Способ обнаружения днк вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней (АЧС). Изобретение позволяет повысить точность обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени. Способ обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени включает выделение ДНК с использованием контрольных образцов (контроль качества выделения вируса и контроль специфики реакции); амплификацию ДНК с использованием синтетических праймеров и флуоресцирующего зонда, включающую денатурацию при 95°С, циклирование: денатурация - отжиг - элонгация и оценку результата по кривым накопления флуоресцентного сигнала по каждому из заданных каналов. В качестве контроля качества выделения вируса используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней. В качестве контроля специфики реакции используют рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи. Синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, взяты в соотношении 1:1:0,5 и имеют следующий нуклеотидный состав: SEQ NO 1:5'-CTG-CTC-ATG-GTA-TCA-ATC-3' - прямой праймер, SEQ NO 2:5'-GAT-ACC-ACA-AGA-TCG-CCG-3' - обратный праймер, SEQ NO 3:5'-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3' - флуоресцирующий зонд, где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду С. Амплификацию проводят при следующем режиме: денатурация при 95°С в течение 90 с, затем циклирование с детекцией, включающей денатурацию при 95°С в течение 15 с, отжиг - 60°С - 30 с и элонгацию - 72°С в течение 4 с. Цикл: денатурация - отжиг - элонгация повторяется 40 раз. Затем накопление флуоресцентного сигнала измеряют по каналам: FAM для специфического сигнала; HEX для сигнала внутреннего контроля; CY5 для сигнала экзогенного внутреннего контроля. Если кривые накопления флуоресцентного сигнала выходят до 36 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 36 цикла, то результат реакции - отрицательный. 1 табл., 9 ил.

 

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней (АЧС) как в практике ветеринарной службы, так и для научных исследований.

Африканская чума свиней (АЧС) является наиболее опасной болезнью для свиней, способной привести к катастрофическим последствиям для свиноводства любой страны. Клинические признаки и патологоанатомические изменения имеют значительное сходство с симптомами, которые наблюдают при классической чуме свиней, поэтому при лабораторных исследованиях эти болезни всегда необходимо дифференцировать.

Известно использование для диагностики африканской чумы свиней олигонуклеотидных праймеров с электрофоретическим учетом результатов амплификации. При таком методе постановки реакции отсутствует возможность количественного определения нуклеиновой кислоты инфекционных агентов в исследуемом материале. Также при наличии стадии электрофореза возрастает риск контаминации лаборатории продуктами ПЦР. При использовании ПЦР с гибридизационно-флуоресцентным учетом результатов есть возможность количественного определения нуклеиновых кислот с регистрацией и интерпретацией полученных результатов в режиме реального времени, что позволяет увеличить достоверность диагностики (Екимов А.Н., Шипулин Г.А., Бочкарев Е.Г., Рюмин Д.В. Новейшие технологии в генодиагностике: полимеразная цепная реакция в реальном времени (Real-Time PCR) // Вестник последипломного медицинского образования. - 2001. - №3. - С. 7-10).

Известны научные публикации, в которых описано применение ПЦР для выявления и идентификации вируса африканской чумы свиней в биологических образцах (J of Virol. Meth. - 2003 - №107. - P. 53-61; J of Virol. Meth. - 2006 - №136. - P. 200-209; J of Virol. Meth. - 2011 - №178. - P. 161-170; J of Trans-boundary and Emerg. Des. - 2013 - №60. - P. 48-58), а также известен ряд патентов (RU №2125089 C1, RU №2360971 C1, US 20140004504 № A1, CN №101921878 A, CN №103320536 A, CN 103757134 В). В перечисленных публикациях и патентах описаны различные форматы ПЦР, которые применяются для диагностики АЧС, в том числе с детекцией в агарозном геле и с гибридизационно-флуоресцентной детекцией.

Наиболее близким по технике выполнения и формату ПЦР является техническое решение (см. патент РФ №2595373, кл. C12Q 1/68, 2016), в котором обнаружение ДНК вируса осуществляют методом полимеразной цепной реакции в режиме реального времени, путем выделения ДНК с использованием образцов: для контроля качества выделения вируса, контроля специфики реакции и набора синтетических праймеров и флуоресцирующего зонда для выявления ДНК вируса, взятых в равных соотношениях, проведение амплификации, включающей денатурацию при 95°С, циклирование: денатурация - отжиг - элонгация и оценка результата по кривым накопления флуоресцентного сигнала по каждому из заданных для образцов каналов.

Недостаток известного способа заключается в том, что не может быть использован для выявления фрагмента гена vp72 вируса африканской чумы свиней из-за неспецифичности праймеров и зонда для африканской чумы, фрагмента гена vp72 вируса африканской чумы.

Техническим результатом является повышение точности обнаружения ДНК вируса африканской чумы свиней методом ПНР в реальном времени за счет конструирования набора, содержащего пару специфичных олигонуклеотидных праймеров и ДНК-зонд, а также подбора условий для проведения ПЦР с ними, обеспечивающего минимальный риск контаминации в лаборатории при проведении анализа, а также исключающего субъективность при оценке результатов ПЦР.

Технический результат достигается тем, что в способе обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени, содержащем выделение ДНК с использованием контрольных образцов: для контроля качества выделения вируса, контроля специфики реакции; амплификацию ДНК с использованием синтетических праймеров и флуоресцирующего зонда, включающую денатурацию при 95°С, циклирование: денатурация - отжиг - элонгация; и оценку результата по кривым накопления флуоресцентного сигнала по каждому из заданных каналов, согласно изобретению используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней в качестве контроля качества выделения вируса, рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи в качестве контроля специфики реакции, а синтетические олигонуклеотидные праймеры и флуоресцирующий зонд взяты в соотношении 1:1:0,5, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеют следующий нуклеотидный состав:

SEQ NO 1 :5'-CTG-CTC-ATG-GTA-TCA-ATC-3' - прямой праймер,

SEQ NO 2 :5'-GAT-ACC-ACA-AGA-TCG-CCG-3' - обратный праймер,

SEQ NO 3 :5'-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3' - флуоресцирующий зонд, где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду С, при этом амплификацию проводят при следующем режиме: денатурация при 95°С в течение 90 с, затем циклирование с детекцией, включающей денатурацию при 95°С в течение 15 с, отжиг - 60°С - 30 с и элонгацию - 72°С в течение 4 с, причем цикл: денатурация - отжиг - элонгация повторяется 40 раз, затем накопление флуоресцентного сигнала измеряют по каналам: FAM для специфического сигнала; HEX для сигнала внутреннего контроля; CY5 для сигнала экзогенного внутреннего контроля, при этом если кривые накопления флуоресцентного сигнала выходят до 36 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 36 цикла, то результат реакции - отрицательный.

Сущность изобретения поясняется чертежом, где представлены графики из отчета работы прибора Rotor-Gene 6000 при использовании Real-time PCR:

на фиг. 1 представлен график канала FAM - искомая ДНК АЧС для отрицательного образца;

на фиг. 2 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - отрицательный образец;

на фиг. 3 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - отрицательный образец;

на фиг. 4 представлен график канала FAM - искомая ДНК АЧС для положительного образца;

на фиг. 5 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - положительный образец;

на фиг. 6 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - положительный образец; на фиг. 7 представлен график канала FAM - искомая ДНК АЧС для сомнительного образца;

на фиг. 8 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - сомнительный образец;

на фиг. 9 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - сомнительный образец.

Способ обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени осуществляется следующим образом.

Для контроля стадии выделения ДНК вируса африканской чумы свиней используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней в качестве контроля качества выделения вируса, а рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи в качестве контроля специфики реакции. Конструирование специфических праймеров и зонда осуществляли с помощью компьютерных программ на основании анализа нуклеотидных последовательностей референтных штаммов и изолятов, опубликованных на ресурсе GenBank, и подбора условий для проведения ПЦР в реальном времени с применением разработанных праймеров и зонда, несущего флуорофор и тушитель, и комплементарного части амплифицируемого со специфическими праймерами фрагмента. Пара синтетических олигонуклеотидных праймеров и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, взяты в соотношении 1:1:0,5 и имеют следующий нуклеотидный состав:

SEQ NO 1 :5'-CTG-CTC-ATG-GTA-TCA-ATC-3' (прямой праймер),

SEQ NO 2 :5'-GAT-ACC-ACA-AGA-TCG-CCG-3' (обратный праймер),

SEQ NO 3: 5'-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3' (флуоресцирующий зонд), где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду С.

Постановка реакции отличается тем, что амплификационная смесь уже готова для использования в следующем режиме (для Rotor-Gene 6000):

1. Удержание температуры 95°С - 90 с

2. Циклирование с детекцией 95°С - 15 с

60°С - 30 с - Детекция (отжиг с считыванием)

72°С - 40 с - элонгация

Цикл повторяют 40 раз.

Для разработки способа диагностики генома вируса африканской чумы свиней осуществлялись в несколько этапов.

1. Анализ структуры генома вируса африканской чумы свиней.

2. Конструирование праймеров и зонда.

3. Подбор оптимальной пары праймеров и зонда.

4. Моделирование состава реакционной смеси способа диагностики с использованием разработанной пары праймеров и зонда.

5. Отработка условий способа диагностики АЧС с использованием разработанной пары праймеров и зонда.

6. Определение чувствительности способа диагностики АЧС с использованием разработанной пары праймеров и зонда.

7. Определение специфичности способа диагностики АЧС с использованием разработанной пары праймеров и зонда.

При конструировании праймеров и зонда основными требованиями были: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри олигонуклеотидов и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига праймеров.

Разработанные олигонуклеотиды имеют оптимальные размер (24-25 пл.) и GC состав (45,8 и 48%), температуру отжига праймеров 55°С, температуру отжига зонда до 72°С.

Состав реакционной смеси подбирали таким образом, чтобы концентрация ионов MgCl2 была в пределах 2,0-2,5 мМ, что обеспечивает оптимальную скорость и точность работы фермента Taq-полимеразы, концентрация дНТФ - не более 2,5 мМ, концентрация каждого праймера - 1,5 пмоль/мкл, зонда - 0,75 пмоль/мкл и объем пробы - 10 мкл.

Отработку условий ПЦР с использованием разработанных олигонуклеотидов осуществляли на амплификаторе Rotor-Gene 6000 (Corbett Research Pty Ltd., Австралия).

Температурно-временной режим проведения ПЦР представлен в таблице.

Оценка результата по кривым накопления флуоресцентного сигнала по каждому из заданных для образцов каналов проводилась по графикам из отчета работы прибора Rotor-Gene 6000 при использовании Real-time PCR.

Для отрицательного образца

Фиг. 1. Канал FAM - искомая ДНК АЧС (фиолетовый цвет). Из исследуемых образцов не вышел. Регистрируется только сигнал контрольного образца (красный цвет).

Фиг. 2. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (фиолетовый цвет) - выходят позже графика положительного контрольного образца (красный цвет), что говорит о незначительном ингибировании реакции.

Фиг. 3. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС (фиолетовый цвет). График экзогенного внутреннего контроля выделения и графики исследуемых образцов совпадают, что говорит, что реакция прошла успешно.

Для положительного образца

Фиг. 4. Канал FAM - искомая ДНК АЧС (синий цвет) - флуоресцентно сигнал начал накапливаться до 36 цикла, его можно считать положительным, Отрицательный контрольный образец не вышел - контаминации контроля нет.

Фиг.5. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (синий цвет) - накопление флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Черный график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

Фиг. 6. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - накопление флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Черный график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график – положительный.

Для сомнительного образца

Фиг. 7. Канал FAM - искомая ДНК АЧС (синий цвет) - по графику видно, что и отрицательный контрольный образец, и исследуемый образец вышли до 36 цикла, это говорит о возможной контаминации.

Фиг. 8. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (синий цвет) - накопление флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Фиолетовый график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

Фиг. 9. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - накопление флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Фиолетовый график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

При учете результата threshold (порог) устанавливали вручную на уровне 10% от максимального уровня флуоресценции в последнем цикле амплификации. Уровень threshold составил не более 0,02. Значения показателя «Ct» были на уровне 24-25. В положительных образцах кривая флуоресценции пересекает линию threshold и, в зависимости от интенсивности сигнала, возвышается над линией более или менее. В отрицательных образцах и отрицательном контроле флуоресценции не наблюдается, что отражается прямой детекции на уровне или ниже линии threshold.

Пример конкретного осуществления способа обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени.

Пример 1. Для анализа методом ПЦР были взяты 2 пробы тканей селезенки от свиней, признанных больными африканской чумой свиней на основании ПЦР-исследований набором производства ГНУ ВНИИВВиМ, г. Покров. В процессе ПЦР в пробах были получены кривые флуоресценции, пересекающие линию threshold, при отсутствии таковой в отрицательном контроле. Это свидетельствует о воспроизводимости результатов проведенных опытов.

Пример 2. Применение реакции амплификации для выявления ДНК вируса африканской чумы свиней, с использованием разработанных специфических олигонуклеотидных праймеров и зонда.

Для анализа методом ПЦР были взяты 6 проб тканей селезенки свиней. В процессе ПЦР во всех пробах были получены кривые флуоресценции, пересекающие линию threshold, при отсутствии таковой в отрицательном контроле. Значения показателя «Ct» составило от 32 до 36. Это свидетельствует о воспроизводимости результатов проведенных опытов.

Предложенный способ диагностики позволяет количественно выявлять на ранних стадиях высококонсервативную область гена VP72 вируса африканской чумы свиней. Применение олигонуклеотидного зонда позволяет повысить чувствительность и специфичность способа, исключить субъективность при оценке результатов. Использование предлагаемой модификации ПЦР позволяет значительно снизить возможность контаминации образцов, помещения, оборудования и реактивов, а также сократить сроки проведения анализа, что важно как для владельцев животных, так и для ветеринарных специалистов.

Предложенный способ диагностики апробирован с положительными результатами и регулярной воспроизводимостью этих результатов в 2016 году на 8 пробах тканей селезенки свиней, признанных больными африканской чумой свиней на основании ПЦР-исследований набором производства ГНУ ВНИИВВиМ, г. Покров.

Работу проводили на базе ФГБОУ ВО «Краснодарский ГАУ».

Способ обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени, содержащий: выделение ДНК с использованием контрольных образцов: для контроля качества выделения вируса, контроля специфики реакции; амплификацию ДНК с использованием синтетических праймеров и флуоресцирующего зонда, включающую денатурацию при 95°C, циклирование: денатурация - отжиг - элонгация и оценку результата по кривым накопления флуоресцентного сигнала по каждому из заданных каналов, отличающийся тем, что используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней в качестве контроля качества выделения вируса, рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи в качестве контроля специфики реакции, а синтетические олигонуклеотидные праймеры и флуоресцирующий зонд взяты в соотношении 1:1:0,5, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеют следующий нуклеотидный состав:

- прямой праймер,

- обратный праймер,

- флуоресцирующий зонд, где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду C, при этом амплификацию проводят при следующем режиме: денатурация при 95°C в течение 90 с, затем циклирование с детекцией, включающей денатурацию при 95°C в течение 15 с, отжиг - 60°C - 30 с и элонгацию - 72°C в течение 4 с, причем цикл: денатурация - отжиг - элонгация повторяется 40 раз, при этом накопление флуоресцентного сигнала измеряют по каналам: FAM для специфического сигнала; HEX для сигнала внутреннего контроля; CY5 для сигнала экзогенного внутреннего контроля, при этом если кривые накопления флуоресцентного сигнала выходят до 36 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 36 цикла, то результат реакции - отрицательный.



 

Похожие патенты:

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к области биотехнологии, а именно к способу одновременной детекции множества последовательностей нуклеотидов при проведении одной полимеразной цепной реакции.

Изобретение относится к области биохимии, в частности к способу обнаружения присутствия гена aad-12 в трансгенном растении сои, содержащем событие pDAB4472-1606. Также раскрыт набор для использования в указанном способе обнаружения присутствия или отсутствия гена aad-12 в геноме растения сои.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Настоящее изобретение относится к агробиотехнологии. Предложен набор синтетических олигонуклеотидов для выявления вируса крапчатости винограда (Grapevine fleck virus) с использованием метода полимеразной цепной реакции.

Настоящее изобретение относится к агробиотехнологии. Предложен набор синтетических олигонуклеотидов для выявления вируса крапчатости винограда (Grapevine fleck virus) с использованием метода полимеразной цепной реакции.

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней (АЧС). Изобретение предназначено для повышения степени специфичности и чувствительности тест-системы, а также сокращения времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях. Тест-система для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени включает пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд. Используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеющие следующий нуклеитидный состав: - прямой праймер, - обратный праймер, - флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3'-концевому нуклеотиду, а FAM - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановки реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду. 1 табл., 9 ил.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha. Данное изобретение может найти применение в терапии. 4 ил.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha. Данное изобретение может найти применение в терапии. 4 ил.

Изобретение относится к области медицины. Изобретение представляет собой набор специфичных олигонуклеотидных праймеров для видовой идентификации бактерий рода Acinetobacter и определения устойчивости к бета-лактамным антибиотикам, включающий: 2 пары олигонуклеотидных праймеров для амлификации гена rpoB, с нуклеотидными последовательностями atgcgtccaggcgagccaccaac, gcggctgaaa acttattcaa taac, tctg aacgctatga cttatc, atggtcgtgtttgtccaattgaa; 3 пары олигонуклеотидных праймеров для амлификации генов карбапенемаз ОХА-типа (оха-51 и оха-51-like), с нуклеотидными последовательностями gcaccataaggcaaccaccaca, aagtatttaaatgggatggg, agaatgggaaaagaacatgacc, ttggacttgagctcatgtctaag, gcaccataaggcaaccacccgg, aagtatttaaatgggatgcc; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-23, с нуклеотидными последовательностями atctggtgtttaaaatgaataa, gattcatcaatactttgatgaa, tggaagggcgagaaaaggtcat, ggcaagggatataaaaccacaa; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-40, с нуклеотидными последовательностями tgaagctcaaacacagggtgta, taaaaaaagaacttatcctatgtg, ccagtatatcaagagcttgcaag, ccttaaaattacaccagtacaagaag. Способ идентификации бактерий Acinetobacter и определения их устойчивости к бета-лактамным антибиотикам включает выделение ДНК из проб биоматериала или бактериальных культур и проведение ПЦР с синтетическими олигонуклеотидными праймерами, при этом используют предложенный набор олигонуклеотидных праймеров, и в случае обнаружения генов rpoB и оха-51 идентифицируют бактерий рода Acinetobacter, а при наличии генов оха-23 и оха-40, кодирующих карбапенемазы ОХА-23 и ОХА-40, делают вывод об устойчивости анализируемого штамма к антибактериальным препаратам бета-лактамного ряда. Изобретение позволяет идентифицировать бактерии Acinetobacter непосредственно в клиническом материале с одновременным определением устойчивости к карбапенемам ОХА-типа; а также может быть использован при выборе лекарственного препарата, режима лечения и для эпидемиологического контроля. 2 н.п. ф-лы, 2 табл.

Изобретение относится к областям молекулярной биологии и генетики растений, в частности к способу молекулярно-генетической идентификации растений березы на основе микросателлитных (SSR) локусов. Способ включает выделение ДНК из исследуемых образцов, проведение ПЦР, электрофоретическое разделение продуктов амплификации ДНК, документирование результатов ПЦР, определение длин амплифицированных фрагментов ДНК путем сравнения со стандартами молекулярной массы, получение таблицы многолокусных генотипов по микросателлитным локусам, сравнение полученных генотипов с генотипами исходных растений с целью установления идентичности особей и оценку вероятности встречаемости мультилокусных генотипов и случайного совпадения неродственных или родственных генотипов. Изобретение позволяет осуществлять надежную и достоверную идентификацию генотипов березы на индивидуальном уровне. Изобретение может быть использовано для широкого спектра видов рода Betula, являясь, таким образом, универсальным. 4 з.п. ф-лы, 3 табл., 4 ил.

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру: 1 ил., 4 табл.

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру: 1 ил., 4 табл.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов. При выявлении сочетания аллеля С MMР-8 (rs11225395) и генотипа GG MMР-7 (rs11568818) прогнозируют низкий риск развития преэклампсии. Изобретение обеспечивает получение критериев оценки риска развития преэклампсии на основе генов матриксных металлопротеиназ. 3 ил., 3 пр.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов. При выявлении сочетания аллеля С MMР-8 (rs11225395) и генотипа GG MMР-7 (rs11568818) прогнозируют низкий риск развития преэклампсии. Изобретение обеспечивает получение критериев оценки риска развития преэклампсии на основе генов матриксных металлопротеиназ. 3 ил., 3 пр.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования риска развития преэклампсии. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов цитокинов MMР-3, MMР-8 и MMР-12. Минимальный риск развития преэклампсии у женщин с наследственной отягощенностью прогнозируют при выявлении сочетания аллелей А MMР-8 (rs11225395), С MMР-8 (rs1320632), А MMР-12 (rs652438), а у женщин без наследственной отягощенности - при выявлении сочетания аллелей 6А MMР-3 (rs3025058), А MMР-8 (rs11225395), С MMР-8 (rs1320632). Изобретение обеспечивает получение критериев оценки риска развития преэклампсии у женщин с отягощенной и неотягощенной наследственностью. 4 ил., 8 пр.

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней. Изобретение позволяет повысить точность обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени. Способ обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени включает выделение ДНК с использованием контрольных образцов ; амплификацию ДНК с использованием синтетических праймеров и флуоресцирующего зонда, включающую денатурацию при 95°С, циклирование: денатурация - отжиг - элонгация и оценку результата по кривым накопления флуоресцентного сигнала по каждому из заданных каналов. В качестве контроля качества выделения вируса используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней. В качестве контроля специфики реакции используют рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи. Синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, взяты в соотношении 1:1:0,5 и имеют следующий нуклеотидный состав: SEQ NO 1:5-CTG-CTC-ATG-GTA-TCA-ATC-3 - прямой праймер, SEQ NO 2:5-GAT-ACC-ACA-AGA-TCG-CCG-3 - обратный праймер, SEQ NO 3:5-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3 - флуоресцирующий зонд, где BHQ1 означает присоединенный к 3-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду С. Амплификацию проводят при следующем режиме: денатурация при 95°С в течение 90 с, затем циклирование с детекцией, включающей денатурацию при 95°С в течение 15 с, отжиг - 60°С - 30 с и элонгацию - 72°С в течение 4 с. Цикл: денатурация - отжиг - элонгация повторяется 40 раз. Затем накопление флуоресцентного сигнала измеряют по каналам: FAM для специфического сигнала; HEX для сигнала внутреннего контроля; CY5 для сигнала экзогенного внутреннего контроля. Если кривые накопления флуоресцентного сигнала выходят до 36 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 36 цикла, то результат реакции - отрицательный. 1 табл., 9 ил.

Наверх