Когорты биомаркеров мочи, профиль экспрессии генов и способы их применения

Изобретение относится к области биохимии. Описан способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида (варианты). В одном из вариантов, способ включает стадии: а. получения у индивида произвольного образца мочи; b. экстракции одной или нескольких мРНК из образца; с. определения уровня экспрессии мРНК PCA3 и ERG; d. нормализации уровня экспрессии мРНК PCA3 и ERG с SPDEF; e. обработки выходного значения для нормализованных уровней экспрессии мРНК PCA3 и ERG, используя формулу:

с получением баллов по шкале EXO106; и f. сравнение баллов по шкале EXO106 с заранее определенной величиной порога отсечения, которую определяли с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, для проведения различия между индивидом с высоким риском возникновения рака предстательной железы и индивидом с низким риском возникновения рака предстательной железы. В одном из вариантов изобретения раком является агрессивный рак. Изобретение расширяет арсенал средств, позволяющих проводить диагностику и прогнозирование рака предстательной железы. 2 н. и 18 з.п. ф-лы, 16 табл., 6 пр., 20 ил.

 

РОДСТВЕННЫЕ ЗАЯВКИ

[0001] По настоящей заявке испрашивается приоритет предварительной заявки США № 61/862630, поданной 6 августа 2013 года, содержание которой включено в настоящий документ путем ссылки в полном объеме.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

[0002] В целом, настоящее изобретение относится к области анализов на биомаркеры, в частности, к определению профиля экспрессии генов в образцах мочи.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

[0003] Развитие знаний о генетических и эпигенетических изменениях, происходящих в раковых клетках, делает возможным распознавать, характеризовать, а также проводить мониторинг опухолей с помощью анализа последовательностей нуклеиновых кислот, связанных с опухолями, и их профилей. Эти изменения можно наблюдать путем детекции любого из разнообразных биомаркеров злокачественных новообразований. Для детекции таких биомаркеров и для получения важной информации для пациентов, врачей, клиницистов и исследователей используют различные анализы молекулярной диагностики. До настоящего времени такие анализы преимущественно проводили на раковых клетках, полученных в результате хирургического удаления опухолевой ткани, или из ткани, полученной при биопсии.

[0004] Однако, возможность проведения таких исследований с использованием образца жидкости организма зачастую более желательна, чем с использованием образцов ткани пациента. Менее инвазивный подход при использовании образца биологической жидкости имеет огромное значение с точки зрения материального и нематериального удобства для пациента, возможности проведения мониторинга на протяжении заболевания, а также возможности получения профилей экспрессии, даже если клетки ткани труднодоступны, например, как в случае предстательной железы. Для образцов в последнем случае, ранее описанные способы сбора требуют проведения ректального исследования предстательной железы (DRE) или массажа предстательной железы для того, чтобы обеспечить поступления в мочу достаточного количества клеточной жидкости из предстательной железы. Образцы, собранные без проведения DRE или массажа предстательной железы, показывают низкий уровень детекции таких биомаркеров.

[0005] Таким образом, существует необходимость в новых неинвазивных способах детекции биомаркеров, например, биомаркеров в микровизикулах мочи, для обеспечения диагностики, прогнозирования, проведения мониторинга или выбора терапии заболевания или другого расстройства предстательной железы. В частности, существует необходимость в неинвазивных способах, при которых не требуется проведение DRE или массажа предстательной железы перед взятием образца мочи и нет необходимости в стадии получения образца, включающей выделение клеточного осадка из образцов мочи.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[0006] Настоящее изобретение относится к способам детекции одного или нескольких биомаркеров в микровизикулах мочи для обеспечения диагностики, прогнозирования, проведения мониторинга или выбора терапии заболевания, такого как, например, рак, в частности, заболевание или другое расстройство предстательной железы у индивида. Способ включает получение у индивида произвольного образца мочи; экстракцию мРНК из образца, детекцию уровня экспрессии мРНК PCA3 и ERG; и нормализацию уровня экспрессии мРНК PCA3 и ERG с KLK3 или с SPDEF. Способ дополнительно включает обработку выходного значения для нормализации уровня экспрессии мРНК PCA3 и ERG, используя заранее определенную формулу; и сравнение выходного значения с заранее определенной величиной порога отсечения, которая была определена с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, для проведения различия между индивидом с высоким риском возникновения рака и индивидом с низким риском возникновения рака. Кроме того, эти способы позволяют идентифицировать индивида с высоким риском рака предстательной железы с высоким индексом Глисона (GS) (например, индекс Глисона (GS)>6), по сравнению с индивидом с низким риском рака предстательной железы с высоким GS. Например, индивиды, у которых выходное значение, больше или, в некоторых вариантах осуществления, равно заранее определенной величине порога отсечения, которая определена с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, имеют высокий риск рака предстательной железы с высоким индексом GS, тогда как индивиды, у которых выходное значение ниже заранее определенной величины порога отсечения, имеют низкий риск рака предстательной железы с высоким GS. Таким образом, эти способы могут использоваться для проведения различия между индивидами с высоким риском рака предстательной железы с высоким GS и индивидами с низким риском рака предстательной железы с высоким GS.

[0007] Изобретение относится к способу диагностики, прогнозирования, проведению мониторинга или выбора терапии нуждающегося в этом индивида, состоящему из стадий получения у индивида произвольного образца мочи; экстракции одной или нескольких мРНК из образца; детекции уровня экспрессии мРНК PCA3 и ERG; нормализации уровня экспрессии мРНК PCA3 и ERG с эталонным геном; обработки выходного значения путем использования нормализованных уровней экспрессии мРНК PCA3 и ERG по заранее определенной формуле; и сравнения выходного значения с заранее определенной величиной порога отсечения, которая определена с помощью кривой ROC, построенной на основе сочетания мРНК PCA3 и мРНК ERG, для проведения различия между индивидом с высоким риском рецидивирующего рака и индивидом с низким риском рецидивирующего рака.

[0008] В способах, раскрытых в настоящем описании, используется образец мочи индивида мужского пола, например, образец с объемом первой порции мочи от 25 до 40 мл. Для способов, раскрытых в настоящем описании, не требуется проведение ректального исследования предстательной железы (DRE), и предпочтительно, используемые в этих способах образцы мочи являются образцами пациентов, которым не проводили DRE.

[0009] В некоторых вариантах осуществления уровень PSA пациента определен. В некоторых вариантах осуществления способы используют для анализа образцов пациентов с PSA в «серой зоне», имеющих уровень PSA, равный от 2 до 10 нг/мл. В некоторых вариантах осуществления пациентом является индивид мужского пола в возрасте по меньшей мере 50 лет.

[0010] В некоторых вариантах осуществления образец пациента анализируют, используя следующий алгоритм:

[0011] В некоторых вариантах осуществления баллы по шкале EXO106 используют для прогнозирования низкого риска развития рака предстательной железы или высокого риска развития рака предстательной железы у пациента. Например, пациентов, у которых балл по шкале EXO106 меньше 10, как вычислено с помощью приведенного выше алгоритма, идентифицируют как имеющих низкий риск развития рака предстательной железы, а пациентов, у которых балл по шкале EXO106 равен 10 или выше, идентифицируют как имеющих высокий риск развития рака предстательной железы.

[0012] В некоторых вариантах осуществления баллы по шкале EXO106 используют для прогнозирования низкого риска развития рака предстательной железы с высоким индексом Глисона (GS) или высокого риска развития рака предстательной железы с высоким GS у пациента. Например, пациентов, у которых балл по шкале EXO106 меньше 10, как вычислено с помощью приведенного выше алгоритма, идентифицируют как имеющих низкий риск развития рака предстательной железы с высоким GS, а пациентов, у которых балл по шкале EXO106 равен 10 или выше, идентифицируют как имеющих высокий риск развития рака предстательной железы с высоким GS.

[0013] В некоторых вариантах осуществления способы по настоящему изобретению дополнительно включают выделение микровезикулярной фракции из произвольного образца мочи и экстракцию нуклеиновой кислоты из микровезикулярной фракции.

[0014] В некоторых вариантах осуществления способ дополнительно включает определение уровня экспрессии AMACR, BIRC5, HOXC6 и/или SPARCL1. В некоторых вариантах осуществления способ дополнительно включает детекцию уровня экспрессии AMACR, BIRC5, HOXC6 и/или SPARCL1 и обработку выходного значения на основании сочетания PCA3, ERG и AMACR, BIRC5, HOXC6 и/или SPARCL1.

[0015] В любом из указанных выше способах перед экстракцией нуклеиновой кислоты в образец мочи добавляют известное количество Q-бета частиц. Определяют уровень экспрессии гена-мишени Q-бета и определенный уровень экспрессии сравнивают с известным количеством Q-бета частиц.

[0016] Изобретение относится к способу диагностики, прогнозирования, проведения мониторинга и выбора терапии расстройства у индивида, включающему стадии: (a) получения у индивида микровезикулярной фракции из образца мочи; (b) экстракции одной или нескольких нуклеиновых кислот из микровезикулярной фракции; и (c) анализа экстрагированных нуклеиновых кислот для детекции наличия, отсутствия или уровня экспрессии PCA3 и ERG. В свежих образцах мочи, а также в образцах мочи, которые были заранее заморожены и разморожены эти маркеры детектируются на постоянном уровне. Предпочтительно, образец мочи составляет 40 мл или 20 мл. Более предпочтительно, образцы мочи представляют собой первую порцию мочи объемом 40 мл из мочевого пузыря или первую порцию мочи объемом 20 мл из мочевого пузыря. Детекция этих маркеров репродуцируется в образцах одного и того же пациента, а также в образцах различных пациентов.

[0017] Изобретение также относится к способу, дополнительно включающему стадию детекции уровня экспрессии эталонного гена и определения нормализованных относительно уровня экспрессии биомаркеров, где относительный уровень экспрессии биомаркеров представляет собой соотношение между уровнем экспрессии биомаркера и уровнем экспрессии эталонного гена, и где индивида идентифицируют как страдающего расстройством, таким как рак, или имеющим повышенный риск его развития, если относительный уровень экспрессии биомаркера выше величины порога отсечения экспрессии биомаркера. В некоторых вариантах осуществления биомаркер представляет собой по меньшей мере ERG и PCA3. В некоторых вариантах осуществления биомаркер представляет собой по меньшей мере ERG и PCA3 и по меньшей мере один другой биомаркер, выбранный из группы, состоящей из AMACR, BIRC5, HOXC6, SPARCL1 и их сочетаний. В некоторых вариантах осуществления эталонный ген представляет собой ген, специфический для предстательной железы. В некоторых вариантах осуществления эталонный ген представляет собой KLK3 или SPDEF, или их сочетание. В некоторых вариантах осуществления эталонный ген представляет собой KLK3. В некоторых вариантах осуществления эталонный ген представляет собой ген «домашнего хозяйства», такой, например, GAPDH.

[0018] В некоторых вариантах осуществления площадь под кривой (AUC), полученную на основе ROC-кривой (операционная характеристика приемника (ROC)) для каждого уровня биомаркера или балла, полученного при комбинировании биомаркеров, обрабатывают, используя результаты биомаркеров как контролей, так и биомаркеров больных пациентов. В некоторых предпочтительных вариантах осуществления значение AUC, полученное на основе Roc-кривой для каждого уровня биомаркера или балла, полученного на основе комбинирования биомаркеров, составляет выше 0,5, 0,6, 0,7 или 0,8. Предпочтительно, значение AUC составляет выше 0,7. Специалист в данной области без труда сможет максимально улучшить диагностическую точность уровня биомаркера или комбинации биомаркеров путем проведения анализа порога отсечения, принимая во внимание чувствительность, специфичность, прогностическую ценность отрицательного результата (NPV), прогностическую ценность положительного результата (PPV), отношение правдоподобия положительного результата (PLR) и отношение правдоподобия отрицательного результата (NLR), необходимых для клинической ценности. Результаты для биомаркеров или результаты для комбинации биомаркеров анализируют любым из различных способов. В некоторых вариантах осуществления результаты анализируют, используя одномерный анализ или одновариантный анализ (SV). В некоторых вариантах осуществления результаты анализируют, используя мультивариантный анализ (MV). Примеры обоих анализов, SV и MV, биомаркеров и/или когорты биомаркеров показаны в таблицах ниже.

[0019] В некоторых вариантах осуществления эталонным геном является ген, специфичный для предстательной железы. В некоторых вариантах осуществления эталонный ген представляет собой KLK3 или SPDEF, или их сочетание. В некоторых вариантах осуществления эталонный ген представляет собой ген «домашнего хозяйства», например, GAPDH.

[0020] Биомаркеры и комбинации биомаркеров (также называемые в настоящем документе как когорты биомаркеров) могут быть использованы в способах диагностики, прогнозирования, проведения мониторинга и выбора терапии расстройства, такого как рак, в том числе, агрессивный рак. В некоторых вариантах осуществления биомаркеры и комбинации биомаркеров могут быть использованы для корреляции биомаркера и/или когорты экспрессии с вероятность того, что индивид страдает агрессивным злокачественным новообразованием или имеет риск его развития, на основе определенного уровня экспрессии и/или профиля экспрессии. В некоторых вариантах осуществления биомаркеры и комбинации биомаркеров могут быть использованы для корреляции биомаркера и/или когорты экспрессии с вероятность того, что индивид страдает рецидивирующим злокачественным новообразованием или имеет риск его развития, на основании определенного уровня экспрессии и/или профиля экспрессии. В некоторых вариантах осуществления биомаркеры и комбинации биомаркеров могут быть использованы для корреляции биомаркера и/или когорты экспрессии с вероятность того, что индивид страдает агрессивным раком предстательной железы или имеет риск его развития, на основании определенного уровня экспрессии и/или профиля экспрессии. Биомаркеры и комбинации биомаркеров могут быть использованы для корреляции биомаркера и/или когорты экспрессии с индексом Глисона у индивида. Например, уровень экспрессии биомаркера и/или когорты можно использовать для определения индекса Глисона у индивида на основании определенного уровня экспрессии и/или профиля экспрессии. Например, уровень экспрессии PCA3 и ERG можно использовать для определения того факта, что у индивида индекс Глисона выше 6. Биомаркеры и комбинации биомаркеров могут быть использованы для корреляции биомаркера и/или когорты экспрессии с вероятностью того, что индивиду будет необходима радикальная простатэктомия, на основании определенного уровня экспрессии и/или профиля экспрессии.

[0021] В некоторых вариантах осуществления расстройством является рак. Например, рак представляет собой рак предстательной железы. В некоторых вариантах осуществления рак представляет собой рак мочеполовой системы, например, рак предстательной железы, рак почки, рак мочевого пузыря или метастатическое злокачественное новообразование, которое поражает мочеполовые органы. В некоторых вариантах осуществления злокачественное новообразование представляет собой агрессивное злокачественное новообразование. Например, в некоторых вариантах осуществления расстройство представляет собой агрессивный рак предстательной железы, агрессивный рак почки или агрессивный рак мочевого пузыря.

[0022] Нуждающийся индивид страдает раком, например, агрессивным раком или имеет риск его развития. В некоторых вариантах осуществления индивид страдает раком предстательной железы или имеет риск его развития. В некоторых вариантах осуществления индивид не имеет риска развития рака предстательной железы. В некоторых вариантах осуществления индивид страдает раком предстательной железы и у него определен конкретный индекс Глисона. Например, в некоторых вариантах осуществления у индивида определен индекс Глисона выше или равный 7. В некоторых вариантах осуществления у индивида определен индекс Глисона, выше или равный 1, 2, 3, 4, 5, 6, 7, 8 или 9. В некоторых вариантах осуществления у индивида определен индекс Глисона, который находится в диапазоне от 1 до 10, от 1 до 9, от 1 до 8, от 1 до 7, от 1 до 6, от 1 до 5, от 1 до 4, от 1 до 3, от 1 до 2, от 2 до 10, от 2 до 9, от 2 до 8, от 2 до 7, от 2 до 6, от 2 до 5, от 2 до 4, от 2 до 3, от 3 до 10, от 3 до 9, от 3 до 8, от 3 до 7, от 3 до 6, от 3 до 5, от 3 до 4, от 4 до 10, от 4 до 9, от 4 до 8, от 4 до 7, от 4 до 6, от 4 до 5, от 5 до 10, от 5 до 9, от 5 до 8, от 5 до 7, от 5 до 6, от 6 до 10, от 6 до 9, от 6 до 8, от 6 до 7, от 7 до 10, от 7 до 9, от 7 до 8, от 8 до 10, от 8 до 9 или от 9 до 10. В некоторых вариантах осуществления у индивида проведена простатэктомия, например, радикальная простатэктомия, или у него имеется риск проведения простатэктомии, например, радикальной простатэктомии.

[0023] Индивидом является, например, мужчина с клиническим подозрением на рак предстательной железы, например, на основании результатов исследования PSA и/или DRE. В некоторых вариантах осуществления в анамнезе у индивида была имеется биопсия с отрицательным результатом. В некоторых вариантах осуществления в анамнезе у индивида нет биопсии с отрицательным результатом. В некоторых вариантах осуществления индивиду рекомендована повторная биопсия. В некоторых вариантах осуществления индивиду рекомендована первичная, или первая, биопсия.

[0024] В некоторых вариантах осуществления индивиду рекомендована простатэктомия или она запланирована. В некоторых вариантах осуществления индивид имеет гистологически подтвержденный ацинарный тип (то есть, типичный) рака предстательной железы. В некоторых вариантах осуществления рак предстательной железы является локализованным. В некоторых вариантах осуществления рак предстательной железы является локально распространенным.

[0025] В некоторых вариантах осуществления индивид не страдает заболеванием, таким как инфекционное заболевание, например, гепатит (все типы) и/или ВИЧ, и/или оно у него не предполагается. В некоторых вариантах осуществления в анамнезе у индивида нет параллельно протекающей опухоли почек и/или мочевого пузыря. В некоторых вариантах осуществления индивид ранее не получал или одновременно не получал никакой неоадъювантной или фокальной терапии рака предстательной железы. В некоторых вариантах осуществления индивид ранее не получал или одновременно не получал никакой неоадъювантной или фокальной терапии, включая андроген-заместительную терапию, в течение шести месяцев до взятия образца мочи.

[0026] Маркеры и/или комбинации маркеров, описанные в настоящем документе, могут быть использованы в различных наборах, например, в диагностическом наборе, который можно использовать для исследования образцов мочи различных пациентов. В некоторых вариантах осуществления перед исследованием образца с помощью набора образец мочи концентрируют, например, с помощью стадии фильтрационной концентрации. Результаты могут быть обработаны, используя различные способы, включая устройства для быстрого считывания данных кПЦР.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0027] На фигурах 1A и 1B представлена серия схематических иллюстраций, изображающих рабочую схему исследования образцов когорты 7 пациентов в день 1 (фигура 1A) и в день 2 (фигура 1B).

[0028] На фигуре 2A графически изображена плотность распределения величин Ct Q бета, при детекции в 258 образцах когорты 7. Ось Y представляет плотность, а ось Х представляет собой величину Ct.

[0029] На фигуре 2B показан диаграмма размаха, на которой изображена плотность распределения величин Ct Q бета, как определено для 258 образцов когорты 7. Ось X представляет собой величину Ct.

[0030] Фигуры 3A и 3B представляют собой два графика, на которых показана корреляция значений AUC PCA3 при нормализации с KLK3 для объема образца каждого пациента когорты 7. На фигуре 3A, ось Y представляет собой значения AUC, а ость X представляет собой каждый образец когорты 7. На фигуре 3B, ось Y представляет собой объем образца, а ось X представляет собой каждый образце когорты 7. Легенда указывает клиники, из которых был получен каждый образец. На фигурах 3A и 3B показано, что AUC PCA3 (нормализован с KLK3) улучшается от <0,65 до >0,7, если объемы донорных образцов ограничены только 20 мл. На этих фигурах видно, что AUC в высокой степени зависит от объема образца.

[0031] Фигуры 4A и 4B представляют собой два графика, изображающих ROC-кривую, на основе анализа экспрессии ERG, нормализованного с KLK3, (не учтен, фигура 4A) и на основе анализа экспрессии PCA3 (фигура 4B), нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 100 мл (N=236). На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0032] Фигуры 5A и 5B представляют собой два графика, изображающих ROC-кривую, на основе анализа экспрессии ERG, нормализованного с KLK3, (не учтен, фигура 5A) и на основе анализа экспрессии PCA3 (фигура 5B), нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 40 мл (N=189). На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0033] Фигуры 6A и 6B представляют собой два графика, изображающих ROC-кривую, на основе анализа экспрессии ERG, нормализованного с KLK3, (не ограничен, фигура 6A) и на основе анализа экспрессии PCA3 (фигура 6B), нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 20 мл (N=122). На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0034] Фигура 7 представляет собой график, изображающий ROC-кривую, на основе анализа экспрессии ERG и PCA3, нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 100 мл (N=236). Анализ экспрессии ERG был учтен. На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0035] Фигура 8 представляет собой график, изображающий ROC-кривую, на основе анализа экспрессии ERG и PCA3, нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 40 мл (N=189). Анализ экспрессии ERG был учтен. На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0036] Фигура 9 представляет собой график, изображающий ROC-кривую, на основе анализа экспрессии ERG и PCA3, нормализованного с KLK3, в образцах пациентов когорты 7, в которых объем образца был меньше или равен 20 мл (N=122). Анализ экспрессии ERG был учтен. На обоих фигурах ось X представляет собой специфичность; ось Y представляет собой чувствительность.

[0037] Фигура 10 представляет собой серию четырех таблиц, на которых показан анализ данных 2×2 когорты 7, используя заранее определенную формулу и величины пороговых значений модели, которые использовали для ранее полученных данных когорты 5. (Чувс.=чувствительность; Спец.=специфичность; NPV=прогносвическая ценность отрицательного результата; PPV=прогностическая ценность положительного результата; С5=контора 5; С7=контора 7). Значения, установленные для данных С5, были удовлетворительны при применении к С7, несмотря на некоторые различия между С5 и С7, такие как, например, протокол экстракции и химическую структуру зондов. Объемы когорты С5, как правило, были ниже, объемов С6, большинство образцов имело объем 40 мл.

[0038] Фигура 11 представляет собой диаграмму размаха, показывающую распределение величин Ct для детектированных генов (AMACR, BIRC5, ERG, НОХС6, KLK3, РСА4, QBETA, SPARCL1 И SPDEF) в каждом образце группы (пул образцов из Германии=пул контрольных образцов, пациенты=пациенты когорты 7, эталон=эталонные контроли и RT-контроли-контроли с обратной транскриптазой).

[0039] Фигура 12 представляет собой график сравнения значений AUC, полученных с помощью одновариантного анализа для каждого указанного гена (РСА3, ERG, AMACR, ВIRC5, НОХС6, SPARCL1 и SPDEF) в образцах с маленьким объемом (20 мл) со значениями AUC всех образов. Все CI и CI, объемом 20 мл, указывают на 95% доверительный интервал для AUC для «всех образцов» и «образцов, объемом 20 мл», соответственно. Ось У представляет собой значения AUG; ось X представляет собой каждый тестируемый ген.

[0040] Фигура 13 представляет собой график, на котором показаны значения AUC, полученные с помощью одновариантного анализа для каждого указанного гена (AMACR, BIRC5, ERG, НОХС6, KLK3, РСА3, SPARCL1 и SPDEF) и сравнение значений AUС в следующих подгруппах: нормализованные с SPDEF или KLK3; учтенные и нормализованные с SPDEF или KLK3; образцы всех объемов и образцы с маленькими объемами; и число копий до значений Ct.

[0041] Фигуры 14А и 14В представляют собой два графика, на которых представлено сравнение анализа когорты 5 (С5) и когорты 7 (С7) с помощью анализа на трех генах. На Фигуре 14А показано сравнение С5 и С7 для всех образцов. На Фигуре 14B показано сравнение С5 и С7 образцов с маленьким объемом. FTO=модель на 3-х генах, где не используется РСА3. FTO относится к модели на трех генах, в которой не используется РСА3.

[0042] Фигура 15 представляет собой график, на котором показаны значения AUC, полученные на аналитической модели на 3-х генах, указанной комбинации следующих генов: AMACR, BIRC5, ERG, HOXC6, KLK3, PCA3 SPARCL1, и SPDEF; и сравнение значений AUC в следующих подгруппах: нормализованные с SPDEF или KLK3; учтенные и нормализованные с SPDEF или KLK3; образцы со всеми объемами и образцы с маленькими объемами; и число копий к величинам Ct.

[0043] Фигура 16 представляет собой график, на котором иллюстративно показано распределение баллов по шкале EXO106 в когорте пациентов, где n=453 образцов, среднее PSA=5,3 нг/мл и 80% образцов 2<PSA<10 нг/мл.

[0044] На Фигуре 17 графически показана AUC для EXO106 в режиме на пациентах с любым индексом Глисона в сравнении с AUC при стандартном лечении (SOC).

[0045] Фигуры 18A и 18B представляет собой серии графиков, изображающих EXO106 в режиме с квартилем, то есть, процентное содержание образцов, идентифицированных как положительные с помощью биопсии, по баллам по шкале EXO106 квартиль.

[0046] Фигура 19 представляет собой графическое изображение балла EXO106 в режиме для рака предстательной железы с высоким баллом, например, с индексом Глисона больше 6.

[0047] Фигура 20 представляет собой графическое изображение балла EXO106 в режиме на основе индекса Глисона в подгруппах.

ПОДРОБНОЕ ОПИСАНИЕ

[0048] Биомаркеры, злокачественных новообразований, включают, например, специфические мутации в последовательностях генов (Cortez and Calin, 2009; Diehl et al., 2008; Network, 2008; Parsons et al., 2008), положительную и отрицательную регуляцию мРНК и экспрессии мкРНК (Cortez and Calin, 2009; Itadani et al., 2008; Novakova et al., 2009), варианты сплайсинга мРНК, изменения в профиле метилирования ДНК (Cadieux et al., 2006; Kristensen and Hansen, 2009), амплификацию и делецию геномных областей (Cowell and Lo, 2009) и абберантную экспрессию повторяющихся последовательностей ДНК (Ting et al., 2011). С помощью различных диагностических молекулярных анализов, таких как мутационный анализ, анализ статуса метилирования геномной ДНК и анализ экспрессии генов, можно детектировать эти биомаркеры и представлять важную информацию пациентам, врачам, клиницистами и исследователям. До настоящего времени, такие анализы преимущественно проводили на злокачественных клетках, полученных при хирургическом удалении опухолевой ткани или из ткани, полученной при биопсии. Например, посредством анализа на биопсию ранее было показано, что PCA3, TMPRSS2:ERG и ERG дифференциально экспрессируются при раке предстательной железы по сравнению со здоровой тканью предстательной железы (Bussemakers et al., 1999; Petrovics et al., 2005; Tomlins et al., 2005).

[0049] Однако, возможность проведения таких исследований с использованием образца жидкости организма зачастую является более желательной, чем с использованием образца ткани пациента. Менее инвазивный подход при использовании образца биологической жидкости имеет огромное значение с точки зрения материального и нематериального удобства для пациента, возможности проведения мониторинга на протяжении заболевания, а также возможности получения профилей экспрессии, даже если клетки ткани труднодоступны, например, как в случае предстательной железы.

[0050] Ранее исследовалась возможность обнаружения маркеров рака предстательной железы, таких как PSA (также называется KLK3), PCA3, TMPRSS2:ERG и ERG, используя образцы мочи (Hessels et al., 2007; Laxman et al., 2008; Laxman et al., 2006; Nguyen et al., 2011; Рис et al., 2010; Rostad et al., 2009; Salami et al., 2011; Tomlins et al., 2005). Однако способы сбора таких образцов, описанные ранее, требуют проведения ректального исследования предстательной железы (DRE) или массажа предстательной железы, для того чтобы обеспечить поступления в мочу достаточного количества клеточной жидкости из предстательной железы. Образцы, собранные без проведения DRE или массажа предстательной железы, показывают низкий уровень детекции таких биомаркеров. Например, уровень детекции для TMPRSS2:ERG составил приблизительно 69% при проведении DRE, и лишь приблизительно 24% без проведения DRE (Rostad et al., 2009).

[0051] Фактически, для существующих в настоящее время способов сбора образцов для анализа мочи на биомаркеры рака предстательной железы требуется применение DRE с постоянным осуществлением давления средней силы на всю пальпируемую поверхность предстательной железы, с 3-х кратными поглаживающими надавливаниями на предстательную железу с каждой стороны, сильным давлением на предстательную железу по направлению снизу вверх и от края к середине (где поверхность углубления предстательной железы составляет от 0,5 до 1 см) для каждой доли три раза (Deras et al., 2008; Hessels et al., 2007; Laxman et al., 2008; Laxman et al., 2006; Nguyen et al., 2011; Рис et al., 2010; Salami et al., 2011).

[0052] Кроме того, для описанного ранее способа получения образца требуется выделение клеточного осадка из образца мочи, полученного после проведения DRE, посредством центрифугирования (Hessels et al., 2007; Laxman et al., 2008; Laxman et al., 2006; Nguyen et al., 2011; Rostad et al., 2009; Salami et al., 2011).

[0053] Большое число проведенных ранее исследований позволяет предположить, что DRE является важной стадией для сбора достаточного количества материала РНК при неинвазивных генетических анализах предстательной железы (Deras et al., 2008; Hessels et al., 2007; Laxman et al., 2008; Laxman et al., 2006; Nguyen et al., 2011; Рис et al., 2010; Rostad et al., 2009; Salami et al., 2011; Tomlins et al., 2011). В некоторых из этих исследований, требуется обработка образцов мочи в пределах 4 часов после сбора (Deras et al., 2008; Tomlins et al., 2011).

[0054] В отличие от этих ранее известных способов сбора образцов и способов детекции биомаркеров в моче, способы, представленные в настоящем документе, не требуют ни проведения DRE или массажа предстательной железы перед сбором образца мочи, ни стадию обработки образцов, включающую выделение клеточного осадка из образцов мочи. В этих новых неинвазивных способах используют микровизикулы мочи для детекции биомаркеров, способствующих диагностики, прогнозированию, проведению мониторинга или выбору терапии заболевания или другого расстройства предстательной железы. Микровизикулы, высвобождаемые опухолевыми клетками, можно использовать для определения генетического статуса опухоли (Skog et al., 2008). Также см. WO 2009/100029, WO 2011/009104, WO 2011/031892 и WO 2011/031877.

[0055] Микровезикулы высвобождаются эукариотическими клетками, или «почкуются» из плазматической мембраны, наружу клеток. Эти мембранные везикулы гетерогенны по размеру и имеют диаметр в диапазоне приблизительно от 10 нм до приблизительно 5000 нм. Все мембранные везикулы, высвобождаемые клетками, размер которых меньше 0,8 мкм в диаметре, обозначают общим понятием «микровезикулы», как в настоящем документе.

[0056] Настоящее изобретение основано на неожиданном обнаружении, что микровизикулы мочи содержат биомаркеры заболевания или другого расстройства предстательной железы у индивида. Таким образом, образец мочи пациента может быть проанализирован на детекцию биомаркеров заболевания или другого расстройства предстательной железы у индивида.

[0057] В способах, приведенных в настоящем документе, производные образцы мочи индивидов собирали без проведения ректального исследования предстательной железы (DRE) или массажа предстательной железы перед сбором мочи. Образцы мочи имеют объем 60 мл, 50 мл, 40 мл, 30 мл, 20 мл, 15 мл или 10 мл. В некоторых предпочтительных вариантах осуществления образцы мочи имеют объем 40 мл или 20 мл. В некоторых вариантах осуществления образцы мочи могут иметь объем от 1 до 40 мл, от 1 до 35 мл, от 1 до 30 мл, от 1 до 25 мл, от 1 до 20 мл, от 1 до 15 мл, от 1 до 10 мл, от 1 до 5 мл, от 5 до 40 мл, от 5 до 35 мл, от 5 до 30 мл, от 5 до 25 мл, от 5 до 20 мл, от 5 до 15 мл, от 5 до 10 мл, от 10 до 40 мл, от 10 до 35 мл, от 10 до 30 мл, от 10 до 25 мл, от 10 до 20 мл, от 10 до 15 мл, от 15 до 40 мл, от 15 до 35 мл, от 15 до 30 мл, от 15 до 25 мл, от 15 до 20 мл, от 20 до 40 мл, от 20 до 35 мл, от 20 до 30 мл, от 20 до 25 мл, от 25 до 40 мл, от 25 до 35 мл, от 25 до 30 мл, от 30 до 40 мл, от 30 до 35 мл, или от 35 до 40 мл.

[0058] В предпочтительном варианте осуществления образец мочи представляет собой первую порцию мочи из мочевого пузыря, которая также известна как «утренняя» моча. Первая порция мочи содержит максимальную концентрацию микровезикул из предстательной железы и, таким образом, анализ первой порции мочи дает максимальный сигнал биомаркеров предстательной железы. Как показано в настоящем документе, диагностическая точность биомаркеров, используемых для диагностики и прогнозирования рака предстательной железы, повышается при уменьшении объема образца первой порции мочи. Полученные сведения, как описано в настоящем документе, указывают на то, что объем первой порции мочи, равный 40 мл или 20 мл, дает максимальную диагностическую точность (то есть, значения AUC). Таким образом, в предпочтительном варианте осуществления образцы мочи представляет собой первую порцию мочи объемом 40 мл или менее, полученную из мочевого пузыря. Например, образцы мочи представляет собой первую порцию мочи объемом 20 мл, полученную из мочевого пузыря.

[0059] Образцы мочи, которые не подходят для использования в наборах и/или способах, раскрытых в настоящем описании, включают такие образцы, которые не хранились и/или не перевозились должным образом. Например, образцы не следует хранить при комнатной температуре (например, 15-25°C) в течение длительного времени. В некоторых вариантах осуществления образцы не следует хранить при комнатной температуре (например, 15-25°C) в течение более 24 часов. В некоторых вариантах осуществления образцы не следует хранить при комнатной температуре (например, 15-25°C) в течение более 36 часов. В некоторых вариантах осуществления образцы не следует хранить при комнатной температуре (например, 15-25°C) в течение более чем 48 часов. Образцы не следует хранить при температуре замерзания (например, 2-8°C) в течение длительного времени. Например, образцы не следует хранить при температуре замерзания (например, 2-8°C) в течение свыше 21 суток. В некоторых вариантах осуществления образцы не следует хранить при температуре замерзания (например, 2-8°C) в течение свыше 30 суток. Как правило, образцы могут быть заморожены (например, ≤70°C) на неопределенный период времени. Образцы следует перевозить на хладоэлементах или на сухом льду, если образец заморожен.

[0060] Образцы мочи, которые не подходят для использования в наборах и/или способах, раскрытых в настоящем описании, включают образцы с чрезмерным содержанием крови.

[0061] Время сбора образцов мочи может также изменяться в зависимости от различных вариантов применения. Образец может быть собран в любое время в качестве разового образца мочи. Разовый образец мочи может подходить для анализов на биомаркеры, если количество биомаркеров в микровезикулах для анализа, не слишком изменяется в течение суток. В других случаях, собирают 24-ех часовой образец мочи, если количество маркеров в микровезикулах для анализа изменяется, и 24-ех часовой объем мочи может уменьшить такой эффект изменения. Еще в других случаях, собирают серию образцов мочи для исследования изменения количества биомаркеров в микровезикулах. Сбор серии образцов можно проводить в определенный интервал времени, например, каждые 6 часов, или по определенному плану, например, до или после терапевтического вмешательства.

[0062] В способах, представленных в настоящем документе, образцы мочи представляет собой первую порцию мочи, предварительно обработанную с помощью способа, включающего по меньшей мере одну стадию фильтрации. Например, используют фильтр с пропускной способность (0,8 микрон) для удаления клеток и клеточного осадка. После такой фильтрации может следовать стадия ультрафильтрации для удаления растворителя и низкомолекулярных аналитов с сохранением микровезикул. Используемые для первичной фильтрации фильтры могут быть любого размера, который подходит для удаления клеток и клеточного осадка, например, любого размера свыше 0,22 микрон. Для выделения микровизикул мочи затем проводят стадию концентрирования фильтрацией предварительно обработанных образцов, где используется фильтр с пороговым значением молекулярной массы для сохранения и концентрирования микровезикул, диаметр которых выше 10 нм. Например, образец затем концентрируют до объема менее 1 мл, предпочтительно, 100-200 мкл. Например, пороговая величина молекулярной массы составляет по меньшей мере 100 кДа.

[0063] В некоторых вариантах осуществления способ предварительной обработки и обработки образца мочи включает следующие стадии. Во-первых, проводят обработку порции образца мочи, например, объемом по меньшей мере 20 мл, с помощью фильтра размером 0,8 мкм. Например, если объем образца составляет ≤50 мл, по меньшей мере 20 мл набирают в шприц, который присоединен к фильтру размером 0,8 мкм, а затем выпускают в чистый сосуд, например, чистую пробирку объемом 50 мл. Если объем образца мочи составляет ≥50 мл, то образец фильтруют, используя фильтр-бутылку с размером фильтра 0,8 мкм, и в некоторых вариантах осуществления используют отсос для прохождения образца через фильтр-бутылку. Затем, независимо от начального объема образца, отфильтрованную мочу в чистом сосуде помещают на импульсное встряхивающее устройство на несколько секунд, например, на 1-2 секунды. Отфильтрованную мочу затем хранят до начала фильтрационной концентрации.

[0064] Порцию отфильтрованной мочи, например, 15 мл, затем обрабатывают, используя фильтр для концентрации (FC). После того, как отфильтрованную мочу с помощью пипетки переносят в камеру FC (то есть, в верхнюю камеру FC-сосуда), можно добавить определенную концентрацию внутреннего контроля, например, внутренний контроль с Q-бета бактериофагом (Attostar, Catalog #BAC200). FC-сосуд затем центрифугируют, например, на роторной центрифуге с плавающим барабаном, и крутят в течение 5 минут при 4500×g при комнатной температуре (например, 20-25°C). Если образец не удалось полностью отфильтровать (>500 мкл ультраконцентрата остается в FC), то следует провести еще раз центрифугирование FC-сосуда в течение 2-5 минут. Образцы, которые показывают минимальные сигналы фильтрата (>10 мл ультраконцентрата остается в FC), следует отбраковать.

[0065] Образец затем вынимают из центрифуги, и фильтрат (то есть, жидкость на дне FC-сосуда) удаляют. Ультраконцентрат затем ресуспендируют с 5 мл оставшейся отфильтрованной мочи и с 10 мл 1×PBS. Образец равномерно перемешивают, например, переворачивая FC-сосуд 3-4 раза. FC-сосуд затем центрифугируют, например, на роторной центрифуге с плавающим барабаном, и крутят в течение 5 минут при 4500×g при комнатной температуре (например, 20-25°C). Образец затем вынимают из центрифуги, и фильтрат удаляют.

[0066] На первой стадии промывки ультраконцентрат ресуспендируют в 15 мл 1×PBS. Образец равномерно перемешивают, например, переворачивая FC-сосуд 3-4 раза. FC-сосуд затем центрифугируют, например, на роторной центрифуге с плавающим барабаном, и крутят в течение 5 минут при 4500×g при комнатной температуре (например, 20-25°C).

[0067] На второй стадии промывки ультраконцентрат ресуспендируют в 15 мл 1×PBS. Образец равномерно перемешивают, например, переворачивая FC-сосуд 3-4 раза. FC-сосуд затем центрифугируют, например, на роторной центрифуге с плавающим барабаном, и крутят в течение 7 минут при 4500×g при комнатной температуре (например, 20-25°C). Ожидаемый объем ультраконцентрата равен 100-200 мкл. Если объем образца больше 250 мкл, то затем FC-сосуд крутят дополнительные 5 минут при 4500×g при комнатной температуре.

[0068] После выделения и концентрации микровизикул мочи образцы предварительно обрабатывают ингибитором РНКазы, перед экстракцией нуклеиновой кислоты, для предупреждения ферментного расщепления экстрагированной РНК и для повышения качества экстракта. Необязательно, образцы можно промывать по меньшей мере один раз с помощью подходящего буфера для дополнительного насыщения или очистки микровезикулярной фракции. В некоторых вариантах осуществления образцы дважды промывают, используя подходящий буфер для дополнительного насыщения или очистки микровезикулярной фракции. РНК экстрагируют из микровезикул способом, включающим лизис микровезикул, пропуск лизата через РНК-связывающую колонку и элюирование РНК из РНК-связывающей колонки, в подходящих условиях, предусмотренных для получения препаратов РНК высокого качества. Необязательно, концентрированные микровезикулы лизируют на фильтре, используя стадию предварительной обработки. Эти препараты РНК высокого качества обеспечивают основанную на анализе мочи молекулярную диагностику рака предстательной железы и другие расстройства предстательной железы.

[0069] В некоторых вариантах осуществления в верхнюю камеру FC-сосуда добавляют 4 мкл ингибитора РНКазы. Сосуд затем встряхивают в боковом направлении для обеспечения полного суспендирования ингибитора РНКазы. Образец затем инкубируют вместе с ингибитором РНКазы в течение 2-3 минут при комнатной температуре (например, 15-25°C). Затем в каждый образец добавляют буфер для лизиса РНК, например, буфер для лизиса РНК Promega (Catalog #Z3051), содержащий 2% 1-триглицерин, в объеме 250 мкл. Образец затем быстро встряхивают на устройстве для встряхивания и инкубируют при комнатной температуре в течение 1 минуты.

[0070] Затем на дно FC-сосуда помещают пипетку (осторожно, чтобы не дотронуться или не задеть боковые поверхности сосуда или фильтра) и переносят 150 мкл раствора (то есть, образец+ингибитор РНКазы) в сосуд объемом 2 мл без РНКазы. Эту стадию повторяют до тех пор, пока весь образец не будет взят и перенесен в сосуд объемом 2 мл без РНКазы. Выделенная микровезикулярная фракция затем готова для экстракции нуклеиновой кислоты, например, экстракции РНК.

[0071] Затем в сосуд объемом 2 мл добавляют изопропанол в объеме 150 мкл, и раствор перемешивают пипеткой. Лизат переносят на колонку для экстракции, и колонку для экстракции центрифугируют в течение 30 секунд при 13000×g. Колонку для экстракции затем переносят в новую пробирку для сбора, и повторяют центрифугирование в течение 30 секунд при 13000×g и перенос из колонки для экстракции в новую пробирку для сбора повторяют до тех пор, пока весь лизат не будет перенесен. Затем в пробирку для сбора добавляют раствор для промывки РНК (буфер RWA) от Promega (Catalog #Z309B-C) в объеме 500 мкл, и пробирку центрифугируют в течение 30 секунд при 13000×g. Образец затем переносят в новую пробирку для сбора, в пробирку для сбора добавляют 300 мкл буфера RWA, и пробирку для сбора затем центрифугируют в течение 2 минут при 13000×g. Образец затем переносят в новую пробирку для сбора, и пробирку для сбора затем центрифугируют в течение 2 минут при 13000×g. Содержимое пробирки для сбора затем переносят в пробирку Eppendorf® объемом 1,5 мл, которая свободна от РНКазы ДНКазы. Содержимое пробирки затем элюируют, используя 16 мкл воды без нуклеазы, например, воду без нуклеазы от Promega (Catalog #P119E) и центрифугируют в течение 1 минуты при 13000×g.

[0072] Экстрагированная из микровезикулярной фракции РНК может затем хранится при ≤-70°C в морозильнике с ультранизкой заморозкой.

[0073] Способы, описанные в настоящем документе, могут включать использование контрольной частицы для определения или оценки качества выделения микровезикул и/или экстракции нуклеиновой кислоты из микровезикул. Контрольные частицы, в совокупности относятся к частицам с размером микровезикул, которые добавляют в некоторых точках выделения микрочастиц или в процессе экстракции нуклеиновой кислоты, где частицы содержат контрольные нуклеиновые кислоты, такие как ДНК или РНК. Конкретно, контрольные нуклеиновые кислоты содержат по меньшей мере один ген-мишень для анализа или измерения для определения выделенного количества контрольных частиц во время процесса выделения или экстракции.

[0074] Предпочтительно, контрольная частица представляет собой Q-бета бактериофаг, называемый в настоящем документе «Q-бета частицей». Q-бета частица, используемая в способах, описанных в настоящем документе, может быть природной вирусной частицей или может быть рекомбинантым или сконструированным вирусом, в котором по меньшей мере один компонент вирусной частицы (например, часть генома или белок оболочки) синтезируют с помощью методик рекомбинантной ДНК или молекулярной биологии, известных в данной области. Q-бета является представителем семейства левивирусов, отличающегося линейным одноцепочечным РНК-геномом, который состоит из 3 генов, кодирующих четыре вирусных белка: белок оболочки, белок созревания, белок лизиса и РНК-репликазу. В виду того, что их размер сходен со средним размером микровезикул, Q-бета может быть без труда очищен из биологического образца, используя те же способы очистки, которые используются для выделения микровезикул, как описано в настоящем документе. Кроме того, простота одноцепочечной генной структуры вируса Q-бета дает преимущества его использования в качестве контроля в анализах амплификации нуклеиновой кислоты. Q-бета частица содержит контрольный ген-мишень или контрольную последовательность-мишень для детекции или измерения количества Q-бета частиц в образце. Например, контрольный ген-мишень представляет собой ген белка оболочки Q-бета. После добавления Q-бета частиц в образец мочи или выделение микровезикул мочи, нуклеиновые кислоты Q-бета частицы экстрагируют вместе с нуклеиновыми кислотами из микровезикул и/или образца мочи, используя способы экстракции, описанные в настоящем документе. Детекцию контрольного гена-мишени Q-бета можно проводить с помощью анализа ОТ-ПЦР, например, одновременно с интересующими биомаркерами (то есть, BIRC5, ERG и SPARCL1). Для определения числа копий можно использовать стандартную кривую по меньшей мере 2, 3 или 4 известных концентраций в 10-кратном разведении контрольного гена-мишени. Число копий, которое было определено, и количество Q-бета частиц, которое было добавлено, можно сравнивать для определения качества процесса выделения и/или экстракции.

[0075] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют Q-бета частицу, которая содержит по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или больше, последовательности нуклеиновой кислоты SEQ ID NO:1:

AAACGGTTCTTGTGACCCATCCGTTACTCGCCAGGCATATGCTGACGTGACCTTTTCGTTCACGCAGTATAGTACCGATGAGGAACGAGCTTTTGTTCGTACAGAGCTTGCTGCTCTGCTCGCTAGTCCTAGCGTCCTCAGTTAGATCCTTATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTGTCGGACAGCTCCCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGATTCTGCAGCGGGAAAACCTGTCCGTGACGTGGATTGGTGCTGCACCCCTCATCCTGTCTCGGATTGTGGGAGGCTGGGAGTGCGAGAAGCATTCCCAACCCTGGCAGGTGCTTGTGGCCTCTCGTGGCAGGGCAGTCTGCGGCGGTGTTCTGGTGCACCCCCAGTGGGTCCTCACAGCTGCCCACTGCATCAGGAACAAAAGCGTGATCTTGCTGGGTCGGCACAGC (SEQ ID NO: 1).

[0076] В некоторых вариантах осуществления Q-бета частицы добавляют в образец мочи перед экстракцией нуклеиновой кислоты. Например, Q-бета частицы добавляют в образец мочи перед ультрафильтрацией и/или после стадии предварительной фильтрации.

[0077] В некоторых вариантах осуществления в образец мочи добавляют 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1000 или 5000 копий Q-бета частиц. В некоторых вариантах осуществления в образец мочи добавляют 100 копий Q-бета частиц. Число копий Q-бета частиц может быть рассчитано на основании способности Q-бета бактериофага инфицировать клетки-мишени. Таким образом, число копий Q-бета частиц коррелирует с колониеобразующими единицами Q-бета бактериофага.

[0078] Способы, приведенные в настоящем документе, могут быть использованы для индивидов, у которых подозревают наличие рака предстательной железы, например, в виду повышенного PSA, данных DRE или любого другого принятого в данной области способа диагностики рака предстательной железы. В некоторых вариантах осуществления способы, приведенные в настоящем документе, могут быть использованы для индивидов, у которых ранее не проводилась какая-либо диагностика, такая как анализ PSA, DRE или любой другой принятый в данной области способ диагностики рака предстательной железы.

[0079] Способы, приведенные в настоящем документе, указывают на связь биомаркеров в микровизикулах мочи и обнаруживаемым раком предстательной железы, как определено с помощью биопсии предстательной железы. Биопсия предстательной железы является современным стандартом диагностики рака предстательной железы, но риск, связанный с проведением биопсии предстательной железы является существенным, особенно с учетом того, что в Соединенных Штатах ежегодно проводят один миллион биопсий. Нередкими являются боль, кровотечение, задержка мочеиспускания и инфекции мочевыводящих путей, при этом могут возникать тяжелые инфекции опасные для жизни.

[0080] Способы, описанные в настоящем документе, относятся к способам неинвазивного анализа уровня экспрессии РНК транскриптов, связанных с злокачественным новообразованием, в образцах мочи или микровизикулах мочи. В частности, способы используют для детекции экспрессии мРНК по меньшей мере PCA3 и ERG в образцах мочи. мРНК ERG может включать одну или несколько изоформ ERG, в том числе ERG1, ERG2, ERG3, ERG4, ERG5, ERG6, ERG7, ERG8, ERG9, изоформу 1 ERG, специфическую для рака предстательной железы (EPC1), и изоформу 2 ERG, специфическую для рака предстательной железы (EPC2). Как показано в настоящем документе, определение уровня экспрессии PCA3 и ERG в микровизикулах мочи обеспечивает его высокую чувствительность и специфичность в качестве биомаркера рака предстательной железы и других расстройств предстательной железы у индивидов, которым ранее проводили биопсию предстательной железы (называются в настоящем документе когорта с биопсией или когорта пациентов). В некоторых вариантах осуществления совместно детектируют 2, 3, 4, 5, 6, 7, 8, 9 или 10 или более биомаркеров.

[0081] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК ERG, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов и/или по меньшей мере 250 нуклеотидов или более, следующей последовательности нуклеиновой кислоты:

CAGTCGAAAGCTGCTCAACCATCTCCTTCCACAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTGTCGGACAGCTCCAACTCCAGCTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAAGATGACGGATCCCGACGAGGTGGCCCGGCGCTGGGGAGAGCGGAAGAGCAAACCCAACATGAACTACGATAAGCTCAGCCGCGCC (SEQ ID NO: 2).

[0082] Как показано в настоящем документе, PCA3 и ERG анализировали с помощью одномерного анализа и было показано, что каждый ген самостоятельно (при нормализации с эталонным геном, таким как KLK3) имеет высокую диагностическую точность (значения AUC выше 0,6). Анализ, описанный в настоящем документе, показывает, что PCA3 и ERG имеют большую диагностическую значимость, если нормализованный уровень экспрессии определяют для обоих, а не по отдельности.

[0083] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК PCA3, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов и/или по меньшей мере 450 нуклеотидов или более, последовательности нуклеиновой кислоты

GGGAGACGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGGAUAUCUGCAGAAUUCGCCCUUAUUGUCUCCUCAGUGACACAGGGCUGGAUCACCAUCGACGGCACUUUCUGAGUACUCAGUGCAGCAAAGAAAGACUACAGACAUCUCAAUGGCAGGGGUGAGAAAUAAGAAAGGCUGCUGACUUUACCAUCUGAGGCCACACAUCUGCUGAAAUGGAGAUAAUUAACAUCACUAGAAACAGCAAGAUGACAAUAUAAUGUCUAAGUAGUGACAUGUUUUUGCACAUUUCCAGCCCCUUUAAAUAUCCACACACACAGGAAGCACAAAAGGAAGCACAGAGAUCCCUGGGAGAAAUGCCCGGCCACCUGCGGCCGCAAGCUUGGAUCCGAAUUCCUGUGUGAAAUUGUUAUCCGCUCACAAUUCCACACAACAUACGAGCCGGAAGCAUAAAGUGUAAAGCCUGGGGUGCCUAAUGA (SEQ ID NO: 3).

[0084] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК ERG, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов и/или по меньшей мере 250 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:2, и мРНК PCA3, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов и/или по меньшей мере 450 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:3.

[0085] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК ERG, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:2, и мРНК PCA3, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:3.

[0086] Дополнительные комбинации биомаркеров можно использовать вместе с PCA3 и ERG, где 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 или более дополнительных генов могут иметь высокую диагностическую значимость в качестве биомаркеров злокачественного новообразования, такого как агрессивное злокачественное новообразование или рак предстательной железы. Примеры этих дополнительных генов включают AMACR, BIRC5, HOXC6 и SPARCL1.

[0087] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК AMACR, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:4, SEQ ID NO:37 или SEQ ID NO:38:

AMACR человека, вариант 1 транскрипта, мРНК (SEQ ID NO:4)

GGGGCGTGGCGCCGGGGATTGGGAGGGCTTCTTGCAGGCTGCTGGGCTGGGGCTAAGGGCTGCTCAGTTTCCTTCAGCGGGGCACTGGGAAGCGCCATGGCACTGCAGGGCATCTCGGTCGTGGAGCTGTCCGGCCTGGCCCCGGGCCCGTTCTGTGCTATGGTCCTGGCTGACTTCGGGGCGCGTGTGGTACGCGTGGACCGGCCCGGCTCCCGCTACGACGTGAGCCGCTTGGGCCGGGGCAAGCGCTCGCTAGTGCTGGACCTGAAGCAGCCGCGGGGAGCCGCCGTGCTGCGGCGTCTGTGCAAGCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGATTCTGCAGCGGGAAAATCCAAGGCTTATTTATGCCAGGCTGAGTGGATTTGGCCAGTCAGGAAGCTTCTGCCGGTTAGCTGGCCACGATATCAACTATTTGGCTTTGTCAGGTGTTCTCTCAAAAATTGGCAGAAGTGGTGAGAATCCGTATGCCCCGCTGAATCTCCTGGCTGACTTTGCTGGTGGTGGCCTTATGTGTGCACTGGGCATTATAATGGCTCTTTTTGACCGCACACGCACTGGCAAGGGTCAGGTCATTGATGCAAATATGGTGGAAGGAACAGCATATTTAAGTTCTTTTCTGTGGAAAACTCAGAAATTGAGTCTGTGGGAAGCACCTCGAGGACAGAACATGTTGGATGGTGGAGCACCTTTCTATACGACTTACAGGACAGCAGATGGGGAATTCATGGCTGTTGGAGCAATAGAACCCCAGTTCTACGAGCTGCTGATCAAAGGACTTGGACTAAAGTCTGATGAACTTCCCAATCAGATGAGCATGGATGATTGGCCAGAAATGAAGAAGAAGTTTGCAGATGTATTTGCAGAGAAGACGAAGGCAGAGTGGTGTCAAATCTTTGACGGCACAGATGCCTGTGTGACTCCGGTTCTGACTTTTGAGGAGGTTGTTCATCATGATCACAACAAGGAACGGGGCTCGTTTATCACCAGTGAGGAGCAGGACGTGAGCCCCCGCCCTGCACCTCTGCTGTTAAACACCCCAGCCATCCCTTCTTTCAAAAGGGATCCTTTCATAGGAGAACACACTGAGGAGATACTTGAAGAATTTGGATTCAGCCGCGAAGAGATTTATCAGCTTAACTCAGATAAAATCATTGAAAGTAATAAGGTAAAAGCTAGTCTCTAACTTCCAGGCCCACGGCTCAAGTGAATTTGAATACTGCATTTACAGTGTAGAGTAACACATAACATTGTATGCATGGAAACATGGAGGAACAGTATTACAGTGTCCTACCACTCTAATCAAGAAAAGAATTACAGACTCTGATTCTACAGTGATGATTGAATTCTAAAAATGGTTATCATTAGGGCTTTTGATTTATAAAACTTTGGGTACTTATACTAAATTATGGTAGTTATTCTGCCTTCCAGTTTGCTTGATATATTTGTTGATATTAAGATTCTTGACTTATATTTTGAATGGGTTCTAGTGAAAAAGGAATGATATATTCTTGAAGACATCGATATACATTTATTTACACTCTTGATTCTACAATGTAGAAAATGAGGAAATGCCACAAATTGTATGGTGATAAAAGTCACGTGAAACAGAGTGATTGGTTGCATCCAGGCCTTTTGTCTTGGTGTTCATGATCTCCCTCTAAGCACATTCCAAACTTTAGCAACAGTTATCACACTTTGTAATTTGCAAAGAAAAGTTTCACCTGTATTGAATCAGAATGCCTTCAACTGAAAAAAACATATCCAAAATAATGAGGAAATGTGTTGGCTCACTACGTAGAGTCCAGAGGGACAGTCAGTTTTAGGGTTGCCTGTATCCAGTAACTCGGGGCCTGTTTCCCCGTGGGTCTCTGGGCTGTCAGCTTTCCTTTCTCCATGTGTTTGATTTCTCCTCAGGCTGGTAGCAAGTTCTGGATCTTATACCCAACACACAGCAACATCCAGAAATAAAGATCTCAGGACCCCCCAGCAAGTCGTTTTGTGTCTCCTTGGACTGAGTTAAGTTACAAGCCTTTCTTATACCTGTCTTTGACAAAGAAGACGGGATTGTCTTTACATAAAACCAGCCTGCTCCTGGAGCTTCCCTGGACTCAACTTCCTAAAGGCATGTGAGGAAGGGGTAGATTCCACAATCTAATCCGGGTGCCATCAGAGTAGAGGGAGTAGAGAATGGATGTTGGGTAGGCCATCAATAAGGTCCATTCTGCGCAGTATCTCAACTGCCGTTCAACAATCGCAAGAGGAAGGTGGAGCAGGTTTCTTCATCTTACAGTTGAGAAAACAGAGACTCAGAAGGGCTTCTTAGTTCATGTTTCCCTTAGCGCCTCAGTGATTTTTTCATGGTGGCTTAGGCCAAAAGAAATATCTAACCATTCAATTTATAAATAATTAGGTCCCCAACGAATTAAATATTATGTCCTACCAACTTATTAGCTGCTTGAAAAATATAATACACATAAATAAAAAAATATATTTTTCATTTCTATTTCATTGTTAATCACAACTACTTACTAAGGAGATGTATGCACCTATTGGACACTGTGCAACTTCTCACCTGGAATGAGATTGGACACTGCTGCCCTCATTTTCTGCTCCATGTTGGTGTCCATATAGTACTTGATTTTTTATCAGATGGCCTGGAAAACCCAGTCTCACAAAAATATGAAATTATCAGAAGGATTATAGTGCAATCTTATGTTGAAAGAATGAACTACCTCACTAGTAGTTCACGTGATGTCTGACAGATGTTGAGTTTCATTGTGTTTGTGTGTTCAAATTTTTAAATATTCTGAGATACTCTTGTGAGGTCACTCTAATGCCCTGGGTGCCTTGGCACAGTTTTAGAAATACCAGTTGAAAATATTTGCTCAGGAATATGCAACTAGGAAGGGGCAGAATCAGAATTTAAGCTTTCATATTCTAGCCTTCAGTCTTGTTCTTCAACCATTTTTAGGAACTTTCCCATAAGGTTATGTTTTCCAGCCCAGGCATGGAGGATCACTTGAGGCCAAGAGTTCGAGACCAGCCTGGGGAACTTGGCTGGACCTCCGTTTCTACGAAATAAAAATAAAAAAATTATCCAGGTATGGTGGTGTGTGCCTGTAGTCCTATCTACTCAAGGGTGGGGCAGGAGGATCACTTGAGCCCAGGAATTTGAGGCCACAGTGAATTAGGATTGCACCACTGCACTCTAGCCCAGGCAACAGAACAAGAACCTGTCTCTAAATAAATAAATAAAAATAATAATAATAAAAAAGATGTTTTCCCTACAA (SEQ ID NO: 4)

AMACR человека, вариант 1 транскрипта, мРНК (SEQ ID NO:37)

GGGGCGTGGCGCCGGGGATTGGGAGGGCTTCTTGCAGGCTGCTGGGCTGGGGCTAAGGGCTGCTCAGTTTCCTTCAGCGGGGCACTGGGAAGCGCCATGGCACTGCAGGGCATCTCGGTCGTGGAGCTGTCCGGCCTGGCCCCGGGCCCGTTCTGTGCTATGGTCCTGGCTGACTTCGGGGCGCGTGTGGTACGCGTGGACCGGCCCGGCTCCCGCTACGACGTGAGCCGCTTGGGCCGGGGCAAGCGCTCGCTAGTGCTGGACCTGAAGCAGCCGCGGGGAGCCGCCGTGCTGCGGCGTCTGTGCAAGCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGATTCTGCAGCGGGAAAATCCAAGGCTTATTTATGCCAGGCTGAGTGGATTTGGCCAGTCAGGAAGCTTCTGCCGGTTAGCTGGCCACGATATCAACTATTTGGCTTTGTCAGGTGGAAGGAACAGCATATTTAAGTTCTTTTCTGTGGAAAACTCAGAAATTGAGTCTGTGGGAAGCACCTCGAGGACAGAACATGTTGGATGGTGGAGCACCTTTCTATACGACTTACAGGACAGCAGATGGGGAATTCATGGCTGTTGGAGCAATAGAACCCCAGTTCTACGAGCTGCTGATCAAAGGACTTGGACTAAAGTCTGATGAACTTCCCAATCAGATGAGCATGGATGATTGGCCAGAAATGAAGAAGAAGTTTGCAGATGTATTTGCAGAGAAGACGAAGGCAGAGTGGTGTCAAATCTTTGACGGCACAGATGCCTGTGTGACTCCGGTTCTGACTTTTGAGGAGGTTGTTCATCATGATCACAACAAGGAACGGGGCTCGTTTATCACCAGTGAGGAGCAGGACGTGAGCCCCCGCCCTGCACCTCTGCTGTTAAACACCCCAGCCATCCCTTCTTTCAAAAGGGATCCTTTCATAGGAGAACACACTGAGGAGATACTTGAAGAATTTGGATTCAGCCGCGAAGAGATTTATCAGCTTAACTCAGATAAAATCATTGAAAGTAATAAGGTAAAAGCTAGTCTCTAACTTCCAGGCCCACGGCTCAAGTGAATTTGAATACTGCATTTACAGTGTAGAGTAACACATAACATTGTATGCATGGAAACATGGAGGAACAGTATTACAGTGTCCTACCACTCTAATCAAGAAAAGAATTACAGACTCTGATTCTACAGTGATGATTGAATTCTAAAAATGGTTATCATTAGGGCTTTTGATTTATAAAACTTTGGGTACTTATACTAAATTATGGTAGTTATTCTGCCTTCCAGTTTGCTTGATATATTTGTTGATATTAAGATTCTTGACTTATATTTTGAATGGGTTCTAGTGAAAAAGGAATGATATATTCTTGAAGACATCGATATACATTTATTTACACTCTTGATTCTACAATGTAGAAAATGAGGAAATGCCACAAATTGTATGGTGATAAAAGTCACGTGAAACAGAGTGATTGGTTGCATCCAGGCCTTTTGTCTTGGTGTTCATGATCTCCCTCTAAGCACATTCCAAACTTTAGCAACAGTTATCACACTTTGTAATTTGCAAAGAAAAGTTTCACCTGTATTGAATCAGAATGCCTTCAACTGAAAAAAACATATCCAAAATAATGAGGAAATGTGTTGGCTCACTACGTAGAGTCCAGAGGGACAGTCAGTTTTAGGGTTGCCTGTATCCAGTAACTCGGGGCCTGTTTCCCCGTGGGTCTCTGGGCTGTCAGCTTTCCTTTCTCCATGTGTTTGATTTCTCCTCAGGCTGGTAGCAAGTTCTGGATCTTATACCCAACACACAGCAACATCCAGAAATAAAGATCTCAGGACCCCCCAGCAAGTCGTTTTGTGTCTCCTTGGACTGAGTTAAGTTACAAGCCTTTCTTATACCTGTCTTTGACAAAGAAGACGGGATTGTCTTTACATAAAACCAGCCTGCTCCTGGAGCTTCCCTGGACTCAACTTCCTAAAGGCATGTGAGGAAGGGGTAGATTCCACAATCTAATCCGGGTGCCATCAGAGTAGAGGGAGTAGAGAATGGATGTTGGGTAGGCCATCAATAAGGTCCATTCTGCGCAGTATCTCAACTGCCGTTCAACAATCGCAAGAGGAAGGTGGAGCAGGTTTCTTCATCTTACAGTTGAGAAAACAGAGACTCAGAAGGGCTTCTTAGTTCATGTTTCCCTTAGCGCCTCAGTGATTTTTTCATGGTGGCTTAGGCCAAAAGAAATATCTAACCATTCAATTTATAAATAATTAGGTCCCCAACGAATTAAATATTATGTCCTACCAACTTATTAGCTGCTTGAAAAATATAATACACATAAATAAAAAAATATATTTTTCATTTCTATTTCATTGTTAATCACAACTACTTACTAAGGAGATGTATGCACCTATTGGACACTGTGCAACTTCTCACCTGGAATGAGATTGGACACTGCTGCCCTCATTTTCTGCTCCATGTTGGTGTCCATATAGTACTTGATTTTTTATCAGATGGCCTGGAAAACCCAGTCTCACAAAAATATGAAATTATCAGAAGGATTATAGTGCAATCTTATGTTGAAAGAATGAACTACCTCACTAGTAGTTCACGTGATGTCTGACAGATGTTGAGTTTCATTGTGTTTGTGTGTTCAAATTTTTAAATATTCTGAGATACTCTTGTGAGGTCACTCTAATGCCCTGGGTGCCTTGGCACAGTTTTAGAAATACCAGTTGAAAATATTTGCTCAGGAATATGCAACTAGGAAGGGGCAGAATCAGAATTTAAGCTTTCATATTCTAGCCTTCAGTCTTGTTCTTCAACCATTTTTAGGAACTTTCCCATAAGGTTATGTTTTCCAGCCCAGGCATGGAGGATCACTTGAGGCCAAGAGTTCGAGACCAGCCTGGGGAACTTGGCTGGACCTCCGTTTCTACGAAATAAAAATAAAAAAATTATCCAGGTATGGTGGTGTGTGCCTGTAGTCCTATCTACTCAAGGGTGGGGCAGGAGGATCACTTGAGCCCAGGAATTTGAGGCCACAGTGAATTAGGATTGCACCACTGCACTCTAGCCCAGGCAACAGAACAAGAACCTGTCTCTAAATAAATAAATAAAAATAATAATAATAAAAAAGATGTTTTCCCTACAA (SEQ ID NO: 37)

AMACR человека, вариант 1 транскрипта, мРНК (SEQ ID NO:38)

GGGGCGTGGCGCCGGGGATTGGGAGGGCTTCTTGCAGGCTGCTGGGCTGGGGCTAAGGGCTGCTCAGTTTCCTTCAGCGGGGCACTGGGAAGCGCCATGGCACTGCAGGGCATCTCGGTCGTGGAGCTGTCCGGCCTGGCCCCGGGCCCGTTCTGTGCTATGGTCCTGGCTGACTTCGGGGCGCGTGTGGTACGCGTGGACCGGCCCGGCTCCCGCTACGACGTGAGCCGCTTGGGCCGGGGCAAGCGCTCGCTAGTGCTGGACCTGAAGCAGCCGCGGGGAGCCGCCGTGCTGCGGCGTCTGTGCAAGCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGATTCTGCAGCGGGAAAATCCAAGGCTTATTTATGCCAGGCTGAGTGGATTTGGCCAGTCAGGAAGCTTCTGCCGGTTAGCTGGCCACGATATCAACTATTTGGCTTTGTCAGGTGTTCTCTCAAAAATTGGCAGAAGTGGTGAGAATCCGTATGCCCCGCTGAATCTCCTGGCTGACTTTGCTGGTGGTGGCCTTATGTGTGCACTGGGCATTATAATGGCTCTTTTTGACCGCACACGCACTGGCAAGGGTCAGGTCATTGATGCAAATATGGTGGAAGGAACAGCATATTTAAGTTCTTTTCTGTGGAAAACTCAGAAATTGAGTCTGTGGGAAGCACCTCGAGGACAGAACATGTTGGATGGTGGAGCACCTTTCTATACGACTTACAGGACAGCAGATGGGGAATTCATGGCTGTTGGAGCAATAGAACCCCAGTTCTACGAGCTGCTGATCAAAGGACTTGGACTAAAGTCTGATGAACTTCCCAATCAGATGAGCATGGATGATTGGCCAGAAATGAAGAAGAAGTTTGCAGATGTATTTGCAGAGAAGACGAAGGCAGAGTGGTGTCAAATCTTTGACGGCACAGATGCCTGTGTGACTCCGGTTCTGACTTTTGAGGAGGTTGTTCATCATGATCACAACAAGGAACGGGGCTCGTTTATCACCAGTGAGGAGCAGGACGTGAGCCCCCGCCCTGCACCTCTGCTGTTAAACACCCCAGCCATCCCTTCTTTCAAAAGGGATCCTTTCATAGGAGAACACACTGAGGAGATACTTGAAGAATTTGGATTCAGCCGCGAAGAGATTTATCAGCTTAACTCAGATAAAATCATTGAAAGTAATAAGGCTGGTAGCAAGTTCTGGATCTTATACCCAACACACAGCAACATCCAGAAATAAAGATCTCAGGACCCCCCAGCAAGTCGTTTTGTGTCTCCTTGGACTGAGTTAAGTTACAAGCCTTTCTTATACCTGTCTTTGACAAAGAAGACGGGATTGTCTTTACATAAAACCAGCCTGCTCCTGGAGCTTCCCTGGACTCAACTTCCTAAAGGCATGTGAGGAAGGGGTAGATTCCACAATCTAATCCGGGTGCCATCAGAGTAGAGGGAGTAGAGAATGGATGTTGGGTAGGCCATCAATAAGGTCCATTCTGCGCAGTATCTCAACTGCCGTTCAACAATCGCAAGAGGAAGGTGGAGCAGGTTTCTTCATCTTACAGTTGAGAAAACAGAGACTCAGAAGGGCTTCTTAGTTCATGTTTCCCTTAGCGCCTCAGTGATTTTTTCATGGTGGCTTAGGCCAAAAGAAATATCTAACCATTCAATTTATAAATAATTAGGTCCCCAACGAATTAAATATTATGTCCTACCAACTTATTAGCTGCTTGAAAAATATAATACACATAAATAAAAAAATATATTTTTCATTTCTATTTCATTGTTAATCACAACTACTTACTAAGGAGATGTATGCACCTATTGGACACTGTGCAACTTCTCACCTGGAATGAGATTGGACACTGCTGCCCTCATTTTCTGCTCCATGTTGGTGTCCATATAGTACTTGATTTTTTATCAGATGGCCTGGAAAACCCAGTCTCACAAAAATATGAAATTATCAGAAGGATTATAGTGCAATCTTATGTTGAAAGAATGAACTACCTCACTAGTAGTTCACGTGATGTCTGACAGATGTTGAGTTTCATTGTGTTTGTGTGTTCAAATTTTTAAATATTCTGAGATACTCTTGTGAGGTCACTCTAATGCCCTGGGTGCCTTGGCACAGTTTTAGAAATACCAGTTGAAAATATTTGCTCAGGAATATGCAACTAGGAAGGGGCAGAATCAGAATTTAAGCTTTCATATTCTAGCCTTCAGTCTTGTTCTTCAACCATTTTTAGGAACTTTCCCATAAGGTTATGTTTTCCAGCCCAGGCATGGAGGATCACTTGAGGCCAAGAGTTCGAGACCAGCCTGGGGAACTTGGCTGGACCTCCGTTTCTACGAAATAAAAATAAAAAAATTATCCAGGTATGGTGGTGTGTGCCTGTAGTCCTATCTACTCAAGGGTGGGGCAGGAGGATCACTTGAGCCCAGGAATTTGAGGCCACAGTGAATTAGGATTGCACCACTGCACTCTAGCCCAGGCAACAGAACAAGAACCTGTCTCTAAATAAATAAATAAAAATAATAATAATAAAAAAGATGTTTTCCCTACAA (SEQ ID NO: 38).

[0088] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК BIRC5, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:5, SEQ ID NO:39 или SEQ ID NO:40:

BIRC5 человека, вариант 1 транскрипта, мРНК (SEQ ID NO:5)

CCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTGTTTTGTCTTGAAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAACAGTGGCTGCTTCTCTCTCTCTCTCTCTTTTTTGGGGGCTCATTTTTGCTGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGCTAGAGCTGACAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTGAGGCTGTCACAGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTTCCTTATCTGTCACACCTGTGCCTCCTCAGAGGACAGTTTTTTTGTTGTTGTGTTTTTTTGTTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAGACAGAGTCCCTGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAGAATAGCACAAACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGGGGTGAACTTCAGGTGGATGAGGAGACAGAATAGAGTGATAGGAAGCGTCTGGCAGATACTCCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCACATGCTGGCCGCTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTGGGGGACTGGCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTCACGTTCTCCACACGGGGGAGAGACGCAGTCCGCCCAGGTCCCCGCTTTCTTTGGAGGCAGCAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCCCTCCTCCCTGTCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGGCTGTTCCTGAGAAATAAAAAGCCTGTCATTTCAAACACTGCTGTGGACCCTACTGGGTTTTTAAAATATTGTCAGTTTTTCATCGTCGTCCCTAGCCTGCCAACAGCCATCTGCCCAGACAGCCGCAGTGAGGATGAGCGTCCTGGCAGAGACGCAGTTGTCTCTGGGCGCTTGCCAGAGCCACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGGCGGTGATGTGGATCTCGGCTTCTGTGAGCCTGTGCTGTGGGCAGGGCTGAGCTGGAGCCGCCCCTCTCAGCCCGCCTGCCACGGCCTTTCCTTAAAGGCCATCCTTAAAACCAGACCCTCATGGCTACCAGCACCTGAAAGCTTCCTCGACATCTGTTAATAAAGCCGTAGGCCCTTGTCTAAGTGCAACCGCCTAGACTTTCTTTCAGATACATGTCCACATGTCCATTTTTCAGGTTCTCTAAGTTGGAGTGGAGTCTGGGAAGGGTTGTGAATGAGGCTTCTGGGCTATGGGTGAGGTTCCAATGGCAGGTTAGAGCCCCTCGGGCCAACTGCCATCCTGGAAAGTAGAGACAGCAGTGCCCGCTGCCCAGAAGAGACCAGCAAGCCAAACTGGAGCCCCCATTGCAGGCTGTCGCCATGTGGAAAGAGTAACTCACAATTGCCAATAAAGTCTCATGTGGTTTTATCTAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:5)

BIRC5 человека, вариант 2 транскрипта, мРНК (SEQ ID NO:39)

CCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATGCAAAGGAAACCAACAATAAGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTGTTTTGTCTTGAAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAACAGTGGCTGCTTCTCTCTCTCTCTCTCTTTTTTGGGGGCTCATTTTTGCTGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGCTAGAGCTGACAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTGAGGCTGTCACAGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTTCCTTATCTGTCACACCTGTGCCTCCTCAGAGGACAGTTTTTTTGTTGTTGTGTTTTTTTGTTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAGACAGAGTCCCTGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAGAATAGCACAAACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGGGGTGAACTTCAGGTGGATGAGGAGACAGAATAGAGTGATAGGAAGCGTCTGGCAGATACTCCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCACATGCTGGCCGCTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTGGGGGACTGGCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTCACGTTCTCCACACGGGGGAGAGACGCAGTCCGCCCAGGTCCCCGCTTTCTTTGGAGGCAGCAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCCCTCCTCCCTGTCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGGCTGTTCCTGAGAAATAAAAAGCCTGTCATTTCAAACACTGCTGTGGACCCTACTGGGTTTTTAAAATATTGTCAGTTTTTCATCGTCGTCCCTAGCCTGCCAACAGCCATCTGCCCAGACAGCCGCAGTGAGGATGAGCGTCCTGGCAGAGACGCAGTTGTCTCTGGGCGCTTGCCAGAGCCACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGGCGGTGATGTGGATCTCGGCTTCTGTGAGCCTGTGCTGTGGGCAGGGCTGAGCTGGAGCCGCCCCTCTCAGCCCGCCTGCCACGGCCTTTCCTTAAAGGCCATCCTTAAAACCAGACCCTCATGGCTACCAGCACCTGAAAGCTTCCTCGACATCTGTTAATAAAGCCGTAGGCCCTTGTCTAAGTGCAACCGCCTAGACTTTCTTTCAGATACATGTCCACATGTCCATTTTTCAGGTTCTCTAAGTTGGAGTGGAGTCTGGGAAGGGTTGTGAATGAGGCTTCTGGGCTATGGGTGAGGTTCCAATGGCAGGTTAGAGCCCCTCGGGCCAACTGCCATCCTGGAAAGTAGAGACAGCAGTGCCCGCTGCCCAGAAGAGACCAGCAAGCCAAACTGGAGCCCCCATTGCAGGCTGTCGCCATGTGGAAAGAGTAACTCACAATTGCCAATAAAGTCTCATGTGGTTTTATCTAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:39)

BIRC5 человека, вариант 3 транскрипта, мРНК (SEQ ID NO:40)

CCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATTGGGCCGGGCACGGTGGCTTACGCCTGTAATACCAGCACTTTGGGAGGCCGAGGCGGGCGGATCACGAGAGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTGTTTTGTCTTGAAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAACAGTGGCTGCTTCTCTCTCTCTCTCTCTTTTTTGGGGGCTCATTTTTGCTGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGCTAGAGCTGACAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTGAGGCTGTCACAGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTTCCTTATCTGTCACACCTGTGCCTCCTCAGAGGACAGTTTTTTTGTTGTTGTGTTTTTTTGTTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAGACAGAGTCCCTGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAGAATAGCACAAACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGGGGTGAACTTCAGGTGGATGAGGAGACAGAATAGAGTGATAGGAAGCGTCTGGCAGATACTCCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCACATGCTGGCCGCTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTGGGGGACTGGCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTCACGTTCTCCACACGGGGGAGAGACGCAGTCCGCCCAGGTCCCCGCTTTCTTTGGAGGCAGCAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCCCTCCTCCCTGTCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGGCTGTTCCTGAGAAATAAAAAGCCTGTCATTTCAAACACTGCTGTGGACCCTACTGGGTTTTTAAAATATTGTCAGTTTTTCATCGTCGTCCCTAGCCTGCCAACAGCCATCTGCCCAGACAGCCGCAGTGAGGATGAGCGTCCTGGCAGAGACGCAGTTGTCTCTGGGCGCTTGCCAGAGCCACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGGCGGTGATGTGGATCTCGGCTTCTGTGAGCCTGTGCTGTGGGCAGGGCTGAGCTGGAGCCGCCCCTCTCAGCCCGCCTGCCACGGCCTTTCCTTAAAGGCCATCCTTAAAACCAGACCCTCATGGCTACCAGCACCTGAAAGCTTCCTCGACATCTGTTAATAAAGCCGTAGGCCCTTGTCTAAGTGCAACCGCCTAGACTTTCTTTCAGATACATGTCCACATGTCCATTTTTCAGGTTCTCTAAGTTGGAGTGGAGTCTGGGAAGGGTTGTGAATGAGGCTTCTGGGCTATGGGTGAGGTTCCAATGGCAGGTTAGAGCCCCTCGGGCCAACTGCCATCCTGGAAAGTAGAGACAGCAGTGCCCGCTGCCCAGAAGAGACCAGCAAGCCAAACTGGAGCCCCCATTGCAGGCTGTCGCCATGTGGAAAGAGTAACTCACAATTGCCAATAAAGTCTCATGTGGTTTTATCTAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 40).

[0089] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК HOXC6, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:6 или SEQ ID NO:41:

HOXC6 человека, варианта 1 транскрипта, мРНК (SEQ ID NO:6)

1TTTTGTCTGTCCTGGATTGGAGCCGTCCCTATAACCATCTAGTTCCGAGTACAAACTGGAGACAGAAATAAATATTAAAGAAATCATAGACCGACCAGGTAAAGGCAAAGGGATGAATTCCTACTTCACTAACCCTTCCTTATCCTGCCACCTCGCCGGGGGCCAGGACGTCCTCCCCAACGTCGCCCTCAATTCCACCGCCTATGATCCAGTGAGGCATTTCTCGACCTATGGAGCGGCCGTTGCCCAGAACCGGATCTACTCGACTCCCTTTTATTCGCCACAGGAGAATGTCGTGTTCAGTTCCAGCCGGGGGCCGTATGACTATGGATCTAATTCCTTTTACCAGGAGAAAGACATGCTCTCAAACTGCAGACAAAACACCTTAGGACATAACACACAGACCTCAATCGCTCAGGATTTTAGTTCTGAGCAGGGCAGGACTGCGCCCCAGGACCAGAAAGCCAGTATCCAGATTTACCCCTGGATGCAGCGAATGAATTCGCACAGTGGGGTCGGCTACGGAGCGGACCGGAGGCGCGGCCGCCAGATCTACTCGCGGTACCAGACCCTGGAACTGGAGAAGGAATTTCACTTCAATCGCTACCTAACGCGGCGCCGGCGCATCGAGATCGCCAACGCGCTTTGCCTGACCGAGCGACAGATCAAAATCTGGTTCCAGAACCGCCGGATGAAGTGGAAAAAAGAATCTAATCTCACATCCACTCTCTCGGGGGGCGGCGGAGGGGCCACCGCCGACAGCCTGGGCGGAAAAGAGGAAAAGCGGGAAGAGACAGAAGAGGAGAAGCAGAAAGAGTGACCAGGACTGTCCCTGCCACCCCTCTCTCCCTTTCTCCCTCGCTCCCCACCAACTCTCCCCTAATCACACACTCTGTATTTATCACTGGCACAATTGATGTGTTTTGATTCCCTAAAACAAAATTAGGGAGTCAAACGTGGACCTGAAAGTCAGCTCTGGACCCCCTCCCTCACCGCACAACTCTCTTTCACCACGCGCCTCCTCCTCCTCGCTCCCTTGCTAGCTCGTTCTCGGCTTGTCTACAGGCCCTTTTCCCCGTCCAGGCCTTGGGGGCTCGGACCCTGAACTCAGACTCTACAGATTGCCCTCCAAGTGAGGACTTGGCTCCCCCACTCCTTCGACGCCCCCACCCCCGCCCCCCGTGCAGAGAGCCGGCTCCTGGGCCTGCTGGGGCCTCTGCTCCAGGGCCTCAGGGCCCGGCCTGGCAGCCGGGGAGGGCCGGAGGCCCAAGGAGGGCGCGCCTTGGCCCCACACCAACCCCCAGGGCCTCCCCGCAGTCCCTGCCTAGCCCCTCTGCCCCAGCAAATGCCCAGCCCAGGCAAATTGTATTTAAAGAATCCTGGGGGTCATTATGGCATTTTACAAACTGTGACCGTTTCTGTGTGAAGATTTTTAGCTGTATTTGTGGTCTCTGTATTTATATTTATGTTTAGCACCGTCAGTGTTCCTATCCAATTTCAAAAAAGGAAAAAAAAGAGGGAAAATTACAAAAAGAGAGAAAAAAAGTGAATGACGTTTGTTTAGCCAGTAGGAGAAAATAAATAAATAAATAAATCCCTTCGTGTTACCCTCCTGTATAAATCCAACCTCTGGGTCCGTTCTCGAATATTTAATAAAACTGATATTATTTTTAAAACTTTA (SEQ ID NO:6)

HOXC6 человека, варианта 2 транскрипта, мРНК (SEQ ID NO:41)

AACTTTTTATTGTGGTTTGTCCGTTCCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGCCAGGGAAACCTGCCCTGGGCGCTCCCTTCATTAGCAGTATTTTTTTTAAATTAATCTGATTAATAATTATTTTTCCCCCATTTAATTTTTTTTCCTCCCAGGTGGAGTTGCCGAAGCTGGGGGCAGCTGGGGAGGGTGGGGATGGGAGGGGAGAGACAGAAGTTGAGGGCATCTCTCTCTTCCTTCCCGACCCTCTGGCCCCCAAGGGGCAGGAGGAATGCAGGAGCAGGAGTTGAGCTTGGGAGCTGCAGATGCCTCCGCCCCTCCTCTCTCCCAGGCTCTTCCTCCTGCCCCCTTCTTGCAACTCTCCTTAATTTTGTTTGGCTTTTGGATGATTATAATTATTTTTATTTTTGAATTTATATAAAGTATATGTGTGTGTGTGTGGAGCTGAGACAGGCTCGGCAGCGGCACAGAATGAGGGAAGACGAGAAAGAGAGTGGGAGAGAGAGAGGCAGAGAGGGAGAGAGGGAGAGTGACAGCAGCGCTCGGACGTCCTCCCCAACGTCGCCCTCAATTCCACCGCCTATGATCCAGTGAGGCATTTCTCGACCTATGGAGCGGCCGTTGCCCAGAACCGGATCTACTCGACTCCCTTTTATTCGCCACAGGAGAATGTCGTGTTCAGTTCCAGCCGGGGGCCGTATGACTATGGATCTAATTCCTTTTACCAGGAGAAAGACATGCTCTCAAACTGCAGACAAAACACCTTAGGACATAACACACAGACCTCAATCGCTCAGGATTTTAGTTCTGAGCAGGGCAGGACTGCGCCCCAGGACCAGAAAGCCAGTATCCAGATTTACCCCTGGATGCAGCGAATGAATTCGCACAGTGGGGTCGGCTACGGAGCGGACCGGAGGCGCGGCCGCCAGATCTACTCGCGGTACCAGACCCTGGAACTGGAGAAGGAATTTCACTTCAATCGCTACCTAACGCGGCGCCGGCGCATCGAGATCGCCAACGCGCTTTGCCTGACCGAGCGACAGATCAAAATCTGGTTCCAGAACCGCCGGATGAAGTGGAAAAAAGAATCTAATCTCACATCCACTCTCTCGGGGGGCGGCGGAGGGGCCACCGCCGACAGCCTGGGCGGAAAAGAGGAAAAGCGGGAAGAGACAGAAGAGGAGAAGCAGAAAGAGTGACCAGGACTGTCCCTGCCACCCCTCTCTCCCTTTCTCCCTCGCTCCCCACCAACTCTCCCCTAATCACACACTCTGTATTTATCACTGGCACAATTGATGTGTTTTGATTCCCTAAAACAAAATTAGGGAGTCAAACGTGGACCTGAAAGTCAGCTCTGGACCCCCTCCCTCACCGCACAACTCTCTTTCACCACGCGCCTCCTCCTCCTCGCTCCCTTGCTAGCTCGTTCTCGGCTTGTCTACAGGCCCTTTTCCCCGTCCAGGCCTTGGGGGCTCGGACCCTGAACTCAGACTCTACAGATTGCCCTCCAAGTGAGGACTTGGCTCCCCCACTCCTTCGACGCCCCCACCCCCGCCCCCCGTGCAGAGAGCCGGCTCCTGGGCCTGCTGGGGCCTCTGCTCCAGGGCCTCAGGGCCCGGCCTGGCAGCCGGGGAGGGCCGGAGGCCCAAGGAGGGCGCGCCTTGGCCCCACACCAACCCCCAGGGCCTCCCCGCAGTCCCTGCCTAGCCCCTCTGCCCCAGCAAATGCCCAGCCCAGGCAAATTGTATTTAAAGAATCCTGGGGGTCATTATGGCATTTTACAAACTGTGACCGTTTCTGTGTGAAGATTTTTAGCTGTATTTGTGGTCTCTGTATTTATATTTATGTTTAGCACCGTCAGTGTTCCTATCCAATTTCAAAAAAGGAAAAAAAAGAGGGAAAATTACAAAAAGAGAGAAAAAAAGTGAATGACGTTTGTTTAGCCAGTAGGAGAAAATAAATAAATAAATAAATCCCTTCGTGTTACCCTCCTGTATAAATCCAACCTCTGGGTCCGTTCTCGAATATTTAATAAAACTGATATTATTTTTAAAACTTTAAAA (SEQ ID NO: 41).

[0090] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК SPARCL1, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:7, SEQ ID NO:42, SEQ ID NO:43 или SEQ ID NO:44:

SPARCL1 человека, вариант 1 транскрипта, мРНК (SEQ ID NO:7)

AAAAATGCATAAAGAGCCAAGTGCTTATATTCTGGCCAAGTTATGAGGCTCTGAGAACAAGAGCTTGAGGGGAAGACTGTTAACCCCATCCACGCCACCAGAATTAGCTCTTTCCCTTTTGGTTTGCAAGCACTGCCTGTAAAGCCCTCGCATGAGAGGCCAGCCTGCTAGGGAAATCCAGGAATCTGCAACAAAAACGATGACAGTCTGAAATACTCTCTGGTGCCAACCTCCAAATTCTCGTCTGTCACTTCAGACCCCCACTAGTTGACAGAGCAGCAGAATTTCAACTCCAGTAGACTTGAATATGCCTCTGGGCAAAGAAGCAGAGCTAACGAGGAAAGGGATTTAAAGAGTTTTTCTTGGGTGTTTGTCAAACTTTTATTCCCTGTCTGTGTGCAGAGGGGATTCAACTTCAATTTTTCTGCAGTGGCTCTGGGTCCAGCCCCTTACTTAAAGGCCATAAGATGTTTTATTGAAAGAAACTTTCAATATCAAGTAATCCAACCAACCTTCTAAGATAAGCCTTTTCCTTCAACACAAAGAAGTGCATTTTGCCAAATCTGGAAAGCATGAAGACTGGGCTTTTTTTCCTATGTCTCTTGGGAACTGCAGCTGCAATCCCGACAAATGCAAGATTATTATCTGATCATTCCAAACCAACTGCTGAAACGGTAGCACCTGACAACACTGCAATCCCCAGTTTAAGGGCTGAAGCTGAAGAAAATGAAAAAGAAACAGCAGTATCCACAGAAGACGATTCCCACCATAAGGCTGAAAAATCATCAGTACTAAAGTCAAAAGAGGAAAGCCATGAACAGTCAGCAGAACAGGGCAAGAGTTCTAGCCAAGAGCTGGGATTGAAGGATCAAGAGGACAGTGATGGTCACTTAAGTGTGAATTTGGAGTATGCACCAACTGAAGGTACATTGGACATAAAAGAAGATATGAGTGAGCCTCAGGAGAAAAAACTCTCAGAGAACACTGATTTTTTGGCTCCTGGTGTTAGTTCCTTCACAGATTCTAACCAACAAGAAAGTATCACAAAGAGAGAGGAAAACCAAGAACAACCTAGAAATTATTCACATCATCAGTTGAACAGGAGCAGTAAACATAGCCAAGGCCTAAGGGATCAAGGAAACCAAGAGCAGGATCCAAATATTTCCAATGGAGAAGAGGAAGAAGAAAAAGAGCCAGGTGAAGTTGGTACCCACAATGATAACCAAGAAAGAAAGACAGAATTGCCCAGGGAGCATGCTAACAGCAAGCAGGAGGAAGACAATACCCAATCTGATGATATTTTGGAAGAGTCTGATCAACCAACTCAAGTAAGCAAGATGCAGGAGGATGAATTTGATCAGGGTAACCAAGAACAAGAAGATAACTCCAATGCAGAAATGGAAGAGGAAAATGCATCGAACGTCAATAAGCACATTCAAGAAACTGAATGGCAGAGTCAAGAGGGTAAAACTGGCCTAGAAGCTATCAGCAACCACAAAGAGACAGAAGAAAAGACTGTTTCTGAGGCTCTGCTCATGGAACCTACTGATGATGGTAATACCACGCCCAGAAATCATGGAGTTGATGATGATGGCGATGATGATGGCGATGATGGCGGCACTGATGGCCCCAGGCACAGTGCAAGTGATGACTACTTCATCCCAAGCCAGGCCTTTCTGGAGGCCGAGAGAGCTCAATCCATTGCCTATCACCTCAAAATTGAGGAGCAAAGAGAAAAAGTACATGAAAATGAAAATATAGGTACCACTGAGCCTGGAGAGCACCAAGAGGCCAAGAAAGCAGAGAACTCATCAAATGAGGAGGAAACGTCAAGTGAAGGCAACATGAGGGTGCATGCTGTGGATTCTTGCATGAGCTTCCAGTGTAAAAGAGGCCACATCTGTAAGGCAGACCAACAGGGAAAACCTCACTGTGTCTGCCAGGATCCAGTGACTTGTCCTCCAACAAAACCCCTTGATCAAGTTTGTGGCACTGACAATCAGACCTATGCTAGTTCCTGTCATCTATTCGCTACTAAATGCAGACTGGAGGGGACCAAAAAGGGGCATCAACTCCAGCTGGATTATTTTGGAGCCTGCAAATCTATTCCTACTTGTACGGACTTTGAAGTGATTCAGTTTCCTCTACGGATGAGAGACTGGCTCAAGAATATCCTCATGCAGCTTTATGAAGCCAACTCTGAACACGCTGGTTATCTAAATGAGAAGCAGAGAAATAAAGTCAAGAAAATTTACCTGGATGAAAAGAGGCTTTTGGCTGGGGACCATCCCATTGATCTTCTCTTAAGGGACTTTAAGAAAAACTACCACATGTATGTGTATCCTGTGCACTGGCAGTTTAGTGAACTTGACCAACACCCTATGGATAGAGTCTTGACACATTCTGAACTTGCTCCTCTGCGAGCATCTCTGGTGCCCATGGAACACTGCATAACCCGTTTCTTTGAGGAGTGTGACCCCAACAAGGATAAGCACATCACCCTGAAGGAGTGGGGCCACTGCTTTGGAATTAAAGAAGAGGACATAGATGAAAATCTCTTGTTTTGAACGAAGATTTTAAAGAACTCAACTTTCCAGCATCCTCCTCTGTTCTAACCACTTCAGAAATATATGCAGCTGTGATACTTGTAGATTTATATTTAGCAAAATGTTAGCATGTATGACAAGACAATGAGAGTAATTGCTTGACAACAACCTATGCACCAGGTATTTAACATTAACTTTGGAAACAAAAATGTACAATTAAGTAAAGTCAACATATGCAAAATACTGTACATTGTGAACAGAAGTTTAATTCATAGTAATTTCACTCTCTGCATTGACTTATGAGATAATTAATGATTAAACTATTAATGATAAAAATAATGCATTTGTATTGTTCATAATATCATGTGCACTTCAAGAAAATGGAATGCTACTCTTTTGTGGTTTACGTGTATTATTTTCAATATCTTAATACCCTAATAAAGAGTCCATAAAAATCCAAATGCTT (SEQ ID NO: 7)

SPARCL1 человека, вариант 2 транскрипта, мРНК (SEQ ID NO:42)

AAAAATGCATAAAGAGCCAAGTGCTTATATTCTGGCCAAGTTATGAGGCTCTGAGAACAAGAGCTTGAGGGGAAGACTGTTAACCCCATCCACGCCACCAGAATTAGCTCTTTCCCTTTTGGTTTGCAAGCACTGCCTGTAAAGCCCTCGCATGAGAGGCCAGCCTGCTAGGGAAATCCAGGAATCTGCAACAAAAACGATGACAGTCTGAAATACTCTCTGGTGCCAACCTCCAAATTCTCGTCTGTCACTTCAGACCCCCACTAGTTGACAGAGCAGCAGAATTTCAACTCCAGTAGACTTGAATATGCCTCTGGGCAAAGAAGCAGAGCTAACGAGGAAAGGGATTTAAAGAGTTTTTCTTGGGTGTTTGTCAAACTTTTATTCCCTGTCTGTGTGCAGAGGGGATTCAACTTCAATTTTTCTGCAGTGGCTCTGGGTCCAGCCCCTTACTTAAAGATCTGGAAAGCATGAAGACTGGGCTTTTTTTCCTATGTCTCTTGGGAACTGCAGCTGCAATCCCGACAAATGCAAGATTATTATCTGATCATTCCAAACCAACTGCTGAAACGGTAGCACCTGACAACACTGCAATCCCCAGTTTAAGGGCTGAAGCTGAAGAAAATGAAAAAGAAACAGCAGTATCCACAGAAGACGATTCCCACCATAAGGCTGAAAAATCATCAGTACTAAAGTCAAAAGAGGAAAGCCATGAACAGTCAGCAGAACAGGGCAAGAGTTCTAGCCAAGAGCTGGGATTGAAGGATCAAGAGGACAGTGATGGTCACTTAAGTGTGAATTTGGAGTATGCACCAACTGAAGGTACATTGGACATAAAAGAAGATATGAGTGAGCCTCAGGAGAAAAAACTCTCAGAGAACACTGATTTTTTGGCTCCTGGTGTTAGTTCCTTCACAGATTCTAACCAACAAGAAAGTATCACAAAGAGAGAGGAAAACCAAGAACAACCTAGAAATTATTCACATCATCAGTTGAACAGGAGCAGTAAACATAGCCAAGGCCTAAGGGATCAAGGAAACCAAGAGCAGGATCCAAATATTTCCAATGGAGAAGAGGAAGAAGAAAAAGAGCCAGGTGAAGTTGGTACCCACAATGATAACCAAGAAAGAAAGACAGAATTGCCCAGGGAGCATGCTAACAGCAAGCAGGAGGAAGACAATACCCAATCTGATGATATTTTGGAAGAGTCTGATCAACCAACTCAAGTAAGCAAGATGCAGGAGGATGAATTTGATCAGGGTAACCAAGAACAAGAAGATAACTCCAATGCAGAAATGGAAGAGGAAAATGCATCGAACGTCAATAAGCACATTCAAGAAACTGAATGGCAGAGTCAAGAGGGTAAAACTGGCCTAGAAGCTATCAGCAACCACAAAGAGACAGAAGAAAAGACTGTTTCTGAGGCTCTGCTCATGGAACCTACTGATGATGGTAATACCACGCCCAGAAATCATGGAGTTGATGATGATGGCGATGATGATGGCGATGATGGCGGCACTGATGGCCCCAGGCACAGTGCAAGTGATGACTACTTCATCCCAAGCCAGGCCTTTCTGGAGGCCGAGAGAGCTCAATCCATTGCCTATCACCTCAAAATTGAGGAGCAAAGAGAAAAAGTACATGAAAATGAAAATATAGGTACCACTGAGCCTGGAGAGCACCAAGAGGCCAAGAAAGCAGAGAACTCATCAAATGAGGAGGAAACGTCAAGTGAAGGCAACATGAGGGTGCATGCTGTGGATTCTTGCATGAGCTTCCAGTGTAAAAGAGGCCACATCTGTAAGGCAGACCAACAGGGAAAACCTCACTGTGTCTGCCAGGATCCAGTGACTTGTCCTCCAACAAAACCCCTTGATCAAGTTTGTGGCACTGACAATCAGACCTATGCTAGTTCCTGTCATCTATTCGCTACTAAATGCAGACTGGAGGGGACCAAAAAGGGGCATCAACTCCAGCTGGATTATTTTGGAGCCTGCAAATCTATTCCTACTTGTACGGACTTTGAAGTGATTCAGTTTCCTCTACGGATGAGAGACTGGCTCAAGAATATCCTCATGCAGCTTTATGAAGCCAACTCTGAACACGCTGGTTATCTAAATGAGAAGCAGAGAAATAAAGTCAAGAAAATTTACCTGGATGAAAAGAGGCTTTTGGCTGGGGACCATCCCATTGATCTTCTCTTAAGGGACTTTAAGAAAAACTACCACATGTATGTGTATCCTGTGCACTGGCAGTTTAGTGAACTTGACCAACACCCTATGGATAGAGTCTTGACACATTCTGAACTTGCTCCTCTGCGAGCATCTCTGGTGCCCATGGAACACTGCATAACCCGTTTCTTTGAGGAGTGTGACCCCAACAAGGATAAGCACATCACCCTGAAGGAGTGGGGCCACTGCTTTGGAATTAAAGAAGAGGACATAGATGAAAATCTCTTGTTTTGAACGAAGATTTTAAAGAACTCAACTTTCCAGCATCCTCCTCTGTTCTAACCACTTCAGAAATATATGCAGCTGTGATACTTGTAGATTTATATTTAGCAAAATGTTAGCATGTATGACAAGACAATGAGAGTAATTGCTTGACAACAACCTATGCACCAGGTATTTAACATTAACTTTGGAAACAAAAATGTACAATTAAGTAAAGTCAACATATGCAAAATACTGTACATTGTGAACAGAAGTTTAATTCATAGTAATTTCACTCTCTGCATTGACTTATGAGATAATTAATGATTAAACTATTAATGATAAAAATAATGCATTTGTATTGTTCATAATATCATGTGCACTTCAAGAAAATGGAATGCTACTCTTTTGTGGTTTACGTGTATTATTTTCAATATCTTAATACCCTAATAAAGAGTCCATAAAAATCCAAATGCTT (SEQ ID NO: 42)

SPARCL1 человека, вариант 3 транскрипта, мРНК (SEQ ID NO:43)

AAAAATGCATAAAGAGCCAAGTGCTTATATTCTGGCCAAGTTATGAGGCTCTGAGAACAAGAGCTTGAGGGGAAGACTGTTAACCCCATCCACGCCACCAGAATTAGCTCTTTCCCTTTTGGTTTGCAAGCACTGCCTGTAAAGCCCTCGCATGAGAGGCCAGCCTGCTAGGGAAATCCAGGAATCTGCAACAAAAACGATGACAGTCTGAAATACTCTCTGGTGCCAACCTCCAAATTCTCGTCTGTCACTTCAGACCCCCACTAGTTGACAGAGCAGCAGAATTTCAACTCCAGTAGACTTGAATATGCCTCTGGGCAAAGAAGCAGAGCTAACGAGGAAAGGGATTTAAAGAGTTTTTCTTGGGTGTTTGTCAAACTTTTATTCCCTGTCTGTGTGCAGAGGGGATTCAACTTCAATTTTTCTGCAGTGGCTCTGGGTCCAGCCCCTTACTTAAAGATCTGGAAAGCATGAAGACTGGGCTTTTTTTCCTATGTCTCTTGGGAACTGCAGCTGCAATCCCGGTGAAAAGGAGATAAGAAGCAAAGGAGCAAACCAAACCTAATATGAATCCTGTACTTTGGCCAGAAGCCGTGGCTCACATCTGTAATCCCAGCACTTTGGGAGGCCAAGACAAATGCAAGATTATTATCTGATCATTCCAAACCAACTGCTGAAACGGTAGCACCTGACAACACTGCAATCCCCAGTTTAAGGGCTGAAGCTGAAGAAAATGAAAAAGAAACAGCAGTATCCACAGAAGACGATTCCCACCATAAGGCTGAAAAATCATCAGTACTAAAGTCAAAAGAGGAAAGCCATGAACAGTCAGCAGAACAGGGCAAGAGTTCTAGCCAAGAGCTGGGATTGAAGGATCAAGAGGACAGTGATGGTCACTTAAGTGTGAATTTGGAGTATGCACCAACTGAAGGTACATTGGACATAAAAGAAGATATGAGTGAGCCTCAGGAGAAAAAACTCTCAGAGAACACTGATTTTTTGGCTCCTGGTGTTAGTTCCTTCACAGATTCTAACCAACAAGAAAGTATCACAAAGAGAGAGGAAAACCAAGAACAACCTAGAAATTATTCACATCATCAGTTGAACAGGAGCAGTAAACATAGCCAAGGCCTAAGGGATCAAGGAAACCAAGAGCAGGATCCAAATATTTCCAATGGAGAAGAGGAAGAAGAAAAAGAGCCAGGTGAAGTTGGTACCCACAATGATAACCAAGAAAGAAAGACAGAATTGCCCAGGGAGCATGCTAACAGCAAGCAGGAGGAAGACAATACCCAATCTGATGATATTTTGGAAGAGTCTGATCAACCAACTCAAGTAAGCAAGATGCAGGAGGATGAATTTGATCAGGGTAACCAAGAACAAGAAGATAACTCCAATGCAGAAATGGAAGAGGAAAATGCATCGAACGTCAATAAGCACATTCAAGAAACTGAATGGCAGAGTCAAGAGGGTAAAACTGGCCTAGAAGCTATCAGCAACCACAAAGAGACAGAAGAAAAGACTGTTTCTGAGGCTCTGCTCATGGAACCTACTGATGATGGTAATACCACGCCCAGAAATCATGGAGTTGATGATGATGGCGATGATGATGGCGATGATGGCGGCACTGATGGCCCCAGGCACAGTGCAAGTGATGACTACTTCATCCCAAGCCAGGCCTTTCTGGAGGCCGAGAGAGCTCAATCCATTGCCTATCACCTCAAAATTGAGGAGCAAAGAGAAAAAGTACATGAAAATGAAAATATAGGTACCACTGAGCCTGGAGAGCACCAAGAGGCCAAGAAAGCAGAGAACTCATCAAATGAGGAGGAAACGTCAAGTGAAGGCAACATGAGGGTGCATGCTGTGGATTCTTGCATGAGCTTCCAGTGTAAAAGAGGCCACATCTGTAAGGCAGACCAACAGGGAAAACCTCACTGTGTCTGCCAGGATCCAGTGACTTGTCCTCCAACAAAACCCCTTGATCAAGTTTGTGGCACTGACAATCAGACCTATGCTAGTTCCTGTCATCTATTCGCTACTAAATGCAGACTGGAGGGGACCAAAAAGGGGCATCAACTCCAGCTGGATTATTTTGGAGCCTGCAAATCTATTCCTACTTGTACGGACTTTGAAGTGATTCAGTTTCCTCTACGGATGAGAGACTGGCTCAAGAATATCCTCATGCAGCTTTATGAAGCCAACTCTGAACACGCTGGTTATCTAAATGAGAAGCAGAGAAATAAAGTCAAGAAAATTTACCTGGATGAAAAGAGGCTTTTGGCTGGGGACCATCCCATTGATCTTCTCTTAAGGGACTTTAAGAAAAACTACCACATGTATGTGTATCCTGTGCACTGGCAGTTTAGTGAACTTGACCAACACCCTATGGATAGAGTCTTGACACATTCTGAACTTGCTCCTCTGCGAGCATCTCTGGTGCCCATGGAACACTGCATAACCCGTTTCTTTGAGGAGTGTGACCCCAACAAGGATAAGCACATCACCCTGAAGGAGTGGGGCCACTGCTTTGGAATTAAAGAAGAGGACATAGATGAAAATCTCTTGTTTTGAACGAAGATTTTAAAGAACTCAACTTTCCAGCATCCTCCTCTGTTCTAACCACTTCAGAAATATATGCAGCTGTGATACTTGTAGATTTATATTTAGCAAAATGTTAGCATGTATGACAAGACAATGAGAGTAATTGCTTGACAACAACCTATGCACCAGGTATTTAACATTAACTTTGGAAACAAAAATGTACAATTAAGTAAAGTCAACATATGCAAAATACTGTACATTGTGAACAGAAGTTTAATTCATAGTAATTTCACTCTCTGCATTGACTTATGAGATAATTAATGATTAAACTATTAATGATAAAAATAATGCATTTGTATTGTTCATAATATCATGTGCACTTCAAGAAAATGGAATGCTACTCTTTTGTGGTTTACGTGTATTATTTTCAATATCTTAATACCCTAATAAAGAGTCCATAAAAATCCAAATGCTT (SEQ ID NO: 43)

SPARCL1 человека, вариант 4 транскрипта, мРНК (SEQ ID NO:44)

AAAAATGCATAAAGAGCCAAGTGCTTATATTCTGGCCAAGTTATGAGGCTCTGAGAACAAGAGCTTGAGGGGAAGACTGTTAACCCCATCCACGCCACCAGAATTAGCTCTTTCCCTTTTGGTTTGCAAGCACTGCCTGTAAAGCCCTCGCATGAGAGGCCAGCCTGCTAGGGAAATCCAGGAATCTGCAACAAAAACGATGACAGTCTGAAATACTCTCTGGTGCCAACCTCCAAATTCTCGTCTGTCACTTCAGACCCCCACTAGTTGACAGAGCAGCAGAATTTCAACTCCAGTAGACTTGAATATGCCTCTGGGCAAAGAAGCAGAGCTAACGAGGAAAGGGATTTAAAGAGTTTTTCTTGGGTGTTTGTCAAACTTTTATTCCCTGTCTGTGTGCAGAGGGGATTCAACTTCAATTTTTCTGCAGTGGCTCTGGGTCCAGCCCCTTACTTAAAGATCTGGAAAGCCATGAACAGTCAGCAGAACAGGGCAAGAGTTCTAGCCAAGAGCTGGGATTGAAGGATCAAGAGGACAGTGATGGTCACTTAAGTGTGAATTTGGAGTATGCACCAACTGAAGGTACATTGGACATAAAAGAAGATATGAGTGAGCCTCAGGAGAAAAAACTCTCAGAGAACACTGATTTTTTGGCTCCTGGTGTTAGTTCCTTCACAGATTCTAACCAACAAGAAAGTATCACAAAGAGAGAGGAAAACCAAGAACAACCTAGAAATTATTCACATCATCAGTTGAACAGGAGCAGTAAACATAGCCAAGGCCTAAGGGATCAAGGAAACCAAGAGCAGGATCCAAATATTTCCAATGGAGAAGAGGAAGAAGAAAAAGAGCCAGGTGAAGTTGGTACCCACAATGATAACCAAGAAAGAAAGACAGAATTGCCCAGGGAGCATGCTAACAGCAAGCAGGAGGAAGACAATACCCAATCTGATGATATTTTGGAAGAGTCTGATCAACCAACTCAAGTAAGCAAGATGCAGGAGGATGAATTTGATCAGGGTAACCAAGAACAAGAAGATAACTCCAATGCAGAAATGGAAGAGGAAAATGCATCGAACGTCAATAAGCACATTCAAGAAACTGAATGGCAGAGTCAAGAGGGTAAAACTGGCCTAGAAGCTATCAGCAACCACAAAGAGACAGAAGAAAAGACTGTTTCTGAGGCTCTGCTCATGGAACCTACTGATGATGGTAATACCACGCCCAGAAATCATGGAGTTGATGATGATGGCGATGATGATGGCGATGATGGCGGCACTGATGGCCCCAGGCACAGTGCAAGTGATGACTACTTCATCCCAAGCCAGGCCTTTCTGGAGGCCGAGAGAGCTCAATCCATTGCCTATCACCTCAAAATTGAGGAGCAAAGAGAAAAAGTACATGAAAATGAAAATATAGGTACCACTGAGCCTGGAGAGCACCAAGAGGCCAAGAAAGCAGAGAACTCATCAAATGAGGAGGAAACGTCAAGTGAAGGCAACATGAGGGTGCATGCTGTGGATTCTTGCATGAGCTTCCAGTGTAAAAGAGGCCACATCTGTAAGGCAGACCAACAGGGAAAACCTCACTGTGTCTGCCAGGATCCAGTGACTTGTCCTCCAACAAAACCCCTTGATCAAGTTTGTGGCACTGACAATCAGACCTATGCTAGTTCCTGTCATCTATTCGCTACTAAATGCAGACTGGAGGGGACCAAAAAGGGGCATCAACTCCAGCTGGATTATTTTGGAGCCTGCAAATCTATTCCTACTTGTACGGACTTTGAAGTGATTCAGTTTCCTCTACGGATGAGAGACTGGCTCAAGAATATCCTCATGCAGCTTTATGAAGCCAACTCTGAACACGCTGGTTATCTAAATGAGAAGCAGAGAAATAAAGTCAAGAAAATTTACCTGGATGAAAAGAGGCTTTTGGCTGGGGACCATCCCATTGATCTTCTCTTAAGGGACTTTAAGAAAAACTACCACATGTATGTGTATCCTGTGCACTGGCAGTTTAGTGAACTTGACCAACACCCTATGGATAGAGTCTTGACACATTCTGAACTTGCTCCTCTGCGAGCATCTCTGGTGCCCATGGAACACTGCATAACCCGTTTCTTTGAGGAGTGTGACCCCAACAAGGATAAGCACATCACCCTGAAGGAGTGGGGCCACTGCTTTGGAATTAAAGAAGAGGACATAGATGAAAATCTCTTGTTTTGAACGAAGATTTTAAAGAACTCAACTTTCCAGCATCCTCCTCTGTTCTAACCACTTCAGAAATATATGCAGCTGTGATACTTGTAGATTTATATTTAGCAAAATGTTAGCATGTATGACAAGACAATGAGAGTAATTGCTTGACAACAACCTATGCACCAGGTATTTAACATTAACTTTGGAAACAAAAATGTACAATTAAGTAAAGTCAACATATGCAAAATACTGTACATTGTGAACAGAAGTTTAATTCATAGTAATTTCACTCTCTGCATTGACTTATGAGATAATTAATGATTAAACTATTAATGATAAAAATAATGCATTTGTATTGTTCATAATATCATGTGCACTTCAAGAAAATGGAATGCTACTCTTTTGTGGTTTACGTGTATTATTTTCAATATCTTAATACCCTAATAAAGAGTCCATAAAAATCCAAATGCTT (SEQ ID NO:44).

[0091] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции (i) мРНК ERG, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов и/или по меньшей мере 250 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:2, (ii) мРНК PCA3, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов и/или по меньшей мере 450 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:3, и (iii) по меньшей мере часть по меньшей мере одной другой мРНК, выбранной из группы, состоящей из (1) мРНК AMACR, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:4, SEQ ID NO:37 или SEQ ID NO:38; (2) мРНК BIRC5, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:5, SEQ ID NO:39 или SEQ ID NO:40; (3) мРНК HOXC6, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:6 или SEQ ID NO:41; и (4) SPARCL1 мРНК, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, последовательности нуклеиновой кислоты SEQ ID NO:7, SEQ ID NO:42, SEQ ID NO:43, или SEQ ID NO:44.

[0092] В некоторых вариантах осуществления наборы и/или способы, раскрытые в настоящем описании, используют для детекции мРНК ERG, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:2, мРНК PCA3, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:3, и по меньшей еще одной мРНК, выбранной из группы, состоящей из мРНК AMACR, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:4, SEQ ID NO:37 или SEQ ID NO:38, мРНК BIRC5, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:5, SEQ ID NO:39 или SEQ ID NO:40, мРНК HOXC6, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:6 или SEQ ID NO:41, и мРНК SPARCL1, имеющей полноразмерную последовательность нуклеиновой кислоты SEQ ID NO:7, SEQ ID NO:42, SEQ ID NO:43 или SEQ ID NO:44.

[0093] Уровень экспрессии мРНК определяли, используя любую из множества методик, принятых в данной области. Например, величины Ct (пороговый цикл) для каждого биомаркера в микровизикулах мочи определяют с помощью анализа ОТ-кПЦР. В анализе ПЦР в реальном времени положительную реакцию определяют по накоплению флуоресцентного сигнала. Величину Ct определяют как число циклов, требуемых для того, чтобы флуоресцентный сигнал пересек порог (то есть, превысил фоновый уровень). Уровни Ct обратно пропорциональны количеству мишеневой нуклеиновой кислоты в образце (то есть, чем меньше уровень Ct, тем больше количество мишеневой нуклеиновой кислоты в образце).

[0094] В некоторых вариантах осуществления рассчитывают число копий детектируемых генов (то есть, PCA3 и ERG). Количество копий также может быть количественно оценено с помощью анализа ОТ-кПЦР одной или нескольких нуклеиновых кислот, экстрагированных из микровизикул мочи. Специалист в данной области может без труда определить число копий известными в данной области способами, например, используя калибровочную кривую.

[0095] Для получения калибровочной кривой в одном и том же планшете анализируют серии разведений известного числа копий кДНК синтетической последовательности РНК, идентичной детектируемому гену, в качестве анализируемых образцов для тех же генов. Сравнивая величины Ct образцов с величинами Ct калибровочной кривой может быть определено точное количество копий последовательностей в анализируемых образцах. Соотнося величины Ct образцов со значениями калибровочных кривых в одном и том же планшете способ «нормализует» различия в проведении анализа, связанные с различной точностью пипетирования, эффективностью компонентов анализа (например, ферментов, зондов, праймеров, dNTP и тому подобное), эффективностью термоциклического прибора кПЦР (например, фильтров, температуры и тому подобное) и других изменений, которые могут возникнуть в разных планшетах.

[0096] В способах, приведенных в настоящем документе, гены, уровни экспрессии которых используют для расчета относительных уровней экспрессии, в совокупности называют «эталонные гены». Эталонный ген, используемый для определения адекватности образца в отношении микровезикулярной РНК, представляет собой ген, который, как правило, обнаруживается в микровизикулах мочи, например, гены «домашнего хозяйства» или гены, специфические для предстательной железы. Уровень экспрессии этих эталонных генов используют для нормализации количества детектируемого сигнала для контроля изменчивости в количестве выделенных микропузырьков между образцами. Например, в способах, приведенных в настоящем документе, эталонный ген, используемый для нормализации экспрессии PCA3 и ERG, может быть геном KLK3, кодирующим простатический специфический антиген (PSA), или собственно антигеном PSA, или SPDEF. Эталонный ген может быть геном, специфическим для предстательной железы. В некоторых вариантах осуществления эталонный ген может быть нетканевым геном «домашнего хозяйства», например, GAPDH. В способах, приведенных в настоящем документе, анализ относительной экспрессии, или нормализации, осуществляют путем вычитания величины Ct гена-маркера, специфичного для предстательной железы (например, KLK3), из величин Ct, полученных для PCA3 и ERG, с получением так называемого ΔCt. Число копий рассчитывают путем построения кривой следующей формулы

Ct=b+a*log10(калибруемые_копии)

по известным калибровочным точкам серий разведений в планшете с получением «калибровочной кривой». Число копий для образцов затем рассчитывают по формуле:

Копии_образцов=10^((Ct_образец-b)/a).

Такой расчет числа копий проводят независимо для каждого гена-маркера (например, PCA3 и/или ERG), а также для эталонного гена (например, KLK3 или SPDEF). «Нормализацию» сигнала, полученного от гена-маркера (например, PCA3 и/или ERG) затем получали путем деления числа копий гена-маркера на число копий эталонного гена (например, ERG/SPDEF, ERG/KLK3, PCA3/SPDEF и ERG/SPDEF).

[0097] В некоторых вариантах осуществления в наборах и/или способах, раскрытых в настоящем описании, используется эталонный ген, содержащий мРНК KLK3, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов и/или по меньшей мере 250 нуклеотидов или более, следующей последовательности нуклеиновой кислоты:

TTGTCTTCCTCACCCTGTCCGTGACGTGGATTGGTGCTGCACCCCTCATCCTGTCTCGGATTGTGGGAGGCTGGGAGTGCGAGAAGCATTCCCAACCCTGGCAGGTGCTTGTGGCCTCTCGTGGCAGGGCAGTCTGCGGCGGTGTTCTGGTGCACCCCCAGTGGGTCCTCACAGCTGCCCACTGCATCAGGAACAAAAGCGTGATCTTGCTGGGTCGGCACAGCCTGTTTCATCCTGAAGACACAGGCCAGGTATTTCAGGTCAGCCACAGCTTCCCACACCCGCTCTACGATATGAGCC (SEQ ID NO:8).

[0098] В некоторых вариантах осуществления в наборах и/или способах, раскрытых в настоящем описании, используется эталонный ген, содержащий мРНК SPDEF, имеющей по меньшей мере часть, например, по меньшей мере 10 нуклеотидов, по меньшей мере 20 нуклеотидов, по меньшей мере 30 нуклеотидов, по меньшей мере 40 нуклеотидов, по меньшей мере 50 нуклеотидов, по меньшей мере 100 нуклеотидов, по меньшей мере 150 нуклеотидов, по меньшей мере 200 нуклеотидов, по меньшей мере 250 нуклеотидов, по меньшей мере 300 нуклеотидов, по меньшей мере 350 нуклеотидов, по меньшей мере 400 нуклеотидов, по меньшей мере 450 нуклеотидов и/или по меньшей мере 500 нуклеотидов или более, следующей последовательности нуклеиновой кислоты:

GGGAGACGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGGAUAUCUGCAGAAUUCGCCCUUAUUUAAGUAGUGACAUGUUUUUGCACAUUUCCAGCCCCUUUAAAUAUCCACACACACAGGAAGCACAAAAGGAAGCACAGAGAUCCCUGGGAGAAAUGCCCGGCCCUGGGUGGGGAUGUGCUGCACGCCCACCUGGACAUCUGGAAGUCAGCGGCCUGGAUGAAAGAGCGGACUUCACCUGGGGCGAUUCACUACAAAUCUGGAAAGCAUGAAGACUGGGCUUUUUUUCCUAUGUCUCUUGGGAACUGCAGCUGCAAUCCCGACAAAUGCAAGAUUAUUAUCUGAUCAUUCCAAACCAACUGCUGAAACGGUAGCACCAGUUGCCCAGAUAACUGUGACGAUGGACUAUGCACCAAUGGUUGCAAGUACGAAGAUCUCUAUAGUAACUGUAAAAGUUUGAAGCUCACAUUAACCUGUAAACAUCAGUUGGUCAGGGACAGUUGCAAAAGGACCACCGCAUCUCUACAUUCAAGAACUGGCCCUUCUUGGAGGGCUGCGCCUGCACCCCGGAGCGGAUGGCCGAGGCUGGCUUCAUCCACUGCCCCACUGAGAACGAGCCAGACUUGACCUGCGGCCGCAAGCUUGGAUCCGAAUUCCUGUGUGAAAUUGUUAUCCGCUCACAAUUCCACACAACAUACGAGCCGGAAGCAUAAAGUGUAAAGCCUGGGGUGCCUAAUGA (SEQ ID NO: 9).

[0099] Можно также провести анализ и сравнение относительных, или нормализованных, уровней экспрессии PCA3 и ERG и эталонного гена, используя любую из множества методик, принятых в данной области. Например, ROC-анализ (операционная характеристика приемника (ROC)) можно проводить в отношении PCA3 и ERG, и, необязательно, по меньшей мере в отношении еще одного биомаркера, где уровень экспрессии измеренных биомаркеров дает значение площади под кривой (AUC) для каждого измеренного биомаркера. Roc-aнализы биомаркеров можно осуществлять по отдельности, то есть как отдельные маркеры, или в комбинации для анализа линейной регрессии. Комбинации биомаркеров с высоким диагностическим значением в качестве биомаркеров, как описано в настоящем документе, с высокой диагностической эффективностью имеют значения AUC, полученные на основе ROC-кривых, свыше 0,5, 0,6, 0,7 или 0,8. Предпочтительно, биомаркер или комбинация биомаркеров имеет значение AUC свыше 0,7. Например, комбинация PCA3 и ERG дает значение AUC свыше 0,7.

[0100] Roc-кривая представляет собой широко используемый инструмент для оценки дифференциальной и диагностической эффективности биомаркера. Если значение биомаркера при некоторых наблюдениях отсутствует, то анализ ROC, основанный исключительно на полном наборе данных, теряет эффективность из-за уменьшения размера выборки образцов, и что более важно, происходит потенциальное смещение выборки. Таким образом, в случае, если значение биомаркера отсутствует, то применяют метод подстановок.

[0101] Площадь под кривой (AUC), полученная на основе ROC- кривой (операционная характеристика приемника (ROC)), для каждого уровня биомаркера или баллы, полученные при сочетании биомаркеров, обрабатывают, используя результаты биомаркеров как контролей, так и больных. Специалист в данной области без труда сможет максимально улучшить диагностический индекс точности уровня биомаркера или комбинации биомаркеров путем проведения анализа порога отсечения, принимая во внимание чувствительность, специфичность, прогностическую ценность отрицательного результата (NPV), прогностическую ценность положительного результата (PPV), отношение правдоподобия положительного результата (PLR) и отношение правдоподобия отрицательного результата (NLR), необходимых для клинической ценности.

[0102] Получение ROC-кривых и анализ популяции образцов, используют для оценки величины порога отсечения, используемой для проведения различия между различными подгруппами индивидов. Например, по величине порога отсечения можно проводить различие межу индивидами с высоким риском рецидивирующего злокачественного новообразования и индивидами с низким риском рецидивирующего злокачественного новообразования. В некоторых вариантах осуществления по величине порогового значения можно проводить различие между индивидами со злокачественным новообразованием и индивидами, не имеющих его. В некоторых вариантах осуществления по величине порога отсечения можно проводить различие между индивидами с неагрессивным и индивидами с агрессивным злокачественным новообразованием. В некоторых вариантах осуществления, по величине порога отсечения можно проводить различие между индивидами с раком предстательной железы с высоким индексом Глисона (например, GS>6) и пациентами с раком предстательной железы с низким индексом Глисона.

[0103] Как описано в настоящем документе, нормализованные уровни экспрессии PCA3 и EGF, определенные в образце мочи индивида, обрабатывают в отношении выходного значения для проведения различия между индивидами подгрупп. В некоторых вариантах осуществления нормализованные уровни экспрессии PCA3 и ERG определяют, используя KLK3 в качестве эталонного гена, следующим образом:

ΔCtERG=CtERG - CtKLK3

ΔCtPCA3=CtPCA3 - CtKLK3

Значения ΔCt ERG и PCA3 затем используют в математической формуле с получением выходного значения. Примером формулы для получения выходного значения является следующая формула:

Выходное значение=(ΔCtERG×0,233)+(ΔCtPCA3×0,446)

[0104] В случае числа копий выходное значение исследования рассчитывается следующим образом:

Выходное значение=Копия PCA3/КопияKLK3 или SPDEF × Coeff+CopyERG/

КопияKLK3 или SPDEF × Coeff,

где коэффициент может быть равен, например, 1 (единице). В случае, если коэффициент является одинаковым, то все гены делают одинаковый относительный вклад в выходное значение. В некоторых вариантах осуществления коэффициенты отличаются для каждого гена-маркера, что указывает на то, что каждый ген-маркер делает различный вклад в выходное значение и, следовательно, в вероятность положительной биопсии. При одном подходе коэффициенты могут быть определены путем подгонки уравнения: выходное значение=копияPCA3/копияyKLK3 или SPDEF × Coeff+копияERG/копияKLK3 или SPDEF × Coeff к существующему набору данных с помощью линейной регрессии.

[0105] Как показано в примерах, приведенных в настоящем описании, с помощью сочетания PCA3 и ERG можно проводить специфическое различие между отрицательной биопсией и положительной биопсией индивидов с чувствительностью, равной 77,8%, и специфичностью, равной 61,8%. Эти значения указывают на силу сочетаний генов-биомаркеров, раскрытых в настоящем описании, в качестве чувствительных и специфических диагностических биомаркеров злокачественного новообразования, например, рака предстательной железы.

[0106] Термин «индивид» предназначен для описания всех животных, у которых показано наличие или у которых предполагается наличие микровезикул, содержащих нуклеиновые кислоты, и/или циркулирующих в моче нуклеиновых кислот. В конкретном варианте осуществления индивидом является млекопитающее; например, человек или примат, собака, кошка, лошадь, корова или другое фермерское животное, или грызун (например, мышь, крыса, морская свинка и тому подобное).

Получение микровезикулярной фракции из образца мочи

[0107] Способы получения микровизикулярной фракции из образца мочи описаны в настоящей заявке, а также в научных публикациях и патентных заявках (Chen et al., 2010; Miranda et al., 2010; Skog et al., 2008). См. также WO 2009/100029, WO 2011/009104, WO 2011/031892 и WO 2011/031877. Эти публикации включены в настоящее описание путем отсылки к их описаниям, относящимся к способам и методикам выделения микровезикул или их фракции. Эти способы могут включать стадии оценки целостности РНК выделенной фракции миковезикул, например, путем определения уровня экспрессии 18S и 28S РНК в пределах фракции.

[0108] Например, способы получения микровезикул с помощью дифференциального центрифугирования описаны в документе Raposo et al. (Raposo et al., 1996), документе Skog et al.(Skog et al., 2008) и в документе Nilsson et al.(Nilsson et al., 2009). Способы анионного обмена и/или гель-проникающей хроматографии описаны в патентах США 6899863 и 6812023. Способы с градиентом плотности сахарозы или электрофореза огранелл описаны в патенте США 7198923. Способ клеточного сортинга с магнитной активацией (MACS) описан в документе Taylor и Gercel-Taylor (Taylor and Gercel-Taylor, 2008). Способ наномерного ультрацентрифугирования описан в документе Cheruvanky et al. (Cheruvanky et al., 2007). Кроме того, микровезикулы могут быть идентифицированы и выделены из жидкости организма индивида с помощью технологии микрочипов, при которой используется микрожидкостная платформа для разделения микровезикул, полученных из опухолей (Chen et al., 2010). Каждая из вышеуказанных ссылок включена в настоящее описание путем ссылки для раскрытия этих способов.

[0109] В одном из вариантов осуществления способов, раскрытых в настоящем описании, микровезикулы, выделенные из мочи, насыщены микровезикулами клеток простаты или опухолевыми клетками. Так как микровезикулы часто несут на поверхности молекулы, такие как антигены их донорных клеток, то молекулы на поверхности могут быть использованы для идентификации, выделения и/или насыщения микровезикул специфических донорных типов клеток (Al-Nedawi et al., 2008; Taylor and Gercel-Taylor, 2008). Таким образом, микровезикулы различных клеточных популяций могут быть проанализированы на содержание нуклеиновых кислот. Например, опухолевые (злокачественные и доброкачественные) микровезикулы несут поверхностные антигены, связанные с опухолью, и могут быть детектированы, выделены и/или насыщены посредством этих поверхностных антигенов, связанных с опухолью. В одном из примеров поверхностный антиген представляет собой адгезивную молекулу эпителиальных клеток (EpCAM), которая специфична для микровезикул, карциномы легких, колоректального рака, рака молочной железы, предстательной железы, головы и шеи и рака печеночного происхождения, но исключая клетки гематологического происхождения (Balzar et al., 1999; Went et al., 2004).

[0110] Кроме того, специфичные микровезикулы опухоли, могут быть охарактеризованы по отсутствию поверхностных маркеров, например, CD80 и CD86. В этих случаях, микровезикулы с маркерами, такими как CD80 и CD86, могут быть исключены из дальнейшего анализа специфических маркеров опухолей. Такое исключение может быть достигнуто различными способами, например, аффинной эксклюзионной хроматографией.

[0111] Получение фракций микровезикул из предстательной железы может быть осуществлено, например, используя антитела, аптамеры, аналоги аптомеров или молекулярно импринтированные полимеры, специфичные в отношении желаемого поверхностного антигена. В некоторых вариантах осуществления поверхностный антиген является специфичным для типа злокачественного новообразования. В некоторых вариантах осуществления поверхностный антиген является специфичным для клеточного типа, которые не обязательно представляет собой карциному.

[0112] В одном из вариантов осуществления способ разделения микровезикул на основе клеточных антигенов, представлен в патенте США 7198923. Как описано, например, в патенте США 5840867 и 5582981, WO/2003/050290 и в публикации Johnson et al. (Johnson et al., 2008), аптамеры и их аналоги специфически связываются с поверхностными молекулами и могут использоваться в качестве инструмента для разделения с целью получения микровезикул в зависимости от типа клеток. Молекулярно-импринтировые полимеры также специфически распознают поверхностные молекулы, как описано, например, в патенте США 6525154, 7332553 и 7384589 и в публикации Bossi et al. (Bossi et al., 2007) и являются инструментом для получения и выделения микровезикул в зависимости от типа клеток. Каждая из вышеуказанных ссылок включена в настоящее описание для раскрытия этих методов.

[0113] В способах, описанных в настоящем документе, образец мочи может быть предварительно обработан на одной или нескольких стадиях фильтрации или центрифугирования для удаления клеточного остатка и других немикровезикулярных веществ. Например, образец мочи может быть отфильтрован через 0,8 мкм-овый фильтр. Необязательно, фильтрат, полученный после прохождения через 0,8 мкм-овый фильтр, может быть дополнительно отфильтрован через 0,22 мкм-овый фильтр. Для выделения микровезикул мочи предварительно обработанные образцы затем концентрируют, используя стадию фильтрационной концентрации. Эта стадия включает использование фильтра, которые имеет молекулярную предельную величину для сохранения и концентрирования микровезикул, диаметром больше 10 нм. Например, образец затем концертируют до объема меньше 1 мл, предпочтительно, 100-200 мкл. Например, молекулярный предел по массе составляет по меньшей мере 100 кДа. Предпочтительно, молекулярный предел по массе составляет 100 кДа.

Экстракция нуклеиновой кислоты из микровезикул

[0114] Методы экстракции нуклеиновой кислоты в целом основаны на методиках, хорошо известных в данной области. Специалисты в данной области смогут выбрать конкретную методику экстракции, подходящую для конкретного биологического образца. Примеры методик экстракции приведены в патентных публикациях WO 2009/100029, US 201/00196426, US 2011/0003704, US 2011/0053157, WO 2011/009104 и WO 2011/031892. Эти публикации включены в настоящий документ путем ссылки для раскрытия проведения методов и методик экстракции нуклеиновых кислот из микровезикул.

[0115] В способах, описанных в настоящем документе, после выделения микровезикул и их очистки, но перед лизисом микровезикул и выделения нуклеиновой кислоты, в образец добавляют ингибитор РНказы для предотвращения нежелательной деградации нуклеиновых кислот после экстракции. Микровезикулы лизируют в присутствии ингибитора РНКазы. Затем к РНК-связывающей колонке добавляют лизат при таких условиях, известных в данной области, при которых РНК микровезикул связывается с колонкой. Необязательно, колонку промывают для повышения количества и выхода РНК. Затем РНК элюируют при таких в условиях, известных в данной области, при которых проводят сбор РНК высокого качества.

[0116] В некоторых вариантах осуществления количество экстрагированных нуклеиновых кислот может быть оценено путем детекции рибосомальной 18S и 28S РНК и путем определения их соотношения. Отношение 18S:28S рРНК предпочтительно составляет приблизительно от 1:1 до приблизительно 1:2; более предпочтительно, приблизительно 1:2.

[0117] В некоторых вариантах осуществления нуклеиновые кислоты могут быть экстрагированы из образцов мочи без выделения или очистки микровезикулярной фракции.

Детекция биомаркеров нуклеиновой кислоты

[0118] Детекцию биомаркеров можно осуществлять на экстрагированных нуклеиновых кислотах большим числом различных путей и основываясь на множестве аспектов. В некоторых вариантах осуществления детекцию биомаркеров нуклиновых кислот из одного или нескольких образцов мочи проводят для получения всего профиля или части профиля экстрагированных нуклеиновых кислот.

[0119] Профиль, в качестве используемого в настоящем документе термина, относится к набору конкретных признаков коллекции нуклеиновых кислот, который может быть определен с помощью количественного или качественного анализа одной или нескольких аминокислот, содержащихся в микровезикулах или в фракции микровезикул, выделенных из образца мочевины индивида. Эталонный профиль в настоящем документе определен как профиль, полученный у независимого индивида или группы индивидов, или у того же индивида в различные точки времени.

[0120] Нуклеиновые кислоты в микровезикулах могут быть нуклеиновыми кислотами одного или нескольких типов, примеры которых приведены в настоящем документе.

[0121] Нуклеиновые кислоты могут быть РНК. РНК могут кодирующей РНК, например, матричной РНК, которая может кодировать белки. РНК может быть также некодирующей РНК (нкРНК), например, рибосомальной РНК, транспортной РНК, микроРНК и другими некодирующими транскриптами, которые могут происходить из геномной ДНК. Эти некодирующие РНК транскрипы могут включать транскрипты, которые транскрибированы из сателлитных повторов; и транспозоны, которые могут быть транспозонами ДНК или ретротранспозонами. Предпочтительно, нуклеиновыми кислотами являются мРНК.

[0122] Нуклеиновые кислоты могут быть ДНК. ДНК может быть одноцепочечной ДНК, которая является обратным транскриптом РНК, например, кДНК. Обратная транскрипция обычно опосредуется обратной транскриптазой, кодируемой геном обратной транскриптазы в клетке. ДНК также может быть одноцепочечной ДНК, которая образуется в процессе репликации ДНК. Геномная ДНК реплицируется в ядре при делении клетки. Некоторые реплицированные ДНК могут отрываться от своей матрицы, экспортироваться из ядра и упаковываться в микровезикулы. ДНК, кроме того, может быть фрагментами двуцепочечной ДНК.

[0123] Кроме того, ДНК может быть некодирующей ДНК (нкДНК). Геном человека содержит только приблизительно 20000 генов, кодирующих белок, что составляет меньше 2% от всего генома. Отношение некодирующих и кодирующих белок последовательностей ДНК повышается как функция сложности развития (Mattick, 2004). Прокариоты имеют меньше 25% нкДНК, простые эукариоты имеют от 25 до 50%, более сложные многоклеточные организмы, такие как растения и животные, имеют более 50% нкDNA, а человек имеет приблизительно 98,5% нкДНК (Mattick, 2004).

[0124] Некоторая часть нкДНК генома транскрибируется в нкРНК. нкРНК вовлечены в большое число важных процессов в клетке, например, ферменты (рибозимы), связывающиеся специфически с белками (аптамерами) и регулирующие активность генов и на уровне транскрипции, и на посттранскрипционном уровне.

[0125] Профиль нуклеиновых кислот может быть получен путем аализа нуклеиновых кислот, полученных из выделенных микровезикул в соответствии со стандартными протоколами уровня техники. Например, анализ ДНК может быть осуществлен одним или несколькими различными способами, известными в данной области, включая анализ с использованием микроматрицы для определения вида нуклеиновой кислоты в экстракте, количественную ПЦР для измерения уровня экспрессии генов, секвинирование ДНК для обнаружения мутаций в генах и анализ бисульфитного метилирования для детекции характера метилирования генов.

[0126] Для получения профилей, в некоторых случаях, можно проводить анализ данных. Такой анализ данных может быть осуществлен, например, с помощью кластерного анализа, метода главных компонент, линейного дискриминантного анализа, анализа кривой операционной характеристики приемника, бинарного анализа, регрессивного анализа пропорциональных рисков Кокса, метода опорных векторов и рекурсивной функции удаления (SVM-РСЕ), классификации по ближайшей центроиде, доказательного анализа или сочетания любых вышеупомянутых аналитических методик.

[0127] В еще одном примере, анализ РНМ может быть осуществлен с помощью цифрового метода анализа экспрессии генов (DGE) (Lipson et al., 2009). В еще одном примере анализа РНК может быть ферментативно расщеплена и превращена в одноцепочечную кДНК, которую затем можно проанализировать, секвенируя на аппарате для секвенирования ДНК, например, одномолекулярный секвинатор HeliScope™ от Helicos BioSciences, как описано в публикации Ting et al. (Ting et al., 2011).

[0128] В других примерах, перед последующей амплификацией может быть проведена обратная транскрипция РНК в комплементарную ДНК (кДНК). Такая обратная транскрипция может быть осуществлена самостоятельно или в сочетании со стадией амплификации. Одним из примеров способа, объединяющего стадии обратной транскрипции и амплификации, является полимеразная цепная реакция с обратной транскрипцией (ОТ-ПЦР), которая дополнительно может быть модифицирована как количественная, например, количественная ОТ-ПЦР, как описано в патенте США номер 5639606, который включен в настоящий документ путем ссылки на это описание. Еще в одном примере способ включает две отдельные стадии: первую стадию обратной транскрипции для преобразования РНК в кДНК, и вторую стадию количественного определения кДНК, используя количественную ПЦР.

[0129] Способы амплификации нуклеиновых кислот включают, но ими не ограничиваются, полимеразную цепную реакцию (ПЦР) (патент США 5219727) и ее варианты, такие как полимеразная реакция in situ (патент США номер 5538871), количественная полимеразная цепная реакция (патент США номер 5219727), гнездовая полимеразная цепная реакция (патент США номер 5556773), самоподдерживающаяся репликация последовательностей и ее варианты (Guatelli et al., 1990), транскрипционно-опосредованная амплификационная система и ее варианты (Kwoh et al., 1989), Qb-репликаза и ее варианты (Miele et al., 1983), холодная ПЦР (, анализ BEAM (Li et al., 2006) и другие способы амплификации нуклеиновых кислот, после чего следует детекция амплифицированных молекул, используя методики, известные специалистам в данной области. Особенно эффективными являются такие системы детекции, которые разработаны для детекции молекул нуклеиновых кислот, если такие молекулы присутствуют в очень небольшом числе. Приведенные выше ссылки включены в настоящее изобретение для информации об этих методах.

[0130] В некоторых вариантах осуществления стадию амплификации нуклеиновой кислоты не проводят. Неамплифицированные нуклеиновые кислоты могут быть проанализированы с помощью количественной ПЦН (ОТ-ПЦР) или проанализированы напрямую, например, посредством секвинирования следующего поколения или технологией NanoString.

[0131] Анализ нуклеиновых кислот, присутствующих в выделенных микровезикулах, может быть количественным и/или качественным. При количественном анализе измеряют уровни экспрессии, либо относительный, либо абсолютный, интересующих специфических нуклеиновых кислот в выделенных микровезикулах способами, известным в данной области и описанными в настоящем документе. При качественном анализе идентифицируют тип интересующих нуклеиновых кислот в выделенных микровезикулах, дикий тип или варианты, способами, известными в данной области.

[0132] В некоторых вариантах осуществления детекция биомаркеров нуклеиновых кислот включает детекцию на наличие или отсутствие одной или набора генетических аберраций. Термин “генетическая аберрация” используется в настоящем документе в отношении количества нуклеиновых кисло, а также вариантов нуклеиновых кислот в микровезикулах, содержащих нуклеиновые кислоты. Конкретно, генетические аберрации включают, но ими не ограничиваются, сверхэкспрессию гена (например, онкогена) или набора генов, пониженную экспрессию гена (например, гена опухолевого супрессора, такого как p53 или RB) или набора генов, альтернативную продукцию сплайсированных вариантов гена или набора генов, варианты числа копий гена (CNV) (например, двойные ДНК (Hahn, 1993), модификации нуклеиновых кислот (например, метилирование, ацетилирование и фосфорилирование), единичные нуклеотидные полиморфизмы (SNP) (например, полиморфизмы в элементах Alu), хромосомные перестановки (например, инверсии, делеции и дубликации) и мутации (вставки, делеции, дупликации, миссенс-кодоны, нонсенс-кодоны, синонимы и другие нуклеотидные изменения) генов или набора генов, где мутации, в большинстве случаев, в конечном счете, влияют на активность и функцию генных продуктов, что приводит к альтернативным вариантам транскрипции и сплайсинга и/или изменениям уровня экспрессии генов, или к комбинациям любых из вышеперечисленных изменений.

[0133] Генетические абберации можно обнаружить во многих типах нуклеиновых кислот. Определение таких генетических аббераций можно проводить с помощью различных методик, известных специалисту в данной области. Например, уровень экспрессии нуклеиновых кислот, альтернативные варианты сплайсинга, хромосомные перестройки и число копий гена можно определять с помощью анализа с микроматрицами (см., например, патенты США номер 6913879, 7364848, 7378245, 6893837 и 6004755) и количественной ПЦР. Изменения в числе копий можно детектировать, например, путем анализа генотипирования всего генома с использованием технологии Infinium Infinium II или путем выравнивания генома человека с использованием микроматрицы CGH (Steemers et al., 2006).

[0134] Модификации нуклеиновых кислот могут быть проанализированы способами, описанными, например, в патенте США номер 7186512 и в патентной публикации WO/2003/023065. Профили метилирования могут определены, например, с помощью анализа метилирования ДНК на панели для злокачественных новообразований OMA003 с использованием технологии Illumina.

[0135] SNP и мутации могут быть детектированы путем гибридизации с аллель-специфическими зондами, путем ферментных методов детекции мутаций, химическим расщеплением гетеродуплексов с ошибочным спариванием (Cotton et al., 1988), рибонуклеазным расщеплением оснований с ошибочным спариванием (Myers et al., 1985), масс-спектрометрией (патенты США номер 6994960, 7074563 и 7198893), секвенированием нуклеиновой кислоты, одноцепочечным конформационным полиморфизмом (SSCP) (Orita et al., 1989), электрофорезом в градиенте денатурирующего геля (DGGE) (Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), электрофорезом в геле с температурным градиентом (TGGE) (Fischer anf Lerman, 1979a; Fischer and Lerman, 1979b), полиморфизмом длинных рестрикционных фрагментов (RFLP) (Kan and Dozy, 1978a; Kan and Dozy, 1978b), анализом лигирования олигонуклеотидом (OLA), аллель-специфической ПЦР (ASPCR) (патент США номер 5639611), лигазной цепной реакцией (LCR) и ее вариантами (Abravaya et al., 1995; Landegren et al., 1988; Nakazawa et al., 1994), проточным цитометрическим гетеродуплексным анализом (WO/2006/113590) и их комбинациями/модификациями.

[0136] В некоторых вариантах осуществления детекцию мутаций проводят с помощью рестрикционного фермента, который разрезает только один вариант биомаркера, но не разрезает другие варианты биомаркера. Как известно в данной области, рестрикционные ферменты правильно распознают конкретные полинуклеотидные участки, а изменение одного или нескольких нуклеотидов в пределах полинуклеотидного участка скорей всего сделает полинуклеотид нераспознаваемым и не разрезаемым для фермента. По существу, детекция одного из вариантов биомаркеров может быть упрощена путем отрезания нескольких или всех других вариантов, которые могут распознаваться этим ферментом. Вариант для детекции может быть вариантом дикого типа или мутантным вариантом.

[0137] Уровни генной экспрессии могут быть определены с помощью методики (Velculescu et al., 1995) серийного анализа генной экспрессии (SAGE) , количественной ПЦР, количественной ПЦР с обратной транскрипцией, анализом на микроматрицах и секвинированием ДНК следующего поколения, как хорошо известно в данной области.

[0138] В целом, способы анализа генетических аббераций описаны во множестве публикаций, не ограничиваясь теми, которые цитированы в настоящем документе, и они доступны для специалистов в данной области. Подходящий способ анализа будет зависеть от специфических целей анализа, состояния/анамнеза пациента, и от конкретного вида злокачественного новообразования(ий), заболеваний и других расстройств, подлежащих обнаружению, мониторингу и лечению.

Биомаркеры, связанные с заболеваниями или другими расстройствами

[0139] Большое число биомаркеров может быть связано с наличием или отсутствием заболевания или других расстройств у индивида. Следовательно, детекция на наличие или отсутствие таких биомаркеров в экстракте нуклеиновой кислоты выделенных микровезикул, согласно способам, описанным в настоящем документе, может способствовать диагностике, прогнозированию или проведению мониторинга прогресса или рецидива заболевания или другого расстройства у индивида.

[0140] ERG, как используется в настоящем изобретении, относится к гену, также называемому гомолог онкогена v-ets вируса E26 эритробластоза и к любым другим идентифицированным изоформам. Например, изоформы ERG включают ERG1, ERG2, ERG3, ERG4, ERG5, ERG6, ERG7, ERG8 и ERG9. ERG также может относится к изоформе 1 гена ERG, специфической для рака предстательной железы ERG (EPC1), и изоформе 2 гена ERG, специфической для рака предстательной железы (EPC2). ERG, или любая изоформа ERG, может использоваться в качестве биомаркера рака предстательной железы.

[0141] PCA3, как используется в настоящем документе, также относится к гену, который также известен как DD3, и к любой идентифицированной изоформе, и может использоваться в качестве биомаркера рака предстательной железы.

[0142] Было обнаружено, что большое число биомаркеров влияет на выбор терапии конкретного пациента. Детекция на наличие или отсутствие таких биомаркеров в экстракте нуклеиновой кислоты выделенных микровезикул, согласно способам, описанным в настоящем документе, может способствовать выбору терапии у конкретного пациента.

Подгруппы пациентов

[0143] Настоящее изобретение относится к способам детекции одного или нескольких биомаркеров в образцах мочи индивида для установления диагноза, прогнозирования, проведения мониторинга и выбора терапии заболевания, такого как, например, злокачественное новообразование, в частности агрессивное злокачественное новообразование.

[0144] Выбор индивида для выделения микровезикул осуществляется специалистом в данной области на основе анализ одного или нескольких различных факторов. Такими учитываемыми факторами являются либо наличие в семейном анамнезе индивида конкретного заболевания (например, злокачественного новообразования), генетической предрасположенности к такому заболеванию, повышенного риска наличия такого заболевания, физиологические симптомы, которые указывают на предрасположенность, либо влияние окружающих факторов. Влияние окружающий факторов включает стиль жизни, воздействие агентов, которые вызывают или способствуют развитию заболевания, например, атмосферные факторы, территориальные факторы, вода и питание. Другие причины для выбора индивида для проведения способов, описанных в настоящем документе, включают наличие в анамнезе заболевания, недавно диагностированного заболевания до лечения или после лечения, недавно прошедшего лечение заболевания (или получающего лечение в настоящее время) или находящегося в ремиссии или в процессе восстановления после заболевания.

[0145] Злокачественное новообразование диагностированное, контролируемое или другим образом оцениваемое способами по настоящему изобретению может быть любым видом злокачественного новообразования или предракового состояния. К нему относятся, но ими не ограничиваются, эпителиальные виды рака, такие как рак легкого, рак яичника, рак шейки матки, рак эндометрия, рак молочной железы, рак мозга, рак толстой кишки и рак предстательной железы. Также к нему относятся желудочно-кишечный рак, рак головы и шеи, немелкоклеточный рак легкого, рак нервной системы, рак сетчатки, рак кожи, рак печение, рак поджелудочной железы, рак почек, рак половых органов и рак мочевого пузыря, меланома и лейкоз. Кроме того, способы и композиции по настоящему изобретению равнозначным образом могут использоваться для обнаружения, диагностики и прогнозирования немалигнизирующих опухолей у индивида (например, нейробластомы, менингиомы и шванномы). Злокачественное новообразование может быть агрессивным. В некоторых вариантах осуществления злокачественное новообразование представляет собой урогенитальный рак, такой как рак предстательной железы, рак мочевого пузыря, рак почки и метастазирующий рак, который поражает мочеполовую систему.

[0146] Настоящее изобретение относится к биомаркерам, которые имеют значительную диагностическую и прогностическую ценность у различных подгрупп пациентов. Пациенты страдают злокачественными новообразованиями, например, раком предстательной железы. В некоторых вариантах осуществления один или несколько биомаркеров детектируют у пациентов, у которых проведена радикальная простатэктомия. В некоторых вариантах осуществления один или несколько биомаркеров детектируют у пациентов с установленным индексом Глисона. В некоторых вариантах осуществления один или несколько биомаркеров детектируют у пациентов, которые экспрессируют ERG, или у пациентов, у которых выявлено злокачественное новообразование, инициируемое экспрессией ERG. Такие пациентов называют в настоящем описании «экспрессирующие ERG». Наличие ERG или экспрессии ERG выше конкретной заранее известной величины указывает на злокачественные новообразования, инициируемые экспрессией ERG. В некоторых вариантах осуществления один или несколько биомаркеров детектируют у пациентов, которые не экспрессируют ERG, или у пациентов, у которых выявлено злокачественное новообразование, не инициируемое экспрессией ERG. Такие пациентов называют в настоящем описании «неэкспрессирующие ERG».

[0147] Система оценки Глисона широко используется в данной области в качестве параметра для прогноза, часто используемого в сочетании с другими прогностическими факторами и исследованиями, рака предстательной железы. Образцы биопсии предстательной железы оценивают, например, с помощью микроскопа, и патоморфолог определяет балл на основании структурных характеристик опухоли предстательной железы. Балл по шкале Глисона основан на степени потери нормальной структуры железистой тканью (например, форма, размер и дифференциация железы). Образцу присваивается показатель наиболее распространенного образца опухоли и второй показатель следующего распространенного образца опухоли. Это может быть первичный или наиболее распространенный образец или вторичный, или второй, наиболее распространенный образец, которые могут быть идентифицированы; альтернативно, может быть присвоен только один показатель. Баллы по шкале Глисона связаны со следующими признаками:

Балл 1 - Рак предстательной железы напоминает нормальную ткань предстательной железы. Железа имеет небольшой размер, хорошо оформлена и имеет плотную структурную решетку.

Балл 2 - Ткань железы все еще хорошо оформлена, но она имеет больший размер и больше ткани между железистыми структурами.

Балл 3 - Ткань железы все еще узнаваема, но клетки темнее. При высокой степени малигнизации некоторые из этих клеток покидают железу и начинают поражать окружающую ткань.

Балл 4 - В ткани распознаются несколько железистых структур. Большинство клеток поражают окружающую ткань.

Балла 5 - В ткани не распознаются железистые структуры. Обычно на всех протяженности окружающих тканей находят просто пласты клеток.

[0148] Два показателя, суммируемые вместе с получением индекса Глисона, также называют суммой по шкале Глисона. Индекс от 2 до 4 является очень низким по шкале агрессивного рака. Индекс от 5 до 6 указывает на умеренную агрессивность рака. Индекс 7 указывает на среднюю агрессивность рака. Индекс от 8 до 10 свидетельствует об агрессивном типе рака.

[0149] Другие системы бальной оценки для разделения неагрессивных форм рака от агрессивных форм рака для других типов злокачественных новообразований, например, рака мочевого пузыря и рака почек, хорошо известны в данной области.

ПРИМЕРЫ

Пример 1: Материалы и методы:

[0150] Последовательности праймеров/зондов: В наборах и способах детекции когорт биомаркеров мочи использовали следующие последовательности праймеров/зондов. В таблице 1 ниже используют следующие аббревиатуры: зонды от Integrated DNA Technologies обозначены как «IDT,» 5’-FAM относится к 5’-репортерному красителю, «3IABkFQ» относится к гасителю 3’-IowaBlack и «ZEN» относится к гасителю in-sequence-ZEN™ от IDT.

Таблица 1.
Последовательности праймера/зонда
Мишень Обозначения Последовательность/
Модификации
SPDEF 0881_SPDEF_e3-4_fF_IDT CCACCTGGACATCTGGAAG (SEQ ID NO:10)
SPDEF 0884_SPDEF_e3-4_r1_IDT AATCGCCCCAGGTGAAGT
(SEQ ID NO:11)
SPDEF 0883_SPDEF_e3-4_p_ZEN /56-FAM/CGG CCT GGA/ZEN/TGA AAG AGC G/3IABkFQ/(SEQ ID NO:12)
ERG 0498_ERG_ex11-12_IDT_f
(ERG LDT F1)
GCGTCCTCAGTTAGATCCTTATCAG (SEQ ID NO:13)
ERG 0499_ERG_ex12-13_IDT_R
(ERG LDT R1)
CTGGCCACTGCCTGGATT
(SEQ ID NO:14)
ERG 0500_ERG_ex12_IDT_FAM_
ZEN_зонд
/56-FAM/CTT GGA CCA /ZEN/ACA AGT AGC CGC CTT GC/3IABkFQ/(SEQ ID NO:15)
PCA3 0539_PCA3_ex3-4_злкч_IDT_f GCA CAT TTC CAG CCC CTT TA
(SEQ ID NO:16)
PCA3 0540_PCA3_ex3-4_злкч_IDT_r GGC ATT TCT CCC AGG GAT CT
(SEQ ID NO:17)
PCA3 0541_PCA3_ex3-4_злкч_IDT_FAM_ZEN_зонд /56-FAM/CAC ACA GGA /ZEN/AGC ACA AAA GGA AGC /3IABkFQ/(SEQ ID NO:18)
Q бета 0545_Qбета_P3_IDT_f AAC GGT TCT TGT GAC CCA TC
(SEQ ID NO:19)
Q бета 0546_Qбета_P3_IDT_r CGA ACA AAA GCT CGT TCC TC
(SEQ ID NO:20)
Q бета 0547_Qбета_P3_Tm69_IDT_FAM_ZEN_зонд /56-FAM/CGC CAG GCA /ZEN/TAT GCT GAC GTG /3IABkFQ/(SEQ ID NO:21)
KLK3 0535_KLK3_LDT_ex1-2_P3_f (KLK3 LDT F1) CCTGTCCGTGACGTGGAT
(SEQ ID NO:22)
KLK3 0536_KLK3_LDT_ex1-2_P3_r (KLK3 LDT R) CAGGGTTGGGAATGCTTCT
(SEQ ID NO:23)
KLK3 0538_KLK3_ex1-2_P3_Tm70_FAM_ZEN_зонд /56-FAM/CGG ATT GTG /ZEN/GGA GGC TGG GA/3IABkFQ/(SEQ ID NO:24)
TMPRSS:
ERG
0949_TMPRSS-ERG_SL_F GCC TGG AGC GCG GCA G
(SEQ ID NO:25)
TMPRSS:
ERG
0951_TMPRSS-ERG_SL_R2 GCA CAC TCA AAC AAC GAC TG
(SEQ ID NO:26)
TMPRSS:
ERG
0955_TMPRSS-ERG_SL_P1 /56-FAM/AGC CTT ATC /ZEN/AGT TGT GAG TGA GGA C/3IABkFQ/(SEQ ID NO:27)
AMACR 0508_AMACR_ex1-2_LDT_f GCCGCGGTGTCATGG
(SEQ ID NO:28)
AMACR 0509_AMACR_ex2_LDT_r TTTCCCGCTGCAGAATCTC
(SEQ ID NO:29)
AMACR 0510_AMACR_353_IDT_FAM_
ZEN_зонд
/56-FAM/AGA AAC TCC /ZEN/AGC TGG GCC CA/3IABkFQ/(SEQ ID NO:30)
BIRC5 0582_BIRC5_P3_e1-2_F GGA CCA CCG CAT CTC TAC AT
(SEQ ID NO:31)
BIRC5 0583_BIRC5_P3_e1-2_R GTC TGG CTC GTT CTC AGT GG
(SEQ ID NO:32)
BIRC5 0584_BIRC5_P3_e1-2_IDT
_FAM_ZEN_зонд
/56-FAM/CTT CTT GGA /ZEN/GGG CTG CGC CT/3IABkFQ/(SEQ ID NO:33)
SPARCL1 0585_SPARCL1_P3-2_f TCT GGA AAG CAT GAA GAC TGG (SEQ ID NO:34)
SPARCL1 0586_SPARCL1_P3-2_R TGC TAC CGT TTC AGC AGT TG (SEQ ID NO:35)
SPARCL1 0587_SPARCL1_P3-2_IDT_FAM_ZEN_зонд /56-FAM/CTG CAG CTG /ZEN/CAA TCC CGA CA/3IABkFQ/(SEQ ID NO:36)

Пример 2: получение образцов пациентов когорты 7

[0151] Образцы когорты пациентов использовали для идентификации биомаркеров, которые могут использоваться для детекции рака предстательной железы на основании нуклеиновых кислот, экстрагированных из микровезикул мочи. В этом исследовании регистрировали когорту пациентов из 258 индивидов, обозначенную этом примере как «когорта 7». Из 258 индивидов у 196 была проведена первичная биопсия, а у 59 - повторная биопсия. Из группы с первичной биопсией у 87 пациентов были положительные результаты биопсии, а у 109 пациентов были отрицательные результаты биопсии. Из группы с повторной биопсией у 15 пациентов были положительные результаты биопсии, а у 44 были отрицательные результаты биопсии.

[0152] Объемы образцов мочи изменялись от 20 до 100 мл. Распределение первичного объема образцов мочи у пациентов было следующим: объем образца (V) равен 20 мл (то есть, V=20 мл), 21% пациентов (n=55); объем образца свыше 20 мл, меньше или равен 40 мл (то есть, 20 мл<V≤40 мл), 27% пациентов (n=70); или объем образца равен свыше 40 мл (то есть, V>40 мл), 52% пациентов (n=133).

[0153] Образцы мочи когорты 7 анализировали, как показано на фигурах 1A и 1B. Например, образцы мочи собирали и фильтровали через фильтр размером 0,8 мкм для того, чтобы отделить клети и другой клеточный осадок от микровезикул, и насыщенные микрочастицами фракции замораживали при -80°C. Первую аликвоту каждого образца (S1) дополнительно обрабатывали. Дополнительные стадии обработки могут включать центрифугирование, концентрацию через фильтрационный концентратор, 1-2 стадии промывки и/или добавление ингибитора РНКазы. Необязательно, перед выделением микрочастиц или экстрацией нуклеиновых кислот для определения количества выделения или экстракции нуклеиновых кислот к образцам могут быть добавлены контрольные частицы, такие как Q-бета частицы. Например, 18 индивидов были исключены из исследования из-за ошибок с контролем Q-бета.

[0154] Конкретно, образец мочи сначала фильтровали, и фильтрат удаляли. Добавляли контроль с Q-бета частицами при подходящей концентрации (например, 100 копий) к аликвоте отфильтрованных образцов мочи (например, 15 мл). Аликвоту затем пропускают через фильтрационный концентратор, и фильтрат удаляют Ультраконцентрат ресуспендируют со второй аликвотой отфильтрованных образцов мочи (например, 5 мл отфильтрованной мочи) и пропускают через фильтрационный концентратор. Ультраконцентрат затем промывают по меньшей мере один раз (например, два раза) и повторно центрифугируют в фильтрационном концентраторе. Добавляют ингибитор РНКазы к ультраконцентрату, расположенному в верхней камере фильтрационного концентратора, и инкубируют при комнатной температуре, например, в течение 2-3 минут. К образу затем напрямую добавляют буфер для лизиса и инкубируют в течение 1 минуты. Лизат затем переносят в другой контейнер для продолжения экстрации нуклеиновой кислоты.

[0155] Из образцов затем экстрагируют нуклеиновую кислоту, используя способы, хорошо известные в данной области, и условия, подходящие для выхода РНК высокого качества. 12 мкл экстрагированной РНК анализируют на профиль с помощью BioAnalyzer. Проводят обратную транскрипцию экстрагированной РНК в кДНК (набор для синтеза кДНК SUPERSCRIPT® VILO, Life Technologies). Количественную ПЦР в реальном времени проводили на образцах кДНК для определения экспрессии гена PCA3, ERG, KLK3 и Qbeta (2 мкл на ген). Для каждого планшета кПЦР была представлена калибровочная стандартная кривая.

[0156] Последовательности паймеров и зондов можно найти в таблице 1.

Пример 3: Анализ экспрессии гена ERG и PSA3

[0157] Проводили множественный анализ, используя результаты генной экспрессии эксперимента кПЦР. РОС-кривые получали на основе дельта Ct или числа копий относительно нормализующего гена KLK3. Отсечение можно использовать для получения пропущенных значений. РОС-анализ PCA3, c использованием KLK3 в качестве гена для нормализации, давал значение AUC, равное 0,727 (Фигура 3). ROC-анализ PCA3 и ERG давал повышенные значения AUC, равные 0,756 (Фигура 4). В других экспериментах геном для нормализации был SPDEE (Фигура 13) и значения AUC, полученные из анализа, используя нормализацию SPDEF, показали, что KLK3 и SPDEF давали эквивалентные результаты.

[0158] Значения модели, или выходные данные, для экспрессии генов PCA3 и ERG также были рассчитаны для каждого примера, используя следующую формулу, которую устанавливали из данных анализа различных когорт пациентов (Когорта 5):

Значение модели=(ΔCtERG × 0,233)+(ΔCtPCA3 × 0,446)

где ΔCtERG=CtERG - CtKLK3; ΔCtPCA3=CtPCA3 - CtKLK33

Выбирали величину порога отсечения модели, например, величина порога отсечения в этом примере была 4,7, и диагностическую точность использованной комбинации PCA3 и ERG с величиной порога отсечения модели, равной 4,7, определяли по анализу 2×2 и анализу Глисона (Фигура 10).

[0159] Результаты анализа 2×2, используя экспрессию генов PCA3 и ERG для каждого объема образца подгруппы когорты 7, суммированы в Таблицах 2a, 3a и 4a. Сочетание PCA3 и ERG превышает 84% чувствительность для идентификации рака предстательной железы в образцах, которые были выявлены как положительные по данным биопсии. В частности, данные показали, что объем образцов мочи, равный 20 мл, давал лучшую диагностическую точность, имея чувствительность 83,6% и специфичность 58,7%. Этот способ также имел высокую прогностическую ценность отрицательного результата, равную 79,4%, и прогностическую ценность положительного результата, равную 53,4%.

[0160] Дальнейший анализ включал распределение образцов по индексу Глисона, как показано в таблицах 2b, 3b и 4b, и анализа квартиля, как показано в таблицах 2d, 2е, 3d, 3e, 4d и 4e. Конкретно, образцы пациентов с индексом Глисона, равным 6 или выше, были верно идентифицированы в 70% образцов.

Пример 4: Модель на трех генах, включая PCA3

[0161] Мультивариантный анализ осуществляли, используя набор генов, включая PCA3. Как показано на Фигуре 15, PCA3-содержащие модели (то есть, PCA3 и ERG плюс дополнительный ген, такой как AMACR, BIRC5, HOXC6 и SPARCL1) неизменно превосходят модели на трех генах FTO, которые не содержат PCA3. Используемыми эталонными генами могут быть KLK3 или SPDEF, на что указывают постоянные значения AUC, полученные при использовании любого гена для нормализации, на Фигуре 15.

[0162] Как было показано, модели на трех генах также имеют улучшенные значения AUC при использовании образов с малым объемом (то есть, 20 мл) по сравнению со всеми образцами (Фигура 15).

Пример 5: Оптимальный объем образца мочи

[0163] Образцы мочи пациентов когорты 7 изменялись от 20 до 100 мл. Распределение образцов с объемами 20 мл или меньше, 40 мл или меньше, но больше 20 мл, и больше 40 мл в когорте 7 показано на Фигуре 1.

[0164] Выделяли микровезикулы, экстрагировали РНК и определяли экспрессию генов биомаркеров, как описано в Примерах 1 и 2. Биостатистический анализ биомаркеров (то есть, PCA3, ERG) в когорте 7 осуществляли путем получения AUC и ROC-графиков на основе числа копий и экспрессии генов, нормализованной по KLK3, для всех образцов в когорте. На Фигуре 3 показано, что AUC, полученное из анализа экспрессии PCA3, имеет высокую зависимость от объема образца. Например, образцы, которые показали AUC больше 0,70, были образцами с объемом менее 40 мл. Наоборот, образцы, которые показали AUC в области от 0,60 до 0,65, были образцами с объемом 40 мл или больше. На фигуре 12 показан однофакторный анализ каждого указанного гена (PCA3, ERG, AMACR, BIRC5, HOXC6, SPARCL1 и SPDEF) и полученные значения AUC для образцов объемом 20 мл или менее сравнивали с полученными значениями AUC для всех образцов. Эти результаты показывают, что образцы объемом 20 мл или менее дают повышенные значения AUC, что указывает на то, что диагностическая ценность одного гена увеличивается в образцах мочи с маленьким объемом. SPDEF представляет собой эталонный ген, используемый для нормализации, и, следовательно, значения AUC не улучшаются при еще меньшем объеме образца.

[0165] Анализ экспрессии биомаркера на число копий, а не значения Ct, также показал, что образцы с меньшим объемом (20 мл) дают улучшенные значения AUC по сравнению со всеми образцами (Фигура 13).

Пример 6. Бальная оценка образцов пациента и подтверждение их статистической достоверности.

[0166] В ходе исследований, описанных в настоящем документе, использовали образцы, отвечавшие следующим критериям: (i) только первая биопсия; (ii) возраст пациент ≥50 лет; (iii) уровень PSA в «серой зоне», в диапазоне от 2 до 10 нг/мл; и (iv) объем полученной мочи от 20 до 49 мл. Образцы пациентов «в cерой зоне» PSA выбирали на том основании, что пациентам с высокими уровнями PSA почти всегда проводят биопсию, а пациентам с низкими уровнями PSA, как правило, только рекомендуют проведение биопсии по другим, не связанным с уровнями PSA, причинам.

[0167] Образцы пациента оценивали в баллах на соответствие с лабораторно-разработанной бальной оценкой (LDT), называемой в настоящем документе шкала EXO106, используя следующий алгоритм:

где количество копий вычисляли, используя программное обеспечение RGQ (Qiagen) для каждого гена, используя однопланшетную калибровочную кривую, и где величина порога отсечения составляла 10. В случае, когда баллы по шкале EXO106 были меньше 10, то баллы связывали с низким риском развития рака предстательной железы. В случае, когда баллы по шкале EXO106 больше или равны 10, то баллы связывали с высоким риском развития рака предстательной железы.

[0168] Следует отметить, что баллы масштабировались умножением на 1,83 и смещались добавлением 16,92 для преобразования баллов EXO106 в более применимый и удобный диапазон значений. Это масштабирование и смещение, тем не менее, не влияло на бальную оценку. Преобразование шкалы EXO106 помещало большую часть данных в диапазон от 0 до 30, но без ограничения баллов на любом из концов шкалы (то есть, отдельные образцы могут иметь баллы вне этого диапазона). Алгоритм для расчета баллов по шкале EXO106 был сконфигурирован таким образом, что прогностическая ценность отрицательных результатов (NPV) по шкале EXO106 при величине порога отсечения 10 была больше NPV калькулятора риска рака предстательной железы (PCPTRC), где величина порога отсечения NPVPCPTRC было выбрано таким образом, что прогнозирует по меньшей мере 30% пациентов, как отрицательные. Алгоритм для шкалы EXO106 также был разработан таким образом, что доля пациентов, спрогнозированных как отрицательные (то есть, количество баллов по шкале EXO106 менее 10) составляла по меньшей мере 30%.

[0169] Приведенное в качестве примера распределение баллов по шкале EXO106 в когорте пациентов, называемой в настоящем документе когорта 8 (то есть, C8, n=453 образца, среднее значение PSA=5,3 нг/мл, и 80% образцов, где 2<PSA<10 нг/мл) показано на фигуре 16. AUC для шкалы EXO106 в режиме на пациентах с любым индексом Глисона в сравнении с AUC при стандартном лечении (SOC), показана на фигуре 17, где AUC для SOC=0,595; AUC для EXO106=0,738; и AUC для EXO106+SOC=0,764. Когорта пациентов, использованная на фигуре 17, имела следующие характеристики: все образцы были «в серой зоне» PSA, все были только из первой биопсии и все были из образцов мочи с маленьким объемом. EXO106 в режиме с квартилем, то есть, процентное содержание образцов, идентифицированных как положительные с помощью биопсии, по баллам по шкале EXO106 квартиль, показано на фигурах 18A и 18B. Опять же, эти образцы были получены от пациентов с любым индексом Глисона.

[0170] Эффективность балла EXO106 для рака предстательной железы с высоким баллом, то есть, с индексом Глисона больше 6, показана на Фигуре 19, а анализ эффективности балла EXO106 на основе индекса Глисона в подгруппах показан на Фигуре 20.

[0171] Таким образом, балл EXO106 может использоваться для прогнозирования заболевания предстательной железы с высоким баллом, например, заболевания с индексом Глисона больше 6. Обычно, совокупность образцов первой биопсии и повторной биопсии очень различны и их анализ должен проводиться раздельно.

[0172] Несмотря на то, что настоящее изобретение было описано со ссылкой на определенные варианты осуществления, возможно большое число модификаций, изменений и уточнений, не отходя от сущности и не выходя за рамки настоящего изобретения, как описано выше и как заявлено в прилагаемой формуле изобретения. Таким образом, следует понимать, что настоящее изобретение не ограничено конкретными описанными вариантами осуществления, но, что оно приведено в полном объеме, которому оно соответствует по закону.

Таблица 2a.
Анализ 2×2 когорты 7 (V≤100 мл, N=236)
Величина пороговых значений модели 8,5
BX ПОЛОЖ. BX ОТРИЦ.
ПОЛОЖ.ТЕСТ 72 69 51,1% PPV
ОТРИЦ.ТЕСТ 21 74 77,9% NPV
77,4% 51,7%.
ЧУВСТ. СПЕЦ.

Таблица 2b.
Анализ индекса Глисона когорты 7 (V≤100 мл, N=236)
Глисон* # Пропущено % Пропущено Определено
6 11 29% 27
3+4=7 6 21% 22
4+3=7 2 13% 13
8 0 0% 3
9 1 13% 7
10 1 100% 0

Таблица 2c.
Анализ когорты 7 (V≤100 мл, N=236)
% ПОЛОЖ.ТЕСТ 59,7%
% ОТРИЦ.ТЕСТ 40,3%

Таблица 2d.
Квартильный анализ когорты 7 (V≤100 мл, N=236)
Группа
Глисона
% Положительной биопсии
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
0,40-6,70 6,70-8,20 8,20-9,40 9,40-13,60
Процент N Процент N Процент N Процент N
6 39,5% 15 26,3% 10 21,1% 8 13,2% 5
3+4=7 35,7% 10 39,3% 11 7,1% 2 17,9% 5
4+3=7 60,0% 9 26,7% 4 6,7% 1 6,7% 1
8 0,0% 0 66,7% 2 33,3% 1 0,0% 0
9 62,5% 5 0,0% 0 25,0% 2 12,5% 1
10 0,0% 0 0,0% 0 0,0% 0 100,0% 1

Таблица 2e.
Квартильный анализ когорты 7 (V≤100 мл, N=236)
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
0,40-6,70 6,70-8,20 8,20-9,40 9,40-13,60
%Bx Полож N %Bx Полож N %Bx Полож N %Bx Полож N
60,9% 64 46,6% 58 26,9% 52 21,0% 62

Таблица 3a.
Анализ 2×2 когорты 7 (V≤40 мл, N=189)
Величина пороговых значений модели 8,5
BX ПОЛОЖ. BX ОТРИЦ.
ПОЛОЖ.ТЕСТ 61 52 54,0% PPV
ОТРИЦ.ТЕСТ 17 59 77,6% NPV
78,2% 53,2%
ЧУВСТ. СПЕЦ.

Таблица 3b.
Анализ индекса Глисона когорты 7(V≤40 мл, N=189)
Глисон # Пропущено % Пропущено Определено
6 8 26% 23
3+4=7 6 24% 19
4+3=7 2 17% 10
8 0 0% 2
9 0 0% 7
10 1 100% 0

Таблица 3c.
Анализ когорты 7 (V≤40 мл, N=189)
% ПОЛОЖ.ТЕСТ 59,8%
% ОТРИЦ.ТЕСТ 40,2%

Таблица 3d.
Квартильный анализ когорты 7 (V≤40 мл, N=189)
Группа
Глисона
% Положительной биопсии
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
0,70-6,70 6,70-8,20 8,20-9,70 9,70-13,60
Процент N Процент N Процент N Процент N
6 38,7% 12 29,0% 9 19,4% 6 12,9% 4
3+4=7 32,0% 8 40,0% 10 8,0% 2 20,0% 5
4+3=7 58,3% 7 25,0% 3 8,3% 1 8,3% 1
8 0,0% 0 50,0% 1 50,0% 1 0,0% 0
9 71,4% 5 0,0% 0 28,6% 2 0,0% 0
10 0,0% 0 0,0% 0 0,0% 0 100,0% 1

Таблица 3e.
Квартильный анализ когорты 7 (V≤40 мл, N=189)
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
0,70-6,70 6,70-8,20 8,20-9,70 9,70-13,60
%Bx Полож N %Bx Полож N %Bx Полож N %Bx Полож N
65,3% 49 50,0% 46 24,0% 50 25,0% 44

Таблица 4a.
Анализ 2×2 когорты 7 (V≤20 мл, N=122)
Величина пороговых значений модели 8,5
BX ПОЛОЖ. BX ОТРИЦ.
ПОЛОЖ.ТЕСТ 42 26 61,8% PPV
ОТРИЦ.ТЕСТ 12 42 77,8% NPV
77,8%
ЧУВСТ.
61,8%
СПЕЦ.

Таблица 4b.
Анализ индекса Глисона когорты 7 (V≤20 мл, N=122)
Глисон # Пропущено % Пропущено Определено
6 7 28% 18
3+4=7 3 20% 12
4+3=7 2 25% 6
8 0 0% 1
9 0 0% 5
10 0 #DIV/0! 0

Таблица 4c.
Анализ когорты 7 (V≤20 мл, N=122)
% ПОЛОЖ.ТЕСТ 55,7%
% ОТРИЦ.ТЕСТ 44,3%

Таблица 4d. Квартильный анализ когорты 7 (V≤20 мл, N=122)
Группа
Глисона
% Положительной биопсии
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
2,20-6,70 6,70-8,20 8,20-9,40 9,40-13,60
Процент N Процент N Процент N Процент N
6 40,0% 10 28,0% 7 20,0% 5 12,0% 3
3+4=7 26,7% 4 46,7% 7 13,3% 2 13,3% 2
4+3=7 62,5% 5 12,5% 1 12,5% 1 12,5% 1
8 0,0% 0 0,0% 0 100,0% 1 0,0% 0
9 80,0% 4 0,0% 0 20,0% 1 0,0% 0
10 r#DIV/0! 0 r#DIV/0! 0 r#DIV/0! 0 r#DIV/0! 0

Таблица 4e.
Квартильный анализ когорты 7 (V≤20 мл, N=122)
Квартиль 1 Квартиль 2 Квартиль 3 Квартиль 4
2,20-6,70 6,70-8,20 8,20-9,40 9,40-13,60
%Bx Полож N %Bx Полож N %Bx Полож N %Bx Полож N
79,3% 29 50,0% 30 35,7% 28 17,1% 35

Ссылки

Al-Nedawi, K., B. Meehan, J. Micallef, V. Lhotak, L. May, A. Guha, and J. Rak. 2008. Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumour cells. Nat Cell Biol. 10:619-24.

Balzar, M., M.J. Winter, C.J. de Boer, and S.V. Litvinov. 1999. The biology of the 17-1A antigen (Ep-CAM). J Mol Med. 77:699-712.

Bossi, A., F. Bonini, A.P. Turner, and S.A. Piletsky. 2007. Molecularly imprinted polymers for the recognition of proteins: the state of the art. Biosens Bioelectron. 22:1131-7.

Bussemakers, M.J., A. van Bokhoven, G.W. Verhaegh, F.P. Smit, H.F. Karthaus, J.A. Schalken, F.M. Debruyne, N. Ru, and W.B. Isaacs. 1999. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res. 59:5975-9.

Chen, C., J. Skog, C.H. Hsu, R.T. Lessard, L. Balaj, T. Wurdinger, B.S. Carter, X.O. Breakefield, M. Toner, and D. Irimia. 2010. Microfluidic isolation and transcriptome analysis of serum microvesicles. Lab Chip. 10:505-11.

Cheruvanky, A., H. Zhou, T. Pisitkun, J.B. Kopp, M.A. Knepper, P.S. Yuen, and R.A. Star. 2007. Rapid isolation of urinary exosomal biomarkers using a nanomembrane ultrafiltration concentrator. Am J Physiol Renal Physiol. 292:F1657-61.

Cotton, R.G., N.R. Rodrigues, and R.D. Campbell. 1988. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc Natl Acad Sci U S A. 85:4397-401.

Cowell, J.K., and K.C. Lo. 2009. Application of oligonucleotides arrays for coincident comparative genomic hybridization, ploidy status and loss of heterozygosity studies in human cancers. Methods Mol Biol. 556:47-65.

Deras, I.L., S.M. Aubin, A. Blase, J.R. Day, S. Koo, A.W. Partin, W.J. Ellis, L.S. Marks, Y. Fradet, H. Rittenhouse, and J. Groskopf. 2008. PCA3: a molecular urine assay for predicting prostate biopsy outcome. J Urol. 179:1587-92.

Furusato, B., C.L. Gao, L. Ravindranath, Y. Chen, J. Cullen, D.G. McLeod, A. Dobi, S. Srivastava, G. Petrovics, and I.A. Sesterhenn. 2008. Mapping of TMPRSS2-ERG fusions in the context of multi-focal prostate cancer. Mod Pathol. 21:67-75.

Guatelli, J.C., K.M. Whitfield, D.Y. Kwoh, K.J. Barringer, D.D. Richman, and T.R. Gingeras. 1990. Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc Natl Acad Sci U S A. 87:1874-8.

Hahn, P.J. 1993. Molecular biology of double-minute chromosomes. Bioessays. 15:477-84.

Hessels, D., F.P. Smit, G.W. Verhaegh, J.A. Witjes, E.B. Cornel, and J.A. Schalken. 2007. Detection of TMPRSS2-ERG fusion transcripts and prostate cancer antigen 3 in urinary sediments may improve diagnosis of prostate cancer. Clin Cancer Res. 13:5103-8.

Johnson, S., D. Evans, S. Laurenson, D. Paul, A.G. Davies, P.K. Ferrigno, and C. Walti. 2008. Surface-immobilized peptide aptamers as probe molecules for protein detection. Anal Chem. 80:978-83.

Kwoh, D.Y., G.R. Davis, K.M. Whitfield, H.L. Chappelle, L.J. DiMichele, and T.R. Gingeras. 1989. Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Proc Natl Acad Sci U S A. 86:1173-7.

Laxman, B., D.S. Morris, J. Yu, J. Siddiqui, J. Cao, R. Mehra, R.J. Lonigro, A. Tsodikov, J.T. Wei, S.A. Tomlins, and A.M. Chinnaiyan. 2008. A first-generation multiplex biomarker analysis of urine for the early detection of prostate cancer. Cancer Res. 68:645-9.

Laxman, B., S.A. Tomlins, R. Mehra, D.S. Morris, L. Wang, B.E. Helgeson, R.B. Shah, M.A. Rubin, J.T. Wei, and A.M. Chinnaiyan. 2006. Noninvasive detection of TMPRSS2:ERG fusion transcripts in the urine of men with prostate cancer. Neoplasia. 8:885-8.

Li, J., L. Wang, H. Mamon, M.H. Kulke, R. Berbeco, and G.M. Makrigiorgos. 2008. Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med. 14:579-84.

Lipson, D., T. Raz, A. Kieu, D.R. Jones, E. Giladi, E. Thayer, J.F. Thompson, S. Letovsky, P. Milos, and M. Causey. 2009. Quantification of the yeast transcriptome by single-molecule sequencing. Nat Biotechnol. 27:652-8.

Mattick, J.S. 2004. RNA regulation: a new genetics? Nat Rev Genet. 5:316-23.

Miele, E.A., D.R. Mills, and F.R. Kramer. 1983. Autocatalytic replication of a recombinant RNA. J Mol Biol. 171:281-95.

Myers, R.M., Z. Larin, and T. Maniatis. 1985. Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science. 230:1242-6.

Nguyen, P.N., P. Violette, S. Chan, S. Tanguay, W. Kassouf, A. Aprikian, and J.Z. Chen. 2011. A panel of TMPRSS2:ERG fusion transcript markers for urine-based prostate cancer detection with high specificity and sensitivity. Eur Urol. 59:407-14.

Nilsson, J., J. Skog, A. Nordstrand, V. Baranov, L. Mincheva-Nilsson, X.O. Breakefield, and A. Widmark. 2009. Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer. Br J Cancer. 100:1603-7.

Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya. 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A. 86:2766-70.

Orozco, A.F., and D.E. Lewis. 2010. Flow cytometric analysis of circulating microparticles in plasma. Cytometry A. 77:502-14.

Palanisamy, N., B. Ateeq, S. Kalyana-Sundaram, D. Pflueger, K. Ramnarayanan, S. Shankar, B. Han, Q. Cao, X. Cao, K. Suleman, C. Kumar-Sinha, S.M. Dhanasekaran, Y.B. Chen, R. Esgueva, S. Banerjee, C.J. LaFargue, J. Siddiqui, F. Demichelis, P. Moeller, T.A. Bismar, R. Kuefer, D.R. Fullen, T.M. Johnson, J.K. Greenson, T.J. Giordano, P. Tan, S.A. Tomlins, S. Varambally, M.A. Rubin, C.A. Maher, and A.M. Chinnaiyan. 2010. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 16:793-8.

Petrovics, G., A. Liu, S. Shaheduzzaman, B. Furusato, C. Sun, Y. Chen, M. Nau, L. Ravindranath, A. Dobi, V. Srikantan, I.A. Sesterhenn, D.G. McLeod, M. Vahey, J.W. Moul, and S. Srivastava. 2005. Frequent overexpression of ETS-related gene-1 (ERG1) in prostate cancer transcriptome. Oncogene. 24:3847-52.

Raposo, G., H.W. Nijman, W. Stoorvogel, R. Liejendekker, C.V. Harding, C.J. Melief, and H.J. Geuze. 1996. B lymphocytes secrete antigen-presenting vesicles. J Exp Med. 183:1161-72.

Rice, K.R., Y. Chen, A. Ali, E.J. Whitman, A. Blase, M. Ibrahim, S. Elsamanoudi, S. Brassell, B. Furusato, N. Stingle, I.A. Sesterhenn, G. Petrovics, S. Miick, H. Rittenhouse, J. Groskopf, D.G. McLeod, and S. Srivastava. 2010. Evaluation of the ETS-related gene mRNA in urine for the detection of prostate cancer. Clin Cancer Res. 16:1572-6.

Rostad, K., O.J. Hellwinkel, S.A. Haukaas, O.J. Halvorsen, A.M. Oyan, A. Haese, L. Budaus, H. Albrecht, L.A. Akslen, T. Schlomm, and K.H. Kalland. 2009. TMPRSS2:ERG fusion transcripts in urine from prostate cancer patients correlate with a less favorable prognosis. APMIS. 117:575-82.

Salami, S.S., F. Schmidt, B. Laxman, M.M. Regan, D.S. Rickman, D. Scherr, G. Bueti, J. Siddiqui, S.A. Tomlins, J.T. Wei, A.M. Chinnaiyan, M.A. Rubin, and M.G. Sanda. 2011. Combining urinary detection of TMPRSS2:ERG and PCA3 with serum PSA to predict diagnosis of prostate cancer. Urol Oncol.

Skog, J., T. Wurdinger, S. van Rijn, D.H. Meijer, L. Gainche, M. Sena-Esteves, W.T. Curry, Jr., B.S. Carter, A.M. Krichevsky, and X.O. Breakefield. 2008. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10:1470-6.

Steemers, F.J., W. Chang, G. Lee, D.L. Barker, R. Shen, and K.L. Gunderson. 2006. Whole-genome genotyping with the single-base extension assay. Nat Methods. 3:31-3.

Taylor, D.D., and C. Gercel-Taylor. 2008. MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecol Oncol. 110:13-21.

Ting, D.T., D. Lipson, S. Paul, B.W. Brannigan, S. Akhavanfard, E.J. Coffman, G. Contino, V. Deshpande, A.J. Iafrate, S. Letovsky, M.N. Rivera, N. Bardeesy, S. Maheswaran, and D.A. Haber. 2011. Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers. Science. 331:593-6.

Tomlins, S.A., S.M. Aubin, J. Siddiqui, R.J. Lonigro, L. Sefton-Miller, S. Miick, S. Williamsen, P. Hodge, J. Meinke, A. Blase, Y. Penabella, J.R. Day, R. Varambally, B. Han, D. Wood, L. Wang, M.G. Sanda, M.A. Rubin, D.R. Rhodes, B. Hollenbeck, K. Sakamoto, J.L. Silberstein, Y. Fradet, J.B. Amberson, S. Meyers, N. Palanisamy, H. Rittenhouse, J.T. Wei, J. Groskopf, and A.M. Chinnaiyan. 2011. Urine TMPRSS2:ERG Fusion Transcript Stratifies Prostate Cancer Risk in Men with Elevated Serum PSA. Sci Transl Med. 3:94ra72.

Tomlins, S.A., D.R. Rhodes, S. Perner, S.M. Dhanasekaran, R. Mehra, X.W. Sun, S. Varambally, X. Cao, J. Tchinda, R. Kuefer, C. Lee, J.E. Montie, R.B. Shah, K.J. Pienta, M.A. Rubin, and A.M. Chinnaiyan. 2005. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 310:644-8.

Velculescu, V.E., L. Zhang, B. Vogelstein, and K.W. Kinzler. 1995. Serial analysis of gene expression. Science. 270:484-7.

Went, P.T., A. Lugli, S. Meier, M. Bundi, M. Mirlacher, G. Sauter, and S. Dirnhofer. 2004. Frequent EpCam protein expression in human carcinomas. Hum Pathol. 35:122-8.

Wong, M.L., and J.F. Medrano. 2005. Real-time PCR for mRNA quantitation. Biotechniques. 39:75-85.

Zhang, M., D.E. Latham, M.A. Delaney, and A. Chakravarti. 2005. Survivin mediates resistance to antiandrogen therapy in prostate cancer. Oncogene. 24:2474-82.

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> Exosome Diagnostics, Inc.

<120> КОГОРТА БИОМАРКЕРОВ МОЧИ, ПРОФИЛЬ ЭКСПРЕССИИ ГЕНОВ И СПОСОБЫ ИХ

ПРИМЕНЕНИЯ

<130> EXOS-016/001WO 322142-2117

<140> PCT/US2014/049946

<141> 2014-08-06

<150> US 61/862630

<151> 2013-08-06

<160> 44

<170> PatentIn version 3.5

<210> 1

<211> 543

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная Q бета частица

<400> 1

aaacggttct tgtgacccat ccgttactcg ccaggcatat gctgacgtga ccttttcgtt 60

cacgcagtat agtaccgatg aggaacgagc ttttgttcgt acagagcttg ctgctctgct 120

cgctagtcct agcgtcctca gttagatcct tatcagattc ttggaccaac aagtagccgc 180

cttgcaaatc caggcagtgg ccagatccag ctttggcagt tcctcctgga gctcctgtcg 240

gacagctccc ggtcggatgt gctgctggag cccttccgcc gcggtgtcat ggagaaactc 300

cagctgggcc cagagattct gcagcgggaa aacctgtccg tgacgtggat tggtgctgca 360

cccctcatcc tgtctcggat tgtgggaggc tgggagtgcg agaagcattc ccaaccctgg 420

caggtgcttg tggcctctcg tggcagggca gtctgcggcg gtgttctggt gcacccccag 480

tgggtcctca cagctgccca ctgcatcagg aacaaaagcg tgatcttgct gggtcggcac 540

agc 543

<210> 2

<211> 300

<212> ДНК

<213> Homo sapiens

<400> 2

cagtcgaaag ctgctcaacc atctccttcc acagtgccca aaactgaaga ccagcgtcct 60

cagttagatc cttatcagat tcttggacca acaagtagcc gccttgcaaa tccaggcagt 120

ggccagatcc agctttggca gttcctcctg gagctcctgt cggacagctc caactccagc 180

tgcatcacct gggaaggcac caacggggag ttcaagatga cggatcccga cgaggtggcc 240

cggcgctggg gagagcggaa gagcaaaccc aacatgaact acgataagct cagccgcgcc 300

<210> 3

<211> 386

<212> РНК

<213> Homo sapiens

<400> 3

gggagacgaa gggccccaga gcagccgagc ggccgccagg gaggaacgca gaacgcccag 60

ccccaggaca cagggcggac accacgacgg caccgagacc aggcagcaaa gaaagacaca 120

gacaccaagg cagggggaga aaaagaaagg cgcgacacca cgaggccaca cacgcgaaag 180

gagaaaaaca cacagaaaca gcaagagaca aaaagcaaga ggacaggcac accagcccca 240

aaaccacaca cacaggaagc acaaaaggaa gcacagagac ccgggagaaa gcccggccac 300

cgcggccgca agcggaccga accgggaaag accgccacaa ccacacaaca acgagccgga 360

agcaaaagga aagccggggg ccaaga 386

<210> 4

<211> 3352

<212> ДНК

<213> Homo sapiens

<400> 4

ggggcgtggc gccggggatt gggagggctt cttgcaggct gctgggctgg ggctaagggc 60

tgctcagttt ccttcagcgg ggcactggga agcgccatgg cactgcaggg catctcggtc 120

gtggagctgt ccggcctggc cccgggcccg ttctgtgcta tggtcctggc tgacttcggg 180

gcgcgtgtgg tacgcgtgga ccggcccggc tcccgctacg acgtgagccg cttgggccgg 240

ggcaagcgct cgctagtgct ggacctgaag cagccgcggg gagccgccgt gctgcggcgt 300

ctgtgcaagc ggtcggatgt gctgctggag cccttccgcc gcggtgtcat ggagaaactc 360

cagctgggcc cagagattct gcagcgggaa aatccaaggc ttatttatgc caggctgagt 420

ggatttggcc agtcaggaag cttctgccgg ttagctggcc acgatatcaa ctatttggct 480

ttgtcaggtg ttctctcaaa aattggcaga agtggtgaga atccgtatgc cccgctgaat 540

ctcctggctg actttgctgg tggtggcctt atgtgtgcac tgggcattat aatggctctt 600

tttgaccgca cacgcactgg caagggtcag gtcattgatg caaatatggt ggaaggaaca 660

gcatatttaa gttcttttct gtggaaaact cagaaattga gtctgtggga agcacctcga 720

ggacagaaca tgttggatgg tggagcacct ttctatacga cttacaggac agcagatggg 780

gaattcatgg ctgttggagc aatagaaccc cagttctacg agctgctgat caaaggactt 840

ggactaaagt ctgatgaact tcccaatcag atgagcatgg atgattggcc agaaatgaag 900

aagaagtttg cagatgtatt tgcagagaag acgaaggcag agtggtgtca aatctttgac 960

ggcacagatg cctgtgtgac tccggttctg acttttgagg aggttgttca tcatgatcac 1020

aacaaggaac ggggctcgtt tatcaccagt gaggagcagg acgtgagccc ccgccctgca 1080

cctctgctgt taaacacccc agccatccct tctttcaaaa gggatccttt cataggagaa 1140

cacactgagg agatacttga agaatttgga ttcagccgcg aagagattta tcagcttaac 1200

tcagataaaa tcattgaaag taataaggta aaagctagtc tctaacttcc aggcccacgg 1260

ctcaagtgaa tttgaatact gcatttacag tgtagagtaa cacataacat tgtatgcatg 1320

gaaacatgga ggaacagtat tacagtgtcc taccactcta atcaagaaaa gaattacaga 1380

ctctgattct acagtgatga ttgaattcta aaaatggtta tcattagggc ttttgattta 1440

taaaactttg ggtacttata ctaaattatg gtagttattc tgccttccag tttgcttgat 1500

atatttgttg atattaagat tcttgactta tattttgaat gggttctagt gaaaaaggaa 1560

tgatatattc ttgaagacat cgatatacat ttatttacac tcttgattct acaatgtaga 1620

aaatgaggaa atgccacaaa ttgtatggtg ataaaagtca cgtgaaacag agtgattggt 1680

tgcatccagg ccttttgtct tggtgttcat gatctccctc taagcacatt ccaaacttta 1740

gcaacagtta tcacactttg taatttgcaa agaaaagttt cacctgtatt gaatcagaat 1800

gccttcaact gaaaaaaaca tatccaaaat aatgaggaaa tgtgttggct cactacgtag 1860

agtccagagg gacagtcagt tttagggttg cctgtatcca gtaactcggg gcctgtttcc 1920

ccgtgggtct ctgggctgtc agctttcctt tctccatgtg tttgatttct cctcaggctg 1980

gtagcaagtt ctggatctta tacccaacac acagcaacat ccagaaataa agatctcagg 2040

accccccagc aagtcgtttt gtgtctcctt ggactgagtt aagttacaag cctttcttat 2100

acctgtcttt gacaaagaag acgggattgt ctttacataa aaccagcctg ctcctggagc 2160

ttccctggac tcaacttcct aaaggcatgt gaggaagggg tagattccac aatctaatcc 2220

gggtgccatc agagtagagg gagtagagaa tggatgttgg gtaggccatc aataaggtcc 2280

attctgcgca gtatctcaac tgccgttcaa caatcgcaag aggaaggtgg agcaggtttc 2340

ttcatcttac agttgagaaa acagagactc agaagggctt cttagttcat gtttccctta 2400

gcgcctcagt gattttttca tggtggctta ggccaaaaga aatatctaac cattcaattt 2460

ataaataatt aggtccccaa cgaattaaat attatgtcct accaacttat tagctgcttg 2520

aaaaatataa tacacataaa taaaaaaata tatttttcat ttctatttca ttgttaatca 2580

caactactta ctaaggagat gtatgcacct attggacact gtgcaacttc tcacctggaa 2640

tgagattgga cactgctgcc ctcattttct gctccatgtt ggtgtccata tagtacttga 2700

ttttttatca gatggcctgg aaaacccagt ctcacaaaaa tatgaaatta tcagaaggat 2760

tatagtgcaa tcttatgttg aaagaatgaa ctacctcact agtagttcac gtgatgtctg 2820

acagatgttg agtttcattg tgtttgtgtg ttcaaatttt taaatattct gagatactct 2880

tgtgaggtca ctctaatgcc ctgggtgcct tggcacagtt ttagaaatac cagttgaaaa 2940

tatttgctca ggaatatgca actaggaagg ggcagaatca gaatttaagc tttcatattc 3000

tagccttcag tcttgttctt caaccatttt taggaacttt cccataaggt tatgttttcc 3060

agcccaggca tggaggatca cttgaggcca agagttcgag accagcctgg ggaacttggc 3120

tggacctccg tttctacgaa ataaaaataa aaaaattatc caggtatggt ggtgtgtgcc 3180

tgtagtccta tctactcaag ggtggggcag gaggatcact tgagcccagg aatttgaggc 3240

cacagtgaat taggattgca ccactgcact ctagcccagg caacagaaca agaacctgtc 3300

tctaaataaa taaataaaaa taataataat aaaaaagatg ttttccctac aa 3352

<210> 5

<211> 2655

<212> ДНК

<213> Homo sapiens

<400> 5

cccagaaggc cgcggggggt ggaccgccta agagggcgtg cgctcccgac atgccccgcg 60

gcgcgccatt aaccgccaga tttgaatcgc gggacccgtt ggcagaggtg gcggcggcgg 120

catgggtgcc ccgacgttgc cccctgcctg gcagcccttt ctcaaggacc accgcatctc 180

tacattcaag aactggccct tcttggaggg ctgcgcctgc accccggagc ggatggccga 240

ggctggcttc atccactgcc ccactgagaa cgagccagac ttggcccagt gtttcttctg 300

cttcaaggag ctggaaggct gggagccaga tgacgacccc atagaggaac ataaaaagca 360

ttcgtccggt tgcgctttcc tttctgtcaa gaagcagttt gaagaattaa cccttggtga 420

atttttgaaa ctggacagag aaagagccaa gaacaaaatt gcaaaggaaa ccaacaataa 480

gaagaaagaa tttgaggaaa ctgcggagaa agtgcgccgt gccatcgagc agctggctgc 540

catggattga ggcctctggc cggagctgcc tggtcccaga gtggctgcac cacttccagg 600

gtttattccc tggtgccacc agccttcctg tgggcccctt agcaatgtct taggaaagga 660

gatcaacatt ttcaaattag atgtttcaac tgtgctcttg ttttgtcttg aaagtggcac 720

cagaggtgct tctgcctgtg cagcgggtgc tgctggtaac agtggctgct tctctctctc 780

tctctctttt ttgggggctc atttttgctg ttttgattcc cgggcttacc aggtgagaag 840

tgagggagga agaaggcagt gtcccttttg ctagagctga cagctttgtt cgcgtgggca 900

gagccttcca cagtgaatgt gtctggacct catgttgttg aggctgtcac agtcctgagt 960

gtggacttgg caggtgcctg ttgaatctga gctgcaggtt ccttatctgt cacacctgtg 1020

cctcctcaga ggacagtttt tttgttgttg tgtttttttg tttttttttt tttggtagat 1080

gcatgacttg tgtgtgatga gagaatggag acagagtccc tggctcctct actgtttaac 1140

aacatggctt tcttattttg tttgaattgt taattcacag aatagcacaa actacaatta 1200

aaactaagca caaagccatt ctaagtcatt ggggaaacgg ggtgaacttc aggtggatga 1260

ggagacagaa tagagtgata ggaagcgtct ggcagatact ccttttgcca ctgctgtgtg 1320

attagacagg cccagtgagc cgcggggcac atgctggccg ctcctccctc agaaaaaggc 1380

agtggcctaa atccttttta aatgacttgg ctcgatgctg tgggggactg gctgggctgc 1440

tgcaggccgt gtgtctgtca gcccaacctt cacatctgtc acgttctcca cacgggggag 1500

agacgcagtc cgcccaggtc cccgctttct ttggaggcag cagctcccgc agggctgaag 1560

tctggcgtaa gatgatggat ttgattcgcc ctcctccctg tcatagagct gcagggtgga 1620

ttgttacagc ttcgctggaa acctctggag gtcatctcgg ctgttcctga gaaataaaaa 1680

gcctgtcatt tcaaacactg ctgtggaccc tactgggttt ttaaaatatt gtcagttttt 1740

catcgtcgtc cctagcctgc caacagccat ctgcccagac agccgcagtg aggatgagcg 1800

tcctggcaga gacgcagttg tctctgggcg cttgccagag ccacgaaccc cagacctgtt 1860

tgtatcatcc gggctccttc cgggcagaaa caactgaaaa tgcacttcag acccacttat 1920

ttctgccaca tctgagtcgg cctgagatag acttttccct ctaaactggg agaatatcac 1980

agtggttttt gttagcagaa aatgcactcc agcctctgta ctcatctaag ctgcttattt 2040

ttgatatttg tgtcagtctg taaatggata cttcacttta ataactgttg cttagtaatt 2100

ggctttgtag agaagctgga aaaaaatggt tttgtcttca actcctttgc atgccaggcg 2160

gtgatgtgga tctcggcttc tgtgagcctg tgctgtgggc agggctgagc tggagccgcc 2220

cctctcagcc cgcctgccac ggcctttcct taaaggccat ccttaaaacc agaccctcat 2280

ggctaccagc acctgaaagc ttcctcgaca tctgttaata aagccgtagg cccttgtcta 2340

agtgcaaccg cctagacttt ctttcagata catgtccaca tgtccatttt tcaggttctc 2400

taagttggag tggagtctgg gaagggttgt gaatgaggct tctgggctat gggtgaggtt 2460

ccaatggcag gttagagccc ctcgggccaa ctgccatcct ggaaagtaga gacagcagtg 2520

cccgctgccc agaagagacc agcaagccaa actggagccc ccattgcagg ctgtcgccat 2580

gtggaaagag taactcacaa ttgccaataa agtctcatgt ggttttatct aaaaaaaaaa 2640

aaaaaaaaaa aaaaa 2655

<210> 6

<211> 1681

<212> ДНК

<213> Homo sapiens

<400> 6

ttttgtctgt cctggattgg agccgtccct ataaccatct agttccgagt acaaactgga 60

gacagaaata aatattaaag aaatcataga ccgaccaggt aaaggcaaag ggatgaattc 120

ctacttcact aacccttcct tatcctgcca cctcgccggg ggccaggacg tcctccccaa 180

cgtcgccctc aattccaccg cctatgatcc agtgaggcat ttctcgacct atggagcggc 240

cgttgcccag aaccggatct actcgactcc cttttattcg ccacaggaga atgtcgtgtt 300

cagttccagc cgggggccgt atgactatgg atctaattcc ttttaccagg agaaagacat 360

gctctcaaac tgcagacaaa acaccttagg acataacaca cagacctcaa tcgctcagga 420

ttttagttct gagcagggca ggactgcgcc ccaggaccag aaagccagta tccagattta 480

cccctggatg cagcgaatga attcgcacag tggggtcggc tacggagcgg accggaggcg 540

cggccgccag atctactcgc ggtaccagac cctggaactg gagaaggaat ttcacttcaa 600

tcgctaccta acgcggcgcc ggcgcatcga gatcgccaac gcgctttgcc tgaccgagcg 660

acagatcaaa atctggttcc agaaccgccg gatgaagtgg aaaaaagaat ctaatctcac 720

atccactctc tcggggggcg gcggaggggc caccgccgac agcctgggcg gaaaagagga 780

aaagcgggaa gagacagaag aggagaagca gaaagagtga ccaggactgt ccctgccacc 840

cctctctccc tttctccctc gctccccacc aactctcccc taatcacaca ctctgtattt 900

atcactggca caattgatgt gttttgattc cctaaaacaa aattagggag tcaaacgtgg 960

acctgaaagt cagctctgga ccccctccct caccgcacaa ctctctttca ccacgcgcct 1020

cctcctcctc gctcccttgc tagctcgttc tcggcttgtc tacaggccct tttccccgtc 1080

caggccttgg gggctcggac cctgaactca gactctacag attgccctcc aagtgaggac 1140

ttggctcccc cactccttcg acgcccccac ccccgccccc cgtgcagaga gccggctcct 1200

gggcctgctg gggcctctgc tccagggcct cagggcccgg cctggcagcc ggggagggcc 1260

ggaggcccaa ggagggcgcg ccttggcccc acaccaaccc ccagggcctc cccgcagtcc 1320

ctgcctagcc cctctgcccc agcaaatgcc cagcccaggc aaattgtatt taaagaatcc 1380

tgggggtcat tatggcattt tacaaactgt gaccgtttct gtgtgaagat ttttagctgt 1440

atttgtggtc tctgtattta tatttatgtt tagcaccgtc agtgttccta tccaatttca 1500

aaaaaggaaa aaaaagaggg aaaattacaa aaagagagaa aaaaagtgaa tgacgtttgt 1560

ttagccagta ggagaaaata aataaataaa taaatccctt cgtgttaccc tcctgtataa 1620

atccaacctc tgggtccgtt ctcgaatatt taataaaact gatattattt ttaaaacttt 1680

a 1681

<210> 7

<211> 3012

<212> ДНК

<213> Homo sapiens

<400> 7

aaaaatgcat aaagagccaa gtgcttatat tctggccaag ttatgaggct ctgagaacaa 60

gagcttgagg ggaagactgt taaccccatc cacgccacca gaattagctc tttccctttt 120

ggtttgcaag cactgcctgt aaagccctcg catgagaggc cagcctgcta gggaaatcca 180

ggaatctgca acaaaaacga tgacagtctg aaatactctc tggtgccaac ctccaaattc 240

tcgtctgtca cttcagaccc ccactagttg acagagcagc agaatttcaa ctccagtaga 300

cttgaatatg cctctgggca aagaagcaga gctaacgagg aaagggattt aaagagtttt 360

tcttgggtgt ttgtcaaact tttattccct gtctgtgtgc agaggggatt caacttcaat 420

ttttctgcag tggctctggg tccagcccct tacttaaagg ccataagatg ttttattgaa 480

agaaactttc aatatcaagt aatccaacca accttctaag ataagccttt tccttcaaca 540

caaagaagtg cattttgcca aatctggaaa gcatgaagac tgggcttttt ttcctatgtc 600

tcttgggaac tgcagctgca atcccgacaa atgcaagatt attatctgat cattccaaac 660

caactgctga aacggtagca cctgacaaca ctgcaatccc cagtttaagg gctgaagctg 720

aagaaaatga aaaagaaaca gcagtatcca cagaagacga ttcccaccat aaggctgaaa 780

aatcatcagt actaaagtca aaagaggaaa gccatgaaca gtcagcagaa cagggcaaga 840

gttctagcca agagctggga ttgaaggatc aagaggacag tgatggtcac ttaagtgtga 900

atttggagta tgcaccaact gaaggtacat tggacataaa agaagatatg agtgagcctc 960

aggagaaaaa actctcagag aacactgatt ttttggctcc tggtgttagt tccttcacag 1020

attctaacca acaagaaagt atcacaaaga gagaggaaaa ccaagaacaa cctagaaatt 1080

attcacatca tcagttgaac aggagcagta aacatagcca aggcctaagg gatcaaggaa 1140

accaagagca ggatccaaat atttccaatg gagaagagga agaagaaaaa gagccaggtg 1200

aagttggtac ccacaatgat aaccaagaaa gaaagacaga attgcccagg gagcatgcta 1260

acagcaagca ggaggaagac aatacccaat ctgatgatat tttggaagag tctgatcaac 1320

caactcaagt aagcaagatg caggaggatg aatttgatca gggtaaccaa gaacaagaag 1380

ataactccaa tgcagaaatg gaagaggaaa atgcatcgaa cgtcaataag cacattcaag 1440

aaactgaatg gcagagtcaa gagggtaaaa ctggcctaga agctatcagc aaccacaaag 1500

agacagaaga aaagactgtt tctgaggctc tgctcatgga acctactgat gatggtaata 1560

ccacgcccag aaatcatgga gttgatgatg atggcgatga tgatggcgat gatggcggca 1620

ctgatggccc caggcacagt gcaagtgatg actacttcat cccaagccag gcctttctgg 1680

aggccgagag agctcaatcc attgcctatc acctcaaaat tgaggagcaa agagaaaaag 1740

tacatgaaaa tgaaaatata ggtaccactg agcctggaga gcaccaagag gccaagaaag 1800

cagagaactc atcaaatgag gaggaaacgt caagtgaagg caacatgagg gtgcatgctg 1860

tggattcttg catgagcttc cagtgtaaaa gaggccacat ctgtaaggca gaccaacagg 1920

gaaaacctca ctgtgtctgc caggatccag tgacttgtcc tccaacaaaa ccccttgatc 1980

aagtttgtgg cactgacaat cagacctatg ctagttcctg tcatctattc gctactaaat 2040

gcagactgga ggggaccaaa aaggggcatc aactccagct ggattatttt ggagcctgca 2100

aatctattcc tacttgtacg gactttgaag tgattcagtt tcctctacgg atgagagact 2160

ggctcaagaa tatcctcatg cagctttatg aagccaactc tgaacacgct ggttatctaa 2220

atgagaagca gagaaataaa gtcaagaaaa tttacctgga tgaaaagagg cttttggctg 2280

gggaccatcc cattgatctt ctcttaaggg actttaagaa aaactaccac atgtatgtgt 2340

atcctgtgca ctggcagttt agtgaacttg accaacaccc tatggataga gtcttgacac 2400

attctgaact tgctcctctg cgagcatctc tggtgcccat ggaacactgc ataacccgtt 2460

tctttgagga gtgtgacccc aacaaggata agcacatcac cctgaaggag tggggccact 2520

gctttggaat taaagaagag gacatagatg aaaatctctt gttttgaacg aagattttaa 2580

agaactcaac tttccagcat cctcctctgt tctaaccact tcagaaatat atgcagctgt 2640

gatacttgta gatttatatt tagcaaaatg ttagcatgta tgacaagaca atgagagtaa 2700

ttgcttgaca acaacctatg caccaggtat ttaacattaa ctttggaaac aaaaatgtac 2760

aattaagtaa agtcaacata tgcaaaatac tgtacattgt gaacagaagt ttaattcata 2820

gtaatttcac tctctgcatt gacttatgag ataattaatg attaaactat taatgataaa 2880

aataatgcat ttgtattgtt cataatatca tgtgcacttc aagaaaatgg aatgctactc 2940

ttttgtggtt tacgtgtatt attttcaata tcttaatacc ctaataaaga gtccataaaa 3000

atccaaatgc tt 3012

<210> 8

<211> 300

<212> ДНК

<213> Homo sapiens

<400> 8

ttgtcttcct caccctgtcc gtgacgtgga ttggtgctgc acccctcatc ctgtctcgga 60

ttgtgggagg ctgggagtgc gagaagcatt cccaaccctg gcaggtgctt gtggcctctc 120

gtggcagggc agtctgcggc ggtgttctgg tgcaccccca gtgggtcctc acagctgccc 180

actgcatcag gaacaaaagc gtgatcttgc tgggtcggca cagcctgttt catcctgaag 240

acacaggcca ggtatttcag gtcagccaca gcttcccaca cccgctctac gatatgagcc 300

<210> 9

<211> 586

<212> РНК

<213> Homo sapiens

<400> 9

gggagacgaa gggccccaga gcagccgagc ggccgccagg gaggaacgca gaacgcccaa 60

agaggacagg cacaccagcc ccaaaaccac acacacagga agcacaaaag gaagcacaga 120

gacccgggag aaagcccggc ccggggggga ggcgcacgcc caccggacac ggaagcagcg 180

gccggagaaa gagcggacca ccggggcgac acacaaacgg aaagcagaag acgggcccag 240

ccgggaacgc agcgcaaccc gacaaagcaa gaaacgacac caaaccaacg cgaaacggag 300

caccaggccc agaaacggac gaggacagca ccaagggcaa gacgaagacc aagaacgaaa 360

aggaagccac aaaccgaaac acagggcagg gacaggcaaa aggaccaccg caccacacaa 420

gaacggcccc ggagggcgcg ccgcaccccg gagcggaggc cgaggcggcc accacgcccc 480

acgagaacga gccagacgac cgcggccgca agcggaccga accgggaaag accgccacaa 540

ccacacaaca acgagccgga agcaaaagga aagccggggg ccaaga 586

<210> 10

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 10

ccacctggac atctggaag 19

<210> 11

<211> 18

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 11

aatcgcccca ggtgaagt 18

<210> 12

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (19)..(19)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 12

cggcctggat gaaagagcg 19

<210> 13

<211> 25

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 13

gcgtcctcag ttagatcctt atcag 25

<210> 14

<211> 18

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 14

ctggccactg cctggatt 18

<210> 15

<211> 26

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (26)..(26)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 15

cttggaccaa caagtagccg ccttgc 26

<210> 16

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 16

gcacatttcc agccccttta 20

<210> 17

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 17

ggcatttctc ccagggatct 20

<210> 18

<211> 24

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (24)..(24)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 18

cacacaggaa gcacaaaagg aagc 24

<210> 19

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 19

aacggttctt gtgacccatc 20

<210> 20

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 20

cgaacaaaag ctcgttcctc 20

<210> 21

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (21)..(21)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 21

cgccaggcat atgctgacgt g 21

<210> 22

<211> 18

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 22

cctgtccgtg acgtggat 18

<210> 23

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 23

cagggttggg aatgcttct 19

<210> 24

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (20)..(20)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 24

cggattgtgg gaggctggga 20

<210> 25

<211> 16

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 25

gcctggagcg cggcag 16

<210> 26

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 26

gcacactcaa acaacgactg 20

<210> 27

<211> 25

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (25)..(25)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 27

agccttatca gttgtgagtg aggac 25

<210> 28

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 28

gccgcggtgt catgg 15

<210> 29

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 29

tttcccgctg cagaatctc 19

<210> 30

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<400> 30

agaaactcca gctgggccca 20

<210> 31

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 31

ggaccaccgc atctctacat 20

<210> 32

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 32

gtctggctcg ttctcagtgg 20

<210> 33

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (20)..(20)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 33

cttcttggag ggctgcgcct 20

<210> 34

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 34

tctggaaagc atgaagactg g 21

<210> 35

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность праймера

<400> 35

tgctaccgtt tcagcagttg 20

<210> 36

<211> 20

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Химически синтезированная последовательность зонда

<220>

<221> misc_feature

<222> (1)..(1)

<223> конъюгирована с 5' 6-FAM

<220>

<221> misc_feature

<222> (9)..(10)

<223> внутренний ZEN гаситель

<220>

<221> misc_feature

<222> (20)..(20)

<223> конъюгирована с 3' Iowa Black(r) FQ

<400> 36

ctgcagctgc aatcccgaca 20

<210> 37

<211> 3191

<212> ДНК

<213> Homo sapiens

<400> 37

ggggcgtggc gccggggatt gggagggctt cttgcaggct gctgggctgg ggctaagggc 60

tgctcagttt ccttcagcgg ggcactggga agcgccatgg cactgcaggg catctcggtc 120

gtggagctgt ccggcctggc cccgggcccg ttctgtgcta tggtcctggc tgacttcggg 180

gcgcgtgtgg tacgcgtgga ccggcccggc tcccgctacg acgtgagccg cttgggccgg 240

ggcaagcgct cgctagtgct ggacctgaag cagccgcggg gagccgccgt gctgcggcgt 300

ctgtgcaagc ggtcggatgt gctgctggag cccttccgcc gcggtgtcat ggagaaactc 360

cagctgggcc cagagattct gcagcgggaa aatccaaggc ttatttatgc caggctgagt 420

ggatttggcc agtcaggaag cttctgccgg ttagctggcc acgatatcaa ctatttggct 480

ttgtcaggtg gaaggaacag catatttaag ttcttttctg tggaaaactc agaaattgag 540

tctgtgggaa gcacctcgag gacagaacat gttggatggt ggagcacctt tctatacgac 600

ttacaggaca gcagatgggg aattcatggc tgttggagca atagaacccc agttctacga 660

gctgctgatc aaaggacttg gactaaagtc tgatgaactt cccaatcaga tgagcatgga 720

tgattggcca gaaatgaaga agaagtttgc agatgtattt gcagagaaga cgaaggcaga 780

gtggtgtcaa atctttgacg gcacagatgc ctgtgtgact ccggttctga cttttgagga 840

ggttgttcat catgatcaca acaaggaacg gggctcgttt atcaccagtg aggagcagga 900

cgtgagcccc cgccctgcac ctctgctgtt aaacacccca gccatccctt ctttcaaaag 960

ggatcctttc ataggagaac acactgagga gatacttgaa gaatttggat tcagccgcga 1020

agagatttat cagcttaact cagataaaat cattgaaagt aataaggtaa aagctagtct 1080

ctaacttcca ggcccacggc tcaagtgaat ttgaatactg catttacagt gtagagtaac 1140

acataacatt gtatgcatgg aaacatggag gaacagtatt acagtgtcct accactctaa 1200

tcaagaaaag aattacagac tctgattcta cagtgatgat tgaattctaa aaatggttat 1260

cattagggct tttgatttat aaaactttgg gtacttatac taaattatgg tagttattct 1320

gccttccagt ttgcttgata tatttgttga tattaagatt cttgacttat attttgaatg 1380

ggttctagtg aaaaaggaat gatatattct tgaagacatc gatatacatt tatttacact 1440

cttgattcta caatgtagaa aatgaggaaa tgccacaaat tgtatggtga taaaagtcac 1500

gtgaaacaga gtgattggtt gcatccaggc cttttgtctt ggtgttcatg atctccctct 1560

aagcacattc caaactttag caacagttat cacactttgt aatttgcaaa gaaaagtttc 1620

acctgtattg aatcagaatg ccttcaactg aaaaaaacat atccaaaata atgaggaaat 1680

gtgttggctc actacgtaga gtccagaggg acagtcagtt ttagggttgc ctgtatccag 1740

taactcgggg cctgtttccc cgtgggtctc tgggctgtca gctttccttt ctccatgtgt 1800

ttgatttctc ctcaggctgg tagcaagttc tggatcttat acccaacaca cagcaacatc 1860

cagaaataaa gatctcagga ccccccagca agtcgttttg tgtctccttg gactgagtta 1920

agttacaagc ctttcttata cctgtctttg acaaagaaga cgggattgtc tttacataaa 1980

accagcctgc tcctggagct tccctggact caacttccta aaggcatgtg aggaaggggt 2040

agattccaca atctaatccg ggtgccatca gagtagaggg agtagagaat ggatgttggg 2100

taggccatca ataaggtcca ttctgcgcag tatctcaact gccgttcaac aatcgcaaga 2160

ggaaggtgga gcaggtttct tcatcttaca gttgagaaaa cagagactca gaagggcttc 2220

ttagttcatg tttcccttag cgcctcagtg attttttcat ggtggcttag gccaaaagaa 2280

atatctaacc attcaattta taaataatta ggtccccaac gaattaaata ttatgtccta 2340

ccaacttatt agctgcttga aaaatataat acacataaat aaaaaaatat atttttcatt 2400

tctatttcat tgttaatcac aactacttac taaggagatg tatgcaccta ttggacactg 2460

tgcaacttct cacctggaat gagattggac actgctgccc tcattttctg ctccatgttg 2520

gtgtccatat agtacttgat tttttatcag atggcctgga aaacccagtc tcacaaaaat 2580

atgaaattat cagaaggatt atagtgcaat cttatgttga aagaatgaac tacctcacta 2640

gtagttcacg tgatgtctga cagatgttga gtttcattgt gtttgtgtgt tcaaattttt 2700

aaatattctg agatactctt gtgaggtcac tctaatgccc tgggtgcctt ggcacagttt 2760

tagaaatacc agttgaaaat atttgctcag gaatatgcaa ctaggaaggg gcagaatcag 2820

aatttaagct ttcatattct agccttcagt cttgttcttc aaccattttt aggaactttc 2880

ccataaggtt atgttttcca gcccaggcat ggaggatcac ttgaggccaa gagttcgaga 2940

ccagcctggg gaacttggct ggacctccgt ttctacgaaa taaaaataaa aaaattatcc 3000

aggtatggtg gtgtgtgcct gtagtcctat ctactcaagg gtggggcagg aggatcactt 3060

gagcccagga atttgaggcc acagtgaatt aggattgcac cactgcactc tagcccaggc 3120

aacagaacaa gaacctgtct ctaaataaat aaataaaaat aataataata aaaaagatgt 3180

tttccctaca a 3191

<210> 38

<211> 2603

<212> ДНК

<213> Homo sapiens

<400> 38

ggggcgtggc gccggggatt gggagggctt cttgcaggct gctgggctgg ggctaagggc 60

tgctcagttt ccttcagcgg ggcactggga agcgccatgg cactgcaggg catctcggtc 120

gtggagctgt ccggcctggc cccgggcccg ttctgtgcta tggtcctggc tgacttcggg 180

gcgcgtgtgg tacgcgtgga ccggcccggc tcccgctacg acgtgagccg cttgggccgg 240

ggcaagcgct cgctagtgct ggacctgaag cagccgcggg gagccgccgt gctgcggcgt 300

ctgtgcaagc ggtcggatgt gctgctggag cccttccgcc gcggtgtcat ggagaaactc 360

cagctgggcc cagagattct gcagcgggaa aatccaaggc ttatttatgc caggctgagt 420

ggatttggcc agtcaggaag cttctgccgg ttagctggcc acgatatcaa ctatttggct 480

ttgtcaggtg ttctctcaaa aattggcaga agtggtgaga atccgtatgc cccgctgaat 540

ctcctggctg actttgctgg tggtggcctt atgtgtgcac tgggcattat aatggctctt 600

tttgaccgca cacgcactgg caagggtcag gtcattgatg caaatatggt ggaaggaaca 660

gcatatttaa gttcttttct gtggaaaact cagaaattga gtctgtggga agcacctcga 720

ggacagaaca tgttggatgg tggagcacct ttctatacga cttacaggac agcagatggg 780

gaattcatgg ctgttggagc aatagaaccc cagttctacg agctgctgat caaaggactt 840

ggactaaagt ctgatgaact tcccaatcag atgagcatgg atgattggcc agaaatgaag 900

aagaagtttg cagatgtatt tgcagagaag acgaaggcag agtggtgtca aatctttgac 960

ggcacagatg cctgtgtgac tccggttctg acttttgagg aggttgttca tcatgatcac 1020

aacaaggaac ggggctcgtt tatcaccagt gaggagcagg acgtgagccc ccgccctgca 1080

cctctgctgt taaacacccc agccatccct tctttcaaaa gggatccttt cataggagaa 1140

cacactgagg agatacttga agaatttgga ttcagccgcg aagagattta tcagcttaac 1200

tcagataaaa tcattgaaag taataaggct ggtagcaagt tctggatctt atacccaaca 1260

cacagcaaca tccagaaata aagatctcag gaccccccag caagtcgttt tgtgtctcct 1320

tggactgagt taagttacaa gcctttctta tacctgtctt tgacaaagaa gacgggattg 1380

tctttacata aaaccagcct gctcctggag cttccctgga ctcaacttcc taaaggcatg 1440

tgaggaaggg gtagattcca caatctaatc cgggtgccat cagagtagag ggagtagaga 1500

atggatgttg ggtaggccat caataaggtc cattctgcgc agtatctcaa ctgccgttca 1560

acaatcgcaa gaggaaggtg gagcaggttt cttcatctta cagttgagaa aacagagact 1620

cagaagggct tcttagttca tgtttccctt agcgcctcag tgattttttc atggtggctt 1680

aggccaaaag aaatatctaa ccattcaatt tataaataat taggtcccca acgaattaaa 1740

tattatgtcc taccaactta ttagctgctt gaaaaatata atacacataa ataaaaaaat 1800

atatttttca tttctatttc attgttaatc acaactactt actaaggaga tgtatgcacc 1860

tattggacac tgtgcaactt ctcacctgga atgagattgg acactgctgc cctcattttc 1920

tgctccatgt tggtgtccat atagtacttg attttttatc agatggcctg gaaaacccag 1980

tctcacaaaa atatgaaatt atcagaagga ttatagtgca atcttatgtt gaaagaatga 2040

actacctcac tagtagttca cgtgatgtct gacagatgtt gagtttcatt gtgtttgtgt 2100

gttcaaattt ttaaatattc tgagatactc ttgtgaggtc actctaatgc cctgggtgcc 2160

ttggcacagt tttagaaata ccagttgaaa atatttgctc aggaatatgc aactaggaag 2220

gggcagaatc agaatttaag ctttcatatt ctagccttca gtcttgttct tcaaccattt 2280

ttaggaactt tcccataagg ttatgttttc cagcccaggc atggaggatc acttgaggcc 2340

aagagttcga gaccagcctg gggaacttgg ctggacctcc gtttctacga aataaaaata 2400

aaaaaattat ccaggtatgg tggtgtgtgc ctgtagtcct atctactcaa gggtggggca 2460

ggaggatcac ttgagcccag gaatttgagg ccacagtgaa ttaggattgc accactgcac 2520

tctagcccag gcaacagaac aagaacctgt ctctaaataa ataaataaaa ataataataa 2580

taaaaaagat gttttcccta caa 2603

<210> 39

<211> 2537

<212> ДНК

<213> Homo sapiens

<400> 39

cccagaaggc cgcggggggt ggaccgccta agagggcgtg cgctcccgac atgccccgcg 60

gcgcgccatt aaccgccaga tttgaatcgc gggacccgtt ggcagaggtg gcggcggcgg 120

catgggtgcc ccgacgttgc cccctgcctg gcagcccttt ctcaaggacc accgcatctc 180

tacattcaag aactggccct tcttggaggg ctgcgcctgc accccggagc ggatggccga 240

ggctggcttc atccactgcc ccactgagaa cgagccagac ttggcccagt gtttcttctg 300

cttcaaggag ctggaaggct gggagccaga tgacgacccc atgcaaagga aaccaacaat 360

aagaagaaag aatttgagga aactgcggag aaagtgcgcc gtgccatcga gcagctggct 420

gccatggatt gaggcctctg gccggagctg cctggtccca gagtggctgc accacttcca 480

gggtttattc cctggtgcca ccagccttcc tgtgggcccc ttagcaatgt cttaggaaag 540

gagatcaaca ttttcaaatt agatgtttca actgtgctct tgttttgtct tgaaagtggc 600

accagaggtg cttctgcctg tgcagcgggt gctgctggta acagtggctg cttctctctc 660

tctctctctt ttttgggggc tcatttttgc tgttttgatt cccgggctta ccaggtgaga 720

agtgagggag gaagaaggca gtgtcccttt tgctagagct gacagctttg ttcgcgtggg 780

cagagccttc cacagtgaat gtgtctggac ctcatgttgt tgaggctgtc acagtcctga 840

gtgtggactt ggcaggtgcc tgttgaatct gagctgcagg ttccttatct gtcacacctg 900

tgcctcctca gaggacagtt tttttgttgt tgtgtttttt tgtttttttt tttttggtag 960

atgcatgact tgtgtgtgat gagagaatgg agacagagtc cctggctcct ctactgttta 1020

acaacatggc tttcttattt tgtttgaatt gttaattcac agaatagcac aaactacaat 1080

taaaactaag cacaaagcca ttctaagtca ttggggaaac ggggtgaact tcaggtggat 1140

gaggagacag aatagagtga taggaagcgt ctggcagata ctccttttgc cactgctgtg 1200

tgattagaca ggcccagtga gccgcggggc acatgctggc cgctcctccc tcagaaaaag 1260

gcagtggcct aaatcctttt taaatgactt ggctcgatgc tgtgggggac tggctgggct 1320

gctgcaggcc gtgtgtctgt cagcccaacc ttcacatctg tcacgttctc cacacggggg 1380

agagacgcag tccgcccagg tccccgcttt ctttggaggc agcagctccc gcagggctga 1440

agtctggcgt aagatgatgg atttgattcg ccctcctccc tgtcatagag ctgcagggtg 1500

gattgttaca gcttcgctgg aaacctctgg aggtcatctc ggctgttcct gagaaataaa 1560

aagcctgtca tttcaaacac tgctgtggac cctactgggt ttttaaaata ttgtcagttt 1620

ttcatcgtcg tccctagcct gccaacagcc atctgcccag acagccgcag tgaggatgag 1680

cgtcctggca gagacgcagt tgtctctggg cgcttgccag agccacgaac cccagacctg 1740

tttgtatcat ccgggctcct tccgggcaga aacaactgaa aatgcacttc agacccactt 1800

atttctgcca catctgagtc ggcctgagat agacttttcc ctctaaactg ggagaatatc 1860

acagtggttt ttgttagcag aaaatgcact ccagcctctg tactcatcta agctgcttat 1920

ttttgatatt tgtgtcagtc tgtaaatgga tacttcactt taataactgt tgcttagtaa 1980

ttggctttgt agagaagctg gaaaaaaatg gttttgtctt caactccttt gcatgccagg 2040

cggtgatgtg gatctcggct tctgtgagcc tgtgctgtgg gcagggctga gctggagccg 2100

cccctctcag cccgcctgcc acggcctttc cttaaaggcc atccttaaaa ccagaccctc 2160

atggctacca gcacctgaaa gcttcctcga catctgttaa taaagccgta ggcccttgtc 2220

taagtgcaac cgcctagact ttctttcaga tacatgtcca catgtccatt tttcaggttc 2280

tctaagttgg agtggagtct gggaagggtt gtgaatgagg cttctgggct atgggtgagg 2340

ttccaatggc aggttagagc ccctcgggcc aactgccatc ctggaaagta gagacagcag 2400

tgcccgctgc ccagaagaga ccagcaagcc aaactggagc ccccattgca ggctgtcgcc 2460

atgtggaaag agtaactcac aattgccaat aaagtctcat gtggttttat ctaaaaaaaa 2520

aaaaaaaaaa aaaaaaa 2537

<210> 40

<211> 2724

<212> ДНК

<213> Homo sapiens

<400> 40

cccagaaggc cgcggggggt ggaccgccta agagggcgtg cgctcccgac atgccccgcg 60

gcgcgccatt aaccgccaga tttgaatcgc gggacccgtt ggcagaggtg gcggcggcgg 120

catgggtgcc ccgacgttgc cccctgcctg gcagcccttt ctcaaggacc accgcatctc 180

tacattcaag aactggccct tcttggaggg ctgcgcctgc accccggagc ggatggccga 240

ggctggcttc atccactgcc ccactgagaa cgagccagac ttggcccagt gtttcttctg 300

cttcaaggag ctggaaggct gggagccaga tgacgacccc attgggccgg gcacggtggc 360

ttacgcctgt aataccagca ctttgggagg ccgaggcggg cggatcacga gagaggaaca 420

taaaaagcat tcgtccggtt gcgctttcct ttctgtcaag aagcagtttg aagaattaac 480

ccttggtgaa tttttgaaac tggacagaga aagagccaag aacaaaattg caaaggaaac 540

caacaataag aagaaagaat ttgaggaaac tgcggagaaa gtgcgccgtg ccatcgagca 600

gctggctgcc atggattgag gcctctggcc ggagctgcct ggtcccagag tggctgcacc 660

acttccaggg tttattccct ggtgccacca gccttcctgt gggcccctta gcaatgtctt 720

aggaaaggag atcaacattt tcaaattaga tgtttcaact gtgctcttgt tttgtcttga 780

aagtggcacc agaggtgctt ctgcctgtgc agcgggtgct gctggtaaca gtggctgctt 840

ctctctctct ctctcttttt tgggggctca tttttgctgt tttgattccc gggcttacca 900

ggtgagaagt gagggaggaa gaaggcagtg tcccttttgc tagagctgac agctttgttc 960

gcgtgggcag agccttccac agtgaatgtg tctggacctc atgttgttga ggctgtcaca 1020

gtcctgagtg tggacttggc aggtgcctgt tgaatctgag ctgcaggttc cttatctgtc 1080

acacctgtgc ctcctcagag gacagttttt ttgttgttgt gtttttttgt tttttttttt 1140

ttggtagatg catgacttgt gtgtgatgag agaatggaga cagagtccct ggctcctcta 1200

ctgtttaaca acatggcttt cttattttgt ttgaattgtt aattcacaga atagcacaaa 1260

ctacaattaa aactaagcac aaagccattc taagtcattg gggaaacggg gtgaacttca 1320

ggtggatgag gagacagaat agagtgatag gaagcgtctg gcagatactc cttttgccac 1380

tgctgtgtga ttagacaggc ccagtgagcc gcggggcaca tgctggccgc tcctccctca 1440

gaaaaaggca gtggcctaaa tcctttttaa atgacttggc tcgatgctgt gggggactgg 1500

ctgggctgct gcaggccgtg tgtctgtcag cccaaccttc acatctgtca cgttctccac 1560

acgggggaga gacgcagtcc gcccaggtcc ccgctttctt tggaggcagc agctcccgca 1620

gggctgaagt ctggcgtaag atgatggatt tgattcgccc tcctccctgt catagagctg 1680

cagggtggat tgttacagct tcgctggaaa cctctggagg tcatctcggc tgttcctgag 1740

aaataaaaag cctgtcattt caaacactgc tgtggaccct actgggtttt taaaatattg 1800

tcagtttttc atcgtcgtcc ctagcctgcc aacagccatc tgcccagaca gccgcagtga 1860

ggatgagcgt cctggcagag acgcagttgt ctctgggcgc ttgccagagc cacgaacccc 1920

agacctgttt gtatcatccg ggctccttcc gggcagaaac aactgaaaat gcacttcaga 1980

cccacttatt tctgccacat ctgagtcggc ctgagataga cttttccctc taaactggga 2040

gaatatcaca gtggtttttg ttagcagaaa atgcactcca gcctctgtac tcatctaagc 2100

tgcttatttt tgatatttgt gtcagtctgt aaatggatac ttcactttaa taactgttgc 2160

ttagtaattg gctttgtaga gaagctggaa aaaaatggtt ttgtcttcaa ctcctttgca 2220

tgccaggcgg tgatgtggat ctcggcttct gtgagcctgt gctgtgggca gggctgagct 2280

ggagccgccc ctctcagccc gcctgccacg gcctttcctt aaaggccatc cttaaaacca 2340

gaccctcatg gctaccagca cctgaaagct tcctcgacat ctgttaataa agccgtaggc 2400

ccttgtctaa gtgcaaccgc ctagactttc tttcagatac atgtccacat gtccattttt 2460

caggttctct aagttggagt ggagtctggg aagggttgtg aatgaggctt ctgggctatg 2520

ggtgaggttc caatggcagg ttagagcccc tcgggccaac tgccatcctg gaaagtagag 2580

acagcagtgc ccgctgccca gaagagacca gcaagccaaa ctggagcccc cattgcaggc 2640

tgtcgccatg tggaaagagt aactcacaat tgccaataaa gtctcatgtg gttttatcta 2700

aaaaaaaaaa aaaaaaaaaa aaaa 2724

<210> 41

<211> 2081

<212> ДНК

<213> Homo sapiens

<400> 41

aactttttat tgtggtttgt ccgttccgag cgctccgcag aacagtcctc cctgtaagag 60

cctaaccatt gccagggaaa cctgccctgg gcgctccctt cattagcagt atttttttta 120

aattaatctg attaataatt atttttcccc catttaattt tttttcctcc caggtggagt 180

tgccgaagct gggggcagct ggggagggtg gggatgggag gggagagaca gaagttgagg 240

gcatctctct cttccttccc gaccctctgg cccccaaggg gcaggaggaa tgcaggagca 300

ggagttgagc ttgggagctg cagatgcctc cgcccctcct ctctcccagg ctcttcctcc 360

tgcccccttc ttgcaactct ccttaatttt gtttggcttt tggatgatta taattatttt 420

tatttttgaa tttatataaa gtatatgtgt gtgtgtgtgg agctgagaca ggctcggcag 480

cggcacagaa tgagggaaga cgagaaagag agtgggagag agagaggcag agagggagag 540

agggagagtg acagcagcgc tcggacgtcc tccccaacgt cgccctcaat tccaccgcct 600

atgatccagt gaggcatttc tcgacctatg gagcggccgt tgcccagaac cggatctact 660

cgactccctt ttattcgcca caggagaatg tcgtgttcag ttccagccgg gggccgtatg 720

actatggatc taattccttt taccaggaga aagacatgct ctcaaactgc agacaaaaca 780

ccttaggaca taacacacag acctcaatcg ctcaggattt tagttctgag cagggcagga 840

ctgcgcccca ggaccagaaa gccagtatcc agatttaccc ctggatgcag cgaatgaatt 900

cgcacagtgg ggtcggctac ggagcggacc ggaggcgcgg ccgccagatc tactcgcggt 960

accagaccct ggaactggag aaggaatttc acttcaatcg ctacctaacg cggcgccggc 1020

gcatcgagat cgccaacgcg ctttgcctga ccgagcgaca gatcaaaatc tggttccaga 1080

accgccggat gaagtggaaa aaagaatcta atctcacatc cactctctcg gggggcggcg 1140

gaggggccac cgccgacagc ctgggcggaa aagaggaaaa gcgggaagag acagaagagg 1200

agaagcagaa agagtgacca ggactgtccc tgccacccct ctctcccttt ctccctcgct 1260

ccccaccaac tctcccctaa tcacacactc tgtatttatc actggcacaa ttgatgtgtt 1320

ttgattccct aaaacaaaat tagggagtca aacgtggacc tgaaagtcag ctctggaccc 1380

cctccctcac cgcacaactc tctttcacca cgcgcctcct cctcctcgct cccttgctag 1440

ctcgttctcg gcttgtctac aggccctttt ccccgtccag gccttggggg ctcggaccct 1500

gaactcagac tctacagatt gccctccaag tgaggacttg gctcccccac tccttcgacg 1560

cccccacccc cgccccccgt gcagagagcc ggctcctggg cctgctgggg cctctgctcc 1620

agggcctcag ggcccggcct ggcagccggg gagggccgga ggcccaagga gggcgcgcct 1680

tggccccaca ccaaccccca gggcctcccc gcagtccctg cctagcccct ctgccccagc 1740

aaatgcccag cccaggcaaa ttgtatttaa agaatcctgg gggtcattat ggcattttac 1800

aaactgtgac cgtttctgtg tgaagatttt tagctgtatt tgtggtctct gtatttatat 1860

ttatgtttag caccgtcagt gttcctatcc aatttcaaaa aaggaaaaaa aagagggaaa 1920

attacaaaaa gagagaaaaa aagtgaatga cgtttgttta gccagtagga gaaaataaat 1980

aaataaataa atcccttcgt gttaccctcc tgtataaatc caacctctgg gtccgttctc 2040

gaatatttaa taaaactgat attattttta aaactttaaa a 2081

<210> 42

<211> 2910

<212> ДНК

<213> Homo sapiens

<400> 42

aaaaatgcat aaagagccaa gtgcttatat tctggccaag ttatgaggct ctgagaacaa 60

gagcttgagg ggaagactgt taaccccatc cacgccacca gaattagctc tttccctttt 120

ggtttgcaag cactgcctgt aaagccctcg catgagaggc cagcctgcta gggaaatcca 180

ggaatctgca acaaaaacga tgacagtctg aaatactctc tggtgccaac ctccaaattc 240

tcgtctgtca cttcagaccc ccactagttg acagagcagc agaatttcaa ctccagtaga 300

cttgaatatg cctctgggca aagaagcaga gctaacgagg aaagggattt aaagagtttt 360

tcttgggtgt ttgtcaaact tttattccct gtctgtgtgc agaggggatt caacttcaat 420

ttttctgcag tggctctggg tccagcccct tacttaaaga tctggaaagc atgaagactg 480

ggcttttttt cctatgtctc ttgggaactg cagctgcaat cccgacaaat gcaagattat 540

tatctgatca ttccaaacca actgctgaaa cggtagcacc tgacaacact gcaatcccca 600

gtttaagggc tgaagctgaa gaaaatgaaa aagaaacagc agtatccaca gaagacgatt 660

cccaccataa ggctgaaaaa tcatcagtac taaagtcaaa agaggaaagc catgaacagt 720

cagcagaaca gggcaagagt tctagccaag agctgggatt gaaggatcaa gaggacagtg 780

atggtcactt aagtgtgaat ttggagtatg caccaactga aggtacattg gacataaaag 840

aagatatgag tgagcctcag gagaaaaaac tctcagagaa cactgatttt ttggctcctg 900

gtgttagttc cttcacagat tctaaccaac aagaaagtat cacaaagaga gaggaaaacc 960

aagaacaacc tagaaattat tcacatcatc agttgaacag gagcagtaaa catagccaag 1020

gcctaaggga tcaaggaaac caagagcagg atccaaatat ttccaatgga gaagaggaag 1080

aagaaaaaga gccaggtgaa gttggtaccc acaatgataa ccaagaaaga aagacagaat 1140

tgcccaggga gcatgctaac agcaagcagg aggaagacaa tacccaatct gatgatattt 1200

tggaagagtc tgatcaacca actcaagtaa gcaagatgca ggaggatgaa tttgatcagg 1260

gtaaccaaga acaagaagat aactccaatg cagaaatgga agaggaaaat gcatcgaacg 1320

tcaataagca cattcaagaa actgaatggc agagtcaaga gggtaaaact ggcctagaag 1380

ctatcagcaa ccacaaagag acagaagaaa agactgtttc tgaggctctg ctcatggaac 1440

ctactgatga tggtaatacc acgcccagaa atcatggagt tgatgatgat ggcgatgatg 1500

atggcgatga tggcggcact gatggcccca ggcacagtgc aagtgatgac tacttcatcc 1560

caagccaggc ctttctggag gccgagagag ctcaatccat tgcctatcac ctcaaaattg 1620

aggagcaaag agaaaaagta catgaaaatg aaaatatagg taccactgag cctggagagc 1680

accaagaggc caagaaagca gagaactcat caaatgagga ggaaacgtca agtgaaggca 1740

acatgagggt gcatgctgtg gattcttgca tgagcttcca gtgtaaaaga ggccacatct 1800

gtaaggcaga ccaacaggga aaacctcact gtgtctgcca ggatccagtg acttgtcctc 1860

caacaaaacc ccttgatcaa gtttgtggca ctgacaatca gacctatgct agttcctgtc 1920

atctattcgc tactaaatgc agactggagg ggaccaaaaa ggggcatcaa ctccagctgg 1980

attattttgg agcctgcaaa tctattccta cttgtacgga ctttgaagtg attcagtttc 2040

ctctacggat gagagactgg ctcaagaata tcctcatgca gctttatgaa gccaactctg 2100

aacacgctgg ttatctaaat gagaagcaga gaaataaagt caagaaaatt tacctggatg 2160

aaaagaggct tttggctggg gaccatccca ttgatcttct cttaagggac tttaagaaaa 2220

actaccacat gtatgtgtat cctgtgcact ggcagtttag tgaacttgac caacacccta 2280

tggatagagt cttgacacat tctgaacttg ctcctctgcg agcatctctg gtgcccatgg 2340

aacactgcat aacccgtttc tttgaggagt gtgaccccaa caaggataag cacatcaccc 2400

tgaaggagtg gggccactgc tttggaatta aagaagagga catagatgaa aatctcttgt 2460

tttgaacgaa gattttaaag aactcaactt tccagcatcc tcctctgttc taaccacttc 2520

agaaatatat gcagctgtga tacttgtaga tttatattta gcaaaatgtt agcatgtatg 2580

acaagacaat gagagtaatt gcttgacaac aacctatgca ccaggtattt aacattaact 2640

ttggaaacaa aaatgtacaa ttaagtaaag tcaacatatg caaaatactg tacattgtga 2700

acagaagttt aattcatagt aatttcactc tctgcattga cttatgagat aattaatgat 2760

taaactatta atgataaaaa taatgcattt gtattgttca taatatcatg tgcacttcaa 2820

gaaaatggaa tgctactctt ttgtggttta cgtgtattat tttcaatatc ttaataccct 2880

aataaagagt ccataaaaat ccaaatgctt 2910

<210> 43

<211> 3019

<212> ДНК

<213> Homo sapiens

<400> 43

aaaaatgcat aaagagccaa gtgcttatat tctggccaag ttatgaggct ctgagaacaa 60

gagcttgagg ggaagactgt taaccccatc cacgccacca gaattagctc tttccctttt 120

ggtttgcaag cactgcctgt aaagccctcg catgagaggc cagcctgcta gggaaatcca 180

ggaatctgca acaaaaacga tgacagtctg aaatactctc tggtgccaac ctccaaattc 240

tcgtctgtca cttcagaccc ccactagttg acagagcagc agaatttcaa ctccagtaga 300

cttgaatatg cctctgggca aagaagcaga gctaacgagg aaagggattt aaagagtttt 360

tcttgggtgt ttgtcaaact tttattccct gtctgtgtgc agaggggatt caacttcaat 420

ttttctgcag tggctctggg tccagcccct tacttaaaga tctggaaagc atgaagactg 480

ggcttttttt cctatgtctc ttgggaactg cagctgcaat cccggtgaaa aggagataag 540

aagcaaagga gcaaaccaaa cctaatatga atcctgtact ttggccagaa gccgtggctc 600

acatctgtaa tcccagcact ttgggaggcc aagacaaatg caagattatt atctgatcat 660

tccaaaccaa ctgctgaaac ggtagcacct gacaacactg caatccccag tttaagggct 720

gaagctgaag aaaatgaaaa agaaacagca gtatccacag aagacgattc ccaccataag 780

gctgaaaaat catcagtact aaagtcaaaa gaggaaagcc atgaacagtc agcagaacag 840

ggcaagagtt ctagccaaga gctgggattg aaggatcaag aggacagtga tggtcactta 900

agtgtgaatt tggagtatgc accaactgaa ggtacattgg acataaaaga agatatgagt 960

gagcctcagg agaaaaaact ctcagagaac actgattttt tggctcctgg tgttagttcc 1020

ttcacagatt ctaaccaaca agaaagtatc acaaagagag aggaaaacca agaacaacct 1080

agaaattatt cacatcatca gttgaacagg agcagtaaac atagccaagg cctaagggat 1140

caaggaaacc aagagcagga tccaaatatt tccaatggag aagaggaaga agaaaaagag 1200

ccaggtgaag ttggtaccca caatgataac caagaaagaa agacagaatt gcccagggag 1260

catgctaaca gcaagcagga ggaagacaat acccaatctg atgatatttt ggaagagtct 1320

gatcaaccaa ctcaagtaag caagatgcag gaggatgaat ttgatcaggg taaccaagaa 1380

caagaagata actccaatgc agaaatggaa gaggaaaatg catcgaacgt caataagcac 1440

attcaagaaa ctgaatggca gagtcaagag ggtaaaactg gcctagaagc tatcagcaac 1500

cacaaagaga cagaagaaaa gactgtttct gaggctctgc tcatggaacc tactgatgat 1560

ggtaatacca cgcccagaaa tcatggagtt gatgatgatg gcgatgatga tggcgatgat 1620

ggcggcactg atggccccag gcacagtgca agtgatgact acttcatccc aagccaggcc 1680

tttctggagg ccgagagagc tcaatccatt gcctatcacc tcaaaattga ggagcaaaga 1740

gaaaaagtac atgaaaatga aaatataggt accactgagc ctggagagca ccaagaggcc 1800

aagaaagcag agaactcatc aaatgaggag gaaacgtcaa gtgaaggcaa catgagggtg 1860

catgctgtgg attcttgcat gagcttccag tgtaaaagag gccacatctg taaggcagac 1920

caacagggaa aacctcactg tgtctgccag gatccagtga cttgtcctcc aacaaaaccc 1980

cttgatcaag tttgtggcac tgacaatcag acctatgcta gttcctgtca tctattcgct 2040

actaaatgca gactggaggg gaccaaaaag gggcatcaac tccagctgga ttattttgga 2100

gcctgcaaat ctattcctac ttgtacggac tttgaagtga ttcagtttcc tctacggatg 2160

agagactggc tcaagaatat cctcatgcag ctttatgaag ccaactctga acacgctggt 2220

tatctaaatg agaagcagag aaataaagtc aagaaaattt acctggatga aaagaggctt 2280

ttggctgggg accatcccat tgatcttctc ttaagggact ttaagaaaaa ctaccacatg 2340

tatgtgtatc ctgtgcactg gcagtttagt gaacttgacc aacaccctat ggatagagtc 2400

ttgacacatt ctgaacttgc tcctctgcga gcatctctgg tgcccatgga acactgcata 2460

acccgtttct ttgaggagtg tgaccccaac aaggataagc acatcaccct gaaggagtgg 2520

ggccactgct ttggaattaa agaagaggac atagatgaaa atctcttgtt ttgaacgaag 2580

attttaaaga actcaacttt ccagcatcct cctctgttct aaccacttca gaaatatatg 2640

cagctgtgat acttgtagat ttatatttag caaaatgtta gcatgtatga caagacaatg 2700

agagtaattg cttgacaaca acctatgcac caggtattta acattaactt tggaaacaaa 2760

aatgtacaat taagtaaagt caacatatgc aaaatactgt acattgtgaa cagaagttta 2820

attcatagta atttcactct ctgcattgac ttatgagata attaatgatt aaactattaa 2880

tgataaaaat aatgcatttg tattgttcat aatatcatgt gcacttcaag aaaatggaat 2940

gctactcttt tgtggtttac gtgtattatt ttcaatatct taatacccta ataaagagtc 3000

cataaaaatc caaatgctt 3019

<210> 44

<211> 2670

<212> ДНК

<213> Homo sapiens

<400> 44

aaaaatgcat aaagagccaa gtgcttatat tctggccaag ttatgaggct ctgagaacaa 60

gagcttgagg ggaagactgt taaccccatc cacgccacca gaattagctc tttccctttt 120

ggtttgcaag cactgcctgt aaagccctcg catgagaggc cagcctgcta gggaaatcca 180

ggaatctgca acaaaaacga tgacagtctg aaatactctc tggtgccaac ctccaaattc 240

tcgtctgtca cttcagaccc ccactagttg acagagcagc agaatttcaa ctccagtaga 300

cttgaatatg cctctgggca aagaagcaga gctaacgagg aaagggattt aaagagtttt 360

tcttgggtgt ttgtcaaact tttattccct gtctgtgtgc agaggggatt caacttcaat 420

ttttctgcag tggctctggg tccagcccct tacttaaaga tctggaaagc catgaacagt 480

cagcagaaca gggcaagagt tctagccaag agctgggatt gaaggatcaa gaggacagtg 540

atggtcactt aagtgtgaat ttggagtatg caccaactga aggtacattg gacataaaag 600

aagatatgag tgagcctcag gagaaaaaac tctcagagaa cactgatttt ttggctcctg 660

gtgttagttc cttcacagat tctaaccaac aagaaagtat cacaaagaga gaggaaaacc 720

aagaacaacc tagaaattat tcacatcatc agttgaacag gagcagtaaa catagccaag 780

gcctaaggga tcaaggaaac caagagcagg atccaaatat ttccaatgga gaagaggaag 840

aagaaaaaga gccaggtgaa gttggtaccc acaatgataa ccaagaaaga aagacagaat 900

tgcccaggga gcatgctaac agcaagcagg aggaagacaa tacccaatct gatgatattt 960

tggaagagtc tgatcaacca actcaagtaa gcaagatgca ggaggatgaa tttgatcagg 1020

gtaaccaaga acaagaagat aactccaatg cagaaatgga agaggaaaat gcatcgaacg 1080

tcaataagca cattcaagaa actgaatggc agagtcaaga gggtaaaact ggcctagaag 1140

ctatcagcaa ccacaaagag acagaagaaa agactgtttc tgaggctctg ctcatggaac 1200

ctactgatga tggtaatacc acgcccagaa atcatggagt tgatgatgat ggcgatgatg 1260

atggcgatga tggcggcact gatggcccca ggcacagtgc aagtgatgac tacttcatcc 1320

caagccaggc ctttctggag gccgagagag ctcaatccat tgcctatcac ctcaaaattg 1380

aggagcaaag agaaaaagta catgaaaatg aaaatatagg taccactgag cctggagagc 1440

accaagaggc caagaaagca gagaactcat caaatgagga ggaaacgtca agtgaaggca 1500

acatgagggt gcatgctgtg gattcttgca tgagcttcca gtgtaaaaga ggccacatct 1560

gtaaggcaga ccaacaggga aaacctcact gtgtctgcca ggatccagtg acttgtcctc 1620

caacaaaacc ccttgatcaa gtttgtggca ctgacaatca gacctatgct agttcctgtc 1680

atctattcgc tactaaatgc agactggagg ggaccaaaaa ggggcatcaa ctccagctgg 1740

attattttgg agcctgcaaa tctattccta cttgtacgga ctttgaagtg attcagtttc 1800

ctctacggat gagagactgg ctcaagaata tcctcatgca gctttatgaa gccaactctg 1860

aacacgctgg ttatctaaat gagaagcaga gaaataaagt caagaaaatt tacctggatg 1920

aaaagaggct tttggctggg gaccatccca ttgatcttct cttaagggac tttaagaaaa 1980

actaccacat gtatgtgtat cctgtgcact ggcagtttag tgaacttgac caacacccta 2040

tggatagagt cttgacacat tctgaacttg ctcctctgcg agcatctctg gtgcccatgg 2100

aacactgcat aacccgtttc tttgaggagt gtgaccccaa caaggataag cacatcaccc 2160

tgaaggagtg gggccactgc tttggaatta aagaagagga catagatgaa aatctcttgt 2220

tttgaacgaa gattttaaag aactcaactt tccagcatcc tcctctgttc taaccacttc 2280

agaaatatat gcagctgtga tacttgtaga tttatattta gcaaaatgtt agcatgtatg 2340

acaagacaat gagagtaatt gcttgacaac aacctatgca ccaggtattt aacattaact 2400

ttggaaacaa aaatgtacaa ttaagtaaag tcaacatatg caaaatactg tacattgtga 2460

acagaagttt aattcatagt aatttcactc tctgcattga cttatgagat aattaatgat 2520

taaactatta atgataaaaa taatgcattt gtattgttca taatatcatg tgcacttcaa 2580

gaaaatggaa tgctactctt ttgtggttta cgtgtattat tttcaatatc ttaataccct 2640

aataaagagt ccataaaaat ccaaatgctt 2670

1. Способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида, где способ включает стадии:

а. получения у индивида произвольного образца мочи;

b. экстракции одной или нескольких мРНК из образца;

с. определения уровня экспрессии мРНК PCA3 и ERG;

d. нормализации уровня экспрессии мРНК PCA3 и ERG с SPDEF;

e. обработки выходного значения для нормализованных уровней экспрессии мРНК PCA3 и ERG, используя формулу:

с получением баллов по шкале EXO106; и

f. сравнение баллов по шкале EXO106 с заранее определенной величиной порога отсечения, которую определяли с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, для проведения различия между индивидом с высоким риском возникновения рака предстательной железы и индивидом с низким риском возникновения рака предстательной железы.

2. Способ по п.1, в котором произвольный образец мочи представляет собой первую порцию мочи объемом 40 мл из мочевого пузыря.

3. Способ по п.1, в котором произвольный образец мочи представляет собой первую порцию мочи объемом 20 мл из мочевого пузыря.

4. Способ по п.1, в котором заранее определенная величина порога отсечения равна 10 баллам по шкале EXO106, где 10 баллов или выше по шкале EXO106 указывают на высокий риск возникновения рака предстательной железы у пациента.

5. Способ по любому из пп.1-4, в котором стадия (a) дополнительно включает выделение микровезикулярной фракции из произвольного образца мочи и экстракцию одной или нескольких нуклеиновых кислот из микровезикулярной фракции.

6. Способ по п.5, в котором стадия выделения микровезикулярной фракции включает обработку образца для удаления клеток и клеточного дебриса и концентрирование микровезикулярной фракции путем проведения ультрацентрифугирования микровезикулярной фракции или с помощью фильтрационного концентратора, и промывку микровезикулярной фракции перед экстракцией одной или более нуклеиновых кислот из микровезикулярной фракции.

7. Способ по п.6, в котором способ дополнительно включает добавление ингибитора РНКазы в микровезикулярную фракцию перед экстракцией одной или более нуклеиновых кислот из микровезикулярной фракции.

8. Способ по любому из пп.1-4, 6 или 7, дополнительно включающий определение на стадии (d) уровня экспрессии одного или более генов, выбранных из: AMACR, BIRC5, HOXC6 и SPARCL1.

9. Способ по любому из пп.1-4, 6 или 7, в котором перед стадией (b) в образец мочи добавляют известное количество частиц Q-бета, и в котором на стадии (с) определяют уровень экспрессии гена-мишени Q-бета, и где уровень экспрессии, который был определен, сравнивают с известным количеством.

10. Способ по любому из пп.1-4, 6 или 7, в котором раком является агрессивный рак.

11. Способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы с высоким индексом Глисона, равным свыше 6 баллов, у нуждающегося в этом индивида, где способ включает стадии:

а. получения у индивида произвольного образца мочи;

b. экстракции одной или нескольких мРНК из образца;

с. определения уровня экспрессии мРНК PCA3 и ERG;

d. нормализации уровня экспрессии мРНК PCA3 и ERG с SPDEF;

e. обработки выходного значения для нормализованных уровней экспрессии мРНК PCA3 и ERG, используя формулу:

с получением баллов по шкале EXO106; и

f. сравнение баллов по шкале EXO106 с заранее определенной величиной порога отсечения, которую определяли с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, для проведения различия между индивидом с высоким риском развития рака предстательной железы с высоким индексом Глисона, равным свыше 6, и индивидом с низким риском развития рака предстательной железы с высоким индексом Глисона, равным свыше 6.

12. Способ по п.11, в котором произвольный образец мочи представляет собой первую порцию мочи объемом 40 мл из мочевого пузыря.

13. Способ по п.11, в котором произвольный образец мочи представляет собой первую порцию мочи объемом 20 мл из мочевого пузыря.

14. Способ по п.11, в котором заранее определенная величина порога отсечения равна 10 баллам по шкале EXO106, где 10 баллов или выше по шкале EXO106 указывают на высокий риск развития рака предстательной железы с высоким индексом Глисона, равным свыше 6.

15. Способ по любому из пп.11-14, в котором стадия (a) дополнительно включает выделение микровезикулярной фракции из произвольного образца мочи и экстракцию одной или нескольких нуклеиновых кислот из микровезикулярной фракции.

16. Способ по п.15, в котором стадия выделения микровезикулярной фракции включает обработку образца для удаления клеток и клеточного дебриса и концентрирование микровезикулярной фракции путем проведения ультрацентрифугирования микровезикулярной фракции или с помощью фильтрационного концентратора, и промывку микровезикулярной фракции перед экстракцией одной или нескольких нуклеиновых кислот из микровезикулярной фракции.

17. Способ по п.16, в котором способ дополнительно включает добавление ингибитора РНКазы в микровезикулярную фракцию перед экстракцией одной или нескольких нуклеиновых кислот из микровезикулярной фракции.

18. Способ по любому из пп.11-14, 16 или 17, дополнительно включающий определение на стадии (d) уровня экспрессии одного или нескольких генов, выбранных из: AMACR, BIRC5, HOXC6 и SPARCL1.

19. Способ по любому из пп.11-14, 16 или 17, в котором перед стадией (b) в образец мочи добавляют известное количество частиц Q-бета, и в котором на стадии (с) определяют уровень экспрессии гена-мишени Q-бета, и где уровень экспрессии, который был определен, сравнивают с известным количеством.

20. Способ по любому из пп.11-14, 16 или 17, в котором раком является агрессивный рак.



 

Похожие патенты:

Изобретение относится к биотехнологии. Изобретение включает новые зонды для изотермической амплификации нуклеиновой кислоты и способы обнаружения последовательности-мишени нуклеиновой кислоты с использованием этих зондов.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к области медицины, в частности к трансплантологии, и предназначено для анализа гемопоэтического химеризма при исследовании однонуклеотидных полиморфизмов генов фолатного цикла.

Изобретение относится к области генетики и селекции сельскохозяйственных животных. Предложен способ проведения ПЦР-ПДРФ-анализа для генотипирования крупного рогатого скота по гену RPS3A.

Изобретение относится к области медицины, в частности к гематологии, и предназначено для определения посттрансплантационного донорского химеризма при анализе точечных мутаций замены оснований в генах тромбофилии.

Изобретение относится к биотехнологии. Описана композиция для амплификации нуклеиновой кислоты, представляющей интерес, включающая смесь деоксинуклеотидов (dNTP), двухвалентных катионов, фермента, способного к амплификации ДНК, и праймеров, пригодных для амплификации нуклеиновой кислоты, представляющей интерес, в том числе ДНК, представляющей интерес, отличающаяся тем, что смесь содержит соль, содержащую аммоний в качестве катиона, и анион слабой кислоты, где указанная соль представляет собой аммоний пентаборат, и дикарбоновую кислоту.

Настоящее изобретение относится к области биотехнологии, конкретно к оценке терапевтической эффективности химиотерапии с использованием противоопухолевого средства, и может быть использовано в медицине.

Предложенная группа изобретений относится к области медицины. Предложены способы определения и выбора терапии для пациента и набор для определения, может ли пациент получать пользу от лечения с помощью антагониста VEGF.

Изобретение относится к области медицины, в частности к онкологии и эпигенетике, и предназначено для скрининга злокачественных новообразований у человека. Осуществляют забор периферической крови.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор для специфической идентификации по меньшей мере одной последовательности ДНК в образце путем проведения полимеразной цепной реакции (ПЦР), включающие одну пару праймеров, специфичных для этой последовательности ДНК, и пару зондов, в которой один представляет собой олигонуклеотидный мишень-специфичный зонд, имеющий 3'-сегмент, комплементарный идентифицируемому участку последовательности ДНК и содержащий метку, и 5'-сегмент, некомплементарный идентифицируемой последовательности ДНК и содержащий метку, а другой - олигонуклеотидный сигнальный зонд, комплементарный 5'-сегменту мишень-специфичного зонда и содержащий метку.

Изобретение относится к биотехнологии. Изобретение включает новые зонды для изотермической амплификации нуклеиновой кислоты и способы обнаружения последовательности-мишени нуклеиновой кислоты с использованием этих зондов.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к области медицины, в частности к трансплантологии, и предназначено для анализа гемопоэтического химеризма при исследовании однонуклеотидных полиморфизмов генов фолатного цикла.

Изобретение относится к области генетики и селекции сельскохозяйственных животных. Предложен способ проведения ПЦР-ПДРФ-анализа для генотипирования крупного рогатого скота по гену RPS3A.

Изобретение относится к области медицины, в частности к гематологии, и предназначено для определения посттрансплантационного донорского химеризма при анализе точечных мутаций замены оснований в генах тромбофилии.

Изобретение относится к области биотехнологии, конкретно к способам обнаружения молекулы-мишени в тест-образце, что может быть использовано в медицине. Описанные способы облегчают детекцию мишени, отличающейся от нуклеиновой кислоты (например, белка-мишени), в исследуемом образце путем детекции нуклеиновой кислоты (т.е., аптамера).

Изобретение относится к биотехнологии. Описана композиция для амплификации нуклеиновой кислоты, представляющей интерес, включающая смесь деоксинуклеотидов (dNTP), двухвалентных катионов, фермента, способного к амплификации ДНК, и праймеров, пригодных для амплификации нуклеиновой кислоты, представляющей интерес, в том числе ДНК, представляющей интерес, отличающаяся тем, что смесь содержит соль, содержащую аммоний в качестве катиона, и анион слабой кислоты, где указанная соль представляет собой аммоний пентаборат, и дикарбоновую кислоту.

Группа изобретений относится к области биохимии. Предложен способ калибровки и измерения сигнала, а также устройство для обнаружения и/или идентификации целевых бактерий.

Изобретение относится к области биохимии. Предложено устройство для проведения полимеразной цепной реакции.

Настоящее изобретение относится к области биотехнологии, конкретно к оценке терапевтической эффективности химиотерапии с использованием противоопухолевого средства, и может быть использовано в медицине.

Изобретение относится к биотехнологии. Изобретение включает новые зонды для изотермической амплификации нуклеиновой кислоты и способы обнаружения последовательности-мишени нуклеиновой кислоты с использованием этих зондов.

Изобретение относится к области биохимии. Описан способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида. В одном из вариантов, способ включает стадии: а. получения у индивида произвольного образца мочи; b. экстракции одной или нескольких мРНК из образца; с. определения уровня экспрессии мРНК PCA3 и ERG; d. нормализации уровня экспрессии мРНК PCA3 и ERG с SPDEF; e. обработки выходного значения для нормализованных уровней экспрессии мРНК PCA3 и ERG, используя формулу: с получением баллов по шкале EXO106; и f. сравнение баллов по шкале EXO106 с заранее определенной величиной порога отсечения, которую определяли с помощью кривой ROC, построенной на основе сочетания PCA3 и ERG, для проведения различия между индивидом с высоким риском возникновения рака предстательной железы и индивидом с низким риском возникновения рака предстательной железы. В одном из вариантов изобретения раком является агрессивный рак. Изобретение расширяет арсенал средств, позволяющих проводить диагностику и прогнозирование рака предстательной железы. 2 н. и 18 з.п. ф-лы, 16 табл., 6 пр., 20 ил.

Наверх