1_h)
FBN1 15 GCGC 48936811 - 48938011 3 CCTGCTCTTTCATCGGCGG
(FBN1_h)
RXRg 1 GCGC 165414513 - 165414516 1 CCTGCTCTTTCATCGGCCG
(RXRg_h)
RYR2 1 GCGC 237205258 - 237206918 7 CCTGCTCTTTCATCGGCGT
(RYR2_h)
SEPT9b 17 GCGC 75368983 - 75368986 1 CCTGCTCTTTCATCGGCGG
(SEPT9b_h)
SOCS3 17 GCGC 76354655 - 76355605 1 CCTGCTCTTTCATCGGCGG
(SOCS3_h)
UCHL1 4 GCGC 41258784 - 41259887 2 CCTGCTCTTTCATCGGCTG
(UCHL1_h)

*Примечание: h - обозначает гибридный праймер (hybrid); подчеркиванием выделена 15-звенная часть праймера, комплементарная универсальному олигонуклеотидному адаптеру.

Реакцию ПЦР в режиме реального времени проводили в объеме 20 мкл в трех повторах на детектирующем амплификаторе CXF-96 («Bio-Rad», США) по программе: 95°С 3 мин, далее 5 циклов без детекции: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек; затем 50 циклов с детекцией (канал FAM) на стадии отжига: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек. Результаты анализировали при помощи программного обеспечения амплификатора CXF-96 и интерпретировали на основании наличия (или отсутствия) пересечения кривых флуоресценции образцов с пороговыми линиями, что соответствовало наличию или отсутствию значения порогового цикла «Cq» в соответствующей графе таблицы результатов программы амплификатора.

На фиг. 1 представлен пример поиска наиболее часто метилированного сайта PuCGPy на выбранном участке регуляторной области гена RYR2. Как видно из фиг. 1, таким оказался седьмой сайт в ампликоне, которому соответствует гибридный праймер 5′-CCTGCTCTTTCATCGGCGT-3′.

Результаты поиска сайтов Pu(5mC)GPy в участках CpG-островков регуляторных областей генов-онкомаркеров суммированы в таблице 3.

Пример 3. GLAD-ПЦР-анализ статуса метилирования генов-онкомаркеров колоректального рака

Образцы операционного материала опухолей (n = 13), нормальной слизистой кишечника (n = 4) и эндоскопических проб (n = 2) от больных колоректальным раком были получены из ФГУП Северский биофизический научный центр ФМБА России (г. Северск, Томская обл., РФ). Для GLAD-ПЦР-анализа статуса метилирования сайтов PuCGPy в заданных положениях участка ДНК определенного гена использовали препараты геномных ДНК, выделенные из клинических образцов известным методом [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.], прошедшие обработку РНК-азой А для очистки от примесей РНК и фрагментацию редкощепящей эндонуклеазой рестрикции TaqI для более полного гидролиза ДНК. Концентрации образцов ДНК (нг/мкл) определяли спектрофотометрически. Реакцию GLAD-ПЦР проводили, как описано в примере 2. В реакцию брали 9 нг ДНК, ПЦР проводили в трех повторах для каждого образца (по 3 нг ДНК, т.е. по ~103 копий генома на реакцию). Один из геномных праймеров в ПЦР заменяли на подобранный, как описано в примере 2, т.е. гибридный праймер.

Таблица 4

Результаты скрининга эпигенетических онкомаркеров методом GLAD-ПЦР на наличие метилирования, коррелирующего с колоректальным раком, в клинических образцах

№ клинического образца RYR2 CNRIP1 ESR1 FBN1 SOCS3 UCHL1 SEPT9b RXR1g ELMO1
1 КРР + + + + + + - + +
2 КРР + + + + + + + + -
3 КРР + + + + + + + - -
4 КРР + + + - + + + + -
5 КРР + + - + + + + + +
6 КРР + + + + + - + + +
7 КРР + + + + - + + + -
8 КРР + + + + + + - - -
9 КРР + + + + + + + + +
10 КРР + - - - + - + + +
11 КРР + + + + - - + + +
12 КРР + + + + + + - + +
13 КРР + + + + + + + - +
14э КРР + + + + + + + - -
15э КРР + + + + - + - - -
10 норм - - - - - - - - -
11 норм - - - - - - - - -
12 норм - - - - - - - - -
13 норм - - - - - - - - -
Число (%) выявленных образцов КРР 15
(100 %)
14
(93 %)
13
(87 %)
13
(87 %)
12
(80 %)
12
(80 %)
11
(73 %)
10
(67 %)
8
(53 %)

*Примечания: «норм» - образцы интактной слизистой; «КРР» - образцы колоректального рака; «э КРР» - образцы, полученные при эндоскопическом обследовании больных колоректальным раком.

Результаты проведенного скрининга представлены в таблице 4. Анализируемый образец считали положительным, когда кривая накопления флуоресценции имела характерную экспоненциальную фазу роста и среднее значение «Ct» для образца было меньше нижней границы диапазона значений пороговых циклов для 4-х образцов интактной слизистой (10-13 норм) на 1 и более цикл. Анализируемый образец считали отрицательным, если среднее значение «Ct» для образца попадало в диапазон значений пороговых циклов для образцов интактной слизистой, было больше или не определялось.

Как видно из таблицы 4, наиболее перспективными при GLAD-ПЦР-анализе клинических образцов колоректального рака оказались гены RYR2, CNRIP1, ESR1, FBN1, SOCS3 и UCHL1, метилирование регуляторных областей которых было выявлено в 80-100% исследованных образцов колоректального рака.

Таким образом, в примере 3 показана возможность успешного применения метода GLAD-ПЦР для идентификации злокачественного поражения толстого кишечника и прямой кишки с использованием разработанного набора олигонуклеотидных праймеров и флуоресцентно-меченых зондов для анализа методом GLAD-ПЦР статуса метилирования заданных сайтов PuCGPy в регуляторных областях генов-онкомаркеров колоректального рака.

Приложение

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> Федеральное бюджетное учреждение науки «Государственный

научный центр вирусологии и биотехнологии "Вектор"» (ФБУН

ГНЦ ВБ "Вектор")

<120> Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов PuCGPy в заданных положениях регуляторных областей генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 методом GLAD-ПЦР

<210> 9

<212> DNA

<213> Homo sapiens

<223> Последовательности для специфических праймеров и зондов на участки CpG-островков регуляторных областей генов-онкомаркеров CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1

<400> 1 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера CNRIP1 (5`→3`):

CNRIP1_g 5`-GCCAGACCCTCGCCCAGACA-3` (20 н)
CNRIP1_z 5`-FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1-3` (20 н)
CNRIP1_h 5`-CCTGCTCTTTCATCGGCGA-3` (19 н)

<400> 2 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ELMO1 (5`→3`):

ELMO1_g 5`-GGGTCGCCGGAGCTCTGA-3` (18 н)
ELMO1_z 5`-FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1-3` (23 н)
ELMO1_h 5`-CCTGCTCTTTCATCGGCCG-3` (19 н)

<400> 3 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ESR1 (5`→3`):

ESR1_g 5`-CGCAGGGCAGAAGGCTCAGAA-3` (21 н)
ESR1_z 5`-FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1-3` (24 н)
ESR1_h 5`-CCTGCTCTTTCATCGGTGT-3` (19 н)

<400> 4 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1 (5`→3`):

FBN1_g 5`-GTAGCGGCCACGACTGGGA-3` (19 н)
FBN1_z 5`-FAM-CAGCCGCCGCCGCCTCCTC-BHQ1-3` (19 н)
FBN1_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 н)

<400> 5 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RXRg (5`→3`):

RXRg_g 5`-GCCGCCGTCACCGCTACT-3` (18 н)
RXRg_z 5`-FAM-CCACCGCCGTCGCTGCTGC-BHQ1-3` (19 н)
RXRg_h 5`-CCTGCTCTTTCATCGGCCG-3` (19 н)

<400> 6 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RYR2 (5`→3`):

RYR2_g 5`-GGGGACCACGGAGGCGACT-3` (19 н)
RYR2_z 5`-FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1-3` (27 н)
RYR2_h 5`-CCTGCTCTTTCATCGGCGT-3` (19 н)

<400> 7 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SEPT9b (5`→3`):

SEPT9b_g 5`-GCAGGAGGCTGTATTTGGG-3` (19 н)
SEPT9b_z 5`-FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1-3` (27 н)
SEPT9b_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 н)

<400> 8 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SOCS3 (5`→3`):

SOCS3_g 5`-CAGTCCCGGGGGCCCTTCT-3` (19 н)
SOCS3_z 5`-FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1-3` (22 н)
SOCS3_h 5`-CCTGCTCTTTCATCGGCGG-3` (19 н)

<400> 9 для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера UCHL1 (5`→3`):

UCHLl_g 5`-GCAGAACCAAGCGAGGGGGAA-3` (21 н)
UCHL1_z 5`-FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1-3` (24 н)
UCHLl_h 5`-CCTGCTCTTTCATCGGCTG-3` (19 н),

где g - геномный праймер (genome); z - флуоресцентно-меченый зонд (zond); h - гибридный праймер (hybrid); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).

1. Способ определения метилирования сайтов PuCGPy регуляторных областей генов-онкомаркеров колоректального рака методом GLAD-ПЦР-анализа, характеризующийся тем, что он включает биоинформационный анализ предшествующих публикаций о генах-онкомаркерах колоректального рака; отбор генов, метилирование сайтов PuCGPy регуляторных областей которых происходит с высокой частотой в ДНК клеток колоректального рака, с учетом возможности выявления метилирования гена на ранних стадиях заболевания и формирование панели из следующих генов-онкомаркеров колоректального рака: CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1; гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 в исследуемой ДНК, и гибридных праймеров, 3'-концы которых комплементарны 5'-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и делают заключение о наличии последовательности Pu(5mC)GPy (где 5mC - 5-метилцитозин, Pu - A или G, Py - T или C) в регуляторных областях генов CNRIP1, ELMO1, ESR1, FBN1, RXRg, RYR2, SEPT9b, SOCS3 и UCHL1 по появлению флуоресцентного сигнала, причем в качестве адаптерной последовательности используют универсальный олигонуклеотидный адаптер 5'-CCTGCTCTTTCATCG-3'/3'-p-GGACGAGAAAGTAGC-p-5', где p - фосфат, а праймеры и зонды содержат последовательности, которые имеют структуру, представленную в независимом п. 3 формулы.

2. Способ по п. 1, отличающийся тем, что отбор генов-онкомаркеров колоректального рака при биоинформационном анализе осуществляют путем рассмотрения нуклеотидных последовательностей регуляторных участков этих генов, выявление располагающихся в них CpG-островков, анализ первичной структуры CpG-островков и их соответствие следующим критериям выбора:
- наличие данных из опубликованных работ, показывающих высокую частоту метилирования регуляторного участка гена в исследованных выборках образцов ДНК от больных колоректальным раком при низкой частоте метилирования данного участка у здоровых доноров или в прилегающих нормальных тканях толстой и прямой кишки онкопациентов;
- присутствие CpG-островка в области начала гена или в районе точки старта кодирования альтернативной изоформы белка - продукта гена;
- присутствие потенциального сайта узнавания эндонуклеазы GlaI (PuCGPy) в нуклеотидной последовательности на выбранном участке;
- достаточное расстояние (50 п.н. и более) между двумя потенциальными сайтами узнавания эндонуклеазы GlaI для одновременного отжига на этом участке флуоресцентно-меченого зонда и геномного праймера и возможность подбора для этого участка праймера и зонда, не подверженных теоретической кросс-гибридизации между собой и с последовательностью адаптера;
- значение G+C состава на кандидатном участке, не превышающее 80%;
- уникальность нуклеотидной последовательности кандидатного участка анализа (невхождение его в число повторяющихся элементов генома).

3. Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов PuCGPy в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР, имеющих следующую структуру:
- для специфических праймеров и зонда на участок регуляторной области гена CNRIP1 (5`→3`):
CNRIP1_g GCCAGACCCTCGCCCAGACA
CNRIP1_z FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
CNRIP1_h CCTGCTCTTTCATCGGCGA;
- для специфических праймеров и зонда на участок регуляторной области гена ELMO1 (5`→3`):
ELMO1_g GGGTCGCCGGAGCTCTGA
ELMO1_z FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
ELMO1_h CCTGCTCTTTCATCGGCCG;
- для специфических праймеров и зонда на участок регуляторной области гена ESR1 (5`→3`):
ESR1_g CGCAGGGCAGAAGGCTCAGAA
ESR1_z FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1
ESR1_h CCTGCTCTTTCATCGGTGT;
- для специфических праймеров и зонда на участок регуляторной области гена FBN1 (5`→3`):
FBN1_g GTAGCGGCCACGACTGGGA
FBN1_z FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
FBN1_h CCTGCTCTTTCATCGGCGG;
- для специфических праймеров и зонда на участок регуляторной области гена RXRg (5`→3`):
RXRg_g GCCGCCGTCACCGCTACT
RXRg_z FAM-CCACCGCCGTCGCTGCTGC-BHQ1
RXRg_h CCTGCTCTTTCATCGGCCG;
- для специфических праймеров и зонда на участок регуляторной области гена RYR2 (5`→3`):
RYR2_g GGGGACCACGGAGGCGACT
RYR2_z FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
RYR2_h CCTGCTCTTTCATCGGCGT;
- для специфических праймеров и зонда на участок регуляторной области гена SEPT9b (5`→3`):
SEPT9b_g GCAGGAGGCTGTATTTGGG
SEPT9b_z FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
SEPT9b_h CCTGCTCTTTCATCGGCGG;
- для специфических праймеров и зонда на участок регуляторной области гена SOCS3 (5`→3`):
SOCS3_g CAGTCCCGGGGGCCCTTCT
SOCS3_z FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1
SOCS3_h CCTGCTCTTTCATCGGCGG;
- для специфических праймеров и зонда на участок регуляторной области гена UCHL1 (5`→3`):
UCHLl_g GCAGAACCAAGCGAGGGGGAA
UCHL1_z FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
UCHLl_h CCTGCTCTTTCATCGGCTG,
где g - геномный праймер (genome); z - флуоресцентно-меченый зонд (zond); h - гибридный праймер (hybrid); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).



 

Похожие патенты:

Изобретение относится к области медицинской микробиологии и касается способа дифференциации токсигенных и атоксигенных штаммов холерных вибрионов О1 серогруппы по ингибирующей активности.

Изобретение относится к области биотехнологии. Описан диагностический способ in vitro диагностики рака эндометрия.

Изобретение касается способа диагностики волчанки у человека. Представленное изобретение включает определение наличия вариации по меньшей мере в одном локусе риска SLE, причем указанная вариация по меньшей мере в одном локусе представляет собой аллель риска однонуклеотидного полиморфизма (SNP).

Изобретение относится к молекулярной биологии и может быть использовано при проведении медико-биологических исследований. Предложен способ подготовки суспензии лимфоцитов человека в этанол-уксусном фиксаторе для выделения ДНК, включающий центрифугирование указанной суспензии и удаление надосадочной жидкости.

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики, ветеринарной медицины, в частности к набору олигодезоксирибонуклеотидов для амплификации и детекции видоспецифичного фрагмента ДНК Anaplasma marginale методом полимеразной цепной реакции (ПЦР) в режиме «реального времени».

Изобретение направлено на композиции и способы выделения, обнаружения, амплификации и количественной оценки патоген-специфичных нуклеиновых кислот в биологическом образце.

Группа изобретений относится к биохимии. Описан набор реагентов для выявления ДНК Neisseria gonorrhoeae в образце, включающий по меньшей мере два олигонуклеотидных праймера для полимеразной цепной реакции и, при необходимости, олигонуклеотидный зонд, термостабильную ДНК-полимеразу, буферный раствор для ПЦР, дезоксинуклеозидтрифосфаты, отличающийся тем, что первый олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 1, второй олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 2.

Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени.

Изобретение относится к области биохимии, в частности к способу определения зиготности аллеля мутанта bm3 и аллеля СОМТ дикого типа с использованием ткани растения кукурузы.

Настоящее изобретение относится к способам выявления лиц с промежуточной возрастной макулодистрофией (ВМД), характеризующихся повышенным риском прогрессирования ВМД до поздней стадии, с помощью полигенного показателя, рассчитываемого на основании результатов полногеномного исследования генных ассоциаций, использующего тысячи однонуклеотидных полиморфизмов (ОНП).

Изобретение относится к области медицины и касается способа, тест-системы диагностики диабетической нефропатии. Сущность способа заключается в том, что в образце от субъекта определяют биомаркер, который представляет собой подобный антигену CD5. Использование способа позволяет диагностировать диабетическую нефропатию. 5 н. и 28 з.п. ф-лы, 13 табл., 5 ил., 1 пр.

Настоящее изобретение относится к количественному способу определения, обладает ли обследуемый человек нарушенной функцией репарации ошибочно спаренных оснований ДНК. Способ предусматривает получение ядерных экстрактов с нормальной функцией MMR и утраченной функцией MMR в качестве положительного и отрицательного контроля из диагностического образца. Далее осуществляют смешивание каждого ядерного экстракта с субстратом-молекулой ДНК, включающим по меньшей мере одну ошибку спаривания оснований, выполняют анализ репарации ошибочно спаренных оснований. В заключении определяют, способен ли указанный ядерный экстракт образца к репарации указанного субстрата-молекулы ДНК; причем указанный образец включает нормальные незлокачественные конститутивные клетки, например, фибробласты. Изобретение дополнительно относится к набору, включающему необходимые реагенты для применения в указанном способе. 4 н. и 16 з.п. ф-лы, 6 ил., 2 табл., 9 пр.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ). У индивидуумов русской национальности, являющихся уроженцами Центрального Черноземья России, из периферической венозной крови выделяют ДНК, после чего проводят анализ полиморфизмов генов TNFα, Ltα, TNFR1 и TNFR2. Среди индивидуумов без сопутствующей патологии глаз в случае выявления комбинации -308G TNFα и +1663G TNFR2 либо комбинации +36G TNFR1 и +1663G TNFR2 или при наличии сопутствующей патологии глаз как миопия, катаракта или возрастная макулярная дегенерация сетчатки в случае выявления +36A TNFR1 либо комбинации +36AA TNFR1 и +1663A TNFR2 либо +250G Ltα и +36AA TNFR1 прогнозируют повышенный риск развития ПОУГ. У индивидуумов с сопутствующей патологией глаз при выявлении +250A Ltα и +36G TNFR1 либо -308G TNFα и +36G TNFR1 прогнозируют низкий риск развития ПОУГ. Изобретение обеспечивает раннее выявление больных с ПОУГ, что позволит предупредить прогрессирование заболевания. 6 ил., 2 табл., 7 пр.

Группа изобретений относится к области биотехнологии. Предложены способ и система для определения нуклеотидной последовательности в заданной области генома плода. Способ включает следующие этапы: конструирование библиотеки для секвенирования из образца геномной ДНК из периферической крови беременной женщины; секвенирование библиотеки для секвенирования с целью получения результата секвенирования. Результат секвенирования плода включает множество полученных при секвенировании данных. Нуклеотидную последовательность в заданной области генома определяют посредством использования скрытой марковской модели на основании результата секвенирования последовательностей плода в сочетании с генетической информацией о родственнике с помощью алгоритма Витерби. Система состоит из аппарата конструирования библиотеки, секвенатора и анализатора. Использование изобретений позволяет произвести генотипирование с высокой точностью. 2 н. и 12 з.п. ф-лы, 2 ил., 1 табл., 1 пр.

Изобретение относится к области биотехнологии. Способ предусматривает приготовление реакционной смеси, содержащей буферный раствор и исследуемый образец ДНК. Добавляют к смеси ДНК-метилтрансферазу с активностью 2 е.а./мкл, модифицирующую цитозин в положении С5, выбранную из группы: Fsp4HI, НаеIII, HspAI, AluI, в зависимости от того, какой сайт необходимо расщепить, смесь инкубируют в течение часа, полученную С5-метилированную ДНК обрабатывают MD-эндонуклеазой ElmI с активностью 2 е.а./мкл или PkrI с активностью 2 е.а./мкл в зависимости от того, в какой позиции необходимо гидролизовать ДНК. С помощью данного способа можно осуществить исчерпывающий сайт-специфический гидролиз ДНК по шести- и восьминуклеотидным последовательностям, не расщепляемым традиционно используемыми эндонуклеазами рестрикции. 2 з.п. ф-лы, 3 ил., 6 пр.

Изобретение относится к области биотехнологии и представляет собой способ сайт-специфического гидролиза С5-метилированной последовательности ДНК. Готовят реакционную смесь, содержащую буферный раствор и образец С5-метилированной ДНК, добавляют к смеси диметилсульфоксид до конечной концентрации 15-25%, а затем MD-эндонуклеазу, смесь инкубируют в течение часа при 30-37°C с последующим анализом результата гидролиза ДНК методом гель-электрофореза, при этом в качестве MD-эндонуклеазы используют GlaI с концентрацией 4-8 е.а./мкл или PcsI с концентрацией 1-2 е.а./мкл. Изобретение позволяет повысить эффективность сайт-специфического гидролиза С5-метилированной последовательности ДНК. 3 з.п. ф-лы, 3 ил., 4 пр.
Наверх