Способ диагностики волчанки у человека



Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека
Способ диагностики волчанки у человека

 


Владельцы патента RU 2596391:

ДЖЕНЕНТЕК, ИНК. (US)

Изобретение касается способа диагностики волчанки у человека. Представленное изобретение включает определение наличия вариации по меньшей мере в одном локусе риска SLE, причем указанная вариация по меньшей мере в одном локусе представляет собой аллель риска однонуклеотидного полиморфизма (SNP). Указанная вариация по меньшей мере в одном локусе содержит Т-аллель rs849142 JAZF1. Определение присутствия указанной вариации по меньшей мере в одном локусе указывает, что субъект страдает волчанкой. Изобретение может быть использовано для точной диагностики такого аутоиммунного заболевания, как волчанка. 7 з.п. ф-лы, 7 ил., 10 табл., 2 пр.

 

По данной заявке испрашивается приоритет предварительной заявки США № 61/278510, зарегистрированной 7 октября, 2009, которая таким образом полностью включена в настоящий документ путем ссылки.

Список последовательностей

Настоящая заявка содержит список последовательностей, которые поданы в ASCII-формате через EFS-Web и, таким образом, полностью включены путем ссылки. Указанная ASCII-копия, созданная 27 декабря 2010, имеет название P4325R1W.txt и размер 3576 байт.

Область техники

Изобретение относится к способам идентификации, диагностики, прогнозирования и оценки риска развития волчанки, а также к способам лечения волчанки. Также изобретение относится к способам идентификации эффективных противоволчаночных терапевтических средств и предсказания ответной реакции на противоволчаночные терапевтические средства.

Предпосылки создания изобретения

Волчанка представляет собой аутоиммунное заболевание, затрагивающее, по оценкам, примерно 1 миллион американцев, в первую очередь, женщин в возрасте от 20 до 40 лет. Волчанка характеризуется выработкой антител, поражающих соединительную ткань. Основной формой волчанки является системная волчанка (системная красная волчанка, SLE). SLE является хроническим аутоиммунным заболеванием с сильными генетическими, а также экзогенными составляющими (см., например, Hochberg M.C, Dubois' Lupus Erythematosus. 5th ed., Wallace D.J, Hahn B.H, eds. Baltimore: Williams and Wilkins (1997); Wakeland E.K, et al., Immunity 2001; 15(3):397-408; Nath S.K, et al., Curr. Opin. Immunol. 2004; 16(6):794-800; D'Cruz et al., Lancet (2007), 369:587-596). Известны различные другие формы волчанки, включая, без ограничений, кожную красную волчанку (CLE), волчаночный нефрит (LN) и неонатальную волчанку.

Волчанка в отсутствие лечения может привести к смерти по мере своего развития, начиная от поражений кожи и суставов и до поражений внутренних органов, включая легкие, сердце и почки (причем заболевание почек представляет собой основную проблему), поэтому проведение ранней и точной диагностики и/или оценки риска развития волчанки является особенно важным. Волчанка в основном проявляется в виде серии обострений, перемежающихся с неострыми периодами или отсутствием проявлений заболевания. Поражение почек, измеряемое по уровню протеинурии в моче, является одним из острых поражений, ассоциированных с патогенностью SLE, и отвечает по меньшей мере за 50% смертности и распространенности заболевания.

Клинически, SLE представляет собой гетерогенное заболевание, отличающееся присутствием высокоаффинных аутоантител. Аутоантитела играют важную роль в патогенезе SLE, а различные клинические проявления болезни являются следствием отложения содержащих антитела иммунных комплексов в кровеносных сосудах, приводящему к воспалению в почках, мозге и коже. Аутоантитела также обладают прямыми патогенными эффектами, способствуя гемолитической анемии и тромбоцитопении. SLE ассоциирована с продукцией антинуклеарных антител, циркулирующих иммунных комплексов и активацией системы комплемента. Частота распространения SLE составляет примерно 1 случай заболевания на 700 женщин в возрасте между 20 и 60 годами. Многочисленные аутоантитела различной специфичности присутствуют у пациентов с SLE. У них часто продуцируются аутоантитела к ДНК, Ro и тромбоцитам, которые способны вызывать клинические признаки заболевания, такие как гломерулонефрит, серозит, полная сердечная блокада у новорожденных и гематологические аномалии. Эти аутоантитела возможно также связаны с расстройствами центральной нервной системы. Arbuckle и др. описывают выработку аутоантител до клинического начала SLE (Arbuckle et al. N. Engl. J. Med. 349(16):1526-1533 (2003)). Точная диагностика волчанки, включая SLE, является сложной, что вынуждает клиницистов прибегать к классификационному подходу, основанному на мультифакторных признаках и симптомах (Gill et al., American Family Physician 68(11):2179-2186(2003)).

Одной из наиболее трудных проблем в клиническом ведении комплексных аутоиммунных заболеваний, таких как волчанка, является точная и ранняя идентификация заболевания у пациента. С целью идентификации генетических факторов, способствующих восприимчивости к SLE, за эти годы были изучены множество сцепленных и представляющих интерес генов. Гаплотипы, несущие аллели DRB1*0301 и DRB1*1501, безусловно ассоциированы с заболеванием, также как и присутствие антител к ядерным аутоантигенам. См., например, Goldberg M.A, et al., Arthritis Rheum. 19(2):129-32 (1976); Graham R.R, et al., Am J Hum Genet. 71(3):543-53 (2002); и Graham R.R, et al., Eur J Hum Genet. 15(8):823-30 (2007). Позднее было обнаружено, что варианты интерферон-регулирующего фактора 5 (IRF5) и сигнального трансдуктора и активатора транскрипции 4 (STAT4) являются существенными факторами риска SLE. См., например, Sigurdsson S, et al., Am J Hum Genet. 76(3):528-37 (2005); Graham R.R, et al., Nat Genet. 38(5):550-55 (2006); Graham R.R, et al., Proc. Natl. Acad. Sci USA 104(16):6758-63 (2007); and Remmers E.F, et al., N Engl. J Med. 357(10):977-86 (2007). Идентификация IRF5 и STAT4 в качестве генов риска SLE поддерживает концепцию, что в некоторых случаях, сигнальный путь интерферона (IFN) I типа играет важную роль в патогенезе SLE. Интерферон I типа присутствует в сыворотке пациентов с SLE, а продукция IFN связана с присутствием антител и содержащих нуклеиновые кислоты иммунных комплексов (подробно описано в Ronnblom et al., J Exp. Med. 194:F59 (2001); также см. Baechler E.C, et al., Curr Opin Immunol. 16(6):801-07 (2004); Banchereau J, et al., Immunity 25(3):383-92 (2006); Miyagi et al., J Exp. Med. 204(10):2383-96 (2007)). У большинства пациентов с SLE наблюдается характерная картина выраженной экспрессии гена интерферона I типа в клетках крови (Baechler et al., Proc Natl. Acad. Sci USA 100:2610 (2003); Bennett et al., J Exp. Med. 197:711 (2003)), и они имеют повышенный уровень индуцируемых интерфероном цитокинов и хемокинов в сыворотке (Bauer et al., PLoS Med 3:e491 (2006)). Иммунные комплексы, содержащие собственную ДНК и РНК, стимулируют экспрессию толл-подобных рецепторов (TLR) 7 и 9 дендритными клетками и продукцию интерферона I типа В-клетками, которая дополнительно стимулирует образование иммунных комплексов (подробно описано в Marshak-Rothstein et al., Annu Rev Immunol. 25, 419 (2007)).

Кроме того, с целью идентификации надежных биомаркеров для диагностических и прогностических целей был проведен ряд исследований. Однако не было идентифицировано никаких клинически валидированных диагностических маркеров, например, биомаркеров, которые обеспечивали возможность клиницистам или другим специалистам точно определять патофизиологические аспекты SLE, клиническую активность, ответ на терапию, прогноз или риск развития заболевания, хотя был идентифицирован ряд представляющих интерес генов и аллелей (вариантов), которые предположительно вносят вклад в восприимчивость к SLE. Например, были опубликованы по меньшей мере 13 общих аллелей, которые вносят вклад в риск SLE у индивидуумов европейского происхождения ((Kyogoku et al., Am J Hum Genet 75(3):504-7 (2004); Sigurdsson et al., Am J Hum Genet 76(3):528-37 (2005); Graham et al., Nat Genet 38(5):550-55 (2006); Graham et al., Proc. Natl. Acad Sci USA 104(16):6758-63 (2007); Remmers et al., N Engl J Med 357(10):977-86 (2007); Cunninghame Graham et al., Nat Genet 40(1):83-89 (2008); Harley et al., Nat Genet 40(2):204-10 (2008); Hom et al., N Engl J Med 358(9):900-9 (2009); Kozyrev et al., Nat Genet 40(2):211-6 (2008); Nath et al., Genet 40(2): 152-4 (2008); Sawalha et al., PLoS ONE 3(3):e1727 (2008)). Потенциальные каузальные аллели известны для HLA-DR3, HLA-DR2, FCGR2A, PTPN22, ITGAM и BANK1 ((Kyogoku et al., Am J Hum Genet 75(3):504-7 (2004); Kozyrev et al., Nat Genet 40(2):211-6 (2008); Nath et al., Nat Genet 40(2):152-4 (2008)), в то время как гаплотипы риска для IRF5, TNFSF4 и BLK возможно вносят вклад в SLE путем влияния на уровень экспрессии мРНК и белка ((Sigurdsson et al., Am J Hum Genet 76(3):528-37 (2005); Graham et al, Nat Genet 38(5):550-55 (2006); Graham et al., Proc. Natl. Acad Sci USA 104(16):6758-63 (2007); Cunninghame Graham et al., Nat Genet 40(1):83-89 (2008); Horn et al., N Engl J Med 358(9):900-9 (2008)). Для STAT4, KIAA1542, IRAK1, PXK и других генов, таких как BLK, еще не определены каузальные аллели, вызывающие SLE ((Remmers et al, N Engl J Med 357(10):977-86 (2007); Harley et al., Nat Genet 40(2):204-10 (2008); Hom et al., N Engl J Med 358(9):900-9 (2008); Sawalha et al., PLoS ONE 3(3):e1727 (2008)). Эти и другие генетические вариации, ассоциированные с волчанкой, также описаны в международной патентной заявке № PCT/US2008/064430 (международная патентная публикация № WO 2008/144761). Хотя вклад такой генетической вариабельности в различные аспекты риска и заболеваемости SLE, которые описаны на сегодняшний день, является важным, необходимо получить больше информации о вкладе генетической вариабельности, например, в значительную клиническую гетерогенность SLE.

Поэтому было бы предпочтительно иметь дополнительные способы молекулярной диагностики, которые можно использовать для объективной идентификации присутствия заболевания и/или его классификации у пациента, для определения патофизиологических аспектов волчанки, клинической активности, ответа на терапию, прогноза или риска развития волчанки. В дополнение, было бы предпочтительно иметь молекулярно-диагностические маркеры, ассоциированные с различными клиническими и/или патофизиологическими, и/или другими биологическими признаками заболевания. Таким образом, постоянно необходима идентификация новых рисков локусов и полиморфизмов, ассоциированных с риском волчанки или других аутоиммунных заболеваний. Такие ассоциации были бы очень полезны для идентификации волчанки у пациентов или для определения склонности к развитию заболевания. Такие ассоциации также были бы очень полезны для идентификации патофизиологических аспектов волчанки, клинической активности, ответа на терапию или прогноза. В дополнение, статистически и биологически значимую и воспроизводимую информацию относительно таких ассоциаций можно было бы использовать в качестве одного из составляющих при идентификации определенных субпопуляций пациентов, для которых бы ожидался значительный эффект от лечения конкретным терапевтическим средством, например, когда терапевтическое средство имеет, или в клинических исследованиях показано, что имеет, терапевтический эффект на такую определенную субпопуляцию пациентов с волчанкой.

Описанное в настоящем документе изобретение отвечает вышеуказанным требованиям, а также предусматривает другие эффекты.

Все, цитируемые в настоящем документе ссылки, включая патентные заявки и публикации, полностью включены путем ссылки для любых целей.

Краткое изложение сущности изобретения

Приведенные способы основаны, по меньшей мере частично, на открытии набора новых локусов, которые ассоциированы с SLE, и которые вносят вклад в риск возникновения заболевания (локусы риска SLE). В дополнение приведен набор аллелей, ассоциированных с данными локусами риска SLE. Также включена каузальная аллель в BLK-локусе, которая ассоциирована с биологическими эффектами, увеличивающими риск SLE. В дополнение приведены локусы риска, ассоциированные с другими аутоиммунными заболеваниями.

Один аспект относится к способу идентификации волчанки у субъекта, включающему детектирование в биологическом образце, полученном от субъекта, присутствия вариации в локусе риска SLE; в котором локусом риска SLE является BLK, в котором вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции однонуклеотидного полиморфизма (SNP), в котором SNP является rs922483 (SEQ ID NO:13), в котором вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, и в котором субъект предположительно страдает волчанкой. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Другой аспект относится к способу идентификации волчанки у пациента, включающему детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4; в котором вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4, и в котором субъект предположительно страдает волчанкой. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в десяти локусах, или по меньшей мере в 13 локусах или в 26 локусах. В одном варианте осуществления изобретения по меньшей мере один локус выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 4. В некоторых вариантах осуществления изобретения присутствие вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4 (причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4), детектируют в комбинации с присутствием вариации в BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Еще один аспект относится к способу идентификации волчанки у субъекта, включающему детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6, и в котором субъект предположительно страдает волчанкой. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 6. В некоторых вариантах осуществления изобретения присутствие вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6 (причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6), детектируют в комбинации с присутствием вариации BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Еще один аспект относится к способу идентификации волчанки у субъекта, включающему детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором вариация в каждом локусе встречается в нуклеотидной позиции, соответствующей позиции SNP для каждого локуса, указанного в таблице 4 и 6, и в котором субъект предположительно страдает волчанкой. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в семи локусах, или по меньшей мере в десяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус, указанный в таблице 4, выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10, а по меньшей мере один локус, указанный в таблице 6, выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе, указанном в таблице 4, и вариация по меньшей мере в одном локусе, указанном в таблице 6, включает SNP, указанные в таблицах 4 и 6, соответственно. В некоторых вариантах осуществления изобретения присутствие вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4 (причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4), и присутствие вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6 (причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6), детектируют в комбинации с присутствием вариации в BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Один аспект относится к способу прогнозирования ответной реакции субъекта с волчанкой на противоволчаночное терапевтическое средство, включающему определение, содержит ли субъект вариацию в локусе риска SLE; в котором локусом риска является BLK, в котором вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, в котором SNP является rs922483 (SEQ ID NO:13), в котором вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, в котором присутствие вариации в BLK-локусе риска SLE указывает на ответную реакцию субъекта на терапевтическое средство.

Другой аспект относится к способу прогнозирования ответной реакции субъекта с волчанкой на противоволчаночное терапевтическое средство, включающему определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4; в котором вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4, в котором присутствие вариации по меньшей мере в одном локусе указывает на ответную реакцию субъекта на терапевтическое средство. В некоторых вариантах осуществления изобретения субъект содержит вариацию по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в десяти локусах, или по меньшей мере в 13 локусах, или в 26 локусах. В одном варианте осуществления изобретения по меньшей мере один локус выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 4. В некоторых вариантах осуществления изобретения способ включает определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4, в комбинации с вариацией в BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, причем присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации в BLK-локусе риска SLE указывает на ответную реакцию субъекта на терапевтическое средство.

Еще один аспект относится к способу прогнозирования ответной реакции субъекта с волчанкой на противоволчаночное терапевтическое средство, включающеу определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6, в котором присутствие вариации по меньшей мере в одном локусе указывает на ответную реакцию субъекта на терапевтическое средство. В некоторых вариантах осуществления изобретения субъект содержит вариацию по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 6. В некоторых вариантах осуществления изобретения способ включает определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6 (причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6), в комбинации с вариацией в BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, причем присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, и присутствие вариации в BLK-локусе риска SLE указывает на ответную реакцию субъекта на терапевтическое средство.

Дополнительный аспект относится к способу прогнозирования ответной реакции субъекта с волчанкой на противоволчаночное терапевтическое средство, включающему определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4, и вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6, причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6; в котором присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, указывает на ответную реакцию субъекта на терапевтическое средство. В некоторых вариантах осуществления изобретения субъект содержит вариацию по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в семи локусах, или по меньшей мере в десяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус, указанный в таблице 4, выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10, а по меньшей мере один локус, указанный в таблице 6, выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе, указанном в таблице 4, и вариация по меньшей мере в одном локусе, указанном в таблице 6, включает SNP, указанные в таблицах 4 и 6, соответственно. В некоторых вариантах осуществления изобретения способ включает определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 4, и вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6, причем вариация по меньшей мере в одном локусе встречается в нуклеотидной позиции, соответствующей позиции SNP по меньшей мере для одного локуса, указанного в таблице 6, в комбинации с вариацией в BLK-локусе риска SLE, причем вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, причем присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, а также присутствие вариации в BLK-локусе риска SLE указывает на ответную реакцию субъекта на терапевтическое средство.

Еще один аспект относится к способу диагностики или прогнозирования волчанки у субъекта, включющему детектирование в биологическом образце, полученном от субъекта, присутствия вариации в локусе риска SLE; в котором локусом риска SLE является BLK, в котором вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, в котором SNP является rs922483 (SEQ ID NO:13), в котором вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один аспект относится к способу диагностики или прогнозирования волчанки у субъекта, включющему детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4; и присутствие вариации по меньшей мере в одном локусе является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в десяти локусах, или по меньшей мере в 13 локусах, или в 26 локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию в BLK-локусе, вариация по меньшей мере в одном локусе, указанном в таблице 4, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один дополнительный аспект относится к способу диагностики или прогнозирования волчанки у субъекта, включающий детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6; и присутствие вариации по меньшей мере в одном локусе является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6, и вариацию в BLK-локусе; вариация по меньшей мере в одном локусе, указанном в таблице 6, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один аспект относится к способу диагностики или прогнозирования волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанным в таблицах 4 и 6, соответственно; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в семи локусах, или по меньшей мере в десяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE, указанный в таблице 4, выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10, и по меньшей мере один локус риска SLE, указанный в таблице 6, выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию по меньшей мере в локусе риска SLE, указанном в таблице 6, и вариацию в BLK-локусе; вариация по меньшей мере в одном локусе, указанном в таблице 4, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, и вариация по меньшей мере в одном локусе, указанном в таблице 6, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Другой аспект относится к способу, помогающему диагностике или прогнозированию волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия вариации в локусе риска SLE; в котором локусом риска SLE является BLK, в котором вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, в котором SNP является rs922483 (SEQ ID NO:13), в котором вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один аспект относится к способу, помогающему диагностике или прогнозированию волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4; и присутствие вариации по меньшей мере в одном локусе является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в десяти локусах, или по меньшей мере в 13 локусах, или в 26 локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию в BLK-локусе; вариация по меньшей мере в одном локусе, указанном в таблице 4, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один дополнительный аспект относится к способу, помогающему диагностике или прогнозированию волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6; и присутствие вариации по меньшей мере в одном локусе является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6, и вариацию в BLK-локусе; вариация по меньшей мере в одном локусе, указанном в таблице 6, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Еще один дополнительный аспект относится к способу, помогающему диагностике или прогнозированию волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6; в котором: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 6; вариация по меньшей мере в одном локусе содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанным в таблицах 4 и 6, соответственно; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, является диагнозом или прогнозом волчанки у субъекта. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в семи локусах, или по меньшей мере в десяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE, указанный в таблице 4, выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10, и по меньшей мере один локус риска SLE, указанный в таблице 6, выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения способ включает детектирование присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и присутствия вариации по меньшей мере в одном локусе риска SLE, указанном в таблице 6, в комбинации с присутствием вариации в BLK-локусе риска SLE; причем: известно, что биологический образец содержит, или предположительно содержит нуклеиновую кислоту, содержащую вариацию по меньшей мере в одном локусе риска SLE, указанном в таблице 4, и вариацию по меньшей мере в локусе риска SLE, указанном в таблице 6, и вариацию в BLK-локусе; вариация по меньшей мере в одном локусе, указанном в таблице 4, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, и вариация по меньшей мере в одном локусе, указанном в таблице 6, содержит или расположена в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, и вариация в BLK-локусе встречается в нуклеотидной позиции, соответствующей позиции SNP, причем SNP является rs922483 (SEQ ID NO:13), причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека; и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 4, и присутствие вариации по меньшей мере в одном локусе, указанном в таблице 6, и присутствие вариации в BLK-локусе является диагнозом или прогнозом волчанки у субъекта.

Один аспект относится к способу лечения волчаночного состояния у субъекта, причем известно, что генетическая вариация присутствует в нуклеотидной позиции, соответствующей SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния.

Другой аспект относится к способу лечения волчаночного состояния у субъекта, причем известно, что у него присутствует генетическая вариация в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, по меньшей мере в одном локусе риска SLE, указанном в таблице 4, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10.

Другой аспект относится к способу лечения волчаночного состояния у субъекта, причем известно, что у него присутствует генетическая вариация в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, по меньшей мере в одном локусе риска SLE, указанном в таблице 6, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3.

Другой аспект относится к способу лечения волчаночного состояния у субъекта, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния у субъекта, который имеет генетическую вариацию в нуклеотидной позиции, соответствующей SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека.

Еще один аспект относится к способу лечения волчаночного состояния у субъекта, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния у субъекта, который имеет генетическую вариацию в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, по меньшей мере в одном локусе риска SLE, указанном в таблице 4. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIPl, PRDMl, JAZF1, UHRF1BP1 и IL10.

Еще один аспект относится к способу лечения волчаночного состояния у субъекта, причем способ включает введение субъекту терапевтического средства, эффективного для лечения состояния у субъекта, который имеет генетическую вариацию в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, по меньшей мере в одном локусе риска SLE, указанном в таблице 6. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3.

Еще один аспект относится к способу лечения субъекта, имеющего волчаночное состояние, причем способ включает введение субъекту терапевтического средства, которое эффективно для лечения указанного состояния, как было показано по меньшей мере в одном клиническом исследовании, в котором средство вводили по меньшей мере пяти людям, каждый из которых имел генетическую вариацию в нуклеотидной позиции, соответствующей SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локусом риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека.

Еще один аспект относится к способу лечения субъекта, имеющего волчаночное состояние, причем способ включает введение субъекту терапевтического средства, которое эффективно для лечения указанного состояния, как было показано по меньшей мере в одном клиническом исследовании, в котором средство вводили по меньшей мере пяти людям, каждый из которых имел генетическую вариацию в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, по меньшей мере в одном локусе риска SLE, указанном в таблице 4. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIPl, PRDMl, JAZF1, UHRF1BP1 и IL10.

Еще один аспект относится к способу лечения субъекта, имеющего волчаночное состояние, причем способ включает введение субъекту терапевтического средства, которое эффективно для лечения указанного заболевания, как было показано по меньшей мере в одном клиническом исследовании, в котором средство вводили по меньшей мере пяти людям, каждый из которых имел генетическую вариацию в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, по меньшей мере в одном локусе риска SLE, указанном в таблице 6. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3.

Другой аспект относится к способу, включающему изготовление терапевтического средства против волчанки, которое включает упаковку средства с инструкцией по применению средства у субъекта, который имеет или полагает, что имеет волчанку, или который имеет генетическую вариацию в позиции, соответствующей SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека.

Еще один аспект относится к способу, включающему изготовление терапевтического средства против волчанки, которое включает упаковку средства с инструкцией по применению средства у субъекта, который имеет или полагает, что имеет волчанку, или который имеет генетическую вариацию в позиции, соответствующей SNP, указанному в таблице 4, по меньшей мере в одном локусе риска SLE, указанном в таблице 4.

Еще один дополнительный аспект относится к способу, включающему изготовление терапевтического средства против волчанки, который включает упаковку средства с инструкцией по применению средства у субъекта, который имеет или полагает, что имеет волчанку, или который имеет генетическую вариацию в позиции, соответствующей SNP, указанному в таблице 6, по меньшей мере в одном локусе риска SLE, указанном в таблице 6.

Один аспект относится к способу отбора пациента, страдающего волчанкой, для лечения противоволчаночным терапевтическим средством, причем способ включает детектирование присутствия генетической вариации в нуклеотидной позиции, соответствующей SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Дополнительный аспект относится к способу отбора пациента, страдающего волчанкой, для лечения противоволчаночным терапевтическим средством, причем способ включает детектирование присутствия генетической вариации в нуклеотидной позиции, соответствующей SNP, указанному в таблице 4, по меньшей мере в одном локусе риска SLE, указанном в таблице 4. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или по меньшей мере в пяти локусах, или по меньшей мере в десяти локусах, или по меньшей мере в 13 локусах, или в 26 локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 4. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Дополнительный аспект относится к способу отбора пациента, страдающего волчанкой, для лечения противоволчаночным терапевтическим средством, причем способ включает детектирование присутствия генетической вариации в нуклеотидной позиции, соответствующей SNP, указанному в таблице 6, по меньшей мере в одном локусе риска SLE, указанном в таблице 6. В некоторых вариантах осуществления изобретения вариацию детектируют по меньшей мере в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из IFIH1, CFB, CLEC16A, IL12B и SH2B3. В одном варианте осуществления изобретения вариация по меньшей мере в одном локусе включает SNP, указанный в таблице 6. В одном варианте осуществления изобретения детектирование включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5'-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.

Другой аспект относится к способу оценки, имеет ли субъект риск развития волчанки, причем способ включает детектирование в биологическом образце, полученном от субъекта, присутствия генетического признака, указывающего на риск развития волчанки, причем указанный генетический признак включает набор по меньшей мере из трех SNP, причем каждый SNP встречается в локусе риска SLE, указанном в таблице 4 и/или таблице 6. В некоторых вариантах осуществления изобретения генетический признак включает набор по меньшей мере из четырех SNP, или по меньшей мере из пяти SNP, или по меньшей мере из семи SNP, или по меньшей мере из десяти SNP. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения генетический признак дополнительно включает SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека.

Дополнительный аспект относится к способу диагностики волчанки у субъекта, причем способ включает детектирование в биологическом образце, полученном от указанного субъекта, присутствия генетического признака, указывающего на волчанку, причем указанный генетический признак включает набор по меньшей мере из трех SNP, причем каждый SNP встречается в локусе риска SLE, указанном в таблице 4 и/или таблице 6. В некоторых вариантах осуществления изобретения генетический признак включает набор по меньшей мере из четырех SNP, или по меньшей мере из пяти SNP, или по меньшей мере из семи SNP, или по меньшей мере из десяти SNP, или по меньшей мере из 15 SNP, или по меньшей мере из 20 SNP, или по меньшей мере из 30 SNP. В одном варианте осуществления изобретения по меньшей мере один локус риска SLE выбран из TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B и SH2B3. В некоторых вариантах осуществления изобретения генетический признак дополнительно включает SNP в локусе риска SLE, причем SNP является rs922483 (SEQ ID NO:13), и локус риска SLE является BLK, причем вариация представляет собой тимин на участке 11389322 на хромосоме 8 человека.

Краткое описание чертежей

На фиг.1 показан общий план эксперимента для направленного репликационного исследования некоторых SNP с целью идентификации дополнительных локусов риска SLE, как описано в примере 1.

На фиг.2 показаны новые полногеномные достоверные ассоциации с SLE и идентификация новых локусов риска в TNIP1 (A), PRDM1 (B), JAZF1 (C), UHRFIBP1 (D) и IL10 (E), как описано в примере 1. (F) гистограмма Р-значений независимых SNP в репликационных образцах пациентов и здоровых людей (контроль), описанных в примере 1; ожидаемая плотность результатов при нулевом распределении указана пунктирной линией.

На фиг.3 показано процентное содержание вариантов, получивших потенциальный (P<1×10-5) и подтвержденный (P<5×10-8) статус в мета-анализе, стратифицированном по Р-значению в исходном GWAS, как описано в примере 1.

На фиг.4 показан блок неравновесия по сцеплению (показан в r2) в промоторной области BLK, как описано в примере 2. На фиг.4 «C>T-rs922483» раскрыт как SEQ ID NO:13.

На фиг.5 показаны результаты люциферазного репортерного анализа экспрессии генов промоторной области BLK, имеющей различные гаплотипы, как описано в примере 2. (A) SNP rs922483 C>T (SEQ ID NO:13) в клетках BJAB; (B) SNP rs922483 C>T (SEQ ID NO:13) в клетках Daudi; (C) SNP rs1382568 A>C/G>C в клетках BJAB; (D) SNP rs1382568 A>C/G>C в клетках Daudi; (E) SNP rs4840568 G>A в клетках BJAB; (F) SNP rs4840568 G>A в клетках Daudi; приведенные данные представляют среднее +/- стандартную ошибку среднего для анализов в трипликатах; столбцы с пятнистым рисунком показывают результаты для гаплотипа, указанного слева от графика; заштрихованный столбик: гаплотип риска 22-АСТ; белый столбик: безрисковый гаплотип 22-GAC; *p<0,05, **p<0,01, ***p<0,001, ns = не достоверно (t-тест). На фиг.5A-F «22 (GT)-повтор» раскрыт как SEQ ID NO:15. На фиг.5C-F «rs922483 C>T» также раскрыт как SEQ ID NO:13.

На фиг.6 показаны результаты люциферазного репортерного анализа экспрессии генов промоторной области BLK, имеющей либо 18 (GT)-повторов (SEQ ID NO:14), либо 22 (GT)-повторов (SEQ ID NO:15) и SNP rs1382568 A>C/G>C, в клетках Daudi, как описано в примере 2. Показанные данные представляют среднее +/- стандартную ошибку среднего для анализов в дупликатах; ns = не достоверно (t-тест). На фиг.6 «18 (GT)-повтор» раскрыт как SEQ ID NO:14, «22 (GT)-повтор» - как SEQ ID NO:15, и «rs922483 C>T» - как SEQ ID NO:13.

На фиг.7 показана последовательность SNP, rs922483 (SEQ ID NO:13), и расположение в SNP каузального аллеля для BLK-локуса, как описано в примере 2. Расположение каузального аллеля показано полужирными квадратными скобками; C/T-вариации указаны полужирным шрифтом.

Подробное описание изобретения

В осуществлении настоящего изобретения на практике будут использоваться, если не указано иное, общепринятые методики молекулярной биологии (включая рекомбинантные методики), микробиологии, клеточной биологии, биохимии и иммунологии, которые входят в компетенцию специалиста в данной области. Такие методики полностью описаны в литературе, такой как, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987, and periodic updates); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994). Кроме того, праймеры, олигонуклеотиды и полинуклеотиды, используемые в настоящем изобретении, можно создать, используя стандартные методики, известные в данной области.

Если не указано иное, то все научные и технические термины, используемые в настоящем изобретении, имеют общепринятые значения, известные специалисту в области, к которой принадлежит изобретение. Например, в Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994) и March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992) для специалиста приведено общее руководство по многим терминам, используемым в настоящей заявке.

Определения

Для интерпретации данной спецификации будут применяться следующие определения, и во всех подходящих случаях термины, используемые в единственном числе будут также включать множественное и, наоборот. Используемые в данном описании и прилагаемой формуле изобретения смысле формы единственного числа включают множественные объекты, если контекст ясно не диктует иное. Таким образом, например, ссылка на «белок» включает множество белков; ссылка на «клетку» включает смеси клеток и т.п. В случае, когда любое определение, указанное ниже, противоречит любому документу, включенному в настоящий документ путем ссылки, то определение, указанное ниже, будет иметь преимущественную силу.

Используемый в настоящем описании термин «волчанка» или «волчаночное состояние» представляет собой аутоиммунное заболевание или расстройство, в основном вызывающее выработку антител, поражающих соединительную ткань. Основной формой волчанки является системная волчанка, системная красная волчанка (SLE), включая кожную SLE и подострую кожную SLE, а также другие типы волчанки (включая нефрит, экстраренальные проявления, церебрит, детскую волчанку, «непочечную» волчанку, дискоидную волчанку и алопецию).

Используемые в настоящем документе взаимозаменяемо термины «полинуклеотид» или «нуклеиновая кислота» относятся к полимерам любой длины из нуклеотидов и включают ДНК и РНК. Нуклеотидами могут быть дезоксирибонуклеотиды, рибонуклеотиды, модифицированные нуклеотиды или основания и/или их аналоги, или любой субстрат, который может быть включен в полимер с помощью ДНК- или РНК-полимеразы. Полинуклеотид может содержать модифицированные нуклеотиды, такие как метилированные нуклеотиды и их аналоги. При наличии, модификацию нуклеотидной структуры можно осуществить до или после сборки полимера. Нуклеотидные последовательности могут прерываться ненуклеотидными компонентами. Полинуклеотид можно дополнительно модифицировать после синтеза, например, конъюгацией с метящим компонентом. Другие типы модификаций включают, например, «кэпы»; замену одного или нескольких природных нуклеотидов их аналогами; межнуклеотидные модификации, такие как, например, модификации с незаряженными связями (например, метилфосфонатной, фосфотриэфирной, фосфоамидатной, карбаматной и т.п.) и заряженными связями (например, фосфортиоатной, фосфордитиоатной и т.п.), модификации, содержащие присоединенные молекулы, такие как, например, белки (например, нуклеазы, токсины, антитела, сигнальные пептиды, поли-L-лизин, и т.п.), модификации с интеркалирующими агентами (например, акридином, псораленом и т.п.), модификации, содержащие хелатообразующие агенты (например, металлы, радиоактивные металлы, бор, металлы-окислители и т.п.), модификации, содержащие алкилирующие агенты, модификации, содержащие модифицированные связи (например, альфа-аномерные нуклеиновые кислоты и т.п.), а также немодифицированные формы полинуклеотида(ов). Кроме того, любые гидроксильные группы, обычно присутствующие в сахарах, могут быть замещены, например, фосфонатными группами и фосфатными группами, защищены стандартными защитными группами или активированы для образования дополнительных связей с дополнительными нуклеотидами, либо они могут быть конъюгированы с твердыми подложками. 5'- и 3'-концевые ОН-группы могут быть фосфорилированы или замещены аминами или органическими кэпирующими группами, состоящими из 1-20 атомов углерода. Также можно получить производные других гидроксильных групп со стандартными защитными группами. Полинуклеотиды могут также содержать аналоги сахаров, таких как рибоза или дезоксирибоза, известные специалистам, включая, например, 2'-О-метил-2'-О-аллилрибозу, 2'-фтор- или 2'-азидорибозу, карбоциклические аналоги сахаров, α-аномерные сахара, эпимерные сахара, такие как арабиноза, ксилозы или ликсозы, пиранозные сахара, фуранозные сахара, седогептулозу, ациклические аналоги и нуклеозидные аналоги с удаленными азотистыми основаниями, такие как метилрибозид. Одна или несколько фосфодиэфирных связей могут быть заменены альтернативными линкерными группами. Такими альтернативными линкерными группами являются, но не ограничиваются ими, варианты, в которых фосфат заменен на Р(О)S (тиоат), Р(S)S (дитиоат), (О)NR2 (амидат), Р(О)R, Р(О)OR', СО или СН2 (формацеталем), где каждый из R или R' независимо представляет собой Н или замещенный, или незамещенный алкил (С1-20), необязательно содержащий эфирную связь (--О--), арил, алкенил, циклоалкил, циклоалкенил или аралдил. Не все связи в полинуклеотиде должны быть идентичными. Предшествующее описание относится ко всем указанным здесь полинуклеотидам, включая РНК и ДНК.

Используемый в настоящем документе термин «олигонуклеотид» относится к коротким одноцепочечным полинуклеотидам, длина которых составляет по меньшей мере 7 нуклеотидов и меньше 250 нуклеотидов. Олигонуклеотиды могут быть синтетическими. Термины «олигонуклеотид» и «полинуклеотид» не являются взаимоисключающими. Вышеприведенное описание полинуклеотида может в равной степени и полностью относиться к олигонуклеотидам.

Термин "праймер" относится к одноцепочечному полинуклеотиду, способному гибридизоваться с нуклеиновой кислотой и позволять полимеризацию комплементарной нуклеиновой кислоты, обычно обеспечивая свободную 3'-OH группу.

Термин «генетическая вариация» или «нуклеотидная вариация» относится к изменению в нуклеотидной последовательности (например, вставке, делеции, инверсии или замене одного или нескольких нуклеотидов, таким как однонуклеотидный полиморфизм (SNP)) относительно референсной последовательности (например, повсеместно встречающейся последовательности, и/или последовательности дикого типа, и/или последовательности основного аллеля). Термин также охватывает соответствующее изменение в комплементарной нуклеотидной последовательности, если не указано иное. В одном варианте осуществления изобретения генетической вариацией является соматический полиморфизм. В одном варианте осуществления изобретения генетической вариацией является полиморфизм зародышевой линии.

Термин «однонуклеотидный полиморфизм» или «SNP» относится к позиции одного основания в ДНК, для которой в популяции существуют разные аллели или альтернативные нуклеотиды. Перед позицией SNP и за ней обычно расположены высоко консервативные последовательности аллеля (например, последовательности, которые варьируют менее чем у 1/100 или 1/1000 представителей популяций). Индивидуум может быть гомозиготным или гетерозиготным по аллелю в каждой SNP-позиции.

Термин «аминокислотная вариация» относится к изменению в аминокислотной последовательности (например, вставке, замене или делеции одной или нескольких аминокислот, таких как внутренняя делеция или укорочение с N- или C-конца) относительно референсной последовательности.

Термин «вариация относится либо к нуклеотидной вариации, либо к аминокислотной вариации.

Термин «генетическая вариация по нуклеотидной позиции, соответствующей позиции SNP», «нуклеотидная вариация по нуклеотидной позиции, соответствующей позиции SNP» и их грамматические варианты относятся к нуклеотидной вариации в полинуклеотидной последовательности по соответствующей относительной позиции ДНК, которую указанный SNP занимает в геноме. Термин также охватывает соответствующую вариацию в комплементарной нуклеотидной последовательности, если не указано иное.

Термин «матрица» или «микроматрица» относится к упорядоченному расположению гибридизуемых матричных элементов, предпочтительно, полинуклеотидных проб (например, олигонуклеотидов) на субстрате. Субстратом может быть твердый субстрат, такой как стеклянный слайд, или полутвердый субстрат, такой как нитроцеллюлозная мембрана.

Термин «амплификация» относится к способу получения одной или нескольких копий референсной нуклеотидной последовательности или комплементарной ей последовательности. Амплификация может быть линейной или экспоненциальной (например, ПЦР). «Копия» необязательно означает полную комплементарность или идентичность по последовательности относительно матричной последовательности. Например, копии могут включать аналоги нуклеотидов, такие как дезоксиинозин, преднамеренные изменения последовательности (такие как изменения последовательности, введенные с помощью праймера, содержащего последовательность, которая гибридизуется с матрицей, но не полностью ей комплементарна), и/или ошибки в последовательности, которые встречаются в ходе амплификации.

Термин «аллель-специфичный олигонуклеотид» относится к олигонуклеотиду, который гибридизуется с областью нуклеиновой кислоты-мишени, которая содержит нуклеотидную вариацию (обычно, замену). «Аллель-специфичная гибридизация» означает, что при гибридизации аллель-специфичного олигонуклеотида с его нуклеиновой кислотой-мишенью, нуклеотид в аллель-специфичном олигонуклеотиде специфично образует пару оснований с нуклеотидной вариацией. Аллель-специфичный олигонуклеотид, способный к аллель-специфичной гибридизации относительно конкретной нуклеотидной вариации, указывают как «специфичный для» данной вариации.

Термин «аллель-специфичный праймер» относится к аллель-специфичному олигонуклеотиду, который является праймером.

Термин «метод удлинения праймера» относится к методу анализа, в котором нуклеотиды добавляются к нуклеиновой кислоте, приводя к более длинной нуклеиновой кислоте или «удлиненному продукту», который детектируют прямым или непрямым способом. Нуклеотиды могут добавляться для удлинения 5'- или 3'-конца нуклеиновой кислоты.

Термин «метод аллель-специфичного включения нуклеотидов» относится к методу удлинения праймера, в котором праймер (а) гибридизуется с нуклеиновой кислотой-мишенью в области, которая расположена в 3'- или 5'-области относительно нуклеотидной вариации и (b) удлиняется с помощью полимеразы, таким образом включая в продукт удлинения нуклеотид, комплементарный нуклеотидной вариации.

Термин «метод аллель-специфичного удлинения праймера» относится к методу удлинения праймера, в котором аллель-специфичный праймер гибридизуется с нуклеиновой кислотой-мишенью и удлиняется.

Термин «метод аллель-специфичной гибридизации олигонуклеотидов» относится к методу анализа, в котором (а) аллель-специфичный олигонуклеотид гибридизуется с нуклеиновой кислотой-мишенью и (b) гибридизацию детектируют прямым или непрямым образом.

Термин «метод с использованием 5'-нуклеаз» относится к методу анализа, в котором гибридизация аллель-специфичного олигонуклеотида с нуклеиновой кислотой-мишенью позволяет нуклеолитическое расщепление гибридизованной пробы, приводя к детектируемому сигналу.

Термин «метод с использованием молекулярных маячков» относится к методу анализа, в котором гибридизация аллель-специфичного олигонуклеотида с нуклеиновой кислотой-мишенью приводит к уровню детектируемого сигнала выше уровня детектируемого сигнала, испускаемого свободным олигонуклеотидом.

Термин «метод лигирования олигонуклеотидов» относится к методу анализа, в котором аллель-специфичный олигонуклеотид и второй олигонуклеотид гибридизуются прилегая друг к другу на нуклеиновой кислоте-мишени и лигируются вместе (либо прямым, либо непрямым образом через промежуточные нуклеотиды), и продукт лигирования детектируют прямым или непрямым образом.

Термин «последовательность-мишень», «нуклеиновая кислота-мишень» или «нуклеотидная последовательность-мишень» относится обычно к представляющей интерес полинуклеотидной последовательности, в которой предположительно находится нуклеотидная вариация или известно, что находится нуклеотидная вариация, включая копии такой нуклеиновой кислоты-мишени, полученные амплификацией.

Термин «детекция» включает любое средство детекции, включая прямую и непрямую детекцию.

Термин «локус риска SLE» и «подтвержденный локус риска SLE» относятся к любому одному из локусов, указанных в таблице 4 и таблице 6, и BLK-локусу.

Термин «аллель риска SLE» или «подтвержденный аллель риска SLE» относится к вариации, встречающейся в локусе риска SLE. Такие вариации включают, но не ограничены этим, однонуклеотидные полиморфизмы, вставки и делеции. Некоторые примеры аллелей риска SLE указаны в таблице 4 и в таблице 6.

В настоящем документе субъект «с риском» развития волчанки может иметь или нет детектируемое заболевание или симптомы заболевания, может иметь или нет проявления детектируемого заболевания или симптомов заболевания перед способами лечения, описанными в настоящем документе. «С риском» указывает на наличие у субъекта одного или нескольких факторов, которые представляют собой измеряемые параметры, коррелирующие с развитием волчанки, описанные в настоящем документе и известные в данной области. Для субъекта, имеющего один или несколько данных факторов риска, более высока вероятность развития волчанки относительно субъекта, не имеющего один или несколько данных факторов риска.

Термин «диагноз» используется в настоящем документе для упоминания идентификации или классификации молекулярного или патологического состояния, заболевания или болезненного состояния. Например, «диагноз» может относиться к идентификации конкретного типа волчаночного состояния, например, SLE. «Диагноз» может также относиться к классификации конкретного подтипа волчанки, например, по затронутым ткани/органу (например, волчаночному нефриту), по молекулярным признакам (например, к субпопуляции пациентов, отличающейся генетической вариацией(ями) в конкретном гене или конкретной области нуклеиновой кислоты).

Термин «помогающий диагностике» используется в настоящем документе для упоминания способов, которые помогают при клиническом определении присутствия или природы конкретного типа симптома или состояния волчанки. Например, способ, помогающий диагностике волчанки, может включать измерение присутствия или отсутствия одного или нескольких локусов риска SLE или аллелей риска SLE в биологическом образце от индивидуума.

Термин «прогноз» используют в настоящем описании для упоминания предсказания вероятности присущих аутоиммунному заболеванию симптомов, включая, например, рецидивы, обострения и устойчивость к лекарственным соединениям, для аутоиммунного заболевания, такого как волчанка. Термин «предсказание» используется в настоящем документе для указания вероятности, что пациент будет отвечать либо положительно, либо отрицательно, на лекарственное соединение или набор соединений.

Используемый в настоящем документе термин «лечение» относится к клиническому вмешательству для изменения естественного пути развития индивидуума или клетки, подвергающихся лечению, и может проводиться до или в течение курса клинической патологии (лабораторной диагностики). Желательные эффекты лечения включают предупреждение возникновения или рецидива заболевания, или его состояния или симптома, облегчение состояния или симптома заболевания, уменьшение любых прямых или непрямых патологических последствий заболевания, снижение скорости развития заболевания, улучшение или смягчения состояния болезни и достижение ремиссии или лучшего прогноза. В некоторых вариантах осуществления изобретения способы и композиции по изобретению применяются при попытках задержать развитие заболевания или расстройства.

«Эффективное количество» относится к количеству, эффективному в необходимых дозировках и в течение необходимых периодов времени для достижения желаемого терапевтического или профилактического результата. «Терапевтически эффективное количество» терапевтического средства может варьировать в соответствии с факторами, такими как состояние заболевания, возраст, пол и вес индивидуума, и способности антитела вызывать желаемый эффект у индивидуума. Терапевтически эффективное количество также представляет собой количество, при котором терапевтически благоприятные эффекты перевешивают любые токсические или неблагоприятные эффекты терапевтического средства. «Профилактически эффективное количество» относится к количеству, эффективному в необходимых дозировках и в течение необходимых периодов времени для достижения желаемого профилактического эффекта. Обычно, но необязательно, поскольку профилактические дозировки используют у субъектов до начала заболевания или на его ранних стадиях, то профилактически эффективное количество будет меньше терапевтически эффективного количества.

«Индивидуум», «субъект» или «пациент» является позвоночным. В некоторых вариантах осуществления изобретения позвоночным является млекопитающее. Млекопитающие включают, но не ограничены этим, приматов (включая человекообразных и нечеловекообразных приматов) и грызунов (например, мышей и крыс). В некоторых вариантах осуществления изобретения млекопитающим является человек.

«Субпопуляция пациентов» и грамматические вариации этого выражения, используемые в настоящем документе, относятся к подгруппе пациентов, отличающейся тем, что они имеют одну или несколько отличительных измеряемых и/или идентифицируемых характеристик, которые отличают подгруппу пациентов от других в более широкой категории заболевания, к которой она принадлежит. Такие характеристики включают подкатегории заболевания (например, SLE, волчаночный нефрит), пол, образ жизни, историю болезни, затронутые органы/ткани, историю лечения и т.п.

Выражение «контрольный субъект» относится к здоровому субъекту, у которого не была диагностирована волчанка или волчаночное состояние, и который не страдает от какого-либо признака или симптома, ассоциированных с волчанкой или волчаночным состоянием.

Используемый в настоящем документе термин «образец» относится к композиции, которая получена от исследуемого субъекта и содержит клеточный и/или другой молекулярный материал, подлежащий характеристике и/или идентификации, например, на основе из физических, биохимических, химических и/или физиологических характеристик. Например, фразы «биологический образец» или «образец заболевания» и их вариации относятся к любому образцу, полученному от исследуемого субъекта, который, как ожидают, или как известно, содержит клеточный и/или молекулярный материал, подлежащий характеристике.

Под «образцом ткани или клеток» понимается набор аналогичных клеток, полученных из ткани субъекта или пациента. Источником образца ткани или клеток может быть солидная ткань, например, из свежего, замороженного и/или законсервированного образца ткани и/или органа, или биопсии или аспирата; кровь или любые компоненты крови; жидкости тела, такие как спинномозговая жидкость, амниотическая жидкость, перитонеальная жидкость или интерстициальная жидкость; клетки, полученные на любой стадии внутриутробного или постнатального развития субъекта. Образцом ткани также могут быть первичные или культивированные клетки или клеточные линии. Необязательно, образец ткани или клеток получают из больной ткани/органа. Образец ткани может содержать соединения, которые естественно не смешаны с тканью в природе, такие как консерванты, антикоагулянты, буферы, фиксирующие агенты, питательные добавки, антибиотики и т.п. Используемые в настоящем изобретении термины «референсный образец», «референсная клетка», «референсная ткань», «контрольный образец», «контрольная клетка» или «контрольная ткань» относятся к образцу, клетке или ткани, полученным из источника, который, как известно или предположительно не затронут заболеванием или патологическим состоянием, для идентификации которого используют способ или композицию по изобретению. В одном варианте осуществления изобретения референсный образец, референсная клетка, референсная ткань, контрольный образец, контрольная клетка или контрольная ткань получены из здоровой части тела того же субъекта или пациента, у которого идентифицируют заболевание или патологическое состояние, используя композицию или способ по изобретению. В одном варианте осуществления изобретения референсный образец, референсная клетка, референсная ткань, контрольный образец, контрольная клетка или контрольная ткань получены из здоровой части тела индивидуума, не являющегося субъектом или пациентом, у которого идентифицируют заболевание или патологическое состояние, используя композицию или способ по изобретению.

В контексте настоящего документа «срез» образца ткани означает отдельную часть или кусочек образца ткани, например, тонкий слой ткани или клеток, срезанный с образца ткани. Следует понимать, что можно взять множество срезов образцов ткани и подвергнуть их анализу по настоящему изобретению, причем следует понимать, что настоящее изобретение включает способ, посредством которого один срез образца ткани анализируют как на морфологическом, так и на молекулярном уровнях, или анализируют в отношении как белка, так и нуклеиновой кислоты.

Под «коррелировать» или «корреляцией» понимают сравнение с использованием любого способа выхода и/или результатов первого анализа или протокола с выходом и/или результатами второго анализа или протокола. Например, можно использовать результаты первого анализа или протокола при выполнении второго протокола и/или можно использовать результаты первого анализа или протокола, чтобы определить, следует ли проводить второй анализ или протокол. В отношении варианта осуществления анализа или протокола экспрессии генов, можно использовать результаты анализа или протокола экспрессии генов для того чтобы определить, следует ли проводить конкретный лечебный режим.

Используемое в настоящем документе слово «метка» относится к соединению или композиции, конъюгированным или слитым прямо или непрямо с реагентом, таким как проба нуклеиновой кислоты или антитело, и способствуют детекции реагента, с которым они конъюгированы или слиты. Метка может быть детектируемой сама по себе (например, радиоизотопные метки или флуоресцентные метки) или, в случае ферментативной метки, может катализировать химическое изменение детектируемых субстратного соединения или композиции.

«Лекарственным препаратом» является действующее лекарственное соединение для лечения заболевания, расстройства и/или патологического состояния. В одном варианте осуществления изобретения, заболеванием, расстройством и/или состоянием является волчанка или ее симптомы или побочные эффекты.

Термин «повышенная резистентность» к конкретному терапевтическому средству или варианту лечения при использовании в контексте изобретения означает сниженный ответ на стандартную дозу лекарственного соединения или на стандартный протокол лечения.

Термин «сниженная чувствительность» к конкретному терапевтическому средству или варианту лечения при использовании в контексте изобретения означает сниженный ответ на стандартную дозу лекарственного соединения или на стандартный протокол лечения, причем сниженный ответ можно скомпенсировать (по меньшей мере частично) путем увеличения дозы средства или интенсивности лечения.

«Прогнозирование ответа» субъекта и его вариации можно оценить, используя любую конечную точку, указывающую на эффект для пациента, включая, без ограничения, (1) ингибирование (до некоторой степени) развития заболевания, включая замедление или полную остановку; (2) снижение числа приступов и/или симптомов заболевания; (3) уменьшение размера поражений; (4) ингибирование (то есть снижение, замедление или полную остановку) инфильтрации пораженных клеток в прилегающие периферические органы и/или ткани; (5) ингибирование (то есть снижение, замедление или полную остановку) распространения заболевания; (6) снижение аутоиммунного ответа, которое может приводить, но не обязательно, к уменьшению или удалению болезненных поражений; (7) ослабление, до некоторой степени, одного или нескольких симптомов, ассоциированных с расстройством; (8) увеличение длительности периода здорового состояния после лечения; и/или (9) снижение смертности на определенный момент времени после лечения.

«Противоволчаночное терапевтическое средство», «терапевтическое средство, эффективное для лечения волчанки» и их грамматические вариации, используемые в настоящем документе, относятся к средству, эффективное количество которого, как известно, клинически показано или ожидается клиницистами, будет обеспечивать терапевтический эффект у субъекта, имеющего волчанку. В одном варианте осуществления изобретения фраза включает любое средство, продаваемое изготовителем, или в ином случае, используемое лицензированными клиницистами, в качестве клинически принятого средства, эффективное количество которого, как ожидается, будет обеспечивать терапевтический эффект у субъекта, имеющего волчанку. В одном варианте осуществления изобретения противоволчаночное терапевтическое средство включает нестероидное противовоспалительное средство (NSAID), которое включает ацетилсалициловую кислоту (например, аспирин), ибупрофен (Мотрин), напроксен (Напросин), индометацин (Индоцин), набуметон (Релафен), толметин (Толектин) и любые другие варианты, которые содержат терапевтически эквивалентные действующие ингредиенты и их составы. В одном варианте осуществления изобретения противоволчаночное терапевтическое средство включает ацетаминофен (например, Тайленол), кортикостероиды или противомалярийные средства (например, хлорокин, гидроксихлорокин). В одном варианте осуществления изобретения противоволчаночное терапевтическое средство содержит иммуномодулирующее лекарственное соединение (например, азатиоприн, циклофосфамид, метотрексат, циклоспорин). В одном варианте осуществления настоящего изобретения противоволчаночным терапевтическим средством является анти-В-клеточный агент (например, анти-CD20 (например, ритуксимаб), анти-CD22), анти-цитокиновый агент (например, анти-фактор некроза опухолей альфа, анти-рецептор интерлейкина 1 (например, анакинра), анти-интерлейкин 10, анти-рецептор интерлейкина 6, анти-интерферон альфа, анти-стимулятор В-лимфоцитов), или ингибитор костимуляции (например, анти-CD154, CTLA4-Ig (например, абатацепт)), модулятор В-клеточной анергии (например, LJP 394 (например, абетимус)). В одном варианте осуществления изобретения противоволчаночное терапевтическое средство включает гормональное лечение (например, DHEA) и анти-гормональную терапию (например, анти-пролактиновый агент бромокриптин). В одном варианте осуществления настоящего изобретения противоволчаночным терапевтическим средством является средство, которое обеспечивает иммуноадсорбцию, представляет собой фактор, ингибирующий комплемент (например, анти-С5а), Т-клеточную вакцинацию, трансфекцию клеток зета-цепью Т-клеточного рецептора или методы лечения с использованием пептидов (например, эдратида, мишенью которого является анти-ДНК идиотипы).

Используемые в настоящем изобретении терапевтическое средство, «одобренное для продажи» или «одобренное в качестве терапевтического средства» или грамматические варианты этих фраз относятся к средству (например, в форме состава лекарственного соединения, лекарственного препарата), который одобрен, лицензирован, зарегистрирован или разрешен соответствующей государственной структурой (например, федеральным, областным или местным регулирующим агентством, департаментом, бюро) для продажи коммерческой структурой и/или через коммерческую структуру, и/или от ее лица (например, направленной на получение прибыли структуры) для лечения конкретного расстройства (например, волчанки) или субпопуляции пациентов (например, пациентов с волчаночным нефритом, пациентов определенной национальности, пола, образа жизни, профиля риска заболевания и т.п.). Соответствующая государственная структура включает, например, Управление США по надзору за качеством пищевых продуктов и лекарственных средств (FDA), Европейское агентство по оценке лекарственных средств (EMEA) и их эквиваленты.

«Антитела» (Ab) и «иммуноглобулины» (Ig) относятся к гликопротеинам, обладающим аналогичными структурными характеристиками. Тогда как антитела проявляют специфичность связывания с конкретным антигеном, иммуноглобулины включают антитела и другие антителоподобные молекулы, у которых обычно отсутствует антигенная специфичность. Полипептиды последнего типа, например, продуцируются на низком уровне лимфатической системой и на повышенном уровне миеломами.

Термины «антитело» и «иммуноглобулин» используются в настоящем документе в самом широком смысле и включают моноклональные антитела (например, полноразмерные или интактные моноклональные антитела), поликлональные антитела, моновалентные антитела, поливалентные антитела, полиспецифичные антитела (например, биспецифичные антитела, при условии, что они проявляют желаемую биологическую активность) и могут также включать некоторые фрагменты антител (описанные более подробно в настоящем документе). Антитело может быть химерным, антителом человека, гуманизированным и/или аффинно зрелым.

Термины «полноразмерное антитело», «интактное антитело» и «целое антитело» используются в настоящем документе взаимозаменяемо для обозначения антитела в его по существу интактной форме, а не фрагментов антител, определение которых приведено ниже. Термины, в частности, относятся к антителу с тяжелыми цепями, содержащими Fc-область.

«Фрагменты антитела» включают участок интактного антитела, предпочтительно содержащий его антиген-связывающую область. Примеры фрагментов антитела включают Fab-, Fab'-, F(ab')2- и Fv-фрагменты, диантитела, линейные антитела, одноцепочечные молекулы антитела, и полиспецифичные антитела, образуемые фрагментами антител.

Расщепление антител папаином приводит к образованию двух антиген-связывающих фрагментов, названных «Fab»-фрагментами, каждый с одним антиген-связывающим участком, и оставшемуся «Fc»-фрагменту, чье название отражает его способность легко кристаллизоваться. Обработка пепсином дает F(ab')2-фрагмент, который имеет два антиген-связывающих участка и все еще способен перекрестно связывать антиген.

«Fv» представляет собой минимальный фрагмент антитела, который содержит полный антиген-связывающий участок. В одном варианте осуществления, двухцепочечные Fv-молекулы состоят из димера из вариабельных доменов одной тяжелой и одной легкой цепи в устойчивой нековалентной связи. В совокупности шесть CDR из Fv придают антиген-связывающую специфичность антителу. Однако даже один вариабельный домен (или половина Fv, содержащая только три CDR, специфичных к антигену) обладает способностью распознавать и связывать антиген, хотя и с более низкой аффинностью относительно полного участка связывания.

Fab-фрагмент содержит вариабельные домены тяжелой и легкой цепей и также содержит константный домен легкой цепи и первый константный домен (CH1) тяжелой цепи. Fab'-фрагменты отличаются от Fab-фрагментов добавлением нескольких остатков на карбоксильном конце домена тяжелой цепи CH1, включая один или несколько цистеинов из шарнирной области антитела. Fab'-SH в настоящем документе означает Fab', в котором цистеиновые остатки константных доменов несут свободную тиольную группу. F(ab')2-фрагменты антитела первоначально продуцировались как пары Fab'-фрагментов, которые имеют шарнирные цистеины между ними. Также известны другие химические способы соединения фрагментов антител.

Используемый в настоящем документе термин «моноклональное антитело» относится к антителу, полученному из популяции по существу гомогенных антител, то есть содержащиеся в популяции индивидуальные антитела являются идентичными за исключением возможных мутаций, например, природных мутаций, которые могут присутствовать в минорных количествах. Таким образом, определение «моноклональное» указывает на характер антитела, которое не является смесью различных антител. В некоторых вариантах осуществления, такое моноклональное антитело обычно включает антитело, содержащее полипептидную последовательность, которая связывает мишень, причем связывающая мишень полипептидная последовательность была получена способом, включающим отбор полипептидной последовательности, связывающей одну мишень, из множества полипептидных последовательностей. Например, способ отбора может представлять собой отбор уникального клона из множества клонов, такого как пул гибридомных клонов, фаговых клонов или клонов рекомбинантной ДНК. Следует понимать, что отобранную последовательность, связывающую мишень, можно дополнительно изменить, например, для повышения аффинности к мишени, можно гуманизировать последовательность, связывающую мишень, улучшить ее продукцию в культуре клеток, снизить ее иммуногенность in vivo, создать полиспецифичное антитело и т.п, и что антитело, содержащее измененную последовательность, связывающую мишень, также является моноклональным антителом по данному изобретению. В отличие от препаратов поликлональных антител, которые обычно включают разные антитела, направленные против разных детерминант (эпитопов), каждое моноклональное антитело препарата моноклональных антител направлено против единственной детерминанты на антигене. В дополнение к своей специфичности, препараты моноклональных антител предпочтительны тем, что они обычно не загрязнены другими иммуноглобулинами.

Определение «моноклональное» указывает на характер антитела, как полученного по существу из гомогенной популяции антител, и его не следует истолковывать так требование получения антитела каким-либо конкретным способом. Например, моноклональные антитела для использования по настоящему изобретению можно изготовить различными методиками, включая, например, гибридомный способ (например, Kohler et al., Nature, 256:495 (1975); Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981)), способы рекомбинантных ДНК (см., например, патент США № 4816567), методики фагового дисплея (см., например, Clackson et al., Nature, 352: 624-628 (1991); Marks et al., J. Mol. Biol. 222:581-597 (1992); Sidhu et al., J. Mol. Biol. 338(2):299-310 (2004); Lee et al., J. Mol. Biol. 340(5):1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34):12467-12472 (2004); and Lee et al., J. Immunol. Methods 284(1-2):119-132(2004), и методики для получения антител человека и антител, подобных антителам человека, в животных, которые имеют части или все иммуноглобулиновые локусы человека или гены, кодирующие последовательности иммуноглобулинов человека (см., например, WO 98/24893; WO 96/34096; WO 96/33735; WO 91/10741; Jakobovits et al., Proc. Natl. Acad. Sci. USA 90:2551 (1993); Jakobovits et al., Nature 362:255-258 (1993); Bruggemann et al., Year in Immunol. 7:33 (1993); патенты США №№ 5545807; 5545806; 5569825; 5625126; 5633425; 5661016; Marks et al., Bio. Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-813 (1994); Fishwild et al., Nature Biotechnol. 14:845-851 (1996); Neuberger, Nature Biotechnol. 14:826 (1996) и Lonberg and Huszar, Intern. Rev. Immunol. 13:65-93 (1995)).

Моноклональные антитела в настоящем документе в особенности включают «химерные» антитела (иммуноглобулины), в которых часть тяжелой и/или легкой цепи идентична или гомологична соответствующим последовательностям в антителах, полученных из определенных биологических видов или принадлежащих к определенному классу или подклассу антител, в то время как остаток цепи (цепей) идентичен или гомологичен соответствующим последовательностям в антителах, полученных из других биологических видов или принадлежащих другому классу или подклассу антител, а также включают фрагменты таких антител, при условии, что они проявляют желаемую биологическую активность (патент США № 4816567; и Morrison et al., Proc. Natl. Acad. Sci. USA 81:6855-9855 (1984)).

«Гуманизированными» формами антител других биологических видов кроме человека (например, мышиных) являются химерные антитела, которые содержат минимальную последовательность, полученную из иммуноглобулина другого биологического вида кроме человека. В одном варианте осуществления изобретения гуманизированное антитело являются иммуноглобулином человека (реципиентным антителом), в котором остатки гипервариабельной области реципиента замещены остатками гипервариабельной области антитела другого биологического вида кроме человека (донорного антитела), такого как мышь, крыса, кролик или нечеловекообразный примат, имеющими желаемую специфичность, аффинность и связывающую способность. В некоторых случаях, аминокислотные остатки из каркасной области (FR) Fv-фрагмента иммуноглобулина человека замещены соответствующими остатками иммуноглобулина другого биологического вида кроме человека. Кроме того, гуманизированные антитела могут содержать остатки, которые не найдены ни в реципиентном антителе, ни в донорном антителе. Эти модификации можно провести для дополнительного улучшения функционирования антитела. В общем, гуманизированное антитело будет содержать по существу все по меньшей мере из одного, и обычно двух, вариабельных доменов, в которых все или по существу все гипервариабельные петли соответствуют петлям иммуноглобулина другого биологического вида кроме человека, и все или по существу все FR-области являются FR-областями из последовательности иммуноглобулина человека. Гуманизированное антитело необязательно также будет содержать по меньшей мере часть константной области иммуноглобулина (Fc), обычно, константной области иммуноглобулина человека. Дополнительные подробности см. в Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); и Presta, Curr. Op. Struct. Biol. 2:593-596 (1992). См. также обзорные статьи и цитируемые в них ссылки: Vaswani and Hamilton, Ann. Allergy, Asthma&Immunol. 1:105-115 (1998); Harris, Biochem. Soc. Transactions 23:1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994).

«Антитело человека» представляет собой антитело, которое содержит аминокислотную последовательность, соответствующую последовательности антитела, полученного от человека, и/или была получена с использованием методик для получения антител человека, раскрытых в настоящем документе. Такие методики включают скрининг полученных от человека комбинаторных библиотек, таких как библиотеки фагового дисплея (см., например, Marks et al., J. Mol. Biol., 222:581-597 (1991) и Hoogenboom et al., Nucl. Acids Res., 19:4133-4137 (1991)); использование клеточный линий миеломы человека и гетеромиеломы мыши и человека для продукции моноклональных антител человека (см., например, Kozbor J. Immunol, 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.55-93 (Marcel Dekker, Inc., New York, 1987); и Boerner et al., J. Immunol., 147:86 (1991)); и получение моноклональных антител в трансгенных животных (например, мышах), способных продуцировать полный репертуар антител человека в отсутствие продукции эндогенных иммуноглобулинов (см., например, Jakobovits et al., Proc. Natl. Acad. Sci USA, 90: 2551 (1993); Jakobovits et al., Nature, 362:255 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993)). Это определение антитела человека специально исключает гуманизированное антитело, содержащее антиген-связывающие остатки из антитела животного.

«Аффинно зрелое» антитело представляет собой антитело с одним или несколькими изменениями в одном или более из CDR, которые приводят к увеличению аффинности антитела к антигену по сравнению с родительским антителом, которое не несет таких изменений. В одном варианте осуществления аффинно зрелое антитело обладает наномолярной или даже пикомолярной аффинностью к антигену-мишени. Аффинно зрелые антитела можно получить способами, известными в данной области. В Marks et al. Bio/Technology 10:779-783 (1992) описано созревание аффинности путем перетасовки VH- и VL-доменов. Неспецифический мутагенез HVR и/или каркасных остатков описывается в: Barbas et al. Proc Nat. Acad. Sci. USA 91:3809-3813 (1994); Schier et al. Gene 169:147-155 (1995); Yelton et al. J. Immunol. 155:1994-2004 (1995); Jackson et al., J. Immunol. 154(7):3310-9 (1995); и Hawkins et al., J. Mol. Biol. 226:889-896 (1992).

«Блокирующее антитело» или «антитело-антагонист» представляет собой антитело, которое ингибирует или снижает биологическую активность антигена, с которым оно связывается. Некоторые блокирующие антитела или антитела-антагонисты частично или полностью подавляют биологическую активность антигена.

«Низкомолекулярное соединение» или «низкомолекулярное органическое соединение» определяют в настоящем документе как органическую молекулу с молекулярным весом ниже примерно 500 дальтон.

При использовании в настоящем документе слово «метка» относится к детектируемым соединению или композиции. Метка может быть детектируемой сама по себе (например, радиоизотопные метки или флуоресцентные метки) или, в случае ферментативной метки, может катализировать химическое изменение субстратного соединения или композиции, которое приводит к детектируемому продукту. Радионуклиды, которые могут служить в качестве детектируемых меток, включают, например, I-131, I-123, I-125, Y-90, Re-188, Re-186, At-211, Cu-67, Bi-212 и Pd-109.

«Выделенной» биологической молекулой, такой как нуклеиновая кислота, полипептид или антитело, является молекула, идентифицированная и отделенная, и/или выделенная по меньшей мере из одного компонента своего природного окружения.

Определение «примерно» относительно значения или параметра в настоящем документе включает (и описывает) варианты, которые направлены на такое значение или параметр per se. Например, описание, относящееся к «примерно Х» включает описание «Х».

Общие методики

В настоящем документе приведены вариации нуклеотидов, ассоциированные с волчанкой. Эти вариации обеспечивают биомаркеры волчанки и/или обеспечивают предрасположенность или вносят вклад в развитие, существование и/или прогресс волчанки. Соответственно, изобретение, описанное в настоящем документе пригодно для различных вариантов, например, в способах и композициях, связанных с диагностикой и терапией волчанки.

В некоторых вариантах осуществления изобретения способы относятся к прогнозу, то есть предсказанию вероятности симптомов заболеваний, присущих аутоиммунному расстройству, включая, например, рецидивы, обострения и устойчивость к лекарственным соединениям аутоиммунного заболевания, такого как волчанка. В одном варианте осуществления изобретения предсказание относится к степени выраженности этих ответов. В одном варианте осуществления изобретения предсказание относится возможности и/или вероятности того, что пациент выживет или у него наступит улучшение после лечения, например, лечения конкретным терапевтическим средством, и в течение некоторого периода времени без рецидивов заболевания. Способы прогнозирования по изобретению можно использовать в клинике для принятия решений относительно лечения путем выбора наиболее подходящих вариантов лечения для любого конкретного пациента. Способы прогнозирования по настоящему изобретению представляют собой ценные инструменты для предсказания вероятности положительного ответа пациента на схему лечения, такую как данная терапевтическая схема, включая, например введение данного терапевтического средства или комбинации, хирургическое вмешательство, лечение стероидами и т.п., или насколько вероятна длительная выживаемость пациента после терапевтической схемы. Диагноз SLE может соответствовать текущим критериям Американского колледжа ревматологии (ACR). Активное заболевание можно определить с помощью одного критерия, «А», группы по изучению волчанки (BILAG) или двух «В» критериев BILAG. Некоторыми признаками, симптомами или другими показателями, используемыми для диагностики SLE, основанными на Tan et al. "The Revised Criteria for the Classification of SLE" Arth Rheum 25 (1982), могут быть высыпания на скулах и щеках, дискоидные высыпания или красные, несколько приподнятые пятна, фотосенсибилизация, такая как реакция на солнечный свет, приводящая к возникновению или увеличению высыпаний на коже, эрозии на слизистой оболочке носоглотки, такие как эрозии на слизистой полости носа или рта (обычно безболезненные), артрит, такой как неэрозивный артрит, затрагивающий два или несколько периферических суставов (артрит, при котором кости вокруг суставов не разрушаются), серозит, плеврит или перикардит, почечные нарушения, такие как избыточное содержание белка в моче (выше 0,5 г/день или 3+ на тестовых полосках) и/или клеточные осадки (патологические элементы в моче, и/или лейкоциты, и/или почечные тубулярные клетки), неврологические признаки, симптомы или другие показатели, припадки (конвульсии), и/или психоз в отсутствие лекарственных соединений или метаболических нарушений, которые, как известно, вызывают подобные эффекты, и гематологические признаки, симптомы или другие показатели, такие как гемолитическая анемия или лейкопения (содержание лейкоцитов ниже 4000 клеток на мл), или лимфопения (меньше 1500 лимфоцитов на миллилитр), или тромбоцитопения (меньше 100000 тромбоцитов на миллилитр). Лейкопения и лимфопения обычно должны детектироваться два или несколько раз. Тромбоцитопения обычно должна детектироваться в отсутствие вызывающих ее лекарственных соединений. Изобретение не ограничено данными признаками, симптомами или другими показателями волчанки.

Детекция генетических вариаций

Нуклеиновой кислотой по любому из вышеуказанных способов может быть геномная ДНК, РНК, транскрибированная на геномной ДНК; или кДНК, полученная из РНК. Нуклеиновая кислота может быть получена из позвоночного, например, млекопитающего. Указывают, что нуклеиновая кислота «получена из» конкретного источника, если она получена напрямую из данного источника, или если она является копией нуклеиновой кислоты, найденной в данном источнике.

Нуклеиновая кислота включает копии нуклеиновой кислоты, например, копии, которые являются результатом амплификации. В некоторых случаях амплификация может быть желательна, например, для получения определенного количества материала для детекции вариаций. Для того чтобы определить присутствует ли вариация в ампликоне, на ампликонах можно провести способ детекции вариаций, такой как, описанные ниже способы.

Вариации можно детектировать определенными способами, известными опытным специалистам в данной области. Такие способы включают, но не ограничены этим, ДНК-секвенирование; методы удлинения праймеров, включая методы аллель-специфичного включения нуклеотидов и методы аллель-специфичного удлинения праймеров (например, аллель-специфичная ПЦР, аллель-специфичная лигазная цепная реакция (LCR) и gap-LCR (модифицированная LCR для снижения неспецифичности)); методы аллель-специфичной гибридизации олигонуклеотидов (например, методы лигирования олигонуклеотидов); методы защиты от расщепления, в которых защиту от расщепляющих агентов используют для детекции несовпадающих оснований в дуплексах нуклеиновых кислот; анализ связывания белка MutS; электрофоретический анализ, в котором сравнивают подвижности варианта и дикого типа молекул нуклеиновых кислот; электрофорез в денатурирующем градиентном геле (DGGE, как, например, в Myers et al. (1985) Nature 313:495); анализ расщепления РНКазой по несовпадающим парам оснований; анализ химического или ферментативного расщепления гетеродуплексной ДНК; масс-спектрометрию (например, MALDI-TOF); анализ генетических битов (GBA); анализы с использованием 5'-нуклеаз (например, TaqMan®); и методы с использованием молекулярных маячков. Некоторые из этих способов более подробно описаны ниже.

Детекцию вариаций в нуклеиновых кислотах-мишенях можно выполнить с помощью молекулярного клонирования и секвенирования нуклеиновых кислот-мишеней, используя методики, хорошо известные в данной области. В альтернативном варианте, для амплификации последовательностей нуклеиновых кислот-мишеней непосредственно из препарата геномной ДНК из опухолевой ткани можно использовать методики амплификации, такие как полимеразная цепная реакция (ПЦР). Затем можно определить последовательность нуклеиновой кислоты амплифицированных последовательностей, и идентифицировать в ней вариации. Методики амплификации хорошо известны в данной области, например, полимеразная цепная реакция описана в Saiki et al., Science 239:487, 1988; патентах США №№ 4683203 и 4683195.

Для амплификации последовательностей нуклеиновых кислот-мишеней также можно использовать лигазную цепную реакцию, которая известна в настоящей области. См., например, Wu et al., Genomics 4:560-569 (1989). В дополнение, для детекции вариаций (например, замен) также можно использовать методику, известную как аллель-специфичная ПЦР. См., например, Ruano and Kidd (1989) Nucleic Acids Research 17:8392; McClay et al. (2002) Analytical Biochem. 301:200-206. В некоторых вариантах осуществления данной методики используют аллель-специфичный праймер, в котором 3'-концевой нуклеотид праймера комплементарен (то есть способен образовывать специфичные пары оснований) определенной вариации в нуклеиновой кислоте-мишени. Если определенная вариация не присутствует, то продукт амплификации не наблюдается. Также для детекции вариаций (например, замен) можно использовать амплификационную рефракторную мутационную систему (ARMS). ARMS описана, например, в публикации европейской патентной заявки № 0332435 и в Newton et al., Nucleic Acids Research, 17:7, 1989.

Другие способы, пригодные для детекции вариаций (например, замен) включают, но не ограничены этим (1) методы аллель-специфичного включения нуклеотидов, такие как методы удлинения на один нуклеотид (см., например, Chen et al. (2000) Genome Res. 10:549-557; Fan et al. (2000) Genome Res. 10:853-860; Pastinen et al. (1997) Genome Res. 7:606-614; и Ye et al. (2001) Hum. Mut. 17:305-316); (2) методы аллель-специфичного удлинения праймера (см., например, Ye et al. (2001) Hum. Mut. 17:305-316; и Shen et al. Genetic Engineering News, vol.23, Mar. 15, 2003), включая аллель-специфичную ПЦР; (3) методы анализа с использованием 5'-нуклеаз (см., например, De La Vega et al. (2002) BioTechniques 32:S48-S54 (описывающую метод TaqMan®); Ranade et al. (2001) Genome Res. 11:1262-1268; и Shi (2001) Clin. Chem. 47:164-172); (4) методы с использованием «молекулярных маячков» (см., например, Tyagi et al. (1998) Nature Biotech. 16:49-53; и Mhlanga et al. (2001) Methods 25:463-71); и (5) методы лигирования олигонуклеотидов (см., например, Grossman et al. (1994) Nuc. Acids Res. 22:4527-4534; публикацию патентной заявки США № 2003/0119004 A1; международную публикацию PCT № WO 01/92579 A2; и патент США № 6027889).

Вариации можно также детектировать способами детекции несовпадений. Несовпадения представляют собой гибридизованные дуплексы нуклеиновых кислот, которые не являются на 100% комплеметарными. Отсутствие полной комплементарности может быть следствием делеций, вставок, инверсий или замен. Одним из способов детекции несовпадений является метод детекции исправления несовпадений (MRD), описанный, например, в Faham et al., Proc. Natl Acad. Sci. USA 102:14717-14722 (2005) и Faham et al., Hum. Mol. Genet. 10:1657-1664 (2001). Другим примером методики расщепления несовпадений является способ защиты от расщепления РНКазой, который подробно описан в Winter et al., Proc. Natl. Acad. Sci. USA, 82:7575, 1985, и в Myers et al., Science 230:1242, 1985. Например, способ по изобретению может включать использование меченной рибопробы, которая комплементарна нуклеиновой кислоте-мишени дикого типа человека. Рибопробу и нуклеиновую кислоту-мишень совместно отжигают (гибридизуют) и далее расщепляют ферментом РНКазой А, способной детектировать некоторые несовпадения в структуре дуплексной РНК. Если РНКаза А обнаруживает несовпадение, то она расщепляет сайт несовпадения. Поэтому, если несовпадение детектируется и расщепляется РНКазой А, то при разделении препарата РНК после отжига электрофорезом в гелевом матриксе будет виден РНК-продукт, который будет меньше по размеру относительно полноразмерной дуплексной РНК для рибопробы и мРНК или ДНК. Длина рибопробы не должна составлять полную длину нуклеиновой кислоты-мишени, а может составлять часть нуклеиновой кислоты-мишени, при условии, что она включает позицию, предположительно имеющую вариацию.

Аналогичным образом для детекции несовпадений можно использовать ДНК-пробы, например, используя ферментативное или химическое расщепление. См., например, Cotton et al., Proc. Natl. Acad. Sci. USA, 85:4397, 1988; и Shenk et al., Proc. Natl. Acad. Sci. USA, 72:989, 1975. В альтернативном варианте несовпадения можно детектировать по сдвигу в электрофоретической подвижности несовпадающих дуплексов относительно совпадающих дуплексов. См., например, Cariello, Human Genetics, 42:726, 1988. В случае либо рибопроб, либо ДНК-проб, нуклеиновую кислоту-мишень, предположительно содержащую вариацию, можно амплифицировать перед гибридизацией. Изменения в нуклеиновой кислоте-мишени также можно детектировать Саузерн-гибридизацией, особенно, если изменения представляют собой крупные перестановки, такие как делеции и вставки.

Для детекции вариаций, например, вставок или делеций, можно использовать пробы полиморфизма длины рестрикционных фрагментов (RFLP) к нуклеиновой кислоте-мишени или окружающим маркерным генам. Вставки и делеции также можно детектировать с помощью клонирования, секвенирования и амплификации целевой нуклеиновой кислоты. Анализ одноцепочечного конформационного полиморфизма (SSCP) также можно использовать для детекции вариантов замены оснований аллеля. См., например, Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989, и Genomics, 5:874-879, 1989.

Микроматричный анализ представляет собой мультиплексную технологию, в которой обычно используют организованные серии из тысяч нуклеотидных проб для гибридизации, например, с образцом кДНК или кРНК при очень жестких условиях. Гибридизацию между мишенью и пробой обычно детектируют и количественно оценивают путем детекции меченных флуорофорами, серебром или хемилюминесцентными соединениями мишеней для определения относительной распространенности последовательностей нуклеиновых кислот в мишени. В обычных микроматричных анализах пробы присоединены к твердой подложке с помощью ковалентной связи с химическим матриксом (через эпокси-силан, амино-силан, лизин, полиакриламид или другие молекулы). Твердой поверхностью является, например, стекло, кремниевый чип или микроскопические шарики. В продаже существуют различные микроматрицы, включая, например, изготовленные Affymetrix, Inc. и Illumina, Inc.

Биологический образец можно получить, используя некоторые способы, известные опытным специалистам в данной области. Биологические образцы можно получить от позвоночных животных, и, в частности, млекопитающих. Часто для получения представительного образца опухолевой ткани используют биопсию ткани. В альтернативном варианте опухолевые клетки можно получить непрямым образом в форме тканей или жидкостей, которые как известно или предположительно содержат целевые опухолевые клетки. Например, образцы бляшек рака легкого можно получить в результате резекции, бронхоскопии, аспирации тонкой иглой, применения щеточек для соскоба слизистой бронхов или из мокроты, плевральной жидкости или крови. Вариации в нуклеиновых кислотах-мишенях (или кодируемых полипептидах) можно детектировать в опухолевом образце или в других забранных образцах, таких как моча, мокрота или сыворотка. (Раковые клетки покидают опухоли и появляются в таких образцах). В результате скрининга таких образцов можно провести раннюю диагностику заболеваний, таких как рак. Дополнительно, мониторинг прогресса терапии можно проводить более просто путем тестирования таких образцов на вариации в нуклеиновых кислотах-мишенях (или кодируемых полипептидах). Кроме того, в данной области известны способы обогащения препаратов тканей по опухолевым клеткам. Например, ткань можно выделить из парафиновых или замороженных срезов. Раковые клетки также можно отделить от нормальных клеток проточной цитометрией или лазерной захватывающей микродиссекцией.

После определения того, что субъект, или образец ткани или клеток, содержат генетическую вариацию, описанную в настоящем документе, предполагается, что можно ввести субъекту эффективное количество соответствующего противоволчаночного терапевтического средства для лечения волчаночного состояния у субъекта. У млекопитающих диагностику различных патологических состояний, описанных в настоящем документе, может провести опытный практикующий врач. В данной области существуют методики диагностики, которые позволяют, например, диагностику или детекцию волчанки у млекопитающего.

Противоволчаночное терапевтическое средство можно вводить в соответствии с известными способами, такими как внутривенное введение в виде болюса или непрерывная инфузия в течение некоторого периода времени, внутримышечный, внутрибрюшинный, интрацереброспинальный, подкожный, интраартикулярный, интрасиновиальный, интратекальный, пероральный, местный или ингаляционный пути. Необязательно, введение можно провести с помощью инфузии через мининасос, используя различные доступные в продаже устройства.

Эффективные дозировки и схемы для введения противоволчаночных терапевтических средств можно определить эмпирически, и это входит в компетенцию специалистов в данной области. Можно использовать однократные или многократные дозы. Например, эффективная дозировка или количество ингибитора интерферона, используемого отдельно, может варьировать в диапазоне от примерно 1 мг/кг до примерно 100 мг/кг веса тела или более в день. Масштабирование дозировок между биологическими видами можно выполнить известным в данной области образом, например, как описано в документе Mordenti et al., Pharmaceut. Res., 8:1351 (1991).

Когда используется введение противоволчаночного терапевтического средства in vivo, в зависимости от пути введения нормальное количество препарата может варьировать от примерно 10 нг/кг до примерно 100 мг/кг веса тела млекопитающего или более в день, предпочтительно, от примерно 1 мкг/кг/день до 10 мг/кг/день. Руководство относительно конкретных дозировок и способов доставки приведено в литературе; см., например, патенты США №№ 4657760; 5206344 или 5225212. Ожидается, что различные составы будут эффективны для различных терапевтических соединений и различных расстройств, а также что для введения, направленного на один орган или ткань, например, может требоваться другой путь доставки относительно доставки в другой орган или ткань.

Предполагается, что в способах можно использовать дополнительные способы лечения. Один или несколько других способов лечения могут включать, но не ограничены этим, введение стероидов и другие стандартные схемы лечения для указанного расстройства. Предполагается, что такие другие способы лечения можно использовать в качестве средства, независимого, например, от направленного противоволчаночного терапевтического средства.

Наборы

Для использования в способах применения, описанных или предложенных выше, также приведены наборы и промышленные изделия. Такие наборы могут включать в себя средства для транспортировки с отделениями для содержания с высокой степенью изоляции одного или нескольких контейнеров, таких как флаконы, пробирки и т.п., причем каждый из контейнеров содержит один из отдельных элементов, используемых в способе. Например, один из контейнеров может содержать пробу, которая имеет детектируемую метку или которая может быть помечена детектируемой меткой. Такая проба может быть полинуклеотидом, специфичным к полинуклеотиду, содержащему локус риска SLE. Если в наборе используется гибридизация нуклеиновых кислот для детекции нуклеиновой кислоты-мишени, то набор может также включать в себя контейнеры, содержащие нуклеотид(ы) для амплификации последовательности нуклеиновой кислоты-мишени, и/или контейнер, содержащий репортерное средство, такое как биотин-связывающий белок, такой как авидин или стрептавидин, связанный с репортерной молекулой, такой как ферментативная, флуоресцентная или радиоизотопная метка.

Наборы обычно будут содержать описанный выше контейнер и один или несколько других контейнеров, содержащих материалы, желательные с коммерческой или пользовательской точки зрения, в том числе, буферы, разбавители, фильтры, иглы, шприцы и вкладыши в упаковку с инструкциями по применению. На контейнере может быть пометка, указывающая, что композиция должна использоваться для определенного терапевтического или нетерапевтического применения, а также она может указывать тип применения либо in vivo, либо in vitro, такое как описанное выше.

Другие необязательные компоненты набора включают один или несколько буферов (например, блокирующий буфер, промывающий буфер, субстратный буфер и т.п.), другие реагенты, такие как субстрат (например, хромоген), химически измененный ферментативной меткой, раствор для экспонирования эпитопа, контрольные образцы (положительные и/или отрицательные контроли), контрольные слайды и т.п. Дополнительным компонентом является фермент, например, включающий без ограничений нуклеазу, лигазу или полимеразу.

Способы маркетинга

Также изобретение относится к способам маркетинга противоволчаночного терапевтического средства или его фармацевтически приемлемой композиции, включающим в себя продвижение, инструктирование и/или обоснование для целевой аудитории, применение средства или его фармацевтической композиции для лечения пациента или популяции пациентов с волчанкой, от которых были получены образцы, показывающие присутствие генетической вариации, раскрытой в настоящем документе.

Маркетинг в общем представляет собой оплаченное сообщение через неперсональную информационную среду, в котором указан спонсор, а сообщение контролируется. Маркетинг в настоящем изобретении включает рекламу, связи с общественностью, размещение скрытой рекламы, спонсорскую поддержку, страхование и продвижение товара. Этот термин также включает спонсированные информационные публикации, появляющиеся в любом из печатных средств массовой коммуникации, разработанные для обращения к массовой аудитории для убеждения, информирования, продвижения, мотивирования или иным образом изменения поведения в направлении подходящего образа приобретения, поддержки или одобрения настоящего изобретения.

Маркетинг способов диагностики можно выполнить любыми средствами. Примеры маркетинговой среды, используемые для доставки данных сообщений, включают телевидение, радио, фильмы, журналы, газеты, интернет и афиши, включая рекламные ролики, которые представляют собой сообщения, появляющиеся на радио и телевидении.

Используемый тип маркетинга будет зависеть от многих факторов, например, от типа целевой аудитории, которую необходимо охватить, например, больниц, страховых компаний, клиник, докторов, медицинских сестер и пациентов, а также от фактора стоимости и связанных юридических законов и нормативных положений, регулирующих маркетинг лекарственных препаратов и средств диагностики. Маркетинг может быть индивидуализированным или заказным, исходя из характеристик пользователя, определяемых взаимодействием с обслуживанием и/или другими данными, такими как демографические характеристики и географическое местоположение пользователя.

Ниже приведены примеры способов и композиций по изобретению. Следует понимать, что различные другие варианты осуществления изобретения можно осуществить на практике исходя из общего описания, приведенного выше.

ПРИМЕРЫ

В примерах ссылки на некоторые публикации обозначены номерами, для которых полная библиографическая информация приведена в конце раздела Примеры.

Пример 1

Идентификация нового локуса риска для SLE

Способы и субъекты

Субъекты

Отбор и генотипирование случаев заболевания SLE, образцов, используемых в полногеномном сканировании ассоциаций (GWAS), а также контроли из коллекции Проекта по контролю здоровья жителей Нью-Йорка (NYHP) (Mitchell et al., J Urban Health 81(2):301-10 (2004)) были описаны ранее (Horn et al., N Engl J Med 358(9):900-9 (2008)). Как подробно описано ниже, случаи SLE состояли из трех серий: а) 338 случаев из Объединенной сети по определению биомаркеров аутоиммунных заболеваний (ABCoN) (Bauer et al., PLoS medicine 3(12):e491 (2006)), спонсируемого NIH/NIAMS репозитория и 141 случаев от Консорциума по генетике аутоиммунных заболеваний (MADGC) (Criswell et al., Am J Hum Genet 76(4):561-71 (2005)); b) 613 случаев из Проекта по генетике волчанки Университета Калифорнии в Сан-Франциско (UCSF) (Seligman et al., Arthritis Rheum 44(3):618-25 (2001); Remmers et al., N Engl J Med 357(10):977-86 (2007)); и c) 335 случаев из Медицинского центра Университета Питтсбурга (UPMC) (Demirci et al., Ann Hum Genet 71(Pt 3):308-11 (2007)) и 8 случаев из Института медицинских исследований им.Фейнштейна. Контролями являлись 1861 образец из коллекции NYHP, 1722 образца из находящейся в общем доступе базы данных iControlDB (доступной от Illumina Inc.) и 4564 образца из Проекта генетических маркеров предрасположенности к раку (CGEMS) Национального института раковых заболеваний (доступного по адресу URL: cgems.cancer.gov).

ПОЛНОГЕНОМНЫЙ НАБОР ДАННЫХ ИЗ 1310 СЛУЧАЕВ ЗАБОЛЕВАНИЯ SLE И 7859 КОНТРОЛЕЙ

Авторами изобретения ранее были описаны отбор и генотипирование образцов случаев заболевания SLE (Horn et al., N Engl J Med 358(9):900-9 (2008)). Все пациенты с SLE имели северо-американское или европейское происхождение, определенное на основании данных от пациента или подтвержденное генотипированием. Диагноз SLE (выполнение четырех или нескольких критериев, определенных Американским колледжем ревматологии (ACR) [Hochberg et al., Arthritis Rheum 40(9): 1725[1997]]), подтверждали во всех случаях исследованием историей болезни (94%) или посредством письменного заверения критериев лечащими ревматологами (6%). Клинические данные для этих серий представлены в другом источнике ((Seligman et al., Arthritis Rheum 44(3):618-25 (2001); Criswell et al., Am J Hum Genet 76(4):561-71 (2005); Bauer et al., PLoS medicine 3(12):e491 (2006); Demirci et al, Ann Hum Genet 71(Pt 3):308-11 (2007); Remmers et al., N Engl J Med 357(10):977-86 (2007)). Генотипирование и отбор образцов из NYHP были описаны ранее (Horn et al., N Engl J Med 358(9):900-9 (2008)). В таблице 1 описано число участвующих в исследовании образцов, упорядоченных по географическому положению.

Отбор образцов и SNP проводили с использованием аналитических модулей в компьютерных программах PLINK и EIGENSTRAT, как описано ниже (см. также Purcell et al., Am J Hum Genet 81(3):559-75 (2007); Price et al., Nat Genet 38(8):904-09 (2006)). Полногеномные данные по SNP использовали в данном исследовании для обеспечения точного соответствия случаев заболевания и контролей, и для получения генотипов в подтвержденных и предположительных локусах SLE.

Таблица 1
Число образцов, проанализированных в полногеномном и репликационном исследовании, упорядоченных по географическому положению
Набор случаев заболевания N Набор контролей N
Открытые образцы
GWASa 1310 7859
Репликационные образцы
СШАb PROFILE 415 NYHP 776
UMN 366 ALZ 2215
UCSF 284
UPMC 52
JHU 12
Всего 1129 2991
Швецияс Умео 244 Умео -
Уппсала 145 Уппсала 132
Стокгольм 270 Стокгольмd 1112
Лунд 155 Лунд 94
Всего 834 Всего 1338
Всего 3273 12188
аОбразцы из описанного полногеномного сканирования ассоциаций (Horn, G. et al., N Engl J Med 358:900-9 (2008)). bНезависимые случаи SLE-когорты в США, полученные из объединения случаев SLE, PROFILE, Университета Калифорнии, Сан-Франциско (UCSF) (Thorburn, CM. et al., Genes Immun. 8:279-87 (2007)), Медицинского центра университета Питтсбурга (UPMC), Университета Миннесоты (UMN) и Университета им.Джона Хопкинса (JHU). Контроли (США) из Проекта по контролю здоровья жителей Нью-Йорка (Gregersen et al.), а также случаи заболевания Альцгеймера и контроли из Университета Питтсбурга и NCRAD. сСлучаи SLE и контроли из Стокгольма, Каролинский институт, Солна, Уппсалы, Лунда и Умео, Швеция. d823 контроля из Стокгольма были генотипированы с использованием SNP-матрицы Illumina 317K. SNP в данных образцах импутировали и анализировали, как описано в способах.

Специализированная SNP-матрица

Специализированная матрица была разработана с 10848 SNP, прошедшими стандарты контроля качества, описанные ниже. Полная матрица включала 12864 SNP, но 2016 SNP не прошли стандарты контроля качества, что оставило 10848 SNP, которые были взяты на анализ. Специализированная матрица состояла из 3188 SNP, выбранных исходя из заданного P<0,05 в полногеномном сканировании ассоциаций с SLE, 505 SNP из 25 ранее опубликованных локусов риска SLE, 42 SNP, выбранных после литературного поиска подтвержденных аллелей риска для других аутоиммунных заболеваний и 7113 SNP, используемых для установления и контролирования субструктуры популяции. Последняя группа включала SNP, которые использовали для определения отличий между континентальными популяциями (Kosoy, R. et al., Hum. Mutat. 30:69-78 (2009)), и SNP, обогащенные в субструктуре европейской популяции (Tian, C. et al., PLoS Genet 4, e4 (2008)). Специализированная матрица была изготовлена Illumina, Inc. с использованием их iSelect Custom BeadChip и идентификационных номеров (rs), которыми авторы изобретения обозначали SNP, прошедшие фильтры контроля качества, описанные ниже.

Контроль качества и импутация

Для данных из США, было проведено генотипирование всего 1464 случаев заболевания из США и 3078 контролей из США с использованием специализированного чипа Illumina, описанного выше, также именуемого в настоящем документе специализированным 12К-чипом. Авторы изобретения использовали жесткие критерии контроля качества (QC), чтобы гарантировать, что только данные с высоким качеством были бы включены в конечный анализ. Более конкретно, авторы: а) исключили 116 индивидуумов, у которых было потеряно больше 5% данных, и b) исключили 279 индивидуумов на основании скрытых родственных связей и дуплицированных образцов, исходя из «идентичного по состоянию» статуса (IBS) (PI Hat>0,15). Авторы включали только SNP с a) с потерей <5% данных, b) р-значение из уравнения Харди-Вайнберга (HWE)>1×10-6, c) частота минорных аллелей (MAF)>0,01% и d) SNP с р-значением >1×10-5 в тесте на дифференциальные пропуски между случаями заболевания и контролями. SNP также исследовали на групповые эффекты. После применения вышеуказанных фильтров, итоговый набор из 1144 случаев заболевания и 3003 контролей и 11024 SNP был доступен для анализа. Все QC-тесты проводили с использованием PLINK (Purcell et al., Am J Hum Genet 81(3):559-75 (2007)).

В случае данных из Швеции для анализа был доступен набор из 888 случаев заболевания и 527 контролей, генотипирование которых проводили на специализированном 12K-чипе. Также в анализ был включен отдельный набор из 1115 контролей из Швеции, генотипированных на матрице на шариках 317K Human HapMap SNP от Illumina, Inc. (также именуемой в настоящем документе 317K-матрицей). Для объединения двух наборов данных авторы следовали приведенной ниже схеме. Сначала был создан набор перекрывающихся данных из 6789 SNP между данными, полученным на 12K и 317K -матрицах. Авторы использовали этот набор данных для исследования шведской репликационной когорты на скрытые родственные связи и дуплицированные образцы. В результате было исключено 313 образцов (PI Hat>0,15). После проверок контроля качества авторы перешли к анализу 863 случаев заболевания и 523 контролей, генотипированных на специализированном 12K-чипе, и 831 контролей, генотипированных на 317K-чипе Illumina. Во-вторых, авторы импутировали (см. ниже) 831 контролей из Швеции, генотипированных на 317K-матрице, для создания большего набора перекрывающихся SNP. Из оставшихся SNP авторы отобрали 4605 SNP путем импутирования. В дальнейшем анализе использовали итоговый набор из 11394 перекрывающихся SNP. Авторы провели отбор SNP из этого набора данных, используя такие же пороговые параметры, как описанные выше. Остальные 1250 SNP, не отобранных с помощью импутации, анализировали только в исходном наборе образцов из Швеции, генотипированных на 12K-чипе.

831 шведских контролей, генотипированных с использованием 317K-матрицы, были импутированы с использованием MACH (компьютерной программы для гаплотипирования на основе метода цепей Маркова, расположенной по адресу URL: sph.umich.edu/csg/abecasis/MACH) и образцов Phase II HapMap CEU в качестве референсных. Образцы Phase II HapMap CEU относятся к образцам из Проекта гаплотипов человека, известные как резиденты штата Юта с предками из северной и западной Европы (CEU) из «Фазы II» публикации данных. (См. также Li et al. Am J Hum Genet S79 at 2290 (2006)). Перед импутацией авторы применяли жесткие проверки контроля качества на 317K SNP. Подгруппа из 293242 маркеров, прошедших следующие критерии: (1) MAF>1%, (2) процент пропуска <5% и (3) HWE p-значение >1×10-6 была включена в импутацию. После импутации SNP с низким качеством импутации, то есть имеющие определенные MACH значения R-squared_Hat (RSQR_HAT)<0,40, были отброшены. Для анализа был доступен перекрывающийся набор из 11394 маркеров. Принимая во внимание неоднозначность импутации, в анализе использовали показатели вероятности, а не распространенность в геноме.

Для импутации образцов из полногеномного исследования ассоциаций данные по генотипам, используемые в мета-анализе, относились к 1310 случаям SLE, генотипированным с использованием Illumina 550K полногеномной SNP-платформы (см. Hom, G. et al., N Engl J Med 358:900-9 (2008)). Отбор и генотипирование образцов случаев заболевания SLE были описаны ранее (Hom, G. et al., N Engl J Med 358:900-9 (2008)). В дополнение к 3583 контролям, описанным ранее (Hom, G. et al., N Engl J Med 358:900-9 (2008)), 4564 контрольных образцов из общедоступного Проекта генетических маркеров предрасположенности к раку (CGEMS) были включены после получения одобрения (доступны по адресу URL: cgems.cancer.gov). Всю группу из 7859 контролей исследовали с использованием фильтров контроля качества данных, как было описано ранее (Hom, G. et al., N Engl J Med 358:900-9 (2008)). Далее для выведения генотипов авторы использовали программу IMPUTE version 1 (доступную по адресу URL: www.stats.ox.ac.uk/~marchini/software/gwas/impute.html), используя образцы HapMap Phase II CEU в качестве референсных (Marchini, J. et al., Nat. Genet. 39:906-913 (2007)). Авторы использовали SNPTEST (доступную по адресу URL: www.stats.ox.ac.uk/~marchini/software/gwas/snptest_v1.1.4.html) для получения статистики ассоциаций (Marchini, J. et al., Nat. Genet. 39:906-913 (2007)). Более конкретно, статистику ассоциаций получали, используя аддитивную модель (параметр -Freqentist 1 в SNPTEST), скорректированную на неоднозначность импутированного генотипа (параметр -proper в SNPTEST). Упорядоченный по рангу список статистики ассоциаций использовали для отбора областей для репликации, как описано.

Стратификация популяции в репликационных образцах

Для каждой репликационой когорты авторы использовали предковые информативные маркеры для коррекции возможной стратификации популяции. Подгруппу из 5486 нескорректированных предковых маркеров, прошедших жесткие критерии контроля качества, использовали для выведения верхнего десятка главных составляющих генетической вариации, используя программное обеспечение EIGENSTRAT (Price et al., Nat Genet 38(8):904-09 (2006)). Из каждого набора образцов удаляли выпадения (определенные как σ>6). Более конкретно, авторы удалили 27 генетических выпадений из когорты из США и 45 выпадений из шведской когорты, соответственно. Некоторая степень стратификации популяции по первым двум собственным векторам наблюдалась в репликационных коллекциях как из США, так и из Швеции. Чтобы скорректировать стратификацию случай-контроль авторы использовали одну из следующих стратегий: (1) авторы применяли коррекцию статистики теста Кохрана-Армитажа, включенную в EIGENSTRAT, к набору репликационных данных из США и шведских данных при наличии данных о генотипе; (2) авторы использовали главные составляющие в качестве копеременных в логистической регрессионной модели в анализе импутированных шведских данных.

Анализ ассоциаций

Для данных из США наблюдалось некоторое расширение в статистике теста после проведения нескорректированного аллельного теста с одной степенью свободы на ассоциацию (PLINK [Purcell, S. et al. Am J Hum Genet 81:559-75 (2007)]). Для коррекции стратификации в образцах из США был проведен метод главных компонент (EIGENSTRAT) с использованием 5486 нескорректированных предковых информативных маркеров. Во-первых, авторы удалили генетические выпадения (определенные как σ>6). Во-вторых, для каждого генотипированного SNP в 1129 случаях заболевания и 2991 контролях вычисляли статистику теста хи-квадрат тенденции изменения в тесте Кохрана-Армитаж с последующим подведением значения статистики критерия для каждого SNP в EIGENSTRAT с использованием первых четырех собственных векторов. Для каждого SNP вычисляли двухсторонние р-значения исходя из статистики критерия. После внесения поправки на стратификацию популяция λgc в образцах из США составляла 1,05.

Для шведских данных авторы исследовали шведскую когорту на скрытую стратификацию популяции, используя 5486 предковых информативных маркеров, генотипированных в образцах 12K, а также в дополнительных контролях Illumina 317K. После удаления генетических выпадений, авторы получили 834 случая и 515 контролей, генотипированных на специализированном 12K-чипе и 823 контроля, генотипированных на Illumina 317K-чипе. Авторы использовали коррекцию статистики теста, реализованную в EIGENSTRAT, на перекрывающемся наборе из 6789 SNP между двумя матрицами Illumina. Для коррекции стратификации в наборе из 4605 SNP, генотипированных в образцах 12K и импутированных в образцы Illumina 317K, авторы использовали первые четыре собственных вектора, описанные выше как попеременные в логистической регрессионной модели, реализованной в SNPTEST, поскольку EIGENSTRAT не предназначена для использования с импутированными данными генотипа. Небольшой набор из 1250 маркеров, не отобранных импутацией в SNP из Illumina 317K, анализировали только для 834 случаев заболевания и 515 контролей, генотипированных на специализированном 12K-чипе. После внесения поправки на стратификацию популяция λgc в шведских образцах составляла 1,10.

Мета-анализ

Авторы использовали метод взвешенных z-величин для проведения мета-анализа. Для объединения результатов по разным когортам, аллели ориентировали на прямую цепь 36 референсных последовательностей генома человека из Национального Центра Биотехнологической Информации (NCBI), чтобы избежать неопределенности, связанной с C/G и A/T SNP. Референсная последовательность генома человека из NCBI доступна по адресу URL: www.ncbi.nlm.nih.gov. См. также Pruitt et al., Nucl. Acids Res. 35 (database issue):D61-D65 (2007). P-значения для каждой когорты конвертировали в z-величины с учетом направления эффекта относительно произвольного референсного аллеля. Взвешенную сумму z-величин вычисляли, взвешивая каждую z-величину по квадратному корню из размера образца для каждой когорты и затем деля сумму на квадратный корень из общего размера образца. Объединенную z-величину для шведских и американских репликационных когорт превращали в односторонние р-значения. Z-величину мета-анализа превращали в двухстороннее р-значение и оценивали доказательство ассоциации. Авторы считали, что SNP, проходящие порог 5×10-8, полностью ассоциированы с SLE. Локусы с объединенным р-значением меньше 1×10-5, которые не проходили порог полногеномной достоверности, рассматривались как весьма вероятные кандидаты. Мета-анализ проводили, используя находящийся в свободном доступе программный пакет METAL (доступный по адресу URL: www.sph.umich.edu/csg/abecasis/Metal). Для вычисления обобщенных отношений шансов авторы использовали метод Кохрана-Мантеля-Хенцеля (CMH) как реализованного в программном обеспечении METAL. Отношения шансов вычисляли относительно аллеля риска для каждого SNP. Также, взвешенную среднюю частоту аллеля в контролях вычисляли относительно аллеля риска каждого SNP.

Доля объяснимой дисперсии

Для SNP, ранее ассоциированных с SLE, и SNP с полученными в репликационном исследовании авторов мета р-значениями меньше 1×10-5 авторы вычислили долю объяснимой дисперсии. Авторы использовали пороговую модель подверженности заболеванию, которая предполагает, что SLE имеет нижнюю величину предрасположенности, которая нормально распределена со средним 0 и дисперсией 1. Авторы предполагают распространенность 0,1% SLE в общей популяции. Для вычисления порога для каждого генотипа, авторы использовали частоту аллелей в контролях и величину эффекта, соответствующую отношению шансов (ОШ) из анализа, проведенного авторами.

Анализ взаимосвязи

Для поиска эпистатических эффектов между максимальными сигналами, авторы составили список всех SNP в таблицах 2, 4 и 6, и провели анализ взаимосвязи в каждой репликационной когорте, используя опцию эпистаза, реализованную в PLINK. Чтобы достичь большей статистической мощности авторы провели анализ только случаев заболевания. После внесения поправки на число тестов, ни одна из взаимосвязей SNP-SNP не была найдена достоверной при p<0,05.

Условный анализ

В каждой геномной области, демонстрирующей сильную ассоциацию с SLE, авторы выбрали SNP, показывающий наиболее сильный сигнал. Авторы использовали PLINK для наложения условий на данный SNP, и искали другие SNP, имеющие сильную ассоциацию с SLE.

TNIP1, PRDM1, JAZF11, UHRF1BP1 и IL10 были идентифицированы в крупномасштабном репликационном исследовании в качестве новых локусов риска системной красной волчанки

В недавних полногеномом анализе ассоциаций (GWA) и исследованиях генов-кандидатов были идентифицированы по меньшей мере 15 общих аллелей риска, которые достигают полногеномной достоверности (P<5×10-8). Они включают гены, важные для приобретенного иммунитета и продукции аутоантител (аллели HLA II класса, BLK, PTPN22 и BANK1), и гены, участвующие в врожденном иммунитете и интерфероновом сигнальном пути (ITGAM, TNFAIP3, STAT4 и IRF5) ((Cunninghame Graham, D.S. et al, Nat. Genet. 40:83-89 (2008); Graham, R.R. et al, Nat. Genet. 40(9):1059-61 (2008); Graham, R.R., et al., J Intern Med 265:680-88 (2009); Harley, J.B. et al., Nat. Genet. 40:204-10 (2008); Horn, G. et al., N Engl J Med 358:900-9 (2008); Kozyrev, S.V. et al., Nat. Genet. 40:211-6 (2008); Sawalha, A.H. et al., PLoS ONE 3:e1727 (2008); Sigurdsson, S. et al., Am J Hum Genet 76:528-37 (2005)). Для идентификации дополнительных локусов риска авторы провели направленное репликационное исследование SNP из 2466 локусов, которые показывали номинальное значение Р<0,05 в недавнем сканировании GWAS7 1310 случаев и 7859 контролей. Авторы генотипировали SNP из 25 ранее опубликованных локусов риска SLE, 42 SNP из 35 локусов, вовлеченных в другие аутоиммунные заболевания, и более 7000 предковых информативных маркеров. Общий план эксперимента показан на фиг.1. Описанные выше SNP были включены в специализированную SNP-матрицу от компании Illumina. Матрицу генотипировали в индивидуальных случаях и контролях из США и Швеции. 823 контрольных образцов из Швеции генотипировали с использованием SNP-матрицы 310К от Illumina и варианты анализировали, как описано в вышеуказанных способах.

Более конкретно, как описано выше, авторы разработали специализированную SNP-матрицу, состоящую более чем из 12000 вариантов, и генотипировали две независимые популяции, популяцию случаев заболеваний SLE и контрольную популяцию из США (1129 случаев SLE и 2991 контролей) и из Швеции (834 случаев SLE и 1338 контролей). В американские контроли были включены 2215 образцов болезни Альцгеймера/контролей к ним, которые считались приемлемыми в качестве контролей, поскольку генетическая основа SLE предположительно является независимой. Затем авторы применили фильтры контроля качества данных, чтобы удалить неадекватные образцы и SNP, выпадения из популяций и дуплицированных/связанных родственными связями индивидуумов (см. указанный выше раздел Способы). После данных мер по контролю качества конечный набор из 10848 SNP исследовали, как указано на фиг.1. Статистику ассоциации с заболеванием для 3735 вариантов вычисляли и корректировали на стратификацию популяций, используя 7113 предковых информативных маркеров (см. указанный выше раздел Способы).

Во-первых, авторы изучили 25 вариантов (из 23 локусов), которые согласно ранее опубликованным данным ассоциированы с SLE (см. таблицу 2). Авторы обнаружили дополнительные свидетельства ассоциации для 21 варианта (P<0,05), включая 9 локусов с полногеномной достоверностью (P<5×10-8), в текущем объединенном наборе данных. Среди результатов с полногеномной достоверностью присутствовали HLA II класса DR3 (DRB1*0301), IRF5, TNFAIP3, BLK, STAT4, ITGAM, PTPN22, PHRF1 (KIAA1542) и TNFSF4 (OX40L). В результате анализа были получены дополнительные доказательства для вариантов из 9 локусов, которые согласно единственному предшествующему исследованию имели полногеномный уровень достоверности: HLA*DR2, TNFAIP3 (rs6920220), BANK1, ATG5, PTTG1, PXK, FCGR2A, UBE2L3 и IRAK1/MECP2.

В результате более раннего исследования генов-кандидатов был идентифицирован MECP2 (Sawalha, A.H. et al., PLoS ONE 3:e1727 (2008)) в качестве потенциального аллеля риска SLE. Однако в текущем набора данных SNP в области IRAK1, гена, необходимого для сигнальных путей толл-подобных рецепторов 7 и 9, и расположенного в пределах идентифицированной области неравновесного сцепления, окружающей MECP2, демонстрировали наиболее сильную ассоциацию. Аналогичные данные недавно были опубликованы (Jacob, C.O. et al., Proc. Natl. Acad. Sci. USA (2009)), и необходима дополнительная исследовательская работа для определения каузального аллеля в локусе IRAK1/MECP2. Авторы обнаружили дополнительные доказательства ассоциации для 3 локусов, TYK2, ICA1 и NMNAT2, для которых ранее было показано достоверное (но не полногеномное) доказательство ассоциации. (Harley, J.B. et al., Nat. Genet. 40:204-10 (2008); Sigurdsson, S. et al., Am J Hum Genet 76:528-37 (2005)). Для четырех ранее показанных как вовлеченные вариантов, LYN, SCUBE1, TLR5 и LY9, не наблюдалось никаких доказательств ассоциации в объединенном наборе данных.

Для идентификации новых локусов риска SLE авторы исследовали всего 3188 SNP из 2446 различных локусов, которые имели доказательства ассоциации с SLE в полногеномном наборе данных у авторов изобретения (Horn, G. et al., N Engl J Med 358, 900-9 (2008)), которые содержал 502033 SNP, генотипированных на 1310 случаях SLE и расширенном наборе из 7859 контролей. С использованием данного набора данных авторы импутировали >2,1 М вариантов, используя образцы HapMap Phase II CEU в качестве референсных (см. раздел Способы выше), и создали упорядоченный по рангу список статистики ассоциаций. Варианты с P<0,05 были отобраны для возможного включения в специализированную репликационную матрицу. Для эффективного генотипирования авторы идентифицировали группы коррелированных вариантов (r2>0,2) с последующим отбором по меньшей мере двух SNP из каждой группы, где наименьшее Р-значение было <0,001. Для оставшихся групп включали SNP с наименьшим Р-значением в группе. В репликационных образцах авторы вычисляли статистику ассоциации (см. Способы) и наблюдали значительное обогащение репликационных результатов относительно ожидаемого нулевого распределения. Кроме ранее опубликованных аллелей риска SLE, было найдено 134 локуса с P<0,05 (ожидаемое количество 64, P=2×10-15) и 12 локусов с P<0,001 (ожидаемое количество 1, P=1×10-9), что позволяет предположить присутствие истинно положительных результатов.

На каждой из фигур 2А-2Е показаны результаты полногеномного анализа ассоциаций, отложенные на оси у относительно геномной позиции на оси х в пределах области 500 т.п.о., окружающей локусы, ограниченные TNIP1 (фиг.2A), PRDM1 (фиг.2B), JAZF1 (фиг.2C), UHRF1BP1 (фиг.2D) и IL-10 (фиг.2E). Мета-анализ Р-значений для наиболее ассоциированного маркера указан закрашенным квадратом на каждой из фиг.2A-2E. Для каждой из фиг.2А-2Е отмечены Р-значения из геномного анализа для указания LD для полногеномного ассоциированного варианта: фактурные кружки выражают r2>0,8; обведенные пунктиром кружки - r2>0,5; заштрихованные кружки - r2>0,2; и незакрашенные кружки - r2<0,2. По низу каждой из фиг.2А-2Е указана частота рекомбинации из CEU HapMap (сплошная черная линия), а известные гены человека указаны под каждым графиком. На фиг.2В (PRDM1), опубликованный ранее и независимый локус риска SLE (rs2245214) рядом с геном ATG5 указан закрашенным черным кружком. На фиг.2F показана гистограмма Р-значений 1256 независимых SNP (r2<0,1 относительно любого другого SNP в матрице) в репликационных образцах 1963 случаев заболевания и 4329 контролей. При нулевом распределении ожидаемая плотность результатов указана пунктирной линией на фиг.2F. Как указано на фиг.2F, наблюдалось значительное обогащение результатов с P<0,05.

Соответственно, в репликационном исследовании было идентифицировано 5 новых локусов риска SLE с объединенным Р-значением, которое превышало полногеномный порог достоверности (P<5×10-8): TNIP1, PRDM1, JAZF1, UHRF1BP1 и IL10. Подробные статистические ассоциации для данных и других локусов показаны ниже в таблице 4.

Вариант, rs7708392, на 5q33.1, который находится внутри интрона белка 1, взаимодействующего с индуцируемым TNF-α белком 3 (TNFAIP3), TNIP1, был достоверно ассоциирован с SLE во всех трех когортах и имел объединенное значение Р=3,8×10-13 (фиг.2A). Недавно было найдено, что варианты рядом с TNIP1 вносят вклад в риск псориаза (Nair, R.P. et al., Nat Genet 41:199-204 (2009)), однако варианты, ассоциированные с SLE и псориазом, отделены 21 т.п.о. и, по-видимому, представляют собой различные генетические сигналы (r2=0,001). TNIP1 и TNFAIP3 представляют собой белки, взаимодействующие друг с другом (Heyninck, K., et al, FEBS Lett 536: 135-40 (2003)), однако точная роль TNIP1 в регуляции TNFAIP3 неизвестна. Ассоциация множества различных вариантов около TNFAIP3 с SLE (Graham, R.R. et al., Nat. Genet. 40(9):1059-61 (2008), Musone, S.L. et al., Nat. Genet. 40(9):1062-64 (2008)), ревматоидным артритом (Plenge, R.M. et al., Nat Genet 39:1477-82 (2007)), псориазом (Nair, R.P. et al., Nat Genet 41:199-204 (2009)) и диабетом I типа (Fung, E.Y. et al., Genes Immun. 10:188-91 (2009)) позволяет предположить, что данный сигнальный путь имеет важную роль в регуляции аутоиммунных реакций.

Второй подтвержденный вариант риска (rs6568431, P=7,12×10-10) был идентифицирован в межгенной области между PR-домен-содержащим белком 1 с ZNF-доменом (PRDM1, также известным BLIMP1) и APG5-подобным белком (ATG5). Сигнал в rs6568431, по-видимому, отличается от ранее опубликованного аллеля риска SLE внутри ATG5, rs2245214 (Harley, J.B. et al., Nat Genet 40:204-10 (2008)) (см. таблицу 4), поскольку rs6568431 имеет r2<0,1 с rs2245214, и rs2245214 остается достоверно ассоциированным с SLE (P<1×10-5) после условной логистической регрессии, включающей rs6568431 (фиг.2B).

Промоторная область сопряженного с другим цинковым пальцем гена 1 (JAZF1) является третьим новым подтвержденным локусом SLE (rs849142, P=1,54×10-9) (фиг.2C). Интересно, что этот же вариант ранее связывали с риском диабета 2-го типа (Zeggini, E. et al., Nat Genet 40:638-45 (2008)) и разницей в росте (Johansson, A. et al., Hum Mol. Genet 18:373-80 (2009)). Для другого аллеля рака простаты около JAZF1, rs10486567, (Thomas, G. et al., Nat Genet 40:310-5 (2008)), не было получено никаких доказательств его ассоциации с текущим исследованием.

Четвертый новый локус риска SLE ограничен не-синонимичным аллелем (R454Q) белка ICBP90-связывающего белка 1 (UHRFBP1, rs11755393, P=2,22×10-8) (фиг.2D). Этот аллель представляет собой неконсервативную аминокислотную замену в потенциальном связывающем партнере UHRF1, транскрипционном и метилирующем факторе, связанном с множеством сигнальных путей (Arita, K., et al., Nature 455:818-21 (2008)). UHRFBP1-аллель риска находится в области протяженного неравновесного сцепления, которая охватывает многие гены, включая полипептид С малого ядерного рибонуклеопротеина (SNPRC), входящего в РНК-процессирующий комплекс, часто являющегося мишенью аутоантител при SLE.

Пятый новый идентифицированный локус SLE представляет собой интерлейкин-10 (IL10; rs3024505, P=3,95×10-8) (фиг.2E). IL10 является важным иммунорегуляторным цитокином, функцией которого является подавление иммунного ответа (Diveu, C, et al., Curr Opin. Immunol. 20:663-8 (2008)), и были опубликованы противоречивые данные о том, что вариация в IL10 ассоциирована с SLE (Nath, S.K., et al., Hum Genet 118:225-34 (2005)). Ассоциированный с SLE вариант идентичен с SNP, недавно идентифицированным как способствующий риску язвенного колита (Franke, A. et al., Nat Genet 40:1319-23 (2008)) и диабета 1-го типа (Barrett, J.C. et al., Nature Genetics 41: 703-707 (2009)), позволяя предположить возможность общей патофизиологии в IL10-сигнальном пути при этих заболеваниях.

Используя порог достоверности P<1×10-5 в объединенном репликационном образце авторы идентифицировали 21 дополнительный локус, предположительно являющихся локусами риска SLE (таблица 4). Менее одного локуса (0,01) с P<1×10-5 ожидалось при распределении для нулевой гипотезы при мета-анализе (P=8×10-77), позволяя предположить, что некоторые из этих локусов, вероятно, являются истинно положительными локусами. Интересные гены-кандидаты в этом списке включают: a) интерферон-регулирующий фактор 8 (IRF8), который был включен в предшествующее GWAS (Graham, R.R. et al., Nat. Genet. 40(9): 1059-61 (2008)), а члены его семейства, IRF5 и IRF7 находятся внутри подтвержденного локуса риска SLE; b) TAO-киназа 3 (TAOK3), несмысловой аллель (rs428073, N47S) киназы, экспрессирующийся в лимфоцитах; c) регулятор лизосомального трафика (LYST), мутации которого вызывают синдром Чедиака-Хигаси у человека, комплексное расстройство, отличающееся лимфопролиферативным расстройством; и d) бета-2 рецептор интерлейкина 12 (IL12RB2), локус, который включает IL23R и SERPBP1, но, по-видимому отличается от вариантов IL23R, опубликованных для аутоиммунных заболеваний - воспалительного заболевания кишечника, псориаза и анкилозирующего спондилита (Duerr, R.H. et al, Science 314:1461-3 (2006)).

Выдающимся признаком данных GWA-исследований является большое число перекрывающихся локусов, общих для различных комплексных заболеваний (Zhernakova, A., et al., Nat Rev Genet 10:43-55 (2009)). Авторы протестировали 42 варианта из 35 локусов, которые ранее были опубликованы, как аллели риска аутоиммунных заболеваний, на ассоциацию с SLE (таблицы 6 и 7). Ни один из одиночных локусов не имел нескорректированного Р-значения <5×10-8, однако, авторы обнаружили обогащение ассоциированных аллелей. Из 35 протестированных локусов (общее количество вариантов - 42) было пять аллелей с нескорректированным P<0,0004 (меньше одного случайного результата, P=4,4×10-12), и с P<0,05 после поправки Бонферрони для 35 заранее заданных локусов. Для каждого из пяти вариантов, SLE-ассоциированный аллель соответствовал ранее опубликованному аллелю и имел такое направление эффекта (таблица 6). Авторы наблюдали высоко достоверную ассоциацию несмыслового аллеля IFIH1 (rs1990760, P=3,3×10-7), который ранее был сцеплен с диабетом I типа и болезнью Грейвса (Smyth, D.J. et al., Nat Genet 38:617-9 (2006); Sutherland, A. et al., J Clin. Endocrinol. Metab 92:3338-41 (2007)). Авторы также наблюдали ассоциацию с несмысловым аллелем (R32Q) фактора комплемента В (CFB, rs641153), который находится в области HLA класса III и представляет собой валидированный аллель риска для возрастной макулярной дегенерации (Gold, B. et al., Nat Genet 38:458-62 (2006)). Аллель риска SLE не находится в достоверном неравновесном сцеплении (LD) с другими вариантами HLA, сцепленными с SLE (DR2/DR3), и оставалась достоверной после условного логистического регрессионного анализа, который включал DR2 и DR3. HLA представляет собой комплексную генетическую область, но поразительно, что аллель SNP rs641153 обладает защитным эффектом, практически идентичным опубликованному аллелю риска AMD (Gold, B. et al, Nat Genet 38:458-62 (2006)). Предполагается дополнительное исследование пяти потенциальных аллелей, связанных с заболеванием.

Кроме того, в таблице 7 приведена подробная сводная статистика для 42 вариантов, идентифицированных в других аутоиммунных заболеваниях. Следует отметить, что варианты из CTLA4, IL23R, NOD2 и CD40, которые представляют собой достоверные факторы риска других аутоиммунных заболеваний, по-видимому, не имеют никакой ассоциации с SLE.

С использованием 26 аллелей риска SLE (21 ранее опубликованных локусов в таблице 2 плюс 5 новых SLE-локусов, описанных выше) были проведены несколько дополнительных анализов. Был проведен парный анализ взаимосвязей с подтвержденными локусами, и согласно предшествующим литературным данным по SLE (Harley, J.B. et al., Nat Genet 40:204-10 (2008)) и другим комплексным заболеваниям (Barrett, J.C. et al., Nat Genet 40:955-62 (2008)), не наблюдалось никаких доказательств относительно неаддитивных взаимодействий. Используя условный логистический регрессионный анализ, авторы не обнаружили доказательств того, что несколько независимых аллелей вносят вклад в риск по любому из индивидуальных локусов риска. Авторы затем оценили процентную долю изменчивости, отнесенную за счет каждого из подтвержденных аллелей риска SLE, с использованием способов, описанных Barrett et al. (Barrett, J.C. et al., Nat Genet 40:955-62 (2008)). HLA-DR3, IRF5 и STAT4, каждый, предположительно, отвечает более чем за 1% генетической изменчивости, в то время как для остальных локусов, каждый отвечает менее чем за 1% изменчивости. В итоге, 26 локусов риска SLE объясняют предположительно 8% общей генетической предрасположенности к SLE.

Направленная репликация GWAS является эффективной схемой исследования для подтверждения дополнительных локусов риска (Hirschhorn, J.N. et al., Nat Rev Genet 6:95-108 (2005)). Однако существует очень мало доступных данных из-за результатов репликации, которые не достигают приемлемого критерия Р-значения для полногеномной достоверности. В настоящем исследовании все варианты с P<0,05 из исходных GWAS-исследований включали в репликационное исследование. Как показано на фиг.3, чем ниже Р-значение было в GWAS-исследовании, тем выше была вероятность достижения предположительного или подтвержденного статуса в репликационном мета-анализе. Интересно, что в настоящем исследовании не было получено ни предположительных, ни подтвержденных результатов от группы вариантов с Р (вычисленной в GWAS) между 0,05 и 0,01, несмотря на то, что эта группа насчитывает примерно 50% всех вариантов, протестированных в репликационном исследовании. Эти результаты могут быть полезны при разработке будущих схем направленных исследований, хотя, конечно, размер исходной GWAS-популяции, размер репликационного образца, структура заболевания и степень влияния предположительных вариантов также необходимо тщательно учитывать при планировании репликационных исследований.

Эти данные обеспечивают дополнительное доказательство того, что общая вариация в генах, важных для функционирования приобретенной и врожденной ветвей иммунной системы, важны для установления риска развития SLE. Хотя каждый из идентифицированных аллелей отвечает только за часть общего генетического риска, данные и другие планируемые исследования способствуют пониманию патогенеза волчанки и позволяют предложить новые мишени и сигнальные пути для поиска и разработки лекарственных соединений.

Пример 2

Повторное секвенирование и идентификация каузального аллеля для BLK

Как обсуждалось выше, BLK был идентифицирован как локус риска, ассоциированный с SLE, который достигает полногеномной достоверности (P<5×10-8). Для дополнительного описания генетического базиса данной ассоциации и для идентификации каузального аллеля (каузальных аллелей), авторы провели исследования по повторному определению нуклеотидной последовательности (повторное секвенирование) BLK-локуса и анализ экспрессии репортерного гена, описанные ниже.

Для повторного секвенирования были повторно определена нуклеотидная последовательность всех 13 экзонов и 2,5 т.п.о. расположенной в 5'-области от них промоторной последовательности BLK-локуса, в ДНК, выделенной у 192 пациентов из Объединенной сети по определению биомаркеров аутоиммунных заболеваний (ABCoN) (Bauer et al., PLoS medicine 3(12):e491 (2006)), спонсируемого NIH/NIAMS репозитория и у 96 контрольных индивидуумов Нью-Йоркского проекта по изучению раковых заболеваний (NYCP) (Mitchell et al., J. Urban Health 81:301-10 (2004)). Перед секвенированием проводили полногеномную амплификацию геномной ДНК согласно протоколу изготовителя (Qiagen, Valencia, CA., кат. № 150045).

Повторное секвенирование показало, что 17 мутаций (10 несинонимичных, 7 синонимичных) были найдены в кодирующей области BLK-гена (таблица 8). Ни одна из этих мутаций не показывала достоверно высокой частоты встречаемости в случаях относительно контролей. Общая частота несинонимичных мутаций не была достоверно выше в случаях (14/191) относительно контролей (7/96).

Кроме того, в некодирующей области BLK были идентифицированы множество общих вариаций (показаны в таблице 9). Для трех SNP (rs4840568, rs1382568 [три-аллельный SNP (A/C/G); C-аллель был ранее идентифицирован как аллель риска] и rs922483 (SEQ ID NO:13)) была показана ассоциация с локусом, ранее идентифицированным в GWAS (Horn et al., N Engl J Med 358:900-09 (2008)) (rs13277113, отношение шансов, 1,39, P=1×10-10) с r2>0,5. На фиг.4 показан блок неравновесного сцепления (показан в r2) внутри промоторной области BLK, который был получен с помощью Haploview (программного обеспечения, свободно доступного по адресу URL: www.broadinstitute.org/haploview/haploview; см. Barrett J.C., et al., Bioinformatics 21:263-65 (2005). На верхней части фигуры показана схематичная диаграмма промоторной области BLK с указанным относительным расположением идентифицированных SNP. Величина r2 между перечисленными SNP показана в квадратиках. Степень LD между двумя SNP указана величиной r2, приведенной в каждом квадратике. Локусы, идентифицированные в GWAS (rs13277113) и три SNP, идентифицированные в результате повторного секвенирования (rs4840568, rsl382568 и rs922483 (SEQ ID NO:13)), обведены черной рамкой в верхней части фигуры.

Повторное секвенирование не выявило никакой общей вариации в кодирующей области BLK. Однако три общих варианта (rs4840568, rs1382568 и rs922483 (SEQ ID NO:13)) были идентифицированы в промоторной области в качестве потенциальных каузальных аллелей биологических эффектов BLK, ассоциированных с повышенным риском SLE. Каждый из этих вариантов использовали в люциферазном репортерном анализе, подробно описанном ниже, для дополнительной характеристики ассоциации.

Репортерный анализ с использованием гена люциферазы проводили для изучения эффекта трех SNP, rs4840568, rs1382568 и rs922483 (SEQ ID NO:13) на BLK-опосредованную экспрессию гена. Последовательность в 5'-области (от -2256 до +55 п.о.) гена BLK амплифицировали, используя геномную ДНК индивидуумов, несущих рисковый или безрисковый гаплотип. Каждый продукт ПЦР клонировали в вектор pCR2.1-TOPO (Invitrogen, Carlsbad, CA; кат. № K4500-01) и затем переклонировали в люциферазный репортерный вектор pGL4 (Promega, Madison, WI; кат. № E6651). Конструкцию, которая несет безрисковый гаплотип, использовали в качестве матрицы для мутагенеза (Stratagene, La Jolla, CA; кат. № 10519-5) для создания различных гаплотипов.

Используемые в ПЦР-амплификации праймеры были следующими: прямой: CCACCTCTCTTCCGCCTTTCTCAT (SEQ ID NO:1); обратный: TTTCATGGCTTGTGGCTTTCTGCC (SEQ ID NO:2). Используемые для мутагенеза праймеры перечислены в таблице 10 ниже.

Для нормализации использовали контрольный репортерный вектор с люциферазой из Renilla reniformis, pRL-TK (Promega, Madison, WI; кат. № E2241). Для трансфекции использовали клеточную линию BJAB (бессмертную лимфоидную клеточную линию с характеристиками В-клеток (из костного мозга), у которой отсутствует геном вируса Эпштейна-Барра, и которая получена из трех лимфом человека; Klein et al., Proc. Natl. Acad. Sci. USA 71:3283-86 (1974)), или клеточную линию Daudi (кат. № CCL-213 в Американской коллекции типовых культур (ATCC)). Для каждой трансфекции 5×106 клеток трансфецировали 5 мкг ДНК каждого вектора, используя устройство Amaxa® Nucleofector® (Lonza, WalkersviUe Inc., WalkersviUe, MD (Lonza Group Ltd., Switzerland; кат. № AAD-1001). Для клеток Daudi использовали набор Cell line Nucleofector® Kit L (Lonza, кат. № VCA-1005) вместе с программой A-030 устройства Nucleofector®. Для клеток BJAB использовали набор Cell line Nucleofector® Kit V (Lonza, кат. № VCA-1005) вместе с программой T-020 устройства Nucleofector®. Все трансфекции проводили либо в дупликатах, либо в трипликатах. Клетки инкубировали при 37°C в течение 16 часов после трансфекции. После инкубации клетки собирали и измеряли люциферазную активность, используя набор Dual-Luciferase® Reporter Assay System (Promega, Madison, WI; кат. № E1960) в соответствии с инструкциями изготовителя.

На фиг.5 показаны эффекты каждого из SNP, rs4840568, rs1382568 и rs922483 (SEQ ID NO:13) на BLK-опосредованную экспрессию гена, измеренную в люциферазном репортерном анализе, описанном выше. Полученные мутагенезом различные гаплотипы сравнивали с безрисковым (дикого типа) гаплотипом 22-GAC (незакрашенный столбец в каждой из фиг.5A-F) и рисковым гаплотипом 22-ACT (заштрихованный столбец на каждой из фиг.5A-F).

На фиг.5А и 5В показано, что SNP rs922483 (C>T) (SEQ ID NO:13) приводил к значительному эффекту на BLK-опосредованную экспрессию гена как в клетках BJAB (фиг.5A), так и в клетках Daudi (фиг.5B). По сравнению с безрисковым гаплотипом 22-GAC (незакрашенный столбец), гаплотип 22-GAT показывал сниженную почти на 50% транскрипционную активность в двух клеточных линиях. Гаплотипы с Т-аллелем показывали согласованно более низкую активность, чем гаплотипы с С-аллелями. Пять независимых экспериментов были проведены в клетках BJAB, и шесть независимых экспериментов были проведены в клетках Daudi. Показанные данные представляют собой среднее +/- стандартная ошибка среднего (s.e.m.) для анализа в трипликатах; *p<0,05, **p<0,01, ***p<0,001 (t-тест).

На фиг.5C и 5D показано, что SNP rs1382568 (A>C/G>C) не приводит к какому-либо достоверному эффекту на BLK-опосредованную экспрессию гена в любой клеточной линии. Оба гаплотипа, 22-GCC и 22-GGC (столбцы с пятнистой заливкой, показывали аналогичный уровень люциферазной активности по сравнению с безрисковым гаплотипом 22-GAC (незакрашенный столбец). Пять независимых экспериментов были проведены в клетках BJAB, и шесть независимых экспериментов были проведены в клетках Daudi. Показанные данные представляют собой среднее +/- стандартная ошибка среднего (s.e.m.) для анализа в трипликатах; *p<0,05, **p<0,01, ***p<0,001, ns= не достоверно (t-тест).

На фиг.5Е и 5F показано, что SNP rs4840568 (G>A) не приводит к достоверному эффекту на BLK-опосредованную экспрессию гена в клетках BJAB или клетках Daudi. Разница между гаплотипом 22-AAC (столбец с пятнистой заливкой) и безрисковым гаплотипом 22-GAC (незакрашенный столбец) не была статистически достоверной в клетках BJAB (фиг.5E), но была статистически достоверной в клетках Daudi (фиг.5F). Вероятность того, что А-аллель является каузальным аллелем, значительно снижена с учетом факта, что гаплотип 22-ACC (столбец с пятнистой заливкой) не показывал никакого нарушения в люциферазной активности по сравнению с безрисковым гаплотипом - GAC (незакрашенный столбец) (фиг.5F). Показанные данные представляют собой среднее +/- стандартная ошибка среднего (s.e.m.) для анализа в трипликатах; *p<0,05, **p<0,01, ***p<0,001, ns = не достоверно (t-тест).

Ранее было показано, что (GT)-повтор в области выше промотора BLK может функционировать как энхансер экспрессии гена BLK (Lin et al., J Biol. Chem. 270:25968 (1995)). Поэтому, авторы также протестировали, может ли длина (GT)-повтора влиять на транскрипционную активность промотора BLK. Для проведения этих экспериментов образцы геномной ДНК от индивидуумов, которые несут оба 18(GT)-повтора (SEQ ID NO:14) или 22(GT)-повтора (SEQ ID NO:15), были отобраны для клонирования с использованием стратегии, описанной выше. Итоговые векторы секвенировали, чтобы подтвердить, что они содержали правильное количество (GT)-повторов. Как показано на фиг.6, гаплотипы с 18(GT)-повторами (SEQ ID NO:14) проявляли уровень транскрипционной активности, аналогичный гаплотипам с 22(GT)-повторами (SEQ ID NO:15) в люциферазном репортерном анализе. Показанные данные представляют собой среднее +/- стандартная ошибка среднего (s.e.m.) для анализа в дупликатах, ns = не достоверно (t-тест).

В итоге, данные результаты повторного секвенирования BLK и результаты люциферазного репортерного анализа указывают на то, что SNP rs922483 (C>T) (фиг.7, SEQ ID NO:13) является каузальным аллелем, который приводит к сниженной транскрипции BLK, биологический эффект которой ассоциирован с повышенным риском SLE. Кроме того, результаты показали, что Т-аллель rs922483 (SEQ ID NO:13) снижал уровень экспрессии BLK-опосредованного гена на 50%.

Интересно отметить, что rs922483 (SEQ ID NO:13) находится в эволюционно консервативной области в первом экзоне BLK и в потенциальном сайте инициации транскрипции генов человека. Консенсусная последовательность для Inr-мотива человека была идентифицирована как YYANWYY (нуклеотидный код по IUPAC). Juven-Gershon et al. Dev. Biol. 339:225-229 (2010). В SNP rs922483 (SEQ ID NO:13) второе основание в Inr-области изменено относительно консенсусного мотива. Соответственно, Inr-последовательностью гаплотипа риска SLE являетсся CTACCTC, в то время как Inr-последовательностью гаплотипа «дикого типа» является CCACCTC. Авторы предполагают, что модификация второго основания в консервативном Inr-мотиве могла бы менять аффинность TFIID-транскрипционного комплекса, приводя к наблюдаемой разнице в транскрипции, описанной выше.

1. Способ диагностики волчанки у человека, включающий определение, содержит ли субъект вариацию по меньшей мере в одном локусе риска SLE, причем указанная вариация по меньшей мере в одном локусе представляет собой аллель риска однонуклеотидного полиморфизма (SNP), где указанная вариация по меньшей мере в одном локусе содержит Т-аллель rs849142 JAZF1, и где определение присутствия указанной вариации по меньшей мере в одном локусе указывает, что субъект страдает волчанкой.

2. Способ по п. 1, в котором по меньшей мере один локус дополнительно содержит один из группы, выбранной из из TNIP1, PRDM1, UHRF1BP1 и IL10.

3. Способ по п. 1, в котором вариация по меньшей мере в одном локусе дополнительно включает одну или более из группы, состоящей из С-аллеля rs7708329 TNIP1, А-аллеля rs6568431 PRDM1, G-аллеля rs11755393 UHRF1BP1 и А-аллеля rs3024505 IL10.

4. Способ по п. 1, в котором по меньшей мере один локус дополнительно содержит один из группы, выбранной из IFIH1, CFB, CLEC16A, IL12B и SH2B3.

5. Способ по п. 1, в котором вариация по меньшей мере в одном локусе дополнительно включает одну или более из группы, состоящей из Т-аллеля rs1990760 IFIH1, G-аллеля rs641153 CFB, А-аллеля rs12708716 CLEC16A, G-аллеля rs6887695 IL12B и Т-аллеля rs17696736 SH2B3.

6. Способ по п. 1, где вариация по меньшей мере в одном локусе дополнительно включает Т-аллель rs922483 BLK.

7. Способ по п. 1, где вариацию детектируют по меньшей мере
в двух локусах, или по меньшей мере в трех локусах, или по меньшей мере в четырех локусах, или в пяти локусах.

8. Способ по любому из пп. 1-7, где определение включает осуществление способа, выбранного из метода удлинения праймера; метода аллель-специфичного удлинения праймера; метода аллель-специфичного включения нуклеотидов; метода аллель-специфичной гибридизации олигонуклеотидов; метода с использованием 5′-нуклеаз; метода с использованием молекулярных маячков; и метода лигирования олигонуклеотидов.



 

Похожие патенты:

Изобретение относится к молекулярной биологии и может быть использовано при проведении медико-биологических исследований. Предложен способ подготовки суспензии лимфоцитов человека в этанол-уксусном фиксаторе для выделения ДНК, включающий центрифугирование указанной суспензии и удаление надосадочной жидкости.

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики, ветеринарной медицины, в частности к набору олигодезоксирибонуклеотидов для амплификации и детекции видоспецифичного фрагмента ДНК Anaplasma marginale методом полимеразной цепной реакции (ПЦР) в режиме «реального времени».

Изобретение направлено на композиции и способы выделения, обнаружения, амплификации и количественной оценки патоген-специфичных нуклеиновых кислот в биологическом образце.

Группа изобретений относится к биохимии. Описан набор реагентов для выявления ДНК Neisseria gonorrhoeae в образце, включающий по меньшей мере два олигонуклеотидных праймера для полимеразной цепной реакции и, при необходимости, олигонуклеотидный зонд, термостабильную ДНК-полимеразу, буферный раствор для ПЦР, дезоксинуклеозидтрифосфаты, отличающийся тем, что первый олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 1, второй олигонуклеотидный праймер имеет нуклеотидную последовательность SEQ ID NO: 2.

Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени.

Изобретение относится к области биохимии, в частности к способу определения зиготности аллеля мутанта bm3 и аллеля СОМТ дикого типа с использованием ткани растения кукурузы.

Настоящее изобретение относится к способам выявления лиц с промежуточной возрастной макулодистрофией (ВМД), характеризующихся повышенным риском прогрессирования ВМД до поздней стадии, с помощью полигенного показателя, рассчитываемого на основании результатов полногеномного исследования генных ассоциаций, использующего тысячи однонуклеотидных полиморфизмов (ОНП).
Изобретение относится к биохимии, в частности к способу диагностики существования или наличия высокого риска гипертиреоза у животного семейства кошачьих и набору для его осуществления.

Группа изобретений относится к области геномики. Предложены способ выявления вариации числа копий в образце генома и система, используемая для осуществления способа.

Изобретение относится к области медицинской и молекулярной генетики, а именно к генетическим конструкциям. Способ определения уровня экспрессии генов Trim5a-ch и Trim5a-hum в образцах клеточной суспензии, предварительно обработанных генотерапевтическим лекарственным средством, в состав которого входит химерный ген Trim5a, предусматривает: выделение нуклеиновых кислот из образцов клеточной суспензии; обработку выделенных нуклеиновых кислот с помощью ДНКазы с получением тотальной клеточной РНК без примеси ДНК; проведение полимеразной цепной реакции, совмещенной с обратной транскрипцией, с использованием полученной тотальной клеточной РНК с детекцией продуктов в режиме реального времени с получением кривых накопления флуоресцентного сигнала; расчет нормализованных концентраций мРНК TRIM5a-ch и мРНК TRIM5a-hum в исследуемых образцах, характеризующих уровень экспрессии, на основании значений копий кДНК TRIM5a-ch и кДНК TRIM5a-hum и кДНК гена бета-глюкоронидазы в пробе ПЦР, полученных из кривых накопления флуоресцентного сигнала, причем расчет проводят по формуле: нормализованная концентрация мРНК TRIM5a = Число копий кДНК TRIM5a/число копий кДНК gus, где gus, - это "house-keeping" ген бета-глюкоронидазы человека.

Изобретение относится к фармацевтической промышленности, а именно к экстракту Helichrysum gymnocephalum (DC) Humbert для ингибирования синтеза меланина, содержащему молекулы формулы (I) в определенном количестве на 100 г сухого вещества экстракта где - одинарная связь или двойная связь; R1=Н или СН3 и R2=Н или ОН. Способ получения экстракта Helichrysum gymnocephalum (DC) Humbert, включающий определенные этапы.
Изобретение относится медицине, а именно к анестезиологии и реаниматологии, и может быть использовано при проведении общей управляемой гипертермии человеческого организма.

Изобретение относится к медицине. Описано противоопухолевое средство, содержащее в качестве активного ингредиента диоксид углерода.

Изобретение относится к медицине, а именно к вакцинопрофилактике. Предложена композиция вакцины, содержащая один или более антигенов, и адъювант, содержащий олеиновую кислоту и моноолеин для применения в интраназальной вакцинации пациента.

Изобретение относится к области медицины и токсикологии, в частности, лечебно-профилактическому питанию населения в зонах экологического неблагополучия. Раскрыт способ приготовления антимутагенного продукта в виде мармелада из смеси соков крыжовника обыкновенного (Ribes uva-crispa L.) и клубней топинамбура (Helianthus tuberosus L.), включающий получение с помощью прессования диффузионных соков крыжовника обыкновенного и топинамбура, концентрирование соков упариванием до уменьшения объема в 2 раза, смешивание концентрированных соков в объемном соотношении 1:1 и выпаривание в течение 3-4 часов на водяной бане до студнеобразования или содержания сухих веществ 68-70%.

Настоящее изобретение относится к способу получения фармацевтической композиции, содержащей деферазирокс. Способ включает стадии получения дисперсии деферазирокса с по меньшей мере одним эксципиентом в воде, гомогенизирования деферазирокса и по меньшей мере одного эксципиента до получения гомогенной дисперсии деферазирокса и измельчения указанной гомогенной дисперсии до получения взвеси со средним размером частиц менее или равным 2000 нм.
Изобретение относится к медицине, а именно к косметической медицине и офтальмологии, и касается коррекции эпикантуса. Для этого осуществляют инъекцию геля стабилизированной гиалуроновой кислоты неживотного происхождения плотностью 22 мг/мл.

Изобретение относится к медицине, а именно к лечебной косметологии, и может быть использовано для лечения и профилактики синдрома хронической усталости. Для этого пациенту вводят препарат Лаеннек курсом 5-10 процедур внутримышечно по 1-3 мл в трапециевидную мышцу шейно-воротниковой зоны и по 1-3 мл в ягодичную мышцу 2 раза в неделю, препарат Энтеросан по 100-300 мг в виде капсул 3 раза в день, за 10-15 минут до еды, 10-20 дней.
Изобретение относится к медицине, в частности к фармации и косметологии, и предназначено для обесцвечивания слизистых оболочек и кожи в местах кровоподтеков. Раскрыто отбеливающее средство, представляющее собой водный раствор для инъекций под слизистую оболочку, под кожу или внутрь кожи, содержащий натрия этилендиаминтетраацетат, перекись водорода, натрия гидрокарбонат, лидокаина гидрохлорид и воду для инъекций при следующем соотношении компонентов, мас.%: Натрия этилендиаминтетраацетат 0,25 Перекись водорода 0,01-0,03 Натрия гидрокарбонат 1,7 Лидокаина гидрохлорид 0,125-0,25 Вода для инъекций - остальное Изобретение обеспечивает эффективное и безопасное инфильтрационное обезболивание и отбеливание тканей при кровоподтеках, отсутствие токсического действия после всасывания раствора в кровь, безболезненность инъекций раствора под слизистую оболочку, под кожу и внутрь кожи, исключает местное раздражающее действие раствора на ткани и их постинъекционное воспаление и некроз. .

Изобретение относится к медицине и касается средства для предотвращения, замедления прогрессирования и/или лечения состояний, в патогенез которых вовлечен фермент ДПП-4, содержащего действующее вещество и фармацевтически приемлемый носитель или носители.

Изобретение относится к медицине и может быть использовано для повышения устойчивости организма к хроническому комбинированному токсическому действию наночастиц оксида никеля и оксида марганца у лиц, относящихся к группе риска. Для этого назначают комплекс биологически активных препаратов, включающий 300 мг глицина, 600 мг цистеина, 4 г глютаминовой кислоты, 25 мл рыбьего жира с 12-15%-ным содержанием полиненасыщенных жирных кислот класса омега-3, 4-5 г пектина, а также селен, йод и витамины А, С, Е. Причем лица группы риска принимают этот комплекс повторными курсами 1-2 раза в год в течение 4-6 недель ежедневно в дозах, обеспечивающих получение в день 300 мг глицина, 600 мг цистеина, 4 г глютаминовой кислоты, 25 мл рыбьего жира с 12-15%-ным содержанием полиненасыщенных жирных кислот класса омега-3, 4-5 г пектина, а также селен, йод и указанные витамины в дозах, обеспечивающих нормальные физиологические потребности организма. Изобретение позволяет снизить токсический и генотоксический эффекты при комбинированном воздействии наночастиц оксида никеля и оксида марганца. 5 табл., 6 ил.
Наверх