Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена prok 1 и/или уменьшением количества белка прокинетицина 1 на основе генно-терапевтических субстанций с геном prok 1, способ получения и использования

Изобретение относится к области биотехнологии, конкретно к терапевтическим генно-инженерным средствам, и может быть использовано для коррекции патологических состояний человека, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1. Средство включает генно-терапевтическую субстанцию, выбранную из группы векторных плазмид, включающих кДНК гена PROK 1 с кодирующей последовательностью белка прокинетицина 1 с делециями 5' и 3'-нетранслируемых областей, полученной на основе участка нативной немодифицированной кДНК гена PROK 1 или модифицированной кДНК гена PROK 1. Изобретение обеспечивает высокий уровень экспрессии гена PROK 1 в эукариотических клетках, увеличивая тем самым количество белка прокинетицина 1 в клетках органов и/или тканей человека, в частности в фибробластах, в эндотелиоцитах семенников, надпочечников, яичников и плаценты, в вагине, шейке, придатках матки, отделах головного мозга, мозжечке и гипофизе. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением уровня экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, в частности, в терапевтических целях.

Предшествующий уровень

Ангиогенез подразделяют на два этапа: васкулогенез и собственно ангиогенез. При этом васкулогенез представляет собой процесс образования кровеносных сосудов de novo из мезодермальных клеток-предшественников, тогда как ангиогенез - развитие новых сосудов из сосудов, сформировавшихся во время васкулогенеза. Ангиогенез начинается с секреции растворимого ангиогенного фактора, воздействующего на близрасположенный кровеносный сосуд и приводящего к изменениям в капиллярной стенке в виде деградации базальной мембраны, митотическому делению эндотелиоцитов, их последующей миграцией в строму и протеолитической деградацией экстрацеллюлярного матрикса. На следующем этапе происходит организация сосудистых эндотелиоцитов в трубчатую структуру и инициализация кровотока во вновь сформированном участке.

Ангиогенез не характерен для неповрежденных тканей организма взрослого человека в физиологических условиях и активизируется при патологическом росте тканей при опухолях, остром или хроническом воспалительном процессе, диабетической ретинопатии. Эндометрий и ткани яичника являются уникальным исключением из этого правила, так как процессы циклического ангиогенеза в них происходят ежемесячно.

Процесс ангиогенеза играет важную роль в развитии и нормальном росте тканей, заживлении ран, репродуктивном цикле у женщин (развитие плаценты и желтого тела, овуляции), и вовлечен в патогенез различных заболеваний. Основными медиаторами ангиогенеза являются: фактор роста фибробластов, тромбоцитарный фактор роста, сосудистый эндотелиальный фактор роста (VEGF), трансформирующий фактор роста бета. Известно индуцирующее действие других факторов: плацентарного фактора роста, интерлейкина-8, фактора роста гепатоцитов, колониестимулирующего фактора роста гранулоцитов. Действие индукторов ангиогенеза направлено на эндотелиальные клетки, а также на сосудистые гладкомышечные клетки и фибробласты. Регуляция неоваскуляризации представляет собой динамический процесс тонкого взаимодействия ингибиторов и активаторов ангиогенеза.

Фактор роста, выделяемый клетками эндокринных желез, который получил название прокинетицин 1 (PROK 1). По своей структуре он близок к семейству VEGF и поэтому первоначально был назван сосудистым эндотелиальным фактором роста, выделенным из эндокринных желез (EG-VEGF). Данная молекула вызывала пролиферацию, миграцию и образование мембранных разрывов в эндотелиальных клетках капилляров, полученных из эндокринных желез. При этом прокинетицин 1 практически не оказывал никакого влияния на другие типы тестируемых эндотелиальных и не эндотелиальных клеток. Подобно VEGF, прокинетицин 1 обладает сайтом связывания HIF-1, и его экспрессия индуцируется гипоксией. Оба фактора приводили к обширному ангиогенезу и формированию кисты при их доставке в яичник. Однако, в отличие VEGF, с помощью прокинетицина 1 удалось стимулировать ангиогенез в роговице или скелетной мышце. Прокинетицин 1 (EG-VEGF) является примером класса узкоспециализированных митогенов, которые действуют, чтобы регулировать тканеспецифичные пролиферацию и дифференцировку эндотелия сосудов.

Белок Bv8, который обозначается как прокинетицин 2 (PROK 2) и представляет собой близко связанный секретируемый белок с EG-VEGF (PROK 1). Показано, что Bv8 индуцирует пролиферацию, выживаемость и миграцию клеток эндотелия сосудов коры надпочечников (LeCouter, J. et al, Proc Natl Acad Sci USA 100, 2685-2690 (2003)). Если PROK 1 (EG-VEGF) экспрессируется преимущественно в эндокринных железах и половых органах, то PROK 2 (Bv8) связан преимущественно с нервной системой.

Сигнальная система прокинетицинов представлена двумя парами лиганд/рецептор - парой PROK1/PROKR1, область действия которой ограничивается желудочно-кишечным трактом (здесь продукты этих генов участвуют в запуске действия мотилина - полипептидного гормона, регулирующего моторику желудка и кишечника).

Экспрессия PROK1 выявлена в клетках семенников, надпочечников, яичников и плаценты, а его эффекты ограничены эндотелиоцитами этих органов. Также экспрессия выявлена в вагине, шейке, придатках матки, отделах головного мозга, мозжечке, гипофизе, коре головного мозга, спинном мозге, предстательной железе, сердце, молочных железах, селезенке, скелетной мышечной ткани, мочевом пузыре, желчном пузыре, коже ноги, надлобковой коже, роговице, слизистой оболочке канала шейки матки, подкожной жировой клетчатке, висцеральной жировой ткани (http://www.proteinatlas.org/ENSG00000143125-PROK1/tissue).

В патенте RU 2559542 описана кодирующая нуклеиновая кислота; вектор экспрессии на ее основе для получения антитела к Bv8 (PROK 2); клетка-хозяин для экспрессии антитела на основе вектора, а также способ получения антитела с использованием клетки. Раскрыта фармацевтическая композиция, использующая антитело в эффективном количестве, а также применение антитела - для лечения опухоли, рака или нарушения пролиферации клеток. Предложено применение антитела для снижения или ингибирования ангиогенеза у субъекта, а также для ингибирования пролиферации клеток эндотелия. Использование изобретения обеспечивает новые антитела с аффинностью в отношении Bv8 человека или макака (KD) менее 10-11 М, как измерено методом BIACORE 3000, которые могут найти применение в терапии различных раковых заболеваний.

В заявке WO 2004081229 описано изобретение, которое содержит способы применения полипептидов Bv8 (PROK 2) и EG-VEGF (PROK 1) и соответствующих нуклеиновых кислот для содействия процессу кроветворения. Кроме того, содержит методы скрининга модуляторов для активности Bv8 и EG-VEGF. Кроме того, в заявке предусмотрены способы лечения с использованием полипептидов Bv8 и EG-VEGF или их антагонистов.

За прототип авторами было принято решение по заявке WO 2003/020892, в котором описаны способы применения полипептида Bv8 (PROK 2), чтобы индуцировать пролиферацию эндотелиальных клеток и повысить выживаемость эндотелиальных клеток. Также содержит методы скрининга модуляторов для активности Bv8. Кроме того, в заявке предусмотрены способы лечения с использованием полипептида Bv8. В одном из вариантов реализации изобретения способ включает в себя контактирование клетки с Bv8 в количестве, эффективном для индукции пролиферации клеток. Способ может дополнительно включать в себя контактирование клеток с VEGF. В другом варианте осуществления настоящего изобретения способ включает введение нуклеиновой кислоты, кодирующей Bv8 в клетки в количестве, эффективном для индукции пролиферации клеток.

Недостатком данного подхода является высокая стоимость получения чистого белка, более частое его введение при терапии (что увеличивает стоимость терапии и повышает риск побочных явлений) и сложность внутриклеточной доставки препарата, а также то, что при создании генно-терапевтического средства в этом изобретении не учитываются индивидуальные характеристики пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, на основе генно-терапевтических субстанций с геном PROK 1.

Указанная задача решается за счет того, что создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, на основе генно-терапевтических субстанций с геном PROK 1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена PROK 1, с кодирующей последовательностью белка прокинетицина 1, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена PROK 1 SEQ ID No:1, или модифицированной кДНК гена PROK 1, при этом в качестве модифицированной кДНК гена PROK 1 используют SEQ ID No:2, или SEQ ID No:3, или SEQ ID No:4, или SEQ ID No:5, или SEQ ID No:6, или SEQ ID No:7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена PROK 1 в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить количество белка прокинетицина 1, в клетках органов и тканей и/или органах и тканях человека, в частности в фибробластах, в эндотелиоцитах семенников, надпочечников, яичников и плаценты, в вагине, шейке, придатках матки, отделах головного мозга, мозжечке, гипофизе, коре головного мозга, спинном мозге, предстательной железе, сердце, молочных железах, селезенке, скелетной мышечной ткани, мочевом пузыре, желчном пузыре, коже ноги, надлобковой коже, роговице, слизистой оболочке канала шейки матки, подкожной жировой клетчатке, висцеральной жировой ткани в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. При этом каждая генетическая конструкция с модифицированной кДНК гена PROK 1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена PROK 1, которая несет модификации, не затрагивающие структуру белка прокинетицина 1, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

Способ получения средства для лечения состояний человеческого организма связанного с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, заключается в получении каждой генно-терапевтической субстанции из группы созданных генно-терапевтических субстанций, при этом получают кДНК гена PROK 1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена PROK 1 с кодирующей последовательностью белка прокинетицина 1, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена PROK 1 SEQ ID No:1, или модифицированной кДНК гена PROK 1, при этом в качестве модифицированной кДНК гена PROK 1 используют, или SEQ ID No:2, или SEQ ID No:3, или SEQ ID No:4, или SEQ ID No:5, или SEQ ID No:6, или SEQ ID No:7, или сочетание этих генетических конструкций.

Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, заключается в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.

Описание фигур

На фиг. 1 представлена нуклеотидная последовательность немодифицированной кДНК гена PROK 1 длиной 318 н.п. SEQ ID No:1, которая имеет высокую гомологию с приводимой в базе данных GenBank под номером NM_032414. и кодирует белок прокинетицина 1 (GenBank NP_115790.1).

На фиг. 2 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID No:2, которая содержит 1 нуклеотидную замену G→C в позиции 66 и 1 нуклеотидную замену A→G в позиции 69, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

На фиг. 3 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID No:3, которая

содержит 1 нуклеотидную замену G→C в позиции 66, две нуклеотидных замены A→G в позиции 69, 90, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

На фиг. 4 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID No:4, которая

содержит 1 нуклеотидную замену G→C в позиции 66, 3 нуклеотидных замены A→G в позициях 69, 90, 93, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

На фиг. 5 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID NO:5, которая

содержит 1 нуклеотидную замену G→C в позиции 66, 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

На фиг. 6 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID NO:6, которая

содержит 2 нуклеотидных замены G→C в позициях 66, 207; 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

На фиг. 7 представлена нуклеотидная последовательность модифицированной кДНК гена PROK 1, SEQ ID No:7, которая

содержит 3 нуклеотидных замены G→C в позициях 66, 207, 321; 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186, не приводящих к изменениям в аминокислотной последовательности белка прокинетицина 1.

Фиг. 8. С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена PROK 1 проводили анализ эндогенной экспрессии гена PROK 1 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена PROK 1, фибробласты со сниженной экспрессией гена PROK 1,

2 - кДНК гена PROK 1, фибробласты с нормальной экспрессией гена PROK 1,

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена PROK 1,

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена PROK 1.

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

Фиг. 9. С целью подтверждения увеличения экспрессии гена PROK 1 в клеточной культуре фибробластов со сниженной экспрессией гена PROK 1 при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена PROK 1 с генетической конструкцией pCMV6- PROK 1 SEQ ID No:1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена PROK 1 в фибробластах с нормальной экспрессией гена PROK 1,

2 - кДНК гена PROK 1 в фибробластах со сниженной экспрессией гена PROK 1 до трансфекции ГТС с кДНК гена PROK 1,

3 - кДНК гена PROK 1 в фибробластах со сниженной экспрессией гена PROK 1 после трансфекции ГТС с кДНК гена PROK 1,

4 - кДНК гена PROK 1 в фибробластах со сниженной экспрессией гена PROK 1 после трансфекции вектором без кДНК гена PROK 1,

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена PROK 1,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена PROK 1 до трансфекции ГТС с кДНК гена PROK 1,

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена PROK 1 после трансфекции ГТС с кДНК гена PROK 1,

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена PROK 1 после трансфекции вектором без кДНК гена PROK 1.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена PROK 1 уровень кДНК гена PROK 1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена PROK 1 - уровень кДНК фибробластов со сниженной экспрессией гена PROK 1 многократно увеличился (до уровня выше, чем уровень кДНК гена PROK 1 в нормальных фибробластах).

Фиг. 10. С целью подтверждения увеличения количества белка прокинетицина 1, в клеточной культуре фибробластов с нормальной экспрессией гена PROK 1 при трансфекции данных клеток генно-терапевтической субстанцией содержащей кДНК гена PROK 1 представлен график изменения количества белка прокинетицина 1, нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК гена PROK 1 (культура В) и трансфицированных генно-терапевтической субстанцией с генетической конструкцией pCDNA 3.1-PROK 1SEQ ID No:1 (культура С). Из графика следует, что при трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена PROK 1 происходит увеличение количества белка прокинетицина 1, в клеточном лизате.

Фиг. 11. С целью подтверждения увеличения количества белка прокинетицина 1, в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией, представлен анализ изменения количества белка прокинетицина 1, в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (В) и трансфицированные генно-терапевтической субстанцией с генетической конструкцией pCMV6- PROK 1 SEQ ID No:7 (С) - в кожу голени. Также анализировали количественный уровень белка прокинетицина 1, в интактной коже. Показано повышение количества белка прокинетицина 1, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией кДНК гена PROK 1 (С).

Фиг. 12. С целью подтверждения увеличения количества белка прокинетицина 1 до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток генно-терапевтическими субстанциями с участком нативной немодифицированной кДНК гена PROK 1 и модифицированных кДНК гена PROK 1, представлен анализ изменения количественного уровня белка прокинетицина 1, в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена PROK 1, используемой для трансфекции фибробластов.

Культуры фибробластов 24 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:1, части (В) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:2, части (С) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:3, части (D) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:4, части (E) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:5, части (F) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:6, части (G) трансфицировали генно-терапевтической субстанцией pCMV6-PROK 1 SEQ ID No:7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена PROK 1.

По итогам анализа количественного уровня белка прокинетицина 1, выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка прокинетицина 1, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:1,

в группе 2 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:2,

в группе 3 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:3,

в группе 4 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:4,

в группе 5 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:5,

в группе 6 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:6,

в группе 7 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции pCMV6-PROK 1 SEQ ID No:7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка прокинетицина 1, присутствует при трансфекции вектором без вставки кДНК гена PROK 1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка прокинетицина 1, (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена PROK 1.

Из фигуры следует, что достижение максимального количества белка прокинетицина 1, в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена PROK 1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:1 (A)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:2 (В)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:3 (С)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:4 (D)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:5 (E)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:6 (F)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:7 (G)

части клеточных культур, трансфицированных плацебо (Н)

Фиг. 13. С целью подтверждения увеличения экспрессии гена PROK 1 в клеточной культуре эпителия эндометрия матки при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена PROK 1 в генетической конструкции pCMV6-Kan/Neo PROK 1 SEQ ID No:2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена PROK 1, эпителий эндометрия до трансфекции

2 - кДНК гена PROK 1, эпителий эндометрия после трансфекции

3 - кДНК гена В2М, эпителий эндометрия до трансфекции

4 - кДНК гена В2М, эпителий эндометрия после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена PROK 1 в культуре эпителия эндометрия матки многократно вырос.

Фиг. 14. С целью подтверждения увеличения экспрессии гена PROK 1 в клеточной культуре эпителиальных клеток роговицы глаза человека при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена PROK 1 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена PROK 1, до трансфекции

2 - кДНК гена PROK 1, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена PROK 1 вырос многократно.

Фиг. 15. С целью подтверждения увеличения количества белка прокинетицина 1, в коже человека при введении в кожу генно-терапевтической субстанции представлен анализ изменения количественного уровня белка прокинетицина 1, в коже. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена PROK 1 pCMV6-PROK 1 SEQ ID No:4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в кожу в зоне голени. Показано увеличение количества белка прокинетицина 1, в биоптате кожи пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена PROK 1, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

Фиг. 16. С целью подтверждения увеличения количества белка прокинетицина 1 в хрящевой ткани человека при введении в хрящевую ткань генно-терапевтической субстанции представлен анализ изменения количественного уровня белка прокинетицина 1 хрящевой ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена PROK 1 pCDNA 3.1 PROK 1 SEQ ID No:5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в хрящевую ткань.

Показано увеличение количественного уровня белка прокинетицина 1, в лизате биоптата хрящевой ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена PROK 1, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

Фиг. 17. С целью подтверждения увеличения количества белка прокинетицина 1, в мышечной ткани человека при введении в мышечную ткань генно-терапевтической субстанции представлен анализ изменения количества белка прокинетицина 1, в мышечной ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена PROK 1 - pCMV6-Kan/Neo PROK 1 SEQ ID No:6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка прокинетицина 1, в биоптате мышечной ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена PROK 1, что говорит об эффективности генно-терапевтической субстанции. Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

Фиг. 18. С целью подтверждения увеличения количества белка прокинетицина 1, до различного индивидуального уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными кДНК гена PROK 1 и участком нативной немодифицированной кДНК гена PROK 1 анализировали количественный уровень белка прокинетицина 1 в коже человека в зависимости от наличия и типа модификаций в кДНК гена PROK 1.

Каждому из 23-х пациентов, которые были отобраны в случайном порядке, вводили в кожу голени 7 генно-терапевтических субстанций pCMV6-SEQ ID No:1, pCMV6-SEQ ID No:2, pCMV6-SEQ ID No:3, pCMV6-SEQ ID No:4, pCMV6-SEQ ID No:5, pCMV6-SEQ ID No:6, pCMV6-SEQ ID No:7, и плацебо pCMV6- XL5.

По итогам анализа количества белка прокинетицина 1, в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка прокинетицина 1, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 1 SEQ ID No:1,

в группе 2 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 1 SEQ ID No:2,

в группе 3 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 1 SEQ ID No:3,

в группе 4 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PPOK 1 SEQ ID No:4,

в группе 5 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 1 SEQ ID No:5,

в группе 6 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 1 SEQ ID No:6,

в группе 7 максимальное количество белка прокинетицина 1, наблюдалось при введении pCMV6-PROK 7 SEQ ID No:7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка прокинетицина 1, присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка прокинетицина 1, (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1.

Из данного примера следует, что достижение максимального количества белка прокинетицина 1, в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена PROK 1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента. Обозначения:

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:1 (A)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:2 (В)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:3 (С)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:4 (D)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:5 (E)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:6 (F)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:7 (G)

биоптаты пациентов после введения плацебо (Н)

Фиг. 19. С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количественный уровень белка прокинетицина 1, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими участок нативной немодифицированной кДНК гена PROK 1 или модифицированные кДНК гена PROK 1.

По итогам анализа количества белка прокинетицина 1, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка прокинетицина 1, в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка прокинетицина 1, в лизате наблюдается при трансфекции генно-терапевтической субстанцией на базе pCMV6 PROK 1 SEQ ID No:1, содержащей участок нативной немодифицированной кДНК гена PROK 1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:1 (A)

2 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:2 (В)

3 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:3 (С)

4 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:4 (D)

5 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:5 (E)

6 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:6 (F)

7 - клеточный лизат после трансфекции ГТС PROK 1 SEQ ID No:7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

Фиг. 20. С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка прокинетицина 1, в лизатах биоптатов кожи этого пациента, после введения ему генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 или участки модифицированных кДНК гена PROK 1.

По итогам анализа количества белка прокинетицина 1, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка прокинетицина 1, в лизате биоптата. В данном эксперименте максимальная концентрация белка прокинетицина 1, отмечена при введении генно-терапевтической субстанции на базе pCMV6 PROK 1 SEQ ID No:7, содержащей модифицированную кДНК гена, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:1 (A)

2 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:2 (В)

3 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:3 (С)

4 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:4 (D)

5 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:5 (E)

6 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:6 (F)

7 - лизат биоптата после введения ГТС PROK 1 SEQ ID No:7 (G)

8 - лизат биоптата после введения плацебо (Н) Реализация изобретения.

При снижении экспрессии генов, кодирующих белки, например, гена PROK 1, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Преимущества использования генетической конструкции с геном PROK1 для коррекции количественного уровня белка прокинетицина 1 в клетках органов и тканей человека, по сравнению с использованием белка прокинетицина 1 человека и нуклеиновой кислоты, кодирующей белок прокинетицин 1 человека, решение по заявке WO 2003/020892 (прототип) следующие:

1) легче обеспечить более высокий и стабильный уровень белка в клетках,

2) не требуется сложная и дорогостоящая процедура рефолдинга и очистки белкового препарата,

3) обеспечивается транспортировка генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка генно-терапевтической субстанции.

4) учтены индивидуальные особенности пациентов.

Таким образом, для создания группы генно-терапевтических субстанций по данному изобретению был выбран ген PROK 1, а не белок прокинетицина 1 человека, кодируемый этим геном.

Для получения группы генно-терапевтических субстанций осуществляют следующие действия:

1. Получение участка нативной кДНК гена PROK 1, содержащей белок-кодирующую область гена PROK 1, клонирование его в промежуточную плазмиду, переклонирование его в экспрессионные векторные плазмиды под контроль эукариотических регуляторных элементов для экспрессии целевого гена таким образом, что полученные генетические конструкции содержат кодирующую нуклеотидную последовательность кДНК белка прокинетицина 1, которая является участком нативной немодифицированной кДНК гена PROK 1 и которая используются для дальнейших модификаций.

2. Внесение в последовательность нуклеотидов кДНК гена PROK 1 модификаций с целью создания ряда кДНК гена PROK 1, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка прокинетицина 1.

3. Клонирование участка нативной немодифицированной кДНК гена PROK 1 и полученных на его основе модифицированных кДНК гена PROK 1 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение ряда генетических конструкций, содержащих модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1 для создания на их базе группы генно-терапевтических субстанций.

6. Создание группы генно-терапевтических субстанций (ГТС), каждая из которых включает генетическую конструкцию с модифицированными кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена PROK 1, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или клеток эпителия эндометрия матки, или клеток эпителия глаза.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или клеток эпителия эндометрия матки, или клеток эпителия глаза, и анализ экспрессии гена PROK 1 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или клеток эпителия эндометрия матки, или клеток эпителия глаза генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена PROK 1 и/или модифицированные кДНК гена PROK 1 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена PROK 1 в различных комбинациях.

D) Сравнительный анализ изменения уровня мРНК гена PROK 1 и/или изменения количества белка прокинетицина 1, после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или клеток эпителия эндометрия матки или клеток эпителия глаза генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена PROK 1 и/или модифицированные кДНК гена PROK 1 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена PROK 1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток трансфицированных генно-терапевтической субстанцией с кДНК гена PROK 1, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена PROK 1 и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена PROK 1 и/или введение пациентам в органы и ткани генно-терапевтических субстанций, например, введение в кожу человека генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 и/или модифицированные кДНК PROK 1, а также плацебо в различных комбинация.

F) Сравнительный анализ количества белка прокинетицина 1 в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных генно-терапевтическими субстанциями, содержащими кДНК гена PROK 1 и векторными плазмидами, не содержащими кДНК гена PROK 1 и/или генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 или модифицированные кДНК гена PROK 1, а также плацебо.

G) Введение пациентам в органы и ткани, например, в хрящевую или мышечную ткань, генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 и/или модифицированных кДНК гена PROK 1, а также плацебо.

H) Сравнительный анализ количества белка прокинетицина 1, в органах и тканях человека, в частности в хрящевой или мышечной ткани человека, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 и/или участки модифицированных кДНК гена PROK 1, а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 и участки модифицированных кДНК гена PROK 1.

J) Сравнительный анализ количества белка прокинетицина 1, в органах и тканях пациента, в частности в коже, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена PROK 1 и участки модифицированных кДНК гена PROK 1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента генно-терапевтической субстанции из группы генно-терапевтических субстанций.

Пример 1

Получение и клонирование нативной немодифицированной кДНКгена PROK 1.

Немодифицированная кДНК гена PROK 1 представляет собой последовательность нуклеотидов, которая имеет высокую гомологию с нуклеотидной последовательностью гена и мРНК PROK 1, приведенной в базе данных GenBank под номером NM_032414; нуклеотиды с 52 по 369 транслируются в аминокислотную последовательность белка прокинетицина 1, соответствующую приведенной в GenBank под номером NP_115790.1.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 17-39 5' AAGCAGGCAGTGTTTTGCCTTCA 3' (PROK1-F1) и 817-797 5' CACGTGAAGGGCCTGAGGGTC 3' (PROK1-R1) из последовательности мРНК PROK1 (NM_032414), получают участок нативной немодифицированной кДНК гена PROK 1, содержащий кодирующую последовательность белка прокинетицина 1, и частичные делеции 5' и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами, на амплификаторе Master CyclerGradient (Eppendorf, USA) в 50 мкл реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера PROK1F1 и PROK1R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 с, 35 циклов, включающих денатурацию при +98°С в течение 10 с, отжиг праймеров при +64°С в течение 30 с и элонгацию при +68°С течение 2 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК длиной 801 н.п., несущий участок нативной немодифицированной кДНК гена PROK 1, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой, дающей тупые концы, например, Smal (NEB, USA) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./мл (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°.

Полученной смесью трансформируют компетентные клетки Е.coli Top10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами PROK 1 --F1 и PROK 1 --R1 и подтверждают секвенированием по методу Сэнгера.

Пример 2

Получение генетических конструкций с участком немодифицированной кДНК гена PROK 1

Для экспрессии участка немодифицированной кДНК гена PROK 1 в клетках органов и тканей человека вариант кДНК гена PROK 1 по Примеру 1 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции либо другой фактор селекции не содержащий генов резистентности к антибиотикам;

3) в плазмиде должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) в плазмиде должно быть наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA), либо плазмидные векторы вирусного происхождения - например, аденовирус человека 5-го серотипа.

5) Плазмида может содержать нуклеотидные последовательности с регуляторными элементами для репликации в клетках млекопитающих, например, такие как SV40 ori из вируса обезьян SV40 или ori P/EBNA-1 из вируса Эпштейн-Барра человека.

6) Плазмида также может содержать дополнительные регуляторные элементы, усиливающие трансляцию белка, например, участки связывания с транскрипционным фактором NFkB, обеспечивающим активный транспорт плазмидной ДНК в клеточное ядро для более эффективной транскрипции целевого гена.

При клонировании участка немодифицированной кДНК гена PROK 1 в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину.

При клонировании участка немодифицированной кДНК гена PROK 1 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину.

Векторную плазмиду pUC19-PROK 1 с участком нативной немодифицированной последовательности кДНК гена PROK 1 используют в качестве матрицы для амплификации со следующими парами праймеров:

для ориентации Hind III - PROK 1-Eco RI

PROK1 F2 GGAAGCTTGCCACCATGAGAGGTGCCACG

PROK1 R2 AAGAATTCCTAAAAATTGATGTTCTTCAA

для ориентации Eco RI - PROK 1-Hind III

PROK1 F3 GGGAATTCGCCACCATGAGAGGTGCCACG

PROK1 R3 GGAAGCTTCTAAAAATTGATGTTCTTCAA

Амплификацию проводят при условиях, приведенных в Примере 1. Далее продукты амплификации переосаждают этиловым спиртом, осадки промывают 70% этанолом и растворяют в 1× ТЕ буфере, после чего подвергают рестрикции с эндонуклеазами EcoRI и HindIII.

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке HindIII-5'NTR- кДНК PROK 1 -3'NTR-EcoRI, либо EcoRI -5'NTR-кДНК PROK 1 -3'NTR- HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага Т4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами EcoRI и HindIII и отбирают генетическую(ие) конструкцию с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Таким образом, получают экспрессионные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), которые содержат нуклеотидную последовательность длиной 318 н.п. с первичной структурой, приведенной на фиг. 1 Seq ID Nol

Пример 3

Модификации кДНК гена PROK 1 в генетических конструкциях для получения на их основе генно-терапевтических субстанций.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка прокинетицина 1, а именно, нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения модифицированных кДНК гена PROK 1 с целью повышения эффективности транскрипции и трансляции белка прокинетицина 1, в клетках тканей и органов человека в участок нативной последовательности кДНК гена PROK 1, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChPROK 1 е II XL kit или QuikChPROK 1 е Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA) согласно рекомендациям производителя (http://www.agilent.com/cs/library/usermanuals/Public/200513).

К плазмидной ДНК, полученной по Примеру 2, в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 19-45 н.п.и проводят ПЦР в буфере QuikChPROK 1 е Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChPROK 1 е Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°С, 1 мин; далее от 30 до 35 циклов: 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coli Тор10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 2 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-PROK 1Seq ID No1, pCMV6-Kan/Neo-PROK 1Seq ID No1 и pCDNA 3.1(+)- PROK 1Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой A→G в позиции 69

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:2 содержит 1 нуклеотидную замену G→C в позиции 66 и 1 нуклеотидную замену A→G в позиции 69, не приводящую к изменениям в аминокислотной последовательности белка, кодируемого последовательностью гена PROK 1 и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 3 проводят последовательный ПЦР-мутагенез на плазмидах PCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan/Neo-PROK 1 SEQ ID No1 и pCDNA 3.1(+)- PROK 1 SEQ ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой А→G в позиции 69

2. PROK 1 79-109 F:

5' ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Комплементарный нуклеотидам 79-109, с заменой A→G в позиции 90;

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:3 содержит 1 нуклеотидную замену G→C в позиции 66, две нуклеотидных замены A→G в позиции 69, 90; не приводящие к изменениям в аминокислотной последовательности белка прокинетицина 1, и имеет первичную структуру, приведенную на фиг. 3.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 4 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan/Neo-PROK 1 SEQ ID No1 и pCDNA 3.1(+)- PROK 1 SEQ ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой A→G в позиции 69

2. PROK 1 79-109 F:

5' ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Комплементарный нуклеотидам 79-109, с заменой A→G в позиции 90;

3. PROK 1 79-106 F:

5' ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Комплементарный нуклеотидам 79-106, с заменами A→G в позициях 90 и 93;

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:4 содержит 1 нуклеотидную замену G→C в позиции 66, 3 нуклеотидных замены A→G в позициях 69, 90, 93; не приводящие к изменениям в аминокислотной последовательности белка прокинетицина 1, и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 5 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan/Neo-PROK 1 SEQ ID No1 и pCDNA 3.1(+)- PROK 1 SEQ ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой A→G в позиции 69

2. PROK 1 79-109 F:

5' ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Комплементарный нуклеотидам 79-109, с заменой A→G в позиции 90;

3. PROK 1 79-106 F:

5' ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Комплементарный нуклеотидам 79-106, с заменами A→G в позициях 90 и 93;

4. PROK 1 172-196 F:

5' AGCCTGTGGCTTCGGGGGCTGCGGA 3',

Комплементарный нуклеотидам 172-196, с заменой A→G в позиции 186;

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:5 содержит 1 нуклеотидную замену G→C в позиции 66, 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186; не приводящие к изменениям в аминокислотной последовательности белка прокинетицина 1, и имеет первичную структуру, приведенную на фиг. 5.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 6 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan/Neo-PROK 1 SEQ ID No1 и pCDNA 3.1(+)- PROK 1 SEQ ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой A→G в позиции 69

2. PROK 1 79-109 F:

5' ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Комплементарный нуклеотидам 79-109, с заменой A→G в позиции 90;

3. PROK 1 79-106 F:

5' ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Комплементарный нуклеотидам 79-106, с заменами A→G в позициях 90 и 93;

4. PROK 1 172-196 F:

5' AGCCTGTGGCTTCGGGGGCTGCGGA 3',

Комплементарный нуклеотидам 172-196, с заменой A→G в позиции 186;

5. PROK 1 194-221 F:

5' GGATGTGCACCCCCCTGGGGCGGGAAGG 3',

Комплементарный нуклеотидам 194-221, с заменой G→C в позиции 207;

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:6 содержит 2 нуклеотидных замены G→C в позициях 66, 207; 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186; не приводящие к изменениям в аминокислотной последовательности белка прокинетицина 1, и имеет первичную структуру, приведенную на фиг. 6.

Для получения модифицированной кДНК гена PROK 1 SEQ ID No 7 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan/Neo-PROK 1 SEQ ID No1 и pCDNA 3.1(+)- PROK 1 SEQ ID No1 с праймерами, комплементарными участку нативной кДНК гена PROK 1, приведенной в GenBank под номером NM_032414:

1. PROK 54-81 F:

5' GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Комплементарный нуклеотидам 54-81, с заменой G→C в позиции 66 и заменой A→G в позиции 69

2. PROK 1 79-109 F:

5' ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Комплементарный нуклеотидам 79-109, с заменой A→G в позиции 90;

3. PROK 1 79-106 F:

5' ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Комплементарный нуклеотидам 79-106, с заменами A→G в позициях 90 и 93;

4. PROK 1 172-196 F:

5' AGCCTGTGGCTTCGGGGGCTGCGGA 3',

Комплементарный нуклеотидам 172-196, с заменой A→G в позиции 186;

5. PROK 1 194-221 F:

5' GGATGTGCACCCCCCTGGGGCGGGAAGG 3',

Комплементарный нуклеотидам 194-221, с заменой G→C в позиции 207;

6. PROK 1 308-336 F:

5' GCTCCAGGTTCCCCGACGGCAGGTACCGC 3',

Комплементарный нуклеотидам 308-336, с заменой G→C в позиции 321;

Модифицированная таким образом нуклеотидная последовательность кДНК PROK 1 SEQ ID No:7 содержит 3 нуклеотидных замены G→C в позициях 66, 207, 321; 4 нуклеотидных замены A→G в позициях 69, 90, 93, 186; не приводящие к изменениям в аминокислотной последовательности белка прокинетицина 1, и имеет первичную структуру, приведенную на фиг. 7.

Таким образом, получают экспрессионные векторы на базе плазмид pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), в которых клонированы участок нативной немодифицированной кДНК гена PROK 1 (SEQ ID No:1) и модифицированные нуклеотидные последовательности кДНК гена PROK 1 (SEQ ID No:2, 3, 4, 5, 6, 7), кодирующие белок прокинетицина 1.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Полученные экспрессионные векторы используют для получения на их основе генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6-XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена PROK 1.

Пример 4

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена PROK 1, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена PROK 1 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (клеток эпителия глаза, или клеток эпителия эндометрия матки и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции генно-терапевтической субстанцией и анализа экспрессии гена PROK 1.

Для последующей трансфекции генно-терапевтической субстанцией содержащей один из вариантов кДНК гена PROK 1 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например, за ушной раковиной или с боковой внутренней поверхности в зоне голени, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена PROK 1, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260:D280 - не менее 1,8, а соотношение полос 28S:18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6

Анализ эндогенной экспрессии гена PROK 1 в культуре первичных фибробластов.

Анализ экспрессии гена PROK 1 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена PROK 1.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена PROK 1 и фибробласты с нормальной экспрессией гена PROK 1, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (251-332 н.п.), специфичной для гена PROK 1, используют прямой праймер

PROK 1FA1 5' CCACGCGAGTCTCAATCA 3'

и обратный праймер

PROK 1-RA1 5' ACTGGACATCCCGCTCAC 3'

Длина продукта амплификации - 84 нуклеотида. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена PROK 1.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого праймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С - 15 с, отжиг праймеров 62°С - 30 с и элонгацию 72°С - 30 с

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов PROK 1 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов PROK 1 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена PROK 1 в разных культурах фибробластов (с низкой экспрессией гена PROK 1 и с нормальной экспрессией гена PROK 1) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена PROK 1, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена PROK 1 генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена PROK 1 в культуре данных клеток.

Для оценки эффективности генно-терапевтической субстанции, содержащей немодифицированную кДНК гена PROK 1 по примеру 2, этой генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена PROK 1, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют генно-терапевтической субстанцией на основе pCMV6-PROK 1 SEQ ID No:1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена PROK 1 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена PROK 1 уровень кДНК гена PROK 1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена PROK 1 - уровень кДНК фибробластов со сниженной экспрессией гена PROK 1 многократно увеличился (до уровня выше, чем уровень кДНК гена PROK 1 в нормальных фибробластах).

Показано, что в клетках трансфицированных генно-терапевтической субстанцией на основе pCMV6-PROK 1 SEQ ID No:1 наблюдается усиление экспрессии целевого гена PROK 1.

Пример 8

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена PROK 1 генно-терапевтической субстанцией с кДНК гена PROK 1 с целью подтверждения увеличения количества белка прокинетицина 1, в культуре данных клеток.

Для оценки изменения количества белка прокинетицина 1, использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (А), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена PROK 1 (В), в качестве трансфицируемых агентов - генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена PROK 1-pCDNA 3.1 PROK 1 SEQ ID No: 1(C), Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции к 0,5 мл культуральной жидкости приливали 0,1 мл 1N HCl, тщательно перемешивали и инкубировали 10 минут при комнатной температуре. Затем нейтрализовывали смесь, добавляя 0,1 мл 1.2N NaOH/0.5M HEPES (рН 7-7,6) и тщательно перемешивали.

Данную смесь использовали для количественного определения целевого белка. Количественное определение продукта кДНК гена PROK 1 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США) чувствительностью 16-2,000 pg/ml согласно методике производителя http://img.creative-diagnostics.com/pdf/DEIA096%20Human%20PROK1%20ELISA%20Kit.pdf.

Метод детекции результатов - колориметрический. Оптическая плотность образцов измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness TechNology Inc., США) и пропорциональна концентрации белка PROK 1 в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка PROK 1, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом, показано, что транфекция фибробластов полученной генно-терапевтической субстанцией, несущей кДНК гена PROK 1, приводит к увеличению количества белка прокинетицина 1, в клетках фибробластов. Результаты показаны на фигуре 10.

Пример 9

Введение в кожу человека клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией с кДНК гена PROK 1 с целью подтверждения увеличения после этого количества белка прокинетицина 1, в биоптате кожи человека.

С целью анализа изменения количества белка прокинетицина 1, в тканях человека пациентам в кожу голени вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных генно-терапевтической субстанцией на основе pCMV6- PROK 1 SEQ ID No:7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве генно-терапевтической субстанции.

Для последующей трансфекции клеток генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка прокинетицина 1, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией на основе pCMV6-PROK 1 SEQ ID No:7, произошло увеличение количества белка прокинетицина 1, что может свидетельствовать об усилении экспрессии гена PROK 1. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена PROK 1pCMV6-XL5) количество белка прокинетицина 1, в коже не изменялась.

Таким образом, показана эффективность генно-терапевтической субстанции при введении в кожу человека клеточной культуры фибробластов, трансфицированных полученной генно-терапевтической субстанцией, несущей модифицированную кДНК гена PROK 1, что приводит к повышению количества белка прокинетицина 1, в коже в зоне введения.

Пример 10

Трансфекция культур фибробластов из биоптатов группы различных пациентов генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1.

С целью подтверждения индивидуального характера увеличения количества белка прокинетицина 1, до различного уровня при трансфекции клеточных культур фибробластов пациентов генно-терапевтическими субстанциями с модифицированными кДНК гена PROK 1 и участком нативной кДНК гена PROK 1 анализировали количественный уровень белка прокинетицина 1, в клеточных лизатах фибробластов, трансфицированных разными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена PROK 1.

Последовательности участка нативной немодифицированной кДНК гена PROK 1 приведена на фигуре 1, SEQ ID No:1, последовательности модифицированных кДНК гена PROK 1 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне голени 24 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка прокинетицина 1, в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мM NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248- 254]).

Затем каждую из 24-х культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:1, содержащей немодифицированную кДНК гена PROK 1 (SEQ ID No:1) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:2, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:2) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-ю часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:3, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:3) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-ю часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:4, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:4) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-ю часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:5, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-ю часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID NO:6, содержащей модифицированную кДНК гена PROK 1 (SEQ ID NO:6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-ю часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:7, содержащей вариант модифицированную кДНК гена PROK 1 (SEQ ID No:7) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена PROK 1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Определение количества белка прокинетицина 1, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

По итогам определения количества белка прокинетицина 1 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка прокинетицина 1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции немодифицированной кДНК гена PROK 1 SEQ ID No:1. В эту группу вошло 4 культуры из 24.

В группе 2 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:2. В эту группу вошло 2 культуры из 24.

В группе 3 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:3. В эту группу вошло 3 культуры из 24.

В группе 4 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:4. В эту группу вошли 5 культуры из 24.

В группе 5 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:5. В эту группу вошло 2 культуры из 24.

В группе 6 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:6. В эту группу вошли 4 культуры из 24.

В группе 7 максимальное количество белка прокинетицина 1, наблюдалось при трансфекции модифицированной кДНК гена PROK 1 SEQ ID No:7. В эту группу вошло 4 культуры из 24.

Ни в одной из клеточных культур, трансфицированных генно-терапевтической субстанцией с векторной плазмидой, не содержащей кДНК гена PROK 1, не было обнаружено максимальное количество белка прокинетицина 1, в отличие от клеточных культур, трансфицированных генно-терапевтическими субстанциями с генетическими конструкциями, содержащими кДНК гена PROK 1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка прокинетицина 1, (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и участок нативной кДНК гена PROK 1.

Из данного примера следует, что достижение максимального количества белка прокинетицина 1, в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена PROK 1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 11

Введение в первичную клеточную культуру эпителия эндометрия матки человека генно-терапевтической субстанции с кДНК гена PROK 1 с целью подтверждения при этом увеличения количества белка прокинетицина 1.

Клеточную культуру эпителия эндометрия матки человека получали путем взятия материала аспирационной биопсии. Трансфекцию этой клеточной культуры проводили генно-терапевтической субстанцией на основе плазмиды pCMV6-Kan/Neo PROK 1 SEQ ID No:2, используя в качестве транспортной молекулы РАМАМ-дендримеры (Weihai CY Dendrimer Technology). В качестве контроля использовали плазмиду pCMV6- Kan/Neo без кДНК гена PROK 1.

Перед проведением трансфекции была приготовлена смесь плазмидной ДНК из расчета, что на 25000 клеток необходимо 0,1 мкл раствора плазмидной ДНК (1 мкг/мл) и 0,3 мкл раствора РАМАМ дендример (1 мкг/мл) с доведением до 4 мкл буферным раствором Хенкса. Полученная смесь аккуратно пикетировалась и инкубировалась при комнатной температуре в течение 15 мин.

Непосредственно перед экспериментом первичная клеточная культура эпителия эндометрия матки человека промывалась средой DMEM. Затем клеточная культура инкубировалась в течение 1 ч с приготовленной трансфекционной смесью при плюс 37°С и 5% CO2. В качестве контроля добавляли 4 мкл буферного раствора Хенкса. После инкубирования клеточная культура промывалась средой DMEM, а затем добавлялась полная ростовая среда. Клеточная культура наблюдалась под микроскопом Zeiss Axio Observer А1 в течение 24 ч.

Сбор клеточной культуры эпителия эндометрия матки человека проводили через 24, 48, 72 и 96 ч после проведения трансфекции. Отбирали ростовую среду, 2 раза промывали буферным раствором Хенкса, 1 раз раствором ЭДТА, затем культуру клеток инкубировали в растворе трипсин-ЭДТА при 37°С в присутствии 5% CO2 в течение 4 минут. Реакцию трипсинизации ингибировали путем добавления ростовой среды. Чтобы избавиться от ростовой среды, суспензию клеток 2 раза промывали буферным раствором Хенкса с последующим центрифугированием.

Полученный осадок ресуспендировали в консерванте RNAlater (Qiagen, Германия).

Выделение РНК производили с помощью набора RNeasy Mini Kit (Qiagen, Германия) согласно методике производителя. Для элиминации ДНК в ходе процедуры выделения РНК использовали набор RNAse-Free DNAse Set (Qiagen, Германия).

Концентрацию выделенной РНК измеряли спектрофотометрически с помощью NanoDrop 2000 (ThermoFisher Scientific Inc.). Оптическую плотность раствора РНК измеряли в диапазоне 220-320 нм. Для работы использовали образцы, для которых общее количество выделенной РНК было не менее 10 нг/мкл РНК, соотношение А260280 - не менее 1,8.

Качество выделенной РНК проверяли методом капиллярного электрофореза на приборе QIAxcel (Qiagen, Германия), используя картридж RNA Quality Control Kit с помощью программы BioGel Software (Qiagen, Германия). Выделенная РНК хранилась на -80°С и использовалась для синтеза первой цепи кДНК методом ОТ-ПЦР.

Синтез суммарной кДНК первой цепи проводили, с помощью обратной транскриптазы RevertAid (Thermo Scientific, США) по методике производителя. В реакционную смесь объемом 20 мкл, состоящую из деионизованной воды, 5Х Reaction Buffer (250 мМ Tris-HCl (рН 8.3 at 25°С), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT), dNTP (25 mM), вносили 200 Ед обратной транскриптазы и 5 пмоль случайного 9-нуклеотидного праймера, в качестве матрицы использовали 120 нг суммарной РНК. Обратную транскрипцию проводили при следующих условиях: 1 цикл предварительной инкубации при 25°С 10 минут, 1 цикл инкубации 52°С - 30 мин., 1 цикл инкубации 85°С - 5 мин.

Суммарную кДНК использовали для проведения ПЦР в реальном времени, которую проводили на амплификаторе CFX96 (Bio-Rad, США), с использованием реакционной смеси iTaq Universal SYBR Green Supermix (Bio-Rad, США), в состав которой входит интеркалирующий краситель SYBR Green I. Постановку реакции осуществляли в объеме 20 мкл согласно инструкции производителя с помощью высокоспецифичных праймеров QuantiTect Primer Assay (Qiagen, Германия) к гену PROK 1 и к референтному гену В2М. В качестве матрицы использовали: каждую пробу после стадии синтеза суммарной кДНК. Результаты амплификации оценивали в режиме реального времени с помощью программного обеспечения Bio-Rad CFX Manager 2.1 (Bio-Rad США) и qBase plus (Biogazelle, Бельгия). ПЦР проводили при следующих условиях: первоначальная денатурация при +95°С в течение 30 с, 45 циклов, включающих денатурацию при +95°С в течение 5 с, отжиг праймеров и элонгация при +60°С в течение 30 с.

Идентификацию, полученных ПЦР-продуктов проводили путем капиллярного электрофореза в картридже QX DNA High Resolution (Qiagen, Германия) с помощью прибора для капиллярного электрофореза QIAxcel (Qiagen, Германия). В качестве выравнивающего маркера использовали QX Alignment Marker 15-3000 п., в качестве маркера длины - QX DNA Size Marker 50-800 п.н. После сравнения полученных данных с теоретически рассчитанной длиной обоих генов, учитывая погрешность прибора (±10 п.н.), было доказано, что детектируемый продукт соответствует гену PROK 1, и референтному гену В2М. В пробах с отрицательным контролем продукт не детектируется.

Показано, что, в клеточной культуре эпителия эндометрия матки человека, трансфицированной генно-терапевтической субстанцией с кДНК гена PROK 1, произошло увеличение количества белка прокинетицина 1, что подтверждает усиление экспрессии гена PROK 1 при использовании генно-терапевтической субстанции с кДНК гена PROK 1. Результаты отражены на фигуре 13.

Пример 12

Трансфекция клеточной культуры эпителия роговицы глаза генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена PROK 1 в данной культуре клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК гена PROK 1, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали эпителий роговицы глаза человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед./мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°С. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°С и в атмосфере, содержащей 5% СO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2-1:3.

Для трансфекции клеток генно-терапевтической субстанцией содержащей кДНК гена PROK 1 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci.2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6-Kan/Neo PROK 1 SEQ ID No:3 с модифицированной кДНК гена PROK 1 SEQ ID No:3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена PROK 1 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции PROK 1 наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена PROK 1.

Показано, что в клетках эпителия роговицы глаза трансфицированных генно-терапевтической субстанцией на основе pCMV6-Kan/Neo PROK 1 SEQ ID No:3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена PROK 1.

Пример 13

Введение в кожу человека генно-терапевтической субстанции с кДНК гена PROK 1 с целью подтверждения при этом увеличения количества белка прокинетицина 1, в коже человека.

С целью анализа изменения количества белка прокинетицина 1, пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена PROK 1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в кожу голени.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 PROK 1 SEQ ID No:4, которая содержит модифицированную кДНК гена PROK 1 (SEQ ID No:4) и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена PROK 1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка прокинетицина 1, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее, как описано в примере 9.

Показано, что в коже пациента в области введения генно-терапевтической субстанции с кДНК гена PROK 1, произошло увеличение количества белка прокинетицина 1, тогда как при введении плацебо, количество белка прокинетицина 1 в коже не изменялась, что говорит об усилении экспрессии гена PROK 1 при использовании генно-терапевтической субстанции с кДНК гена PROK 1. Результаты отражены на фигуре 15.

Пример 14

Введение в хрящевую ткань человека генно-терапевтической субстанции с кДНК гена PROK 1 с целью подтверждения при этом увеличения количества белка прокинетицина 1 в хрящевой ткани человека.

С целью анализа изменения количества белка прокинетицина 1 пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена PROK 1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в хрящевую ткань ушных раковин с тыльной стороны.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 PROK 1 SEQ ID No:5, которая содержит модифицированную кДНК гена PROK 1 (SEQ ID No:5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена PROK 1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1 - 2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 2-4 см друг от друга.

Количество белка прокинетицина 1 оценивали в лизатах биоптатов хрящевой ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков хрящевой ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL), далее по примеру 9.

Показано, что в хрящевой ткани пациента в области введения генно-терапевтической субстанции с кДНК гена PROK 1, произошло увеличение количества белка прокинетицина 1, тогда как при введении плацебо количество белка прокинетицина 1, в хрящевой ткани не изменялось, что подтверждает усиление экспрессии гена PROK 1 при использовании генно-терапевтической субстанции с кДНК гена PROK 1. Результаты отражены на фигуре 16.

Пример 15

Введение в мышечную ткань человека генно-терапевтической субстанции с кДНК гена PROK 1 с целью подтверждения при этом увеличения количества белка прокинетицина 1 в мышечной ткани человека.

С целью анализа изменения количества белка прокинетицина 1 пациентам вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена PROK 1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена PROK 1 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo PROK 1 SEQ ID No:6, которая содержит модифицированную кДНК гена PROK 1 (SEQ ID No:6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена PROK 1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Количество белка прокинетицина 1 оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения генно-терапевтической субстанции с кДНК гена PROK 1, произошло увеличение количества белка прокинетицина 1, тогда как при введении плацебо количество белка прокинетицина 1 в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена PROK 1 при использовании генно-терапевтической субстанции с кДНК гена PROK 1. Результаты отражены на фигуре 17.

Пример 16

Введение группе различных пациентов генно-терапевтических субстанций содержащих модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1.

С целью подтверждения индивидуального характера увеличения количества белка прокинетицина 1 до различного уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированной кДНК гена PROK 1 анализировали количественный уровень белка прокинетицина 1 в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена PROK 1.

Последовательность участка нативной немодифицированной кДНК гена PROK 1 приведена на фигуре 1, PROK 1 SEQ ID No:1, последовательности модифицированных кДНК гена PROK 1 приведены на фигурах 2-7 (PROK 1 SEQ ID No:2, PROK 1 SEQ ID No:3, PROK 1 SEQ ID No:4, PROK 1 SEQ ID No:5, PROK 1 SEQ ID No:6, PROK 1 SEQ ID No:7).

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена PROK 1 (SEQ ID No:1), вторая генетическая конструкция содержит участок модифицированной кДНК гена PROK 1 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК в сочетании с транспортными молекулами - липосомами по примеру 9.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 23-х пациентов, которые были отобраны в случайном порядке, вводили 7 генно-терапевтических субстанций и плацебо в кожу голени.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:1, содержащий немодифицированную кДНК гена PROK 1 (SEQ ID No:1) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

В - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:2, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:2) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

С - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:3, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:3) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

D - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:4, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:4) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Е - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:5, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

F - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:6, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

G - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6-SEQ ID No:7, содержащий модифицированную кДНК гена PROK 1 (SEQ ID No:7) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащей кДНК гена PROK 1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Количество белка прокинетицина 1 оценивали в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

По итогам анализа количественного уровня белка прокинетицина 1 выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка прокинетицина 1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка прокинетицина 1, наблюдалось при введении немодифицированной кДНК гена PROK 1 SEQ ID No:1. В эту группу вошел 3 биоптат из 23.

В группе 2 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:2. В эту группу вошли 3 биоптата из 23.

В группе 3 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:3. В эту группу вошли 3 биоптата из 23.

В группе 4 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:4. В эту группу вошли 4 биоптата из 23.

В группе 5 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:5. В эту группу вошли 3 биоптата из 23.

В группе 6 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:6. В эту группу вошли 5 биоптата из 23.

В группе 7 максимальное количество белка прокинетицина 1, наблюдалось при введении модифицированной кДНК гена PROK 1 SEQ ID No:7. В эту группу вошли 2 биоптата из 23.

Ни в одном из биоптатов, в которые были введены генно-терапевтические субстанции плацебо - векторной плазмидой, не содержащей кДНК гена PROK 1, не было обнаружено максимальное количество белка прокинетицина 1, в отличие от биоптатов, в которые были введены генно-терапевтические субстанции с генетическими конструкциями, содержащими кДНК гена PROK 1.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные и участок нативной кДНК гена PROK 1.

Из данного примера следует, что достижение максимального количества белка прокинетицина 1, в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена PROK 1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 17

Трансфекция клеточной линии фибробластов пациента разными генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1 с целью персонализированного выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка прокинетицина 1, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генно-терапевтическими субстанциями, содержащими участок нативной немодифицированной кДНК гена PROK 1 и/или модифицированные кДНК гена PROK 1.

Последовательность участка нативной немодифицированной кДНК гена PROK 1 приведена на фигуре 1, PROK 1 SEQ ID No:1, последовательности модифицированных кДНК гена PROK 1 приведены на фигурах 2-7 (PROK 1 SEQ ID No:2, PROK 1 SEQ ID No:3, PROK 1 SEQ ID No:4, PROK 1 SEQ ID No:5, PROK 1 SEQ ID No:6, PROK 1 SEQ ID No:7).

Культуры фибробластов из биоптата пациента вырастили по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Первую часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:1, содержащей участок нативной немодифицированной кДНК гена PROK 1 (SEQ ID No:1) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:2, содержащей участок модифицированной кДНК гена PROK 1 (SEQ ID No:2) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Третью часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:3, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:3) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Четвертую часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:4, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:4) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Пятую часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:5, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Шестую часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID NO:6, содержащей модифицированную кДНК гена PROK 1 (SEQ ID NO:6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Седьмую часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:7, содержащей модифицированную кДНК гена PROK 1 (SEQ ID No:7) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Восьмую часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена PROK 1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка прокинетицина 1 в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

По итогам определения количества белка прокинетицина 1, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка прокинетицина 1, в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена PROK 1. В данном эксперименте максимальное количество белка прокинетицина 1, в лизате отмечено при трансфекции генно-терапевтической субстанцией на базе pCMV6 PROK 1 SEQ ID No:5, содержащей немодифицированную кДНК гена PROK 1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18

Введение в кожу пациента различных генно-терапевтических субстанций, содержащих модифицированные кДНК гена PROK 1 и участок нативной немодифицированной кДНК гена PROK 1 с целью выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка прокинетицина 1, в лизатах биоптатов кожи этого пациента, после введения ему в кожу генно-терапевтических субстанций, содержащих модифицированные кДНК гена PROK 1 и/или участок нативной кДНК гена PROK 1.

Последовательность участка нативной немодифицированной кДНК гена PROK 1 приведена на фигуре 1, PROK 1 SEQ ID No:1, последовательности модифицированных кДНК гена PROK 1 приведены на фигурах 2-7 (PROK 1 SEQ ID No:2, PROK 1 SEQ ID No:3, PROK 1 SEQ ID No:4, PROK 1 SEQ ID No:5, PROK 1 SEQ ID No:6, PROK 1 SEQ ID No:7).

Пациенту вводили 7 генно-терапевтических субстанций и плацебо в кожу голени.

Первая генно-терапевтическая субстанция (А) на базе pCMV6-SEQ ID No:1, содержащая участок нативной немодифицированной кДНК гена PROK 1 (SEQ ID No:1) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая генно-терапевтическая субстанция (В) на базе pCMV6-SEQ ID No:2, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:2) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Третья генно-терапевтическая субстанция (С) на базе pCMV6-SEQ ID No:3, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:3) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Четвертая генно-терапевтическая субстанция (D) на базе pCMV6-SEQ ID No:4, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:4) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Пятая генно-терапевтическая субстанция (Е) на базе pCMV6-SEQ ID No:5, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Шестая генно-терапевтическая субстанция (F) на базе pCMV6-SEQ ID No:6, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Седьмая генно-терапевтическая субстанция (G) на базе pCMV6-SEQ ID No:7, содержащая модифицированную кДНК гена PROK 1 (SEQ ID No:7) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Восьмая векторная плазмида pCMV6-XL5, не содержащая кДНК гена PROK 1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена PROK 1 (SEQ ID No:1), вторая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена PROK 1 (SEQ ID No:7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка прокинетицина 1 определяли в девяти биоптатах кожи пациента через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Prokineticin 1, PROK1 ELISA Kit (CD creative diagnostics, США), как описано в Примере 8.

По итогам определения количества белка прокинетицина 1, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка прокинетицина 1, в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена PROK 1. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении генно-терапевтической субстанции на базе pCMV6 PROK 1 SEQ ID No:6, содержащей модифицированную кДНК гена PROK 1, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, возникших вследствие недостаточной экспрессии гена PROK 1, способ его получения и использования.

Созданное средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций с использованием одной из модифицированных кДНК гена PROK 1 или участка нативной немодифицированной кДНК гена PROK 1 позволяет на практике использовать входящие в группу генно-терапевтические субстанции для повышения до необходимого уровня количества белка прокинетицина 1, в различных клетках органов и тканей и/или органах и тканях человека путем увеличения экспрессии гена PROK 1.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант генно-терапевтической субстанции из созданной группы генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка прокинетицина 1, в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование генно-терапевтической субстанции с участком нативной немодифицированной кДНК гена PROK 1 не приводит к желаемому изменению уровня количества белка прокинетицина 1, в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена PROK 1, приводящей к более эффективной экспрессии гена PROK 1.

При использовании заявленной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Группа генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена PROK 1, повышая количество белка прокинетицина 1, в клетках органов и тканей и/или органах и тканях человека в частности, фибробластах, в эндотелиоцитах семенников, надпочечников, яичников и плаценты, в вагине, шейке, придатках матки, отделах головного мозга, мозжечке, гипофизе, коре головного мозга, спинном мозге, предстательной железе, сердце, молочных железах, селезенке, скелетной мышечной ткани, мочевом пузыре, желчном пузыре, коже ноги, надлобковой коже, роговице, слизистой оболочке канала шейки матки, подкожной жировой клетчатке, висцеральной жировой ткани, в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, фибробластах, в эндотелиоцитах семенников, надпочечников, яичников и плаценты, в вагине, шейке, придатках матки, отделах головного мозга, мозжечке, гипофизе, коре головного мозга, спинном мозге, предстательной железе, сердце, молочных железах, селезенке, скелетной мышечной ткани, мочевом пузыре, желчном пузыре, коже ноги, надлобковой коже, роговице, слизистой оболочке канала шейки матки, подкожной жировой клетчатке, висцеральной жировой ткани в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, на основе генно-терапевтических субстанций с геном PROK 1, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена PROK 1 и/или повышение количества белка прокинетицина 1, в клетках органов и тканей и/или органах и тканях организма.

Кроме этого при введении генетических конструкций в отличие от введения непосредственно белка, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Повышение эффективности коррекции количественного уровня белка прокинетицина 1, в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена PROK 1 используют не белок, а генетическую конструкцию с кДНК гена PROK 1, кодирующую этот белок.

Промышленная применимость

Все приведенные примеры по созданию и использованию созданной группы генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е.ф. - относительная единица флуоресценции

ГТС - генно-терапевтическая субстанция

1. Средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1, на основе генно-терапевтических субстанций с геном PROK 1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена PROK 1, с кодирующей последовательностью белка прокинетицина 1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена PROK 1 SEQ ID No: 1 или модифицированной кДНК гена PROK 1, при этом в качестве модифицированной кДНК гена PROK 1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена PROK 1 в эукариотических клетках, в клетках органов и тканей человека, где клетки органов и тканей человека выбраны из фибробластов, эндотелиоцитов семенников, надпочечников, яичников и плаценты, вагины, шейки, придатков матки, отделов головного мозга, мозжечка, гипофиза, коры головного мозга, спинного мозга, предстательной железы, сердца, молочных желез, селезенки, скелетной мышечной ткани, мочевого пузыря, желчного пузыря, кожи ноги, надлобковой кожи, роговицы, слизистой оболочки канала шейки матки, подкожной жировой клетчатки, висцеральной жировой ткани в сочетании с транспортной молекулой или без нее при введении этого средства в органы и ткани человека.

2. Средство по п. 1, отличающееся тем, что каждая генетическая конструкция с модифицированной кДНК гена PROK 1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена PROK 1, которая несет модификации, не затрагивающие структуру белка прокинетицина 1, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций, и не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

4. Способ получения средства для лечения состояний человеческого организма связанного с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина 1 по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций, при этом получают кДНК гена PROK 1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генно-терапевтической субстанции, затем комбинируют генно-терапевтическую субстанцию с транспортной молекулой для трансфекции полученным средством клеток органов и тканей и/или введения полученного средства в органы и ткани человека, при этом используют кДНК гена PROK 1 с кодирующей последовательностью белка прокинетицина 1, с делециями 5' и 3'-нетранслируемых областей, полученной на основе участка нативной немодифицированной кДНК гена PROK 1 SEQ ID No: 1 или модифицированной кДНК гена PROK 1, при этом в качестве модифицированной кДНК гена PROK 1 используют или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7 или используют сочетание этих генно-терапевтических субстанций.

5. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена PROK 1 и/или уменьшением количества белка прокинетицина, заключающийся в трансфекции средством по п. 1 на основе генно-терапевтической субстанции или субстанций, выбранной или выбранных из группы созданных генно-терапевтических субстанций, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных созданным средством для лечения на основе генно-терапевтической субстанции или субстанций, выбранной или выбранных из группы созданных генно-терапевтических субстанций, и/или во введении в органы и ткани пациента средства для лечения на основе генно-терапевтической субстанции или субстанций, выбранной или выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к генетически модифицированному грызуну, экспрессирующему гуманизированный Т-клеточный рецептор (TCR) и содержащему в геноме своей зародышевой линии: нереаранжированную последовательность вариабельной области TCRα, и/или нереаранжированную последовательность вариабельной области TCRβ, к способу его получения, а также к его выделенной эмбриональной клетке и ткани.

Изобретение относится к области биохимии, в частности к генетически модифицированному грызуну, экспрессирующему гуманизированный Т-клеточный рецептор (TCR) и содержащему в геноме своей зародышевой линии: нереаранжированную последовательность вариабельной области TCRα, и/или нереаранжированную последовательность вариабельной области TCRβ, к способу его получения, а также к его выделенной эмбриональной клетке и ткани.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Изобретение дополнительно относится к применению такой молекулы искусственной нуклеиновой кислоты, кодирующей терапевтические пептиды или белки в медицине при генной терапии и/или генетической вакцинации.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Изобретение дополнительно относится к применению такой молекулы искусственной нуклеиновой кислоты, кодирующей терапевтические пептиды или белки в медицине при генной терапии и/или генетической вакцинации.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Синергетический эффект, обусловленный наличием 3'-UTR гена альбумина и 3’-некодирующей области матричной РНК, уложенной во вторичную структуру типа «стебель-петля», в структуре искусственной нуклеиновой кислоты, позволяет повысить стабильность и продлить экспрессию кодируемого белка.

Изобретение относится к биотехнологии, конкретно к рекомбинантному получению белка теплового шока человека 70 (БТШ70), и может быть использовано для получения БТШ70 в молоке трансгенных животных.

Изобретение относится к генетической инженерии, в частности к способу модификации целевого геномного локуса путем гомологичной рекомбинации в мышиной эмбриональной стволовой (ES) клетке.

Изобретение относится к генетической инженерии, в частности к способу модификации целевого геномного локуса путем гомологичной рекомбинации в мышиной эмбриональной стволовой (ES) клетке.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к конъюгату рекомбинантной бутирилхолинэстеразы человека и окисленной каламиновой кислоты со средней молекулярной массой 27 кДа.

Изобретение относится к биотехнологии, конкретно к рекомбинантному получению белка теплового шока человека 70 (БТШ70), и может быть использовано для получения БТШ70 в молоке трансгенных животных.

Изобретение относится к области биотехнологии, конкретно к С5-связывающим полипептидам, содержащим С5-связывающий мотив ВМ, что может быть использовано в медицине. Получают С5-связывающий полипептид, содержащий С5-связывающий мотив ВМ, причем этот мотив состоит из аминокислотной последовательности, соответствующей EX2X3X4AX6X7EIDX11LPNLX16X17X18QWX21AFIX25X26LX28D, и применяют полученный полипептид для лечения связанного с С5 состояния, например для ингибирования гемолитического эффекта.

Настоящее изобретение относится к биотехнологии и генетической инженерии, в частности к генетически модифицированным грызунам, таким как мышь и крыса, которые экспрессируют химерный человеческий/не относящийся к человеку полипептид МНС I и/или человеческий полипептид β2 микроглобулина, а также к клеткам таких грызунов.

Изобретение относится к биотехнологии, конкретно к получению рекомбинантных белков человека, и может быть использовано для получения и очистки рекомбинантного белка GAGE1 человека.

Изобретение относится к области биотехнологии, конкретно к получению нового рекомбинантного фактора свертывания крови, представляющего собой химерный белок с увеличенным временем полужизни в плазме, состоящий из фактора III человека и мутантного Fc-фрагмента IgG человека, что может быть использовано в медицине.

Изобретение относится к области биотехнологии. Предложен экспрессионный плазмидный лентивирусный вектор для гетерологичной экспрессии рекомбинантного человеческого белка CD44 в клетках млекопитающих.

Изобретение относится к области биотехнологии, конкретно предложен высокостабильный Т-клеточный рецептор, что может быть использовано в медицине. Полученный Т-клеточный рецептор, имеющий мутации в своем гидрофобном коровом домене, используют в составе фармацевтической композиции для лечения опухоли.

Изобретение относится к области биохимии, в частности к выделенной конструкции нуклеиновой кислоты для борьбы с западным кукурузным жуком, также к молекуле РНК, кодируемой вышеуказанной конструкцией.

Изобретение относится к биотехнологии, конкретно к рекомбинантному получению белка теплового шока человека 70 (БТШ70), и может быть использовано для получения БТШ70 в молоке трансгенных животных.

Предложенная группа изобретений относится к области медицины. Предложены cпособ выявления ингибиторов супрессии супрессора опухолевого роста Pdcd4 в опухолевых клетках и генетическая конструкция pLucPdcd4, представляющая собой плазмиду, кодирующую репортерный белок, представляющий собой химеру люциферазы светлячка с белком Pdcd4 человека.

Изобретение относится к области биотехнологии, конкретно к бис-Met-гистонам, и может быть использовано в медицине. Молекула нуклеиновой кислоты кодирует полипептид, состоящий из двух остатков метионина в качестве первого и второго N-концевых аминокислотных остатков, соединенных через пептидную связь со зрелым эукариотическим гистоном H1.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных белков, повышающих иммуногенность последовательности иммуногенного полипептида, что может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к терапевтическим генно-инженерным средствам, и может быть использовано для коррекции патологических состояний человека, связанных с уменьшением экспрессии гена PROK 1 иили уменьшением количества белка прокинетицина 1. Средство включает генно-терапевтическую субстанцию, выбранную из группы векторных плазмид, включающих кДНК гена PROK 1 с кодирующей последовательностью белка прокинетицина 1 с делециями 5 и 3-нетранслируемых областей, полученной на основе участка нативной немодифицированной кДНК гена PROK 1 или модифицированной кДНК гена PROK 1. Изобретение обеспечивает высокий уровень экспрессии гена PROK 1 в эукариотических клетках, увеличивая тем самым количество белка прокинетицина 1 в клетках органов иили тканей человека, в частности в фибробластах, в эндотелиоцитах семенников, надпочечников, яичников и плаценты, в вагине, шейке, придатках матки, отделах головного мозга, мозжечке и гипофизе. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

Наверх