Поликонъюгаты для введения in vivo полинуклеотидов



Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов
Поликонъюгаты для введения in vivo полинуклеотидов

 


Владельцы патента RU 2430740:

Ф.ХОФФМАНН-ЛЯ РОШ АГ (CH)

Настоящее изобретение относится к композициям, которые можно применять для введения полинуклеотидов или других молекул, не обладающих способностью проникать в клетки молекул млекопитающих. Предлагаемая композиция, предназначенная для введения молекулы в клетку, содержит конъюгат формулы: N-L1-P-(L2-M)y, в которой N обозначает не обладающую способностью проникать через мембраны молекулу или молекулу с низкой способностью проникать через мембрану; L1 обозначает первое обратимое сцепление, содержащее лабильную в физиологических условиях связь; Р обозначает полимер, обладающий активностью в отношении мембраны; L2 обозначает второе обратимое сцепление, содержащее ортогональную лабильную в физиологических условиях связь; М обозначает маскирующий агент выбранный из группы, включающей стабилизаторы стерической конфигурации, обеспечивающие направленный перенос группы и агенты, модифицирующие заряд, и y обозначает целое число, большее 0. Системы поликонъюгатов обладают видами активности, которые обеспечивают направленный перенос, обладают антиопсонизизирующим, антиагрегационным и трансфекционным действием, в небольших биосовместимых предназначенных для введения in vivo носителях. 17 з.п. ф-лы, 36 ил.

 

Перекрестная ссылка на родственные заявки

Настоящая заявка притязает на приоритет предварительной заявки на патент США №60/822833, зарегистрированной 18 августа 2006 г., и предварительной заявки на патент США №60/91868, зарегистрированной 3 мая 2007 г.

Предпосылки создания изобретения

Эффективность введения полинуклеотидов и других, не обладающих способностью проникать через мембраны соединений в живые клетки, в значительной степени ограничена комплексом мембранных систем клетки. Лекарственные средства, которые применяют для антисмысловой и генной терапии, представляют собой относительно крупные гидрофильные полимеры, и они часто несут также большой отрицательный заряд. Обе эти физические характеристики препятствуют их непосредственной диффузии через клеточную мембрану. По этой причине основной проблемой при введении полинуклеотидов является проникновение полинуклеотида внутрь клетки. Разработаны многочисленные реагенты для трансфекции, предназначенные для введения полинуклеотидов в клетки in vitro. Однако введение in vivo полинуклеотидов осложняется токсичностью, взаимодействиями с сывороткой и недостаточной эффективностью направленного переноса, обеспечиваемого реагентами для трансфекции, которые обладают активностью in vitro. Реагенты для трансфекции, которые хорошо «работают» in vitro, катионные полимеры и липиды, как правило, оказывают дестабилизирующее действие на клеточные мембраны и образуют крупные частицы. Положительный (катионный) заряд реагента для трансфекции облегчает введение связывание нуклеиновой кислоты, а также ее связывание с клеткой. Дестабилизация мембран облегчает введение не обладающих способностью проникать через мембраны полинуклеотидов через клеточную мембрану. Эти свойства делает реагенты для трансфекции неэффективными или токсичными in vivo. Заряд катиона приводит к взаимодействию с компонентами сыворотки, что обусловливает дестабилизацию взаимодействия полинуклеотид-реагент для трансфекции и недостаточную биологическую доступность, и эффективность направленного переноса. Заряд катиона может приводить также к токсичности in vivo. Активность в отношении мембраны реагента для трансфекции, который может обладать эффективностью in vitro, часто приводит к токсичности in vivo.

Для введения in vivo комплекс для трансфекции (реагент для трансфекции в сочетании с подлежащей введению нуклеиновой кислотой) должен быть небольшим, т.е. диаметром менее 100 нм, и предпочтительно менее 50 нм. Более эффективными могут быть комплексы еще меньшего размера, менее 20 нм или даже менее 10 нм. Комплексы для трансфекции крупнее 100 нм обладают очень незначительной способностью проникать в клетки, отличные от клеток кровеносных сосудов, in vivo. Применяемые in vitro комплексы также несут положительный заряд. Этот положительный заряд необходим для прикрепления комплекса к клетке и слияния с мембраной, ее дестабилизации или разрушения. Положительный заряд применяемых in vivo комплексов для трансфекции приводит к нежелательным взаимодействиям с сывороткой и, как следствие, к недостаточной биологической доступности. Практически нейтральные или отрицательно заряженные комплексы должны обладать in vivo лучшими характеристиками распределения и способностью осуществлять направленный перенос. Однако применяемые in vitro комплексы для трансфекции ассоциируют с нуклеиновыми кислотами путем взаимодействий типа заряд-заряд (электростатические взаимодействия). Отрицательно заряженные полимеры и липиды не взаимодействуют с отрицательно заряженными нуклеиновыми кислотами. Кроме того, эти электростатические комплексы имеют тенденцию к агрегации или осаждению при контакте с физиологическими концентрациями солей или компонентами сыворотки. И, наконец, комплексы для трансфекции, которые являются эффективными in vitro, часто являются токсичными in vivo. Полимеры и липиды, применяемые для трансфекции, разрушают или дестабилизируют клеточные мембраны. Баланса между этой активностью и эффективностью введения нуклеиновых кислот легче достигать in vitro, чем in vivo.

Хотя нескольким группам исследователей удалось добиться существенных улучшений в отношении введения генов в клетки in vivo, сохраняется необходимость в создании формы, которая обеспечивала бы эффективное введение в клетку-мишень полинуклеотида в сочетании с обеспечивающим введение агентом и не обладала бы токсичностью, как правило, ассоциированной с введением in vivo реагентов для трансфекции. В настоящем изобретении предложены композиции и способы введения в клетку и высвобождения в клетке полинуклеотида, основанные на применении систем для введения, включающих биологически лабильные конъюгаты.

Краткое изложение сущности изобретения

Предпочтительным вариантом осуществления отличительных признаков изобретения является композиция, предназначенная для введения полинуклеотида в клетку in vivo, которая содержит обратимо замаскированный обладающий активностью в отношении мембран полимер, обратимо конъюгированный с полинуклеотидом. Полимер присоединяют через одну или несколько первых обратимых ковалентных связей к одному или нескольким маскирующим агентам и дополнительно присоединяют через одну или несколько вторых обратимых ковалентных связей к одному или нескольким полинуклеотидам. Первые и вторые обратимые ковалентные связи могут представлять собой обратимые мостики, которые могут расщепляться в одинаковых или сходных условиях или которые могут расщепляться в различных условиях, т.е. они могут содержать ортогональные обратимые мостики. Конъюгат полинуклеотид-полимер вводят млекопитающему в фармацевтически приемлемом носителе или разбавителе.

Предпочтительным вариантом осуществления изобретения являются обладающие активностью в отношении мембран полимеры, представляющие собой статистические сополимеры простого поливинилового эфира. Сополимеры простого поливинилового эфира можно синтезировать из двух, трех или большего количества различных мономеров. Мономеры можно выбирать из группы, включающей: защищенный простой аминовиниловый эфир, такой как фталимидосодержащие простые виниловые эфиры, простой бутилвиниловый эфир, простой додецилвиниловый эфир, простой октадецилвиниловый эфир. Предпочтительные статистические сополимеры простого поливинилового эфира содержат три мономера: содержащий амин мономер, простой винилбутиловый эфир и простой октадецилвиниловый эфир.

В предпочтительном варианте осуществления изобретения одну или несколько биофизических характеристик обладающего активностью в отношении мембран полимера обратимо защищают или модифицируют с помощью маскирующего агента. Маскирующие агенты можно выбирать из группы, включающей стабилизаторы стерической конфигурации, обеспечивающие направленный перенос группы или модифицирующие заряд агенты. Маскирующий агент может улучшать биораспределение или направленный перенос конъюгата полимер-полинуклеотид путем ингибирования неспецифических взаимодействий полимера с компонентами сыворотки или нецелевыми клетками. Маскирующий агент может также снижать агрегацию полимера или конъюгата полимер-полинуклеотид. Маскирующие агенты, содержащие обеспечивающие направленный перенос группы, могут повышать специфический для клетки направленный перенос или интернализацию в клетке путем направленного переноса системы конъюгата к рецептору клеточной поверхности. Маскирующий агент можно конъюгировать с обладающим активностью в отношении мембран полимером до или после конъюгации полимера с полинуклеотидом.

В предпочтительном варианте осуществления изобретения полинуклеотид можно вводить в клетки с помощью описанных систем конъюгатов, которые можно выбирать из группы, включающей: ДНК, РНК, блокирующие полинуклеотиды, антисмысловые олигонуклеотиды, плазмиды, экспрессионные векторы, олигонуклеотиды, siPHK, микроРНК, мРНК, shPHK и рибозимы.

В предпочтительном варианте осуществления изобретения маскирующий агент(ы) и полинуклеотид(ы) ковалентно связывают с обладающим активностью в отношении мембран полимером через обратимые связи. Хотя маскировка полимера и присоединение полинуклеотида к полимеру являются важными, указанные присоединения могут оказывать влияние на трансфекционную активность полимера или активность полинуклеотида. Путем присоединения маскирующего агента и полинуклеотида к полимеру через обратимые связи, которые расщепляются в соответствующий момент времени, активность полимера восстанавливают и полинуклеотид высвобождается. Обратимые ковалентные связи содержат обратимые или лабильные мостики, которые можно выбирать из группы, включающей: лабильные в физиологических условиях мостики (физиологически лабильные мостики), лабильные в физиологических клеточных условиях мостики, лабильные при определенных значениях рН мостики (рН-лабильные мостики), очень лабильные при определенных значениях рН мостики, чрезвычайно лабильные при определенных значениях рН мостики, расщепляемые ферментами мостики и дисульфидные мостики. Присутствие двух обратимых связей, соединяющих полимер с полинуклеотидом и маскирующим агентом, обеспечивает совместное введение полинуклеотида с обеспечивающим введение полимером и избирательный направленный перенос, и инактивацию обеспечивающего введение полимера маскирующим агентом. Обратимость связей обеспечивает высвобождение полинуклеотида из обладающего активностью в отношении мембран полимера и избирательную активацию обладающего активностью в отношении мембран полимера.

Предпочтительным вариантом осуществления изобретения является композиция, которая содержит: обеспечивающий введение полимер, ковалентно связанный с: а) одной или несколькими обеспечивающими направленный перенос группами, стабилизаторами стерической конфигурации или модифицирующими заряд агентами через одну или несколько обратимых связей; и б) одним или несколькими полинуклеотидами через одну или несколько обратимых связей. В одном из вариантов осуществления изобретения обратимая ковалентная связь обеспечивающего направленный перенос агента, стабилизатора стерической конфигурации или модифицирующего заряд агента является ортогональной относительно ковалентной обратимой связи полинуклеотида.

Предпочтительным вариантом осуществления изобретения является система, включающая конъюгат полимера, предназначенная для введения полинуклеотида в клетку и высвобождения полинуклеотида в клетке, которая содержит: полинуклеотид, обратимо конъюгированный с обладающим активностью в отношении мембран полимером, который сам обратимо конъюгирован с маскирующим агентом. Обеспечивающие конъюгацию связи могут быть одинаковыми или различными. Кроме того, обеспечивающие конъюгацию связи могут расщепляться в одних и тех же или различных условиях.

Предпочтительным вариантом осуществления изобретения является система, включающая конъюгат полимера, предназначенная для введения не обладающей способностью проникать через мембраны молекулы в клетку и высвобождения молекулы в клетке. Система, включающая конъюгат полимера, содержит не обладающую способностью проникать через мембраны молекулу, обратимо связанную с обладающим активностью в отношении мембран полимером, при этом с обладающим активностью в отношении мембран полимером связано через обратимые ковалентные связи несколько маскирующих агентов. Обладающие активностью в отношении мембран полимеры могут обладать токсичностью или могут не обеспечивать направленный перенос при применении in vivo. Обратимое присоединение маскирующего агента обратимо ингибирует или изменяет взаимодействия с мембраной, взаимодействия с сывороткой, взаимодействия с клеткой, токсичность или заряд полимера. Предпочтительная обратимая ковалентная связь представляет собой: лабильный мостик, физиологически лабильный мостик или мостик, который расщепляется во внутриклеточной среде клетки млекопитающих. Предпочтительный лабильный мостик представляет собой лабильный при определенных значениях рН мостик. Предпочтительным лабильным при определенных значениях рН мостиком является малеаматный мостик. Другим предпочтительным лабильным мостиком является дисульфидный мостик. Не обладающие способностью проникать через мембрану молекулы включают (но, не ограничиваясь только ими): полинуклеотиды, белки, антитела и не обладающие способностью проникать через мембраны лекарственные средства.

В предпочтительном варианте осуществления изобретения полинуклеотид присоединяют к полимеру в присутствии избытка полимера. Избыток полимера может способствовать приготовлению препаративной формы конъюгата полинуклеотид-полимер. Избыток полимера может снижать агрегацию в процессе приготовления препаративной формы конъюгата. Конъюгат полинуклеотид-полимер можно отделять от избытка полимера до введения конъюгата в клетку или организм. В другом варианте конъюгат полинуклеотид-полимер можно вводить вместе с избытком полимера в клетку или организм. Взятый в избыточном количестве полимер может представлять собой тот же самый или другой полимер.

В предпочтительном варианте осуществления изобретения содержащие полимер конъюгаты, предлагаемые в изобретении, можно применять для введения in vitro полинуклеотида или другой не обладающей способностью проникать через мембрану молекулы. Для введения in vitro обратимая маскировка полимера повышает активность трансфекции некоторых не эффективных в противном случае полиаминов, таких как полилизин. Обратимая маскировка может повышать также применимость других обладающих активностью в отношении мембран полимеров посредством снижения их токсичности или ограничения их способности разрушать мембрану эндосом.

Предпочтительным вариантом осуществления изобретения является система, предназначенная для введения полинуклеотида в клетку in vivo, применение которой предусматривает: присоединение путем ковалентной связи обеспечивающей направленный перенос группы к полинуклеотиду, присоединение путем ковалентной связи второй обеспечивающей направленный перенос группы к обладающему активностью в отношении мембран полимеру и введение путем инъекции полинуклеотида и обладающего активностью в отношении мембран полимера в организм.

Другие объекты, отличительные признаки и преимущества изобретения должны стать очевидными после ознакомления с приведенным ниже подробным описанием изобретения в сочетании с прилагаемыми чертежами.

Краткое описание чертежей

На чертежах показано:

на фиг.1 - реакционная схема полимеризации полимеров простого поливинилового эфира;

на фиг.2 - иллюстрация нескольких вариантов маскирующих агентов, предлагаемых в изобретении;

на фиг.3 - иллюстрация формирования обратимых конъюгатов полинуклеотид-полимер и обратимой маскировки конъюгата малеаматами;

на фиг.4 - микрофотографии, демонстрирующие целенаправленное введение в гепатоциты печени PBAVE-полимера, замаскированного A) CDM-ПЭГ (слева) или Б) CDM-ПЭГ плюс CDM-Pip-LBA;

на фиг.5 - микрофотографии, демонстрирующие введение замаскированного конъюгата полинуклеотид-полимер в гепатоциты in vivo;

на фиг.6 - график, иллюстрирующий «выключение» гена-мишени in vivo после опосредуемого поликонъюгатом введения обладающей активностью в отношении гена ppara siPHK (siPHK ppara);

на фиг.7 - микрофотографии, демонстрирующие введение dsДНК в печень in vivo с использованием (A) ДНК-DW1360-CDM-ПЭГ/NAG, (Б) ДНК+DW1360-CDM-ПЭГ/NAG (полинуклеотид, не конъюгирован с полимером), (В) ДНК-DW1360-CDM-ПЭГ/глюкоза и (Г) ДНК-DW1360-СВМ-ПЭГ/манноза. Данные для меченной с помощью Су3 ДНК представлены в левом верхнем квадрате на каждой панели, для актина, окрашенного снабженным флуоресцентной меткой ALEXA®-488 фаллоидином, - в верхнем правом квадрате, для ядер - в левом нижнем квадрате и объединенное изображение - в правом нижнем квадрате;

на фиг.8 - графики и блоты, иллюстрирующие «выключение» экспрессии гена-мишени в печени мышей после внутривенного введения включающих siPHK поликонъюгатов. (А) Снижение уровней мРНК ароВ в печени после обработки поликонъюгатами, содержащими обладающую активностью в отношении гена ароВ siPHK (siPHK ароВ). (Б) Уровни в сыворотке белка ароВ-100 у обработанных содержащими siPHK ароВ поликонъюгатами мышей. (В) Снижение уровней мРНК ppara в печени после внутривенного введения содержащих siPHK ppara поликонъюгатов;

на фиг.9 - график, иллюстрирующий дозовую зависимость содержащего siPHK ароВ-1 поликонъюгата. (А) «Выключение» мРНК ароВ после инъекции серийных разведений содержащего siPHK ароВ-1 поликонъюгата. (Б) «Выключение» мРНК ароВ после инъекции различных количеств siPHK;

на фиг.10 - график, иллюстрирующий уровни холестерина у мышей, обработанных содержащим siPHK ароВ-1 поликонъюгатом;

на фиг.11 - микрофотографии, демонстрирующие накопление липидов в печени мышей после введения поликонъюгата, содержащего (А) siPHK ароВ или (Б) siPHK GL3, применяемой в качестве отрицательного контроля, или (В) только физиологического раствора;

на фиг.12 - график, иллюстрирующий ингибирование экспрессии гена (А) и снижение в результате уровня холестерина (Б) через 2-15 дней после введения содержащего siPHK ароВ-1 конъюгата мышам в день 0;

на фиг.13 - микрофотографии, демонстрирующие введение in vivo антител к гепатоцитам посредством введения антитела, обратимо конъюгированного с DW1360 и замаскированного с помощью CDM-ПЭГ и CDM-NAG. В верхнем левом квадрате представлены данные для меченых антител, в верхнем правом квадрате - для актина, в нижнем левом квадрате - для ядер и в нижнем правом квадрате - объединенное изображение;

на фиг.14 - график, иллюстрирующий «выключение» гена в первичных гепатоцитах, трансфектированных siPHK АроВ, которую вводили с помощью поступающего в продажу реагента для трансфекции in vitro или с помощью различных количеств поликонъюгата, содержащего siPHK ароВ;

на фиг.15 - график, иллюстрирующий трансфекцию конъюгатами, содержащими siPHK, клеток линии Hepa-1c1c7 in vitro: «только конъюгат» обозначает замаскированную siPHK-PLL;

на фиг.16 - график, иллюстрирующий флуоресценцию DPH в присутствии PBAVE;

на фиг.17 - графики, иллюстрирующие А) профили элюции стандартов ПЭГ на колонке Shodex SB-803; Б) калибровочную кривую для колонки Shodex SB-803 и В) калибровочную кривую для расчета молекулярной массы PBAVE-полимера;

на фиг.18 - графики, иллюстрирующие А) профили элюции меченных Су3 стандартов нуклеиновых кислот и замаскированного конъюгата полинуклеотид-полимер. Б) калибровочную кривую для гель-фильтрации на Sephacryl S-500-колонке и В) калибровочную кривую для расчета молекулярной массы замаскированного конъюгата полинуклеотид-полимер;

на фиг.19 - микрофотографии, демонстрирующие введение in vivo полинуклеотида в позитивные по рецептору галактозы опухоли (А-Б) или негативные по рецептору галактозы опухоли (В-Г) с помощью конъюгатов олигонуклеотид-полимер-СDМ/ПЭГ/NAG (А, В) или конъюгатов олигонуклеотид-полимер-СDМ/ПЭГ/глюкоза (Б, Г).

Подробное описание изобретения

Настоящее изобретение относится к соединениям, композициям и способам, пригодным для введения в клетки млекопитающих полинуклеотидов или других не обладающих способностью проникать в клетку молекул. В настоящем описании предложена поликонъюгатная система для введения полинуклеотидов или других не обладающих способностью проникать через мембраны молекул в клетки in vivo. Поликонъюгатная система включает агенты, обладающие способностью обеспечивать направленный перенос, способностью противодействовать опсонизации, агрегации и обладающие трансфекционной активностью, сосредоточенные в предназначенном для введения носителе небольшого, менее 50 нанометров, размера. Имеющим решающее значение компонентом системы является обратимость связей, соединяющих компоненты системы.

Первым компонентом описанных конъюгатов, предназначенных для введения in vivo полинуклеотидов, является обратимая в физиологических условиях ковалентная связь полинуклеотида с обладающим активностью в отношении мембран полимером. Ковалентное присоединение полинуклеотида к обладающему активностью в отношении мембран полимеру гарантирует, что полинуклеотид не будет легко отщепляться в результате диссоциации от полимера при введении in vivo или ех vivo в присутствии сыворотки, и в результате обеспечивает совместное введение полинуклеотида с обладающим активностью в отношении мембран полимером в клетку-мишень. Однако ковалентное присоединение полинуклеотида к полимеру может делать полинуклеотид неактивным. Таким образом, присоединение полинуклеотида к обладающему активностью в отношении мембран полимеру осуществляют через физиологически обратимую связь или мостик. Благодаря применению физиологически обратимой связи полинуклеотид может отщепляться от полимера, высвобождая полинуклеотид, который вступает в функциональное взаимодействие с компонентами клетки. В результате выбора соответствующей обратимой связи можно создавать конъюгат, из которого полинуклеотид высвобождается только после его введения в требуемую область, такую как клеточная цитоплазма.

Второй компонент описанных применяемых in vivo конъюгатов, предназначенных для введения полинуклеотидов, содержит обратимую модификацию обладающего активностью в отношении мембран полимера. Обратимая модификация обладающего активностью в отношении мембран полимера снижает непродуктивные взаимодействия с сывороткой и не являющейся мишенью клеткой и снижает токсичность. Маскирующий агент может также придавать дополнительную требуемую функцию конъюгата, такую как повышение взаимодействия с клеткой-мишенью или усиление эндоцитоза конъюгата. Полимер маскируют путем ковалентного присоединения маскирующего агента к полимеру посредством физиологически обратимой ковалентной связи. Маскирующий агент может представлять собой стабилизатор стерической конфигурации, обеспечивающую направленный перенос группу или модифицирующий заряд агент. Маскирующий агент может защищать полимер от неспецифических взаимодействий, повышать время нахождения в кровотоке, повышать специфические взаимодействия, ингибировать токсичность или изменять заряд полимера. Каждая из указанных модификаций может изменять активность полимера в отношении мембраны, приводя к тому, что модифицированный полимер может оказаться неспособным облегчать введение полинуклеотида. Поэтому присоединение маскирующего агента к обладающему активностью в отношении мембран полимеру осуществляют через физиологически обратимую связь. Благодаря применению физиологически обратимой связи маскирующий агент может отщепляться от полимера, оставляя полимер без маскировки, и это приводит к восстановлению активности незамаскированного полимера. В результате выбора соответствующей обратимой связи можно создавать конъюгат, при использовании которого восстанавливается активность обладающего активностью в отношении мембран полимера после его введения в или достижения требуемого типа клеток или клеточной области.

Изобретение относится к системам введения на основе конъюгата общей формулы:

N-L1-P-(L2-M)y,

в которой N обозначает полинуклеотид или другую не обладающую способностью проникать в клетку молекулу, L1 обозначает обратимую связь, Р обозначает полимер, L2 обозначает вторую обратимую связь и М обозначает маскирующий агент. Маскирующий агент М защищает или модифицирует свойства или взаимодействие Р, y обозначает целое число больше 0. Предпочтительным полимером является обладающий активностью в отношении мембран полимер. Другой предпочтительный полимер представляет собой предназначенный для трансфекции полимер. Один полимер можно связывать с несколькими маскирующими агентами. Несколько маскирующих агентов можно связывать с полимером через несколько обратимых связей. После расщепления обратимой связи L2 замаскированное свойство или способность к взаимодействию у полимера Р восстанавливается. Маскирующий агент М может придавать дополнительную функцию полимеру Р, такую как связывание с клеточным рецептором. Обратимая связь L1 может быть такой же или может отличаться от обратимой связи L2 (быть ортогональной ей). Обратимое сцепление обратимой связи L1 или L2 выбирают так, чтобы расщепление происходило в требуемой физиологической среде, такой, которая присутствует в требуемой ткани, органе и субклеточной области, или в ответ на добавление фармацевтически приемлемого экзогенного агента. Полинуклеотид N и маскирующий агент М можно присоединять к полимеру Р в любом месте на полимере Р.

Полимеры

Полимер, представляет собой молекулу, состоящую из повторяющихся связанных между собой более мелких элементов (звеньев), которые называют мономерами. Полимер может быть линейным, разветвленным, разветвленным сетчатым, звездчатым, гребенчатым или лестничным. Основная цепь полимера состоит из атомов, связи которых необходимы для увеличения длины полимера. Например, поли-L-лизин, углерод карбонила, α-углерод и α-аминогруппы требуются для удлинения полимера и поэтому являются атомами, входящими в основную цепь. Боковая цепь полимера состоит из атомов, связи которых не требуются для увеличения длины полимера.

Полимер может представлять собой гомополимер, для получения которого применяют одинаковые мономеры, или полимер может представлять собой сополимер, для получения которого применяют два или большее количество различных типов мономеров. Сополимеры могут представлять собой чередующиеся, статистические (произвольные) сополимеры, блок-сополимеры и привитые (гребенчатые) сополимеры.

Чередующиеся полимеры содержат мономеры в различном повторяющемся порядке, таком как -[А-В]n-. Мономеры чередующихся полимеров, как правило, не гомополимеризуют, а подвергают взаимодействию друг с другом с образованием чередующегося сополимера.

Мономеры в статистических сополимерах не имеют определенного порядка или расположения в любой конкретной цепи, т.е. имеют следующее строение: -An-Bm-. Общие композиции таких полимеров отражают соотношение входящих в него (загруженных) мономеров. Однако точное соотношение одного и другого мономера может быть различным в разных цепях. Распределение мономеров также может быть различным в каждом полимере. Кроме того, химические свойства мономера могут влиять на уровень его включения в статистический сополимер и его распределение в полимере. Таким образом, хотя соотношение мономеров в статистическом сополимере зависит от соотношения загруженных мономеров, степень загрузки может не соответствовать точно соотношению включенных мономеров.

Блок-полимер имеет сегмент или блок одного полимера (полиА), за которым следует сегмент или блок второго полимера (полиВ): т.е. -полиА-полиВ-. В результате различные полимерные цепи соединяют по типу конфигурации голова-к-хвосту. Таким образом, блок-полимер имеет линейное расположение блоков различных по составу мономеров. Как правило, хотя и необязательно, полимерные блоки являются гомополимерами, при этом полимер А может состоять из мономеров, отличных от мономеров, из которых состоит полимер В. Диблок-сополимер представляет собой полиА-полиВ, а триблок-сополимер представляет собой полиА-полиВ-полиА. Если А представляет собой гидрофильную группу, а В представляет собой гидрофобную группу, то образовавшийся блок-сополимер может представлять собой полимерное поверхностно-активное вещество. Привитый полимер является таким типом блок-сополимера, в котором цепи одного полимера привиты в боковые цепи другого мономера, например, как показано ниже (где n, m, х, y и z обозначают целые числа):

Мономеры

В процессах полимеризации можно использовать широкое разнообразие мономеров. Мономеры могут быть катионными, анионными, цвиттерионными, гидрофильными, гидрофобными, липофильными, амфипатическими или амфотерными. Мономеры сами могут представлять собой полимеры. Мономеры могут содержать химические группы, которые можно модифицировать до или после полимеризации. Такие мономеры имеют реактивные группы, выбранные из ряда, включающего: амин (первичный, вторичный и третичный), амид, карбоновую кислоту, сложный эфир, гидразин, гидразид, гидроксиламин, галоидалкил, альдегид и кетон. Предпочтительно реактивную группу можно модифицировать после конъюгации полинуклеотида или в водном растворе.

Как известно специалистам в области полимеризации, существует несколько категорий процессов полимеризации. Например, полимеризация может быть цепной или ступенчатой.

Ступенчатая полимеризация

При ступенчатой полимеризации полимеризацию осуществляют постадийно. Для удлинения полимера используют реакцию между мономерами, олигомерами и полимерами. При этом не требуется никакой инициации, так как одна и та же реакция имеет место на всем протяжении и не имеет стадии обрыва цепи, поскольку концевые группы еще являются реактивными. Скорость полимеризации снижается в зависимости от поглощения функциональных групп.

Полимер можно создавать с помощью ступенчатой полимеризации, используя мономеры, которые имеют две реактивные группы (А и В) в одном и том же мономере (гетеробифункциональный), при этом А содержит реактивную группу и В содержит реактивную в отношении А группу (реактивная группа, которая образует ковалентную связь с А). Полимеризация А-В позволяет получать -[А-В]n-. Реактивные группы А и В можно соединять ковалентной связью или множеством ковалентных связей, получая состоящий из мономеров полимер. Полимер можно создавать также путем ступенчатой полимеризации, используя гомобифункциональные мономеры, такие как А-А+В-В, получая -[А-А-В-В]n-. Как правило, эти реакции могут включать ацилирование и алкилирование. Две реактивные группы мономера можно соединять одной ковалентной связью или множеством ковалентных связей.

Если реактивная группа А представляет собой амин, то В представляет собой обладающую реактивностью в отношении амина группу, которую можно выбирать из группы, включающей: изотиоцианат, изоцианат, ацилазид, N-гидроксисукцинимид, сульфонилхлорид, альдегид (включая формальдегид и глутаровый альдегид), кетон, эпоксид, карбонат, сложный имидоэфир, карбоксилат, активированный карбодиимидом, алкилфосфат, галоидарилы (дифтординитробензол), ангидрид, галогенангидрид, сложный пара-нитрофениловый эфир, сложный орто-нитрофениловый эфир, сложный пентахлорфениловый эфир, сложный пентафторфениловый эфир, карбонилимидазол, карбонилпиридиний и карборилдиметиламинопиридиний. Другими словами, если реактивная группа А представляет собой амин, то В может представлять собой ацилирующий или алкилирующий агент или агент для аминирования.

Если реактивная группа А представляет собой сульфгидрил (тиол), то В представляет собой обладающую реактивностью в отношении тиола группу, которую можно выбирать из группы, включающей: йодацетильное производное, малеимид, азиридиновое производное, акрилоильное производное, фторбензольное производное и дисульфидное производное (такое как пиридилдисульфид или производные 5-тио-2-нитробензойной кислоты (TNB)).

Если реактивная группа А представляет собой карбоксилат, то реактивная группа В представляет собой обладающую реактивностью в отношении карбоксилата группу, которую можно выбирать из группы, включающей: диазоацетат и амин, в качестве которого используют карбодиимид. Можно применять другие добавки, такие как карбонилимидазол, диметиламинопиридин (ДМАП), N-гидроксисукцинимид или спирт, в случае применения карбодиимида и ДМАП.

Если реактивная группа А представляет собой гидроксил, то реактивная группа В представляет собой обладающую реактивностью в отношении гидроксила группу, которую можно выбирать из группы, включающей: эпоксид, оксиран, активированный карбамат, активированный сложный эфир и галоидалкил.

Если реактивная группа А представляет собой альдегид или кетон, то реактивная группа В представляет собой обладающую реактивностью в отношении альдегида или кетона группу, которую можно выбирать из группы, включающей: гидразин, производное гидразида, амин (для получения основания Шиффа, которое можно не восстанавливать или восстанавливать с помощью восстановителя, такого как NaCNBH3) и гидроксилсодержащее соединение.

Полимер можно создавать с помощью ступенчатой полимеризации, используя бифункциональные. Мы вынуждены признать правоту экспертизы, признак, относящийся к приему с пищей, характеризует способ лечения и не имеет отношения к применению для приготовления лекарственного средства. Как нам кажется, можно было бы обосновать, что этот признак является существенным для заявленного применения, только если будет доказано, что прием лекарственного средства во время еды оказывает влияние на его получение. Мономеры и другие агенты, такие, например, как А-А плюс другой агент, с получением -[А-А]n-.

Если реактивная группа А представляет собой сульфгидрильную (тиол) группу, то ее затем можно превращать в дисульфидные мостики с помощью окислителей, таких как йод (I2), перйодат натрия (NaIO4) или кислород (O2). Если реактивная группа А представляет собой амии, то ее можно превращать в тиол путем взаимодействия с 2-иминотиолатом (реагент Траута), который затем подвергают окислению и образованию дисульфида. Для катализа формирования дисульфидного мостика можно применять также дисульфидные производные (такие как пиридилдисульфид или производные TNB).

Реактивные группы А или В в любом из приведенных выше примеров могут представлять собой также фотореактивную группу, такую как арилазид (включая галогенированный арилазид), диазогруппу, бензофенон, алкин или диазириновое производное.

Реакции с участием амина, гидроксила, сульфгидрила или карбоксилата позволяют получать химические связи, которые описаны как амиды, амидины, дисульфиды, простые эфиры, сложные эфиры, енамипы, имины, мочевины, изотиомочевины, изомочевины, сульфонамиды, карбаматы, алкиламинные связи (вторичные амины) и простые связи типа углерод-азот, в которых углерод содержит гидроксильную группу, простой тиоэфир, диол, гидразон, диазогруппу или сульфон.

Цепная полимеризация

При цепной реакции полимеризации рост полимера происходит в результате последовательного добавления мономерных звеньев до достижения определенной длины растущих цепей. Механизмы инициации и роста являются различными и, как правило, включают стадию обрыва цепи. Цепные реакции полимеризации могут быть радикальными, анионными или катионными. Мономеры для цепной полимеризации можно выбирать из таких групп, как: винил, простой виниловый эфир, акрилатные, метакрилатные, акриламидные и метакриламидные группы. Цепную полимеризацию можно осуществлять также посредством циклической полимеризации или полимеризации с раскрытием кольца. Можно применять также несколько различных типов ингибиторов свободных радикалов, включая (но, не ограничиваясь только ими): пероксиды, гидроксипероксиды и азосоединения, такие как дигидрохлорид 2,2′-азобис(амидинопропана) (ААР).

Эффективность трансфекции

Понятие трансфекция относится к переносу полинуклеотида или другого биологически активного соединения снаружи клетки внутрь клетки, так, чтобы при этом полинуклеотид или биологически активное соединение являлось функциональным. Примерами реагентов для трансфекции, предназначенных для введения полинуклеотидов в клетки т vitro, являются, но, не ограничиваясь только ими: липосомы, липиды, полиамины, осадки фосфата кальция, гистонные белки, полиэтиленимин и полиамфолитные комплексы и их комбинации. Многие из предназначенных для трансфекции in vitro реагентов являются катионными, что позволяет реагенту ассоциироваться или образовывать комплекс с отрицательно заряженными нуклеиновыми кислотами посредством электростатического взаимодействия.

Обладающие активностью в отношении мембран полимеры

Обладающие активностью в отношении мембран полимеры представляют собой амфипатические полимеры, которые могут индуцировать одно или несколько следующих воздействий на биологическую мембрану: изменять или разрушать мембрану, что позволяет не обладающим способностью проникать через мембрану молекулам входить в клетку или пересекать мембрану, образование пор в мембране, расщепление мембран или разрушение или растворение мембраны. В контексте настоящего описания мембрана или клеточная мембрана содержит липидный бислой. Обладающие активностью в отношении мембран полимеры, предлагаемые в изобретении, включают такие полимеры, которые облегчают введение полинуклеотида или другой не обладающей способностью проникать через мембрану молекулы снаружи клетки внутрь клетки и предпочтительно в цитоплазму клетки. Функциональную активность в отношении изменения или разрушения мембраны полимера или соединения можно определять по их роли по меньшей мере в одном из следующих процессов: лизис клеток крови (гемолизис), слияние, вытекание содержимого из липосом, слияние с липосомами, клеточное слияние, клеточный лизис и высвобождение эндосом. Обладающие активностью в отношении мембран полимеры, которые могут вызывать лизис клеточных мембран, называют мембранолитическими полимерами. Обладающие активностью в отношении мембран полимеры, которые могут разрушать эндосомы или лизосомы, относятся к эндосомолитическим полимерам. Воздействие обладающих активностью в отношении мембран полимеров на клеточную мембрану может быть кратковременным. Активность полимера в отношении мембраны определяют на основе его аффинности к мембране, которая обусловливает денатурацию или деформацию двухслойной структуры. Обладающие активностью в отношении мембран полимеры могут представлять собой синтетические или не встречающиеся в естественных условиях амфипатические полимеры. Обладающие активностью в отношении мембран полимеры могут обладать трансфекционной активностью in vitro. Обладающие активностью в отношении мембран полимеры могут быть катионными, анионными, амфипатическими, амфотерными, поверхностно-активными или представлять собой их комбинации.

Введение полинуклеотида или другой не обладающей способностью проникать через мембрану молекулы в клетку опосредуется индуцируемым обладающим активностью в отношении мембран полимером разрушением или дестабилизацией плазменной мембраны или мембраны внутренних пузырьков (таких как эндосома или лизосома), включая образование пор в мембране или нарушение функции эндосом или лизосом.

В контексте настоящего описания обладающие активностью в отношении мембран полимеры отличаются от класса полимеров, обозначенных как проникающие в клетку пептиды или полимеры, представителями которых являются такие соединения как богатый аргинином пептид, выведенный из ТАТ-белка ВИЧ, пептид antennapedia (обусловливающий развитие ног вместо головы у Drosophila), VP22-пептид, транспортан, богатые аргинином искусственные пептиды, небольшие богатые гуанидием искусственные полимеры или т.п. Хотя проникающие в клетку соединения, вероятно, транспортируют некоторые молекулы через мембрану с одной стороны липидного бислоя на другую сторону липидного бислоя, вероятно без необходимости в эндоцитозе и без разрушения целостности мембраны, их механизм действия пока не известен и ведется дискуссия о самой их активности.

Эндосомолитические полимеры

Эндосомолитические полимеры представляют собой полимеры, которые в ответ на изменение значения рН могут вызывать разрушение или лизис эндосомы или служат для выхода в норме не обладающего способностью проникать через мембрану соединения, такого как полинуклеотид или белок, из заключенного во внутреннюю клеточную мембрану пузырька, такого как эндосома или лизосома. Высвобождение из эндосомы является важным для введения широкого разнообразия молекул, которые проникают благодаря эндоцитозу, но не обладают способностью диффундировать через клеточные мембраны. В эндосомолитическпх полимерах происходит сдвиг их физико-химических свойств при физиологически приемлемых значениях рН (как правило, рН 5,5-8). Этот сдвиг может приводить к изменению растворимости полимера, его способности взаимодействовать с другими соединениями и изменению гидрофобности или гидрофильности. Репрезентативные эндосомолитические полимеры могут нести рН-титруемые группы или рН-лабильные группы или связи. В контексте настоящего описания под рН-титруемыми группами подразумевают группы, которые являются обратимыми акцепторами или донорами протонов в воде в зависимости от значения рН в физиологических условиях, т.е. при значении рН от 4 до 8. Для рН-титруемых групп характерны значения pKa в диапазоне от 4 до 8, и они действуют в качестве буферов при указанных значениях рН. Так, рН-титруемые группы приобретают или теряют заряд при более низких значениях рН среды, окружающей эндосому. Группы, титруемые при физиологических значениях рН, можно определять экспериментально путем осуществления кислотно-основного титрования и экспериментального определения, обладает ли группа забуферивающим действием при значениях рН от 4 до 8. Примерами групп, которые могут обладать забуферивающими свойствами при таких значения рН, являются, но, не ограничиваясь только ими: карбоновые кислоты, имидазол, N-замещенный имидазол, пиридин, фенолы и полиамины. Полимеры, несущие рН-титруемые группы, могут разрушать внутренние пузырьки с помощью так называемого эффекта «протонной губки». Таким образом, обратимо замаскированный обладающий активностью в отношении мембран полимер, где маскирующие агенты присоединены к полимеру через рН-лабильные связи, можно рассматривать как эндосомолитический полимер.

Подгруппой эндосомолитических соединений являются фузогенные соединения, включая фузогенные пептиды. Фузогенные пептиды могут облегчать высвобождение из эндосомы агентов, таких как олигомерные соединения, в цитоплазму. Вероятно, фузогенные пептиды изменяют конформацию при кислых значениях рН, эффективно дестабилизируя эндосомную мембрану, повышая тем самым поступление в цитоплазму содержимого эндосомы. Примерами фузогенных пептидов являются пептиды, выведенные из полимиксина В, вируса гриппа НА2, GALA, KALA, EALA, мелиттина и пептидов-производных мелиттина, β-амилоидного пептида, связанного с болезнью Альцгеймера, и т.п.

Полиамфолиты

Полиамфолитным является полимер, содержащий и анионные, и катионные мономерные звенья. Более конкретно в контексте настоящего описания полиамфолит содержит множество анионных мономеров и множество катионных мономеров. Полиамфолитный полимер необязательно может содержать неионные мономерные звенья. В водных растворах осаждение полиамфолитов происходит вблизи их изоэлектрической точки. Полиамфолит можно получать полимеризацией анионных и катионных мономеров, включая полимерные мономеры. В другом варианте полиамфолит можно получать путем модификации более чем одной, но не всех заряженных групп полимера. Если заряженные группы модифицируют обратимо, то получают обратимый полиамфолит.

Амфипатические полимеры

Амфипатические или амфифильные полимеры хорошо известны и признаны в данной области, они имеют как гидрофильные (полярные, водорастворимые), так и гидрофобные (неполярные, липофильные, водонерастворимые) группы или фрагменты. Гидрофильными группами в качественных понятиях являются химические фрагменты, которые «отдают предпочтение» воде. Как правило, указанные химические группы являются водорастворимыми и являются донорами или акцепторами водородных связей в воде. Гидрофильная группа может быть заряженной или незаряженной. Заряженные группы могут быть положительно заряженными (анионные) или отрицательно заряженными (катионные) или нести оба заряда. Амфипатическое соединение может представлять собой полианион, поликатион, цвиттерион или полиамфолит. Примерами гидрофильных групп являются соединения, несущие следующие химические фрагменты: углеводы, полиоксиэтилен, некоторые пептиды, олигонуклеотиды и группы, содержащие амины, амиды, алкоксиамиды, карбоновые кислоты, атомы серы или гидроксильные радикалы. Гидрофобными группами в качественных понятиях являются химические фрагменты, которые «избегают» воду. Как правило, такие химические группы не являются водорастворимыми и не имеют тенденцию образовывать водородные связи. Липофильные группы растворимы в жирах, маслах, липидах и неполярных растворителях и обладают невысокой способностью или не обладают вообще способностью образовывать водородные связи. Углеводороды (содержащие 2 или большее количество атомов углерода), определенные замещенные углеводороды, холестерин, производные холестерина и некоторые пептиды являются примерами гидрофобных групп. В контексте настоящего описания к амфипатическим полимерам относят, в частности, молекулу, полученную при расщеплении ковалентной связи и замене ее на водород. Например, в бутиламине расщепление связей между углеродом и азотом с заменой на атомы водорода приводит к получению аммиака (гидрофильное соединение) и бутана (гидрофобное соединение). Однако, если 1,4-диаминобутан расщепляют на связях азот-углерод и заменяют на атомы водорода, то образовавшиеся молекулы и в этом случае представляют собой аммиак (2×) и бутан. Однако 1,4,-диаминобутан не рассматривается как амфипатическое соединение, поскольку для образования гидрофобного фрагмента требуется расщепление двух связей.

Встречающийся в естественных условиях полимер представляет собой полимер, который можно обнаружить в природе. Их примерами являются полинуклеотиды, белки, коллаген и полисахариды (крахмалы, целлюлоза, гликозамингликаны, хитин, агар, агароза). Встречающийся в естественных условиях полимер можно выделять из биологического источника, или он может быть синтетическим. Синтетический полимер можно составлять или получать путем химического процесса, осуществляемого человеком, и не создавать с помощью встречающихся в естественных условиях биологических процессов. Не встречающийся в естественных условиях полимер представляет собой синтетический полимер, который не создан из встречающихся в естественных условиях материалов (животного или растительного происхождения) или мономеров (таких как аминокислоты, нуклеотиды и сахариды). Полимер может быть полностью или частично природным, синтетическим или неприродным.

Полимер может иметь одну или несколько лабильных или расщепляемых связей. Если лабильные связи являются расщепляемыми в физиологических условиях или клеточных физиологических средах, то полимер является биоразложимым. Расщепляемая связь может находиться либо в основной цепи, либо в боковой цепи. Если расщепляемая связь находится в основной цепи, то расщепление связи приводит к уменьшению длины полимера и образованию двух или большего количества молекул. Например, более мелкие полимеры простого поливинилового эфира можно объединять через лабильные связи с получением более крупных полимеров простого поливинилового эфира. Если расщепляемая связь находится в боковой цепи, то расщепление связи приводит к потере атомов боковой цепи полимера.

В настоящем описании представлен класс амфипатических поливиниловых статистических сополимеров. Поливиниловые сополимеры можно синтезировать из двух, трех или большего количества различных мономеров.

Предпочтительные мономеры можно выбирать из ряда, включающего: заряженный простой виниловый эфир, простой виниловый эфир, содержащий защищенную ионную группу, простой виниловой эфир с защищенным фталимидом амином, простой ацилвиниловый эфир, простой алкилвиниловый эфир, простой (низш.)алкилвиниловый эфир, простой (высш.)алкилвиниловый эфир, простой бутилвиниловый эфир, простой додецилвинидовый эфир, простой октадецилвиниловый эфир, простой виниловый эфир холестерина и другие углеводородсодержащие гидрофобные простые виниловые эфиры.

Класс представляющих наибольший интерес полимеров включает: содержащие амин статистические сополимеры простого поливинилового эфира, полученные в результате полимеризации с тремя мономерами: фталимидные мономеры, небольшие гидрофобные мономеры и крупные гидрофобные мономеры. Удаление защиты фталимидного мономера позволяет получать аминовый мономер. Небольшие гидрофобные мономеры содержат углерод-водородные цепи с 2-6 атомами углерода. Крупные гидрофобные мономеры содержат углерод-водородные цепи, включающие от примерно 10 до примерно 22 атомов углерода или от примерно 12 до примерно 18 атомов углерода. Гидрофобные мономеры среднего размера содержат углерод-водородные цепи, содержащие от примерно 6 до примерно 10 атомов углерода. Предпочтительные полимеры простого аминополивинилового эфира представляют собой: полимер простого амино-/бутил-/октадецилполивинилового эфира или полимер амино-/бутил-/додецилполивинилового эфира.

Биофизические свойства статистических сополимеров простого поли(винилового) эфира определяются конкретными выбранными мономерами, соотношением, в котором они включены в полимер, и размером полимера. Различные полимеры можно получать, изменяя степень загрузки мономеров в реакции полимеризации. Хотя соотношение включенных мономеров в полимер может быть такой же, что и степень загрузки мономеров, соотношения могут быть различными. Вне зависимости от того, соответствует ли включение мономеров степени загрузки или соответствует другому соотношению, можно изменять степень загрузки мономеров для достижения требуемого соотношения включения мономеров. Предпочтительный простой аминополивиниловый эфир представляет собой растворимый в воде обладающий активностью в отношении мембран амин-/бутил-/октадециловый или амин/бутил/додециловый статистический триполимер. Можно синтезировать полимеры со сходным содержанием подобных аминовых и гидрофобных полимеров из полиаминов, таких как: полиэтиленимин, полилизин, поливиниламин и полиаллиламин, или других полимеров, таких как поливиниловый спирт, посредством модификации боковых цепей этих полимеров.

Предпочтительные обладающие активностью в отношении мембран полимеры, предлагаемые в изобретении, имеют растворимость в воде, составляющую 1 мг/мл или более. Предпочтительные обладающие активностью в отношении мембран полимеры, предлагаемые в изобретении, являются поверхностно-активными веществами. Обладающие активностью в отношении мембран полимеры, предлагаемые в изобретении, предпочтительно имеют молекулярную массу от примерно 5 до примерно 100 кДа, более предпочтительно от примерно 7 до примерно 50 кДа и наиболее предпочтительно от примерно 10 до примерно 30 кДа.

Маскирующий агент

Полимеры, которые могут обеспечивать введение полинуклеотида снаружи клетки в цитоплазму часто обладают токсичностью или плохим биораспределением in vivo. В результате необходимо маскировать свойства полимера, который характеризуется токсичностью или плохим биораспределением. Поскольку, модифицируя полимер с целью маскировки указанных свойств можно также инактивировать трансфекционную активность или активность в отношении мембран полимера, то маскирующие агенты соединяют с полимером через физиологически обратимые связи. Расщепление связи восстанавливает защищенное или замаскированное свойство полимера.

В контексте настоящего описания подразумевается, что маскирующий агент представляет собой молекулу, которая, будучи связана с полимером, защищает, ингибирует или инактивирует одно или несколько свойств (биофизические или биохимические характеристики) полимера. Маскирующий агент может придавать также дополнительную активность или функцию полимеру, которая отсутствует у полимера без маскирующего агента. Свойства полимеров, которые можно маскировать, включают: активность в отношении мембран, эндосомолитическая активность, заряд, эффективный заряд, активность трансфекции, взаимодействия в сыворотке, взаимодействия с клетками и токсичность. Маскирующие агенты могут также ингибировать или предупреждать агрегацию конъюгата полинуклеотид-полимер в физиологических условиях. Маскирующие агенты, предлагаемые в изобретении, можно выбирать из группы, включающей: стабилизаторы стерической конфигурации, группы, обеспечивающие направленный перенос, и модификаторы заряда. С одним полимером можно обратимо связывать несколько маскирующих агентов. Для инактивации определенного свойства полимера может потребоваться связывать более одного маскирующего агента с полимером. Для достижения требуемого уровня инактивации с полимером связывают достаточное количество маскирующих агентов. Требуемый уровень модификации полимера, достигаемый благодаря присоединению маскирующего(их) агента(ов) легко определять с помощью соответствующих анализов активности полимера. Например, если полимер обладает активностью в отношении мембран в данном анализе, достаточное количество маскирующего агента связывают с полимером для достижения требуемого уровня ингибирования активности в отношении мембран в данном анализе. Для ингибирования агрегации полимера в физиологических условиях можно обратимо связывать с полимером достаточное количество маскирующего агента. Можно применять более одного вида маскирующих агентов. Например, с полимером можно связывать как стабилизаторы стерической конфигурации, так и обеспечивающие направленный перенос группы. Стабилизаторы стерической конфигурации и обеспечивающие направленный перенос группы могут функционировать также в качестве модификаторов заряда, но могут и не обладать такой функцией. Маскирующие агенты, предлагаемые в изобретении, обратимо связывают с полимером. В контексте настоящего описания подразумевается, что маскирующий агент обратимо связан с полимером, если обращение связи приводит к восстановлению замаскированной активности полимера. Маскирующие агенты связывают с полимером путем образования обратимых ковалентных связей с реактивными группами полимера. Реактивные группы можно выбирать из ряда, включающего: амины, спирты, тиолы, гидразиды, альдегиды, карбоксилы и т.д. От одной до всех реактивных групп или заряженных групп в полимере можно обратимо модифицировать. В одном из вариантов осуществления изобретения по меньшей мере два маскирующих агента обратимо связывают с полимером. В другом варианте осуществления изобретения маскирующие агенты обратимо связывают примерно с 20%, 30%, 40%, 50%, 60%, 70% или 80% реактивных групп полимера. В другом варианте осуществления изобретения маскирующие агенты обратимо связывают примерно с 20%, 30%, 40%, 50%, 60%, 70% или 80% заряженных групп полимера. В следующем варианте осуществления изобретения количество (в процентах) маскирующих агентов, обратимо связывающих полимер с заряженными группами полимера, составляет примерно 20%, 30%, 40%, 50%, 60%, 70% или 80%.

В контексте настоящего описания подразумевается, что полимер является замаскированным, если одно или несколько свойств полимера ингибируется или инактивируется присоединением одного или нескольких маскирующих агентов. Полимер является обратимо замаскированным, если расщепление связей, соединяющих маскирующие агенты с полимером, приводит к восстановлению замаскированного свойства полимера.

Предпочтительные маскирующие агенты, предлагаемые в изобретении, обладают способностью модифицировать полимер (формировать обратимую связь с полимером) в водном растворе. Конкретным примером соединения, которое можно применять, является производное малеинового ангидрида, в котором R1 обозначает метил (-СН3) и R2 обозначает группу пропионовой кислоты (-(СН2)2CO2H) или эфиры/амиды кислоты.

В контексте настоящего описания подразумевается, что стабилизатор стерической конфигурации представляет собой природный, синтетический или не встречающийся в естественных условиях неионный гидрофильный полимер, который препятствует внутримолекулярным или межмолекулярным взаимодействиям полимера, к которому он присоединен, относительно полимера, который не содержит стабилизатор стерической конфигурации. Стабилизатор стерической конфигурации препятствует участию полимера в электростатических взаимодействиях. Электростатические взаимодействия представляют собой нековалентную ассоциацию двух или большего количества субстанций благодаря силам притяжения между положительными и отрицательными зарядами. Стабилизаторы стерической конфигурации могут ингибировать взаимодействие с компонентами крови и, как следствие, опсонизацию, фагоцитоз и поглощение системой эндоплазматического ретикулума. Таким образом, стабилизаторы стерической конфигурации могут повышать время нахождения в кровотоке молекул, к которым они присоединены. Стабилизаторы стерической конфигурации могут также ингибировать агрегацию полимера. Предпочтительными стабилизаторами стерической конфигурации являются полиэтиленгликоль (ПЭГ) и производные ПЭГ. В контексте настоящего описания подразумевается, что предпочтительный ПЭГ может содержать примерно 1-500 этиленгликольных мономеров, 2-20 этиленгликольных мономеров, 5-15 этиленгликольных мономеров или примерно 10 этиленгликольных мономеров. В контексте настоящего описания подразумевается, что предпочтительный ПЭГ может также иметь среднюю молекулярную массу примерно 85-20000 Дальтон (Да), примерно 200-1000 Да, примерно 200-750 Да или примерно 550 Да. Другие приемлемые стабилизаторы стерической конфигурации можно выбирать из группы, включающей: полисахариды, декстран, циклодекстрин, поли(виниловый спирт), поливинилпирролидон, 2-гидроксипропилметакрилат (НРМА) и водорастворимые простые эфиры целлюлозы.

Обеспечивающие направленный перенос группы или лиганды применяют для направленного переноса или введения полимера в клетку- или ткань-мишень или в специфические типы клеток. Обеспечивающие направленный перенос группы повышают ассоциацию молекул с клеткой-мишенью. Так, обеспечивающие направленный перенос группы могут улучшать фармакокинетические свойства или биораспределение конъюгата, к которому они присоединены, улучшая распределение в клетке и поглощение клеткой конъюгата. Одну или несколько обеспечивающих направленный перенос групп можно сцеплять с обладающим активностью в отношении мембран полимером либо непосредственно или посредством связи со спейсером. Связывание обеспечивающей направленный перенос группы, такой как лиганд, с клеткой или клеточным рецептором может инициировать эндоцитоз. Обеспечивающие направленный перенос группы могут быть одновалентными, двухвалентными, трехвалентными, четырехвалентными или иметь более высокую валентность. Обеспечивающие направленный перенос группы можно выбирать из ряда, включающего: соединения, обладающие аффинностью к молекуле клеточной поверхности, лиганды клеточного рецептора и антитела, фрагменты антител и миметики антител, обладающие аффинностью к молекулам клеточной поверхности. Предпочтительная обеспечивающая направленный перенос группа содержит лиганд клеточного рецептора. Для направленного переноса лекарственных средств и генов в клетки и к специфическим клеточным рецепторам применяют разнообразные лиганды. Лиганды клеточных рецепторов можно выбирать из группы, включающей: углеводы, гликаны, сахариды, включая, но не ограничиваясь только ими: галактозу, производные галактозы, маннозу и производные маннозы), витамины, фолат, биотин, аптамеры и пептиды (включая, но не ограничиваясь только ими: RGD-содержащие пептиды, инсулин, EGF и трансферрин). Примерами обеспечивающих направленный перенос групп являются группы, мишенью которых является азиалогликопротеиновый (ASGP) рецептор благодаря присутствию азиалогликопротеинов или остатков галактозы. Например, клетки печени содержат ASGP-рецепторы. Таким образом, содержащие галактозу обеспечивающие направленный перенос группы можно применять для направленного переноса в гепатоциты. Содержащие галактозу обеспечивающие направленный перенос группы включают, но не ограничиваясь только ими: галактозу, N-ацетилгалактозамин, олигосахариды и кластеры сахаридов (такие как: Tyr-Clu-Clu-(аминогексил-CalNAc)3, галактозные кластеры, основой которых является лизин, и галактозные кластеры, основой которых является холан). Другие приемлемые конъюгаты могут включать олигосахариды, которые могут связываться с распознающими углеводы доменами (CRD), которые обнаружены в азиалогликропротеиновом рецепторе (ASGP-R). Примеры фрагментов конъюгатов, содержащих олигосахариды и/или углеводные комплексы, представлены в US 6525031.

В контексте настоящего описания подразумевается, что модификатор заряда представляет собой группу, которая изменяет ионную группу полимера. Модификатор заряда может нейтрализовать заряженную группу полимера или изменять заряд полимерного иона с положительного на отрицательный или с отрицательного на положительный. Модификация заряд полииона приводит к образованию полииона противоположного заряда или приводит к образованию полиамфолита. Модификацию заряда можно применять также для получения полимера с требуемым чистым зарядом или зета-потенциалом. Конъюгаты с практически нейтральным чистым зарядом или зета-потенциалом являются предпочтительными для введения in vivo полинуклеотидов. Предпочтительный модификатор заряда обратимо модифицирует заряженную или ионную группу. Обратимые модификаторы заряда можно выбирать из группы, включающей: карбоксидиметилмалеиновый ангидрид (CDM), диметилмалеиновый ангидрид (DM), сложный тиоэфир CDM, CDM-маскирующий агент, CDM-стабилизатор стерической конфигурации, CDM-лиганд, CDM-ПЭГ и CDM-галактозу.

Зета-потенциал является физическим свойством, которым обладает любая частица в суспензии, и этот показатель близок к поверхностному заряду. В водных средах значение рН образца является одним из наиболее важных факторов, влияющих на зета-потенциал. Когда заряд основан на протонировании/депротонировании оснований/кислот, то заряд зависит от значения рН. Таким образом, значение зета-потенциала должно отражать условия раствора, прежде всего основную роль имеет значение рН. Для обычных частиц величина зета-потенциала свидетельствует о возможной стабильности коллоидной системы. Если все частицы в суспензии имеют большой отрицательный или положительный зета-потенциал, то они должны иметь тенденцию отталкивать друг друга, и в результате частицы не имеют тенденцию к объединению. Однако, если частицы имеют низкое значение зета-потенциала, то не существует силы, предотвращающей их объединение и хлопьеобразование. Основная разделяющая линии между стабильными и нестабильными суспензиями для обычных частиц проходит па уровне либо +30, либо -30 мВ. Частицы, имеющие положительный зета-потенцнал, превышающий +30 мВ, или отрицательный потенциал, более низкий чем -30 мВ, как правило, считаются стабильными. При создании изобретения было установлено, что замаскированные с помощью CDM конъюгаты полинуклеотид-полимер могут образовывать небольшие частицы размером <20 нм или <10 им (что определяют с помощью динамического рассеяния света, аналитического ультрацентрифугирования или атомно-силовой микроскопии), которые являются стабильными, несмотря па то, что имеют зета-потенциал между +30 и -30 мВ в физиологическом солевом растворе и рН 9.

Чистый заряд или зета-потенциал конъгатов полинуклеотид-полимер, предлагаемых в изобретении, можно контролировать путем присоединения маскирующих агентов или модификаторов заряда. Заряд полимера, прежде всего положительный заряд, может приводить к нежелательным взаимодействиям с компонентами сыворотки или клетками, не являющимися мишенями. Путем защиты заряда с помощью стабилизаторов стерической конфигурации или модификации заряда можно легко получать конъюгаты, видимый поверхностный заряд которых близок к нейтральному. Путем модификации заряженных групп полимера можно создавать частицы, обладающие стабильностью в сыворотке, зета-потенциал которых, измеренный при рН 9, находится в диапазоне от +30 до -30 мВ, между +20 и -20 мВ, между +10 и -10 мВ или между +5 и -5 мВ. При рН 7, вероятно, чистый заряд конъюгата должен иметь большую положительную величину, чем при рН 9. Чистый заряд или поверхностный заряд является важным фактором при введении полинуклеотидных комплексов in vivo.

Лабильная (неустойчивая) связь

Связь или линкер представляет собой соединяющий элемент между двумя атомами, который сцепляет одну представляющую интерес химическую группу или сегмент с другой представляющей интерес химической группой или сегментом посредством одного или нескольких ковалентных мостиков. Например, связь может соединять полинуклеотид или маскирующий агент с полимером. При формировании связи может происходить соединение двух отдельных молекул с образованием одной молекулы, или она может соединять два атома одной и той же молекулы. Связь может быть нейтральной или может нести положительный или отрицательный заряд. Обратимая или лабильная связь содержит обратимый или лабильный мостик. Связь необязательно может включать спейсер, который увеличивает расстояние между двумя объединяемыми атомами. Спейсер может придавать дополнительную гибкость и/или увеличивать длину связи. Спейсеры могут включать, но не ограничиваясь только ими: алкильные группы, алкенильные группы, алкинильные группы, арильные группы, аралкильные группы, аралкенильные группы, аралкинильные группы, каждая из которых может содержать один или несколько гетероатомов, и гетероциклы. Спейсерные группы хорошо известны в данной области и перечисленный выше ряд не следует рассматривать, как ограничивающий объем изобретения.

Обратимая или лабильная связь (мостик) представляет собой ковалентную связь, отличную от ковалентной связи с атомом водорода, которую можно избирательно разрушать или расщеплять в условиях, при которых не разрушаются или расщепляются другие ковалентные связи в этой же молекуле. Более конкретно, обратимая или лабильная связь представляет собой ковалентную связь, которая является менее стабильной (термодинамически) или быстрее расщепляется (кинетически) в соответствующих условиях, чем другие нелабильные ковалентные связи в этой же молекуле. Расщепление лабильной связи в молекуле может приводить к образованию двух или большего количества молекул. Специалисты в данной области способность к расщеплению или лабильность связи, как правило, выражают в понятиях времени полужизни () касательно расщепления связи или времени, которое необходимо для расщепления половины связей. Ортогональные связи представляют собой связи, которые расщепляются в условиях, при которых происходит расщепление одной из них, но не другой. Две связи считаются ортогональными, если времена их полужизни касательно расщепления в конкретной среде отличаются друг от друга в 10 или более раз. Таким образом, к обратимым или лабильным связям относятся связи, которые можно избирательно расщеплять быстрее, чем другие связи в молекуле.

Группы, представляющие собой доноры и акцепторы электронов, могут присутствовать в молекуле непосредственно вблизи расщепляемой связи, в результате электронные воздействия групп-доноров и групп-акцепторов электронов влияют на скорость расщепления связи. Группы-акцепторы электронов (EWG) представляют собой атомы или части молекул, которые притягивают к себе (акцептируют) электронную плотность другого атома, связи или части молекулы, при этом снижается электронная плотность представляющей интерес связи (донор). Группы-доноры электронов (EDG) представляют собой атомы или части молекул, которые отдают электроны другому атому, связи или части молекулы, при этом повышается электронная плотность представляющей интерес связи (акцептор). Группы, представляющие собой акцепторы/доноры электронов, для того, чтобы оказывать действие, должны находиться в достаточной близости, как правило, в пределах примерно 3 связей, от подлежащей расщеплению связи.

Другая стратегия повышения скорости расщепления связи предусматривает включение функциональных групп в ту же молекулу, в которой присутствует лабильная связь. Близость функциональных групп друг к другу в молекуле должна быть такой, чтобы внутримолекулярная реакция преобладала над межмолекулярной реакцией. Близость функциональных групп друг к другу может приводить к более высоким концентрациям функциональных групп. В целом, внутримолекулярные реакции являются существенно более быстрыми, чем межмолекулярные реакции. Реактивные группы, разделенные 5 и 6 атомами, могут образовывать чрезвычайно лабильные связи из-за образования 5- и 6-членных кольцевых переходных состояний. Примерами являются молекулы, включающие производные карбоновых кислот (кислоты, эфиры, амиды) и спирты, тиолы, карбоновые кислоты или амины в одной и той же молекуле, которые взаимодействую с образованием эфиров, карбоновых и карбонатных эфиров, фосфатных эфиров, тиольных эфиров, ангидридов кислот или амидов. Стерические взаимодействия могут также изменять скорость расщепления связи.

Соответствующие условия определяются типом лабильной связи, и они хорошо известны в органической химии. Лабильная связь может быть чувствительной к значению рН, окислительным или восстановительным условиям или агентам, температуре, концентрации солей, присутствию фермента или присутствию дополнительного агента. Например, определенные пептидные, сложноэфирные или сахаридные линкеры можно расщеплять в присутствии соответствующего фермента. В другом примере повышенные или пониженные значения рН могут являются соответствующими условиями для рН-лабильной связи. В еще одном примере окислительные условия могут представлять собой соответствующие условия для лабильной в окислительных условиях связи. И еще в одном примере восстановительные условия могут представлять собой соответствующие условия для лабильной в восстанавливающих условиях связи. Например, дисульфидный мостик, состоящий из двух алкилтиолов, можно расщеплять восстановлением в присутствии тиолов без расщепления связей типа углерод-углерод. В этом примере связи типа углерод-углерод не являются лабильными в восстанавливающих условиях.

Скорость трансформации лабильной группы можно контролировать, изменяя химические составляющие молекулы, содержащей лабильную группу. Например, добавление конкретных химических фрагментов (например, акцепторов или доноров электронов) вблизи лабильной группы может влиять на конкретные состояния (например, значение рН), в которых может иметь место химическая трансформация.

Молекулы могут содержать одну или несколько обратимых или лабильных связей. Если в молекуле присутствует более одной обратимой или лабильной связи, и все обратимые или лабильные связи относятся к одному и тому же типу (расщепляются примерно с одинаковой скоростью в одних и тех же условиях), то молекула содержит множество обратимых или лабильных связей. Если более одной обратимой или лабильной связи присутствует в молекуле и обратимые или лабильные связи относятся в разным типам (на основе либо соответствующих требуемых для лабильности условий, либо химической функциональной группы лабильных связей), то молекула содержит ортогональные обратимые или лабильные связи. Ортогональные обратимые или лабильные связи обеспечивают способность расщеплять обратимую или лабильную связь одного типа, оставляя обратимую связь второго типа без расщепления или разрушения. Другими словами две лабильные связи являются ортогональными друг другу, если одна может расщепляться в условиях, в которых другая связь остается интактной. Ортогональные защитные группы хорошо известны в области органической химии и содержат ортогональные связи.

В контексте настоящего описания подразумевается, что физиологически лабильная связь представляет собой лабильную связь, которая может расщепляться в условиях, которые, как правило, встречаются или аналогичны встречающимся в организме млекопитающего. Физиологически лабильные группы связей выбирают из связей, которые подвергаются химической трансформации (например, расщеплению), когда находятся в физиологических условиях.

В контексте настоящего описания подразумевается, что клеточная физиологически лабильная связь представляет собой связь, которая может расщепляться во внутриклеточной среде млекопитающих. Внутриклеточные среды млекопитающих включают химические условия, такие как значение рН, температура, окислительные или восстановительные условия или агенты и концентрация соли, обнаруженные или аналогичные встречающимся в клетках млекопитающих. Внутриклеточные среды млекопитающих включают также наличие ферментативной активности, которая в норме характерна для клетки млекопитающего, например, связанной с протеолитическими или гидролитическими ферментами. Клеточная физиологически лабильная связь может расщеплять также в ответ на введение фармацевтически приемлемого экзогенного агента. Физиологически лабильные связи, расщепление которых характеризуется временем полужизни, составляющим менее 45 мин, считаются очень лабильными. Физиологически лабильные связи, расщепление которых характеризуется временем полужизни, составляющим менее 15 мин, считаются чрезвычайно лабильными

Химическую трансформацию (расщепление лабильной связи) можно инициировать, добавляя фармацевтически приемлемый агент в клетку, или она может происходить спонтанно, когда молекула, содержащая лабильную связь, достигает соответствующего внутри- и/или внеклеточного окружения. Например, рН-лабильная связь может расщепляться, когда молекула проникает в кислую среду эндосомы. Так, рН-лабильную связь можно рассматривать как расщепляемую в эндосоме связь. Ферментативно расщепляемые связи могут расщеплять при контакте с ферментами, которые присутствуют в эндосоме или лизосоме, или в цитоплазме. Дисульфидный мостик может расщепляться, когда молекула проникает в обладающую более высокой восстанавливающей способностью среду клеточной цитоплазмы. Таким образом, дисульфид можно рассматривать как расщепляемую в цитоплазме связь.

«Лабильная при определенных значениях рН связь» («рН-лабильная связь»): В контексте настоящего описания подразумевается, что рН-лабильные связи представляют собой лабильные связи, которые избирательно разрушаются в кислых условиях (рН<7). Такие связи можно обозначать также как лабильные в условиях эндосомы связи, поскольку значение рН в эндосомах и лизосомах менее 7. Под понятие «рН-лабильные связи» подпадают рН-лабильные связи (лабильные при определенных значениях рН связи), очень лабильные при определенных значениях рН связи и чрезвычайно лабильные при определенных значениях рН связи. РН-лабильные связи можно выбирать из группы, включающей:

а) кетали, лабильные в кислых средах (рН менее 7, выше 4), образующие диол и кетон,

б) ацетали, лабильные в кислых средах (рН менее 7, выше 4), образующие диол и альдегид,

в) имины или иминиумы, лабильные в кислых средах (рН менее 7, выше 4), образующие амин и альдегид или кетон,

г) связи типа кремний-кислород-углерод, лабильные в кислых средах,

д) связи типа кремний-азот (силазаны), и

е) связи типа кремний-углерод (арилсиланы, винилсиланы и аллилсиланы),

ж) малеамат-амидные связи, которые синтезируют из производных малеинового ангидрида и аминов,

з) сложные орто-эфиры,

и) гидразоны,

к) активированные производные карбоновых кислот (эфиры, амиды), созданные так, чтобы они подвергались катализируемому кислотой гидролизу,

л) простые виниловые эфиры.

Органосиланы в течение длительного времени применяют в качестве защитных групп кислорода в органическом синтезе благодаря тому, что их просто получать (связь типа кремний-кислород-углерод) и легко удалять защитную группу в кислых условиях. Например, и простые силиловые эфиры, и простые силиленоловые эфиры несут указанную связь. Связи типа кремний-кислород-углерод чувствительны к гидролизу в кислых условиях с образованием силанилов и спирта (или енола). Замена как атома кремния, так и углерода спирта может оказывать влияние на скорость гидролиза из-за стерических и электронных эффектов. Это дает возможность изменять скорость гидролиза связи кремний-кислород-углерод путем внесения замены либо в органосилан, либо в спирт, либо и в органосилан и в спирт, облегчая требуемое действие. Кроме того, заряженные или реактивные группы, такие как амины или карбоксилат, можно связывать с атомом кремния, что придает лабильному соединению заряд и/или реактивность.

Гидролиз силазана приводит к образованию силанола и амина. Силазанам присуща большая чувствительность к гидролизу, чем связи типа кремний-кислород-углерод, однако скорость гидролиза возрастает в кислых условиях. Замена и атома кремния, и амина может оказывать влияние на скорость гидролиза благодаря стерическим и электронным эффектам. Это дает возможность изменять скорость гидролиза силазана путем замены либо кремния, либо амина с целью облегчения требуемого действия.

Другим примером рН-лабильной связи является применение лабильной в кислых условиях связи типа простого енольного эфира. Скорость расщепления указанной лабильной связи зависит от структур образовавшегося карбонильного производного и высвободившегося спирта. Например, аналоги простого этилизопропенилового эфира, которые можно синтезировать из простых β-галоидных эфиров, имеют полужизни примерно 2 мин при рН 5. Аналоги простого этилциклогексенилового эфира, которые можно синтезировать из простых эфиров фенола, имеют время полужизни примерно 14 мин при рН 5.

Путем взаимодействия ангидрида с амином можно получать амид и кислоту. Как правило, обратная реакция (образование ангидрида и амина) является очень медленной и энергетически нецелесообразной. Однако, если ангидрид представляет собой циклический ангидрид, то реакция с амином позволяет получать молекулу, в которой амид и кислота находятся в одной и той молекуле, т.е. амид кислоты. Присутствие обеих реактивных групп (амида и карболовой кислоты) в одной и той же молекуле облегчает обратную реакцию. В частности, продукт взаимодействия первичных аминов с малеиновым ангидридом и производными малеинового ангидрида, малеамовыми кислотами, обратно превращаются в амин и ангидрид от 1×109 до 1×1013 раз быстрее, чем их нециклические аналоги (Kirby, 1980).

Взаимодействие амина с ангидридом с образованием амида и кислоты

Взаимодействие амина с циклическим ангидридом с образованием амида кислоты.

Расщепление амида кислоты с образованием амина и ангидрида зависит от значения рН и резко ускоряется при кислом значении рН. Эту зависимая от рН реактивность можно применять для образования обратимых чувствительных к значению рН связей и линкеров. Цис-аконитовую кислоту использовали в качестве такой чувствительной к значению рН линкерной молекулы. Сначала с молекулой сшивали γ-карбоксилат. На второй стадии либо α-, либо β-карбоксилат сшивали со второй молекулой с получением рН-чувствительного сочетания двух молекул. Время полужизни касательно расщепления этого линкера при рН 5 составляло от 8 до 24 ч.

Структуры цис-аконитового ангидрида и малеинового ангидрида

Значение рН, при котором имеет место расщепление, контролируют путем добавления химических компонентов к лабильному фрагменту. Скорость превращения малеамовых кислот в амины и малеиновые ангидриды в значительной степени зависит от замещения (R2 и R3) системы малеинового ангидрида. Когда R2 обозначает метил, скорость превращения в 50 раз выше, чем когда R2 и R3 обозначают водород. Когда присутствуют алкильные заместители и в R2, и в R3 (например, 2,3-диметилмалеиновый ангидрид), то скорость очень резко возрастает, реакция протекает в 10000 быстрее по сравнению с реакцией, в которой участвует незамещенный малеиновый ангидрид. Малеаматная связь, образовавшаяся в результате модификации амина 2,3-диметилмалеиновым ангидридом, расщепляется с восстановлением ангидрида и амина, время полужизни которых составляет от 4 до 10 мин при рН 5. Это позволяет предполагать, что если R2 и R3 представляют собой группы более крупные, чем водород, то скорость превращения амида кислоты в амин и ангидрид должна быть быстрее, чем в случае, когда R2 и/или R3 обозначают водород.

Очень лабильная при определенных значениях рН связь: Время полужизни очень лабильной при определенных значениях рН связи при рН 5 составляет менее 45 мин. Создание очень лабильной при определенных значениях рН связей известно в области химии.

Чрезвычайно лабильные при определенных значениях рН связи: Время полужизни чрезвычайно лабильной при определенных значениях рН связи при рН 5 составляет менее 15 мин. Создание чрезвычайно лабильных при определенных значениях рН связей известно в области химии.

Связь полинуклеотида с полимером

Большинство разработанных ранее методов введения полинуклеотида в клетки основано на образовании комплекса анионной нуклеиновой кислоты с катионным агентом, предназначенным для введения, таким как катионный полимер или катионный липид. Электростатические комплексы с более крупными полинуклеотидами, например плазмидами, имеют тенденцию к агрегации и увеличению размеров (>500 нм) в физиологических растворах. Более мелкие полинуклеотиды, олигонуклеотиды, из-за их небольшого размера образуют нестабильные электростатические комплексы с возможными предназначенными для введения агентами. Более эффективным методом упаковки полинуклеотидов является ковалентное связывание полинуклеотида с предназначенным для введения носителем. Однако присоединение к полимеру может ингибировать активность полинуклеотида в клетке. При создании изобретения было обнаружено, что путем присоединения полинуклеотида к полимеру через обратимый линкер, который расщепляется после введения полинуклеотида в клетку, можно вводить функционально активный полинуклеотид в клетку in vivo. Обратимый линкер выбирают таким образом, чтобы он подвергался химической трансформации (например, расщеплению) при нахождении в определенных физиологических условиях (например, в восстанавливающей среде цитоплазмы клеток). Присоединение полинуклеотида к предназначенному для введения или обладающему активностью в отношении мембран полимеру повышает эффективность введения полинуклеотида в клетку in vivo. Высвобождение полинуклеотида из полимера путем расщепления обратимой связи облегчает взаимодействие полинуклеотида с соответствующими клеточными компонентами с проявлением активности.

Помимо полинуклеотидов можно вводить в клетки in vivo с использованием описанных поликонъюгатов в качестве носителей также и другие не обладающие способностью проникать через мембрану молекулы или молекулы с невысокой способностью проникать через мембраны. Молекулы, пригодные для обратимого присоединения к обладающему активностью в отношении мембран полимеру, включают: белки, антитела, фрагменты антител, факторы транскрипции, низкомолекулярные лекарственные средства, противораковые лекарственные средства и другие синтетические молекулы, включая молекулы, которые оказывают действие на транскрипцию.

Присоединение не обладающей способностью проникать через мембраны молекулы к обладающему активностью в отношении мембран полимеру позволяет получать носитель, имеющий пригодный размер для введения in vivo. Описанные молекулярные конъюгаты в основном состоят из полимера и имеют размер и обеспечивающие направленный перенос свойства, такие же, которые известны для других полимеров. Для введения внутрь сосудов (системное введение) носитель должен обладать способностью преодолевать эндотелиальный барьер для достижения представляющих интерес паренхимных клеток. Наиболее крупные эндотелиальные «окна» (отверстия в эндотелиальном барьере) находятся в печени и имеют средний диаметр примерно 100 нм. Трансэпителиальные поры в других органах существенно меньше. Например, известно, что мышечный эпителий имеет структуру, в которой присутствует большое количество мелких пор с радиусом 4 нм и меньшее количество более крупных пор с радиусом 20-30 нм. Размер носителя для введения полинуклеотида также важен для процесса проникновения в клетку. Считается, что клеточная интернализация посредством эндоцитоза ограничена комплексами диаметром не более примерно 100 нм, т.е. размером эндоцитозных пузырьков. Предлагаемые в изобретении конъюгаты имеют размер менее 100 нм, болеее предпочтительно менее 50 нм и наиболее предпочтительно менее 20 нМ или менее 10 нм.

Почечная ультрафильтрация представляет собой один из основных путей элиминации гидрофильных белков, полимеров и конъюгатов полимер-белок из крови. Среди параметров, влияющих на этот процесс, следует отметить химический состав, размер, заряд. Глобулярные белки с молекулярной массой свыше 70 кДа, как правило, не подвергаются клиренсу посредством почечной ультрафильтрации. Таким образом, конъюгация со стабилизаторами стерической конфигурации, такими как ПЭГ, снижает почечный клиренс в результате увеличения эффективного молекулярного размера полимеров, к которым они присоединены. Ультрафильтрация ПЭГ с молекулярной массой менее 8 кДа не ограничена, в то время как ультрафильтрация ПЭГ с массой 8-30 кДа регулируется молекулярным размером. Элиминация ПЭГ с молекулярной массой, превышающей 30 кДа, резко снижается. По этой причине предпочтительными являются несущие маскирующий агент конъюгаты полимер-полинуклеотид, общая масса которых превышает примерно 10 кДа, превышает примерно 20 кДа или превышает примерно 30 кДа. Помимо меньшей подверженности почечной ультрафильтрации, полимер с высокой молекулярной массой может в большей степени накапливаться в проницаемых тканях, таких как опухоли, в результате пассивной увеличенной проницаемости и механизма удерживания.

Полинуклеотид

Понятие полинуклеотид или нуклеиновая кислота, или полинуклеиновая кислота в данной области относится к полимеру, содержащему по меньшей мере два нуклеотида. Нуклеотиды представляют собой мономерные звенья полинуклеотидных полимеров. Полинуклеотиды, имеющие менее 120 мономерных звеньев, часто называют олигонуклеотидами. Встречающиеся в естественных условиях нуклеиновые кислоты имеют дезоксирибозо- или рибозофосфатный каркас. Не встречающийся в естественных условиях или синтетический полинуклеотид представляет собой полинуклеотид, который полимеризован in vitro или в бесклеточной системе и содержит такие же или сходные основания, но может иметь тип каркаса, отличный от встречающегося в естественных условиях рибозо- или дезоксирибозофосфатного каркаса. Полинуклеотиды можно синтезировать с помощью любых известных в данной области методов. Полинуклеотидные каркасы, известные в данной области, включают: ПНК (пептидные нуклеиновые кислоты), фосфоротиоаты, фосфородиамидаты, морфолины и другие варианты фосфатного каркаса нативных нуклеиновых кислот. Основания представляют собой пурины и пиримидины, которые в свою очередь включают встречающиеся в естественных условиях соединения, такие как аденин, тимин, гуанин, цитозин, урацил, инозин, и аналоги встречающихся в естественных условиях оснований. Синтетические производные пуринов и пиримидинов включают, но не ограничиваясь только ими, модификации, которые приводят к появлению новых реактивных групп в нуклеотиде, таких как, но не ограничиваясь только ими, амины, спирты, тиолы, карбоксилаты и галоидалкилы. Под это понятие подпадают также все известные аналоги ДНК и РНК. Понятие полинуклеотид включает дезоксирибонуклеиновую кислоту (ДНК) и рибонуклеиновую кислоту (РНК) и комбинации ДНК, РНК и других встречающихся в естественных условиях и синтетических нуклеотидов.

ДНК может иметь форму кДНК, полимеризованной in vitro ДНК, плазмидной ДНК, фрагментов плазмидной ДНК, генетического материала, полученного из вируса, линейной ДНК, векторов (Р1, РАС, ВАС, YAC и искусственные хромосомы), экспрессионных векторов, кассет экспрессии, химерных последовательностей, рекомбинантной ДНК, хромосомной ДНК, олигонуклеотида, аптисмысловой ДНК или производных указанных групп. РНК может иметь форму матричной РНК (мРНК), полимеризованной in vitro РНК, рекомбинантной РНК, олигонуклеотидной РНК, транспортной РНК (тРНК), малой ядерной РНК (мяРНК), рибосомной РНК (рРНК), химерной последовательности, антисмысловой РНК, интерферирующей РНК, малой интерферирующей РНК (siPHK), микроРНК (миРНК), рибозимой, внешних направляющих последовательностей, малых не матричных РНК (snmPHK), нетранслируемых РНК (utPHK), snoPHK (24-меры, модифицированные snmPHK, которые действуют путем антисмыслового механизма), крошечных некодирующих РНК (tncPHK), малой РНК-шпильки (shRNA) или производных указанных групп. Кроме того, ДНК и РНК могут иметь одну, две, три или четыре цепи. Двух-, трех- и четырехцепочечный полинуклеотид может содержать и РНК, и ДНК или другие комбинации встречающихся в естественных условиях и/или синтетических нуклеиновых кислот.

Блокирующий полинуклеотид представляет собой полинуклеотид, который воздействует на функцию или экспрессию ДНК или РНК. Блокирующие полинуклеотиды не транслируются в белок, но их присутствие или экспрессия в клетке изменяет экспрессию или функцию клеточных генов или РНК. Блокирующие полинуклеотиды вызывают деградацию или ингибируют функцию или трансляцию конкретной клеточной РНК, как правило, мРНК, специфическим для последовательности образом. Таким образом, ингибирование РНК может эффективно ингибировать экспрессию гена, с которого РНК транскрибируется. В контексте настоящего описания подразумевается, что блокирующий полинуклеотид можно выбирать из ряда, включающего такие элементы, как: антисмысловой олигонуклеотид, взаимодействующий с РНК полинуклеотид, dsPHK, siPHK, миРНК, hPHK, рибозим, hammerhead-рибозим (рибозим типа «головки молотка»), внешняя направляющая последовательность (US 5962426), snoPHK, образующая тройную спираль, транскрибируемая с участием олигонуклеотидной РНК-полимеразы II ДНК, которая кодирует блокирующий полинуклеотид, ДНК, транскрибируемые с участием РНК-полимеразы III, которые кодируют блокирующий полинуклеотид. Блокирующий полинуклеотид может представлять собой ДНК, РНК, комбинацию РНК и ДНК, или может содержать не встречающиеся в естественных условиях или синтетические нуклеотиды.

Блокирующие полинуклеотиды можно полимеризовать in vitro, они могут быть рекомбинантными, содержать химерные последовательности или производные указанных групп. Блокирующий полинуклеотид может содержать рибонуклеотиды, дезоксирибонуклеотиды, синтетические нуклеотиды или любую приемлемую комбинацию, ингибирующую РНК- или ген-мишень.

Полинуклеотид, принимающий участие в РНК-интерференции (PHKi) (PHKi-полинуклеотид), представляет собой молекулу, которая может индуцировать РНК-интерференцию путем воздействия на механизм пути РНК-интерференции в клетках млекопитающих, в результате чего происходит нарушение или ингибирование трансляции транскриптов матричной РНК (мРНК) трансгена специфическим для последовательности образом. Два основных PHKi-полинуклеотида представляют собой малые (или короткие) интерферирующие РНК (siPHK) и микроРНК (миРНК). Однако, как установлено, и другие полинуклеотиды также могут опосредовать РНК-интерференцию. PHKi-полинуклеотиды можно выбирать из группы, включающей: siPHK, микроРНК, двухцепочечную РНК (dsPHK), короткую РНК-шпильку (shPHK) и кассеты экспрессии, кодирующие РНК, если они обладают способностью индуцировать РНК-интерференцию. siPHK содержит двухцепочечную структуру, как правило, состоящую из 15-50 пар оснований и предпочтительно из 21-25 пар оснований, и имеющую нуклеотидную последовательность, которая идентична (полностью комплементарна) или практически идентична (частично комплементарна) кодирующей последовательности в экспрнессируемом гене-мишени или РНК внутри клетки. siPHK может иметь состоящие из двух нуклеотидов 3′-выступающие концы. siPHK может состоять из двух ренатурированных полинуклеотидов или одного полинуклеотида, который образует структуру типа шпильки. Молекула siPHK, предлагаемая в изобретении, содержит смысловую область и антисмысловую область. В одном из вариантов осуществления изобретения siPHK, входящие в конъюгат, состоят из двух олигонуклеотидных фрагментов, при этом один фрагмент содержит нуклеотидную последовательность антисмысловой цепи молекулы siPHK, а второй фрагмент содержит нуклеотидную последовательность смысловой области молекулы siPHK. В другом варианте осуществления изобретения смысловую цепь соединяют с антисмысловой цепью через линкерную молекулу, такую как полинуклеотидный линкер или ненуклеотидный линкер. МикроРНК (миРНК) представляют собой генные продукты в виде малых некодирующих РНК, состоящих примерно из 22 nt (нуклеотидов), которые вызывают деструкцию или подавление трансляции их мРНК-мишеней. Если комплементарность между миРНК и мРНК-мишенью является частичной, то трансляция мРНК-мишени подавляется, а если комплементарность является более полной, то мРНК-мишень расщепляется. В случае миРНК комплекс связывается с сайтами-мишенями, обычно локализованными в 3′ UTR мРНК, которая, как правило, имеет лишь частичную гомологию с миРНК. «Область затравки», т.е. участок, состоящий примерно из 7 последовательных нуклеотидов на 5′-конце миРНК, который осуществляет точное спаривание оснований с ее мишенью, играет основную роль в специфичности миРНК. Связывание комплекса RISC (РНК-индуцируемый комплекс выключения гена)/миРНК с мРНК может приводить либо к подавлению трансляции белка, либо к расщеплению и деградации мРНК. Согласно современным данным расщепление мРНК главным образом происходит, если существует точная гомология по всей длине миРНК и ее мишени, а не только в важной для спаривания оснований ее области затравки (Pillai и др., 2007).

Антисмысловой олигонуклеотид представляет собой полинуклеотид, содержащий последовательность, которая комплементарна последовательности, присутствующей в мРНК-мишени. Антисмысловой олигонуклеотид связывается (спаривается) с мРНК специфическим для последовательности образом. Это связывание может препятствовать связыванию других клеточных ферментов с мРНК, что приводит к ингибированию трансляции мРНК или расщеплению мРНК.

Внешние направляющие последовательности представляют собой антисмысловые олигорибонуклеотиды, которые индуцируют опосредуемое РНКазой Р расщепление РНК-мишени путем формирования предшественника РНК-подобного комплекса (US 5624824).

Рибозимы представляют собой, как правило, олигонуклеотиды РНК, которые содержат последовательность, комплементарную РНК-транскрипту-мишени, и последовательность РНК, которая действует в качестве фермента, расщепляя РНК-транскрипт. Расщепление мРНК препятствует трансляции.

Олигонуклеотид, который образует блокирующий полинуклеотид, может включать концевой кэп на 5′-конце, 3′-конце или и на 5′-, и на 3′-концах. Копирующий фрагмент может представлять собой, но не ограничиваясь только ими, инвертированный остаток рибозы в молекуле ДНК, лишенной азотистого основания, инвертированный дезокситимидиновый остаток, тимидиновый остаток или 3′-глицерильную модификацию.

Транскрибируемые при участии РНК-полимеразы II и III ДНК могут транскрибироваться в клетке с образованием малых РНК-шпилек, которые могут функционировать в качестве siPHK, индивидуальных смысловых и антисмысловых siPHK с линейными цепями или линейных РНК, которые могут функционировать в качестве антисмысловой РНК. Транскрибируемые при участии РНК-полимеразы III ДНК содержат промоторы, выбранные из ряда, включающего: U6-промоторы, H1-промоторы и tPHK-промоторы. Промоторы РНК-полимеразы II включают промоторы U1, U2, U4 и U5, промоторы мяРНК промоторы микроРНК и промоторы мРНК.

Перечень известных последовательностей миРНК можно почерпнуть из баз данных, поддерживаемых среди прочего такими исследовательскими организациями, как Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center и European Molecule Biology Laboratory. Данные об эффективности последовательностей siPHK и местах связывания конъюгатов также подробно описаны в соответствующей литературе. PHKi-молекулы легко можно создавать и получать с помощью методик, известных в данной области. Кроме того, существуют компьютерные средства для повышения шанса обнаружения эффективных и специфических мотивов последовательностей (Pei и др., 2006, Reynolds и др., 2004, Khvorova и др., 2003, Schwarz и др., 2003, Ui-Tei и др., 2004, Heale и др., 2005, Chalk и др., 2004, Amarzguioui и др., 2004).

Полинуклеотиды, предлагаемые в изобретении, можно химически модифицировать. Применение химически модифицированного полинуклеотида может улучшать различные свойства полинуклеотида, включая, но не ограничиваясь только ими: устойчивость к расщеплению нуклеазами in vivo, поглощение клеткой, активность и специфическую для последовательности гибридизацию. Примерами таких химических модификаций являются, но не ограничиваясь только ими: фосфоротиоатные межнуклеотидные связи, 2′-O-метилрибонуклеотиды, 2′-дезокси-2′-фторрибонуклеотиды, 2′-дезоксирибонуклеотиды, состоящие из «универсальных оснований» нуклеотиды, 5-С-метилнуклеотиды и включение инвертированного остатка рибозы в молекулу ДНК, лишенную азотистого основания. Установлено, что эти химические модификации при их применении в различных полинуклеотидных конструкциях сохраняют активность полинуклеотида в клетках, в то же время резко повышая стабильность в сыворотке этих соединений. Химически модифицированная siPHK может также снижать до минимально возможного уровня возможность активации интерферонов в организме человека.

В одном из вариантов осуществления изобретения химически модифицированный PHKi-полинуклеотид, предлагаемый в изобретении, содержит дуплекс, который имеет две цепи, при этом одна или обе цепи могут быть модифицированы, где каждая цепь содержит от примерно 19 до примерно 29 (например, примерно 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 или 29) нуклеотидов. В одном из вариантов осуществления изобретения PHKi-полинуклеотид, предлагаемый в изобретении, содержит один или несколько модифицированных нуклеотидов, сохраняя способность опосредовать процесс PHKi внутри клетки или реконструированной системе in vitro. PHKi-полинуклеотид можно модифицировать, при этом химическая модификация затрагивает один или несколько (например, примерно 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более) нуклеотидов. PHKi-полинуклеотид, предлагаемый в изобретении, может содержать определенный процент модифицированных нуклеотидов относительно общего количества нуклеотидов, присутствующих PHKi-полинуклеотиде. Сам по себе PHKi-полинуклеотид, предлагаемый в изобретении, может в целом содержать модифицированные нуклеотиды примерно в 5-100% нуклеотидных положений (например, в 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100% нуклеотидных положений). Фактический процент модифицированных нуклеотидов, присутствующих в данном PHKi-полинуклеотиде, зависит от общего количества нуклеотидов, присутствующих в PHKi-полинуклеотиде. Если PHKi-полинуклеотид является одноцепочечным, то процентное содержание модифицированных нуклеотидов можно определять в зависимости от общего количества нуклеотидов, присутствующих в одноцепочечном PHKi-полинуклеотиде. Аналогично этому, если PHKi-полинуклеотид является двухцепочечным, то процентное содержание модифицированных нуклеотидов можно определять в зависимости от общего количества нуклеотидов, присутствующих в смысловой цепи, антисмысловой цепи или и смысловой, и антисмысловой цепях. Кроме того, фактический процент модифицированных нуклеотидов, присутствующих в данном PHKi-полинуклеотиде может зависеть также от общего количества пуриновых и пиримидиновых нуклеотидов, присутствующих в PHKi-полинуклеотиде. Например, при этом все пиримидиновые нуклеотиды и/или все пуриновые нуклеотиды, присутствующие в PHKi-полинуклеотиде, могут быть модифицированными.

PHKi-полинуклеотид модулирует экспрессию РНК, кодируемую геном. Поскольку множество генов могут иметь определенный уровень гомологии их последовательностей, то PHKi-полинуклеотид можно создавать таким образом, чтобы его мишенью был класс генов, обладающих достаточной гомологией последовательностей. Так, PHKi-полинуклеотид может содержать последовательность, комплементарную последовательностям, которые характерны для различных генов-мишеней, или являются уникальными для специфического гена-мишени. Таким образом, можно создавать PHKi-полинуклеотид, мишенью которого будут консервативные области последовательности РНК, которые имеют гомологию с несколькими генами, тем самым оказывая направленное воздействие на несколько генов в семействах генов (например, различные изоформы гена, полученные в результате сплайсинга варианты, мутантные гены и т.д.). В другом варианте осуществления изобретения PHKi-полинуклеотид можно создавать так, чтобы его мишенью являлась последовательность, которая является уникальной для специфической последовательности РНК индивидуального гена.

Понятие комплементарность относится к способности полинуклеотида образовывать водородную(ые) связь(и) с другой полинуклеотидной последовательностью либо согласно традиционному предложенному Уотсоном-Криком типу или согласно другому нетрадиционному типу. Касательно полинуклеотидных молекул, предлагаемых в настоящем изобретении, свободная энергия связывания полинуклеотидной молекулы с ее мишенью (эффекторный сайт связывания) или комплементарнной последовательностью, является достаточной для того, чтобы происходил процессинг соответствующей функции полинуклеотида, например, ферментативное расщепление мРНК или ингибирование трансляции. Определение свободной энергии связывания для молекул нуклеиновых кислот хорошо известно в данной области (Frier и др., 1986, Turner и др., 1987). Процент комплементарности свидетельствует о проценте оснований в состоящей из смежных нуклеотидов цепи в первой полинуклеотидной молекуле, которые могут образовывать водородные связи (например, спаривание оснований согласно модели Уотсона-Крика), со второй полинуклеотидной последовательностью (например, 5, 6, 7, 8, 9, 10 из 10 соответствуют 50%, 60%, 70%, 80%, 90% и 100% комплементарности). Полная комплементарность означает, что все основания в состоящей из смежных нуклеотидов цепи полинуклеотидной последовательности связаны с помощью водородной связи с таким же количеством смежных оснований во второй полинуклеотидной последовательности.

Под ингибированием, понижающей регуляцией или «выключением» экспрессии гена подразумевают, что экспрессия гена, оцененная по уровню РНК, транскрибированной с гена, или уровню полипептида, белка или субъединицы белка, транслируемого с РНК, понижена по сравнению с тем, когда содержащие блокирующий полинуклеотид конъюгаты, предлагаемые в изобретении, отсутствуют. Ингибирование, понижающая регуляция или «выключение» экспрессии гена с помощью полинуклеотида, введенного с использованием композиций, предлагаемых в изобретении, предпочтительно являются более низкими по сравнению с уровнем, обнаруженным в присутствии контрольной инактивирующей нуклеиновой кислоты с реорганизованной (скремблированной) последовательностью или инактивирующими ошибочными спариваниями, или в отсутствии конъюгации полинуклеотида с маскирующим полимером.

Введенный полинуклеотид может находиться в цитоплазме или ядре вне эндогенного генетического материала. В другом варианте ДНК может рекомбинироваться с (становиться частью) эндогенным генетическим материалом. Рекомбинация может приводить к встраиванию ДНК в хромосомную ДНК путем либо гомологичной, либо негомологичной рекомбинации.

Полинуклеотид можно вводить в клетку для экспрессии экзогенной нуклеотидной последовательности, для ингибирования, элиминации, повышения или изменения экспрессии эндогенной нуклеотидной последовательности или воздействия на специфические физиологические характеристики, которые в норме не ассоциированы с клеткой.

Полинуклеотиды могут содержать кассету экспрессии, предназначенную для экспрессии всего или части белка или РНК. Понятие кассета экспрессии относится к встречающемуся в естественных условиях или полученному рекомбинантно полинуклеотиду, который обладает способностью экспрессировать последовательность. Понятие рекомбинантная в контексте настоящего описания относится к полинуклеотидной молекуле, которая состоит из сегментов полинуклеотидов, соединенных с помощью известных в области молекулярной биологии методов. Кассета содержит кодирующую область представляющего интерес гена наряду с любыми другими последовательностями, которые оказывают воздействие на экспрессию представляющей интерес последовательности. Кассета экспрессии, как правило, включает промотор (обеспечивающий инициацию транскрипции) и транскрибируемую последовательность. Необязательно кассета экспрессии может включать, но не ограничиваясь только ими: энхансеры транскрипции, некодирующие последовательности, сигналы сплайсинга, сигналы терминации транскрипции и сигналы полиаденилирования. Кассета экспрессии РНК, как правило, включает кодон инициации трансляции (обеспечивающий инициацию трансляции) и последовательность, кодирующую один или несколько белков. Необязательно кассета экспрессии может включать, но не ограничиваясь только ими, сигналы терминации трансляции, полиаденозиновую последовательность, внутренние рибосомальные сайты проникновения (IRES) и некодирующие последовательности.

Полинуклеотид может содержать последовательности, которые не обладают конкретной функцией в клетке-мишени, но которые применяют для получения полинуклеотида. Такие последовательности включают, но не ограничиваясь только ими, последовательности, которые необходимы для репликации или отбора полинуклеотида в организме-хозяине.

Понятие ген обычно относится к полинуклеотидной последовательности, которая содержит кодирующие последовательности, необходимые для получения терапевтического полинуклеотида (например, рибозима) или полипептида, или предшественника. Полипептид может кодироваться полноразмерной кодирующей последовательностью или любой частью кодирующей последовательности, если она сохраняет требуемую активность или функциональные свойства (например, ферментативную активность, связывание лиганда, трансдукцию сигнала) полноразмерного полипептида или фрагмента. Под понятие подпадает также кодирующая область гена и включающая последовательности, локализованные по соседству с кодирующей областью и на 5′-, и на 3′-концах на расстоянии примерно 1 т.п.н. или более на любом конце, в результате ген соответствует длине непроцессированной мРНК. Последовательности, которые локализованы на 5′-конце кодирующей области и которые присутствуют в мРНК, обозначают как 5′-нетранслируемые последовательности. Последовательности, которые локализованы на 3′-конце или по ходу транскрипции кодирующей области и которые присутствуют в мРНК, обозначают как 3′-нетранслируемые последовательности. Под понятие ген подпадают как кДНК, так и геномные формы гена. Геномная форма или клон гена содержит кодирующую область, прерываемую некодирующими последовательностями, которые называют интронами, прерывающими областями или прерывающими последовательностями. Интроны представляют собой сегменты гена, которые транскрибируются в ядерную РНК. Интроны могут содержать регуляторные элементы, такие как энхансеры. Интроны изымают или удаляют путем сплайсинга из ядерного или первичного транскрипта; в результаты интроны отсутствуют в зрелом транскрипте РНК. Матричная РНК (мРНК) функционирует в процессе трансляции для придания специфичности последовательности или для упорядочивания аминокислот в возникающем полипептиде. Ген может включать также другие области или последовательности, включая, но не ограничиваясь только ими, промоторы, энхансеры, сайты связывания факторов транскрипции, сигналы полиаденилирования, внутренние рибосомальные сайты проникновения, глушители (silencer), изолирующие последовательности, области присоединения матрикса. Эти последовательности могут примыкать к кодирующей области гена (в пределах 10000 нуклеотидов) или находиться в удаленных сайтах (более 10000 нуклеотидов). Эти некодирующие последовательности оказывают влияние на уровень или скорость транскрипции и/или трансляции гена. Ковалентная модификация гена может влиять на скорость транскрипции (например, метилирование геномной ДНК), стабильность мРНК (например, длина полиаденозинового 3′-хвоста), скорость трансляции (например, 5′-кэп), репарацию нуклеиновых кислот, ядерный транспорт и иммуногенность. Одним из примеров ковалентной модификации нуклеиновой кислоты является воздействие реагентов типа LABELIT® (фирма Mirus Corporation, Мэдисон, шт. Висконсин).

В контексте настоящего описания понятие экспрессия гена относится к процессу превращения генетической информации, кодируемой в гене, в РНК (например, малая РНК, siPHK, мРНК, рРНК, тРНК или мяРНК) посредством транскрипции дезоксирибонуклеинового гена (например, благодаря ферментативному действию РНК-полимеразы), а для кодирующих белки генов - в белок посредством трансляции мРНК. Экспрессию генов можно регулировать на многих стадиях этого процесса. Понятие повышающая регуляция или активация относится к регуляции, которая повышает производство продуктов экспрессии генов (т.е. РНК или белок), а понятие понижающая активация или подавление относится к регуляции, которая снижает производство. Молекулы (например, факторы транскрипции), которые участвуют в повышающей регуляции или понижающей регуляции, часто называют активатором и репрессорами соответственно.

Полинуклеотид можно применять в исследовательских целях или для осуществления изменения в клетке, которое можно использовать в терапевтических целях. Введение полинуклеотида в терапевтических целях обычно называют генной терапией. Введение полинуклеотида может приводить к модификации генетического материала, присутствующего в клетке-мишени. Понятие стабильная трансфекция или стабильно трансфектированный, как правило, относится к интродукции и интеграции экзогенного полинуклеотида в геном трансфектированной клетки. Понятие стабильный трансфектант относится к клетке, в которой полинуклеотид стабильно интегрирован в геномную ДНК. Для стабильной трансфекции можно применять также эписомальные векторы, которые реплицируются в процессе деления эукариотической клетки (например, векторы на основе плазмидной ДНК, содержащие сайт инициации репликации вируса папилломы, искусственные хромосомы). Понятие кратковременная трансфекция или кратковременно трансфектированный относится к интродукции полинуклеотида в клетку, в которой не происходит интеграции полинуклеотида в геном трансфектированной клетки. Если полинуклеотид содержит обладающий способностью к экспрессии ген, то кассету экспрессии подвергают регуляторному контролю, который обеспечивает управление экспрессией эндогенных генов в хромосомах. Понятие кратковременный трансфектант относится к клетке, в которой произошло поглощение полинуклеотида, но не произошла интеграция полинуклеотида в ее геномную ДНК.

Создание препаративных форм

Конъюгат полинуклеотид-полимер получают путем ковалентного сцепления полинуклеотида с полимером. Полимер полимеризуют или модифицируют таким образом, чтобы он содержал реактивную группу А. Полинуклеотид также полимеризуют или модифицируют так, чтобы он содержал реактивную группу В. Реактивные группы А и В выбирают таким образом, чтобы их можно было сцеплять обратимой ковалентной связью с помощью методов, известных в данной области.

Конъюгацию полинуклеотида с полимером можно осуществлять в присутствии избытка полимера. Поскольку полинуклеотид и полимер могут нести противоположные заряды в процессе конъюгации, то присутствие избытка полимера может снижать или элиминировать агрегацию конъюгата. В другом варианте можно применять избыток полимера-носителя, такого как поликатион. Избыток полимера можно удалять из конъюгированного полимера до введения конъюгата животному или в клеточную культуру. Еще в одном варианте избыток полимера можно вводить вместе с конъюгатом животному или в клеточную культуру.

Полимер можно конъюгировать также с маскирующим агентом в присутствии избытка полимера или маскирующего агента. Поскольку полинуклеотид и полимер могут нести противоположные заряды в процессе конъюгации, то присутствие избытка полимера может снижать или элиминировать агрегацию конъюгата. В другом варианте можно применять избыток полимера-носителя. Избыток полимера можно удалять из конъюгированного полимера до введения конъюгата животному или в клеточную культуру. Еще в одном варианте избыток полимера можно вводить вместе с конъюгатом животному или в клеточную культуру. Полимер можно модифицировать до или после конъюгации полинуклеотида с полимером.

Реагент для трансфекции

Процесс введения полинуклеотида в клетку обычно называют трансфекцией или процессом трансфекции. Понятие трансфекция в контексте настоящего описания относится к интродукции полинуклеотида или другого биологически активного соединения снаружи клетки внутрь клетки таким образом, чтобы полинуклеотид обладал биологической активностью. Полинуклеотид можно применять в исследовательских целях или для осуществления изменения в клетке, которое можно использовать в терапевтических целях. Введение полинуклеотида может приводить к модификации генетического материала, присутствующего в клетке-мишени. Реагент для трансфекции или предназначенный для введения носитель представляет собой соединение или соединения, которое(ые) связывается(ются) или образует(ют) комплекс(ы) с олигонуклеотидами и полинуклеотидами и опосредует(ют) проникновение в клетки. Реагенты для трансфекции in vitro или предназначенные для введения носители представляют собой соединения или композиции соединений, которые связываются или образуют комплекс с олигонуклеотидами и полинуклеотидами и опосредуют их проникновение в клетки. Примерами реагентов для трансфекции являются, но не ограничиваясь только ими, комплексы белка и полимера (полиплексы), липидов и липосом (липоплексы), комбинации полимеров и липидов (липополиплексы), осадки, полученные при использовании фосфата кальция, и дендримеры. Как правило, реагент для трансфекции имеет компонент с чистым положительным зарядом, который связывается с отрицательным зарядом олигонуклеотида или полинуклеотида. Катионные агенты для трансфекции можно конденсировать также с крупными нуклеиновыми кислотами. Агенты для трансфекции можно применять также для ассоциации функциональных групп с полинуклеотидом. Функциональные группы включают обеспечивающие направленный перенос в клетку сигналы, сигналы ядерной локализации, соединения, которые повышают высвобождение содержимого эндосом или других внутриклеточных пузырьков (например, обладающие активностью в отношении мембран соединения) и другие соединения, которые изменяют поведение или взаимодействия соединения или комплекса, к которому они присоединены (модификаторы взаимодействия).

Конъюгированные полинуклеотиды, предлагаемые в настоящем изобретении, являются ценными реагентами, и они могут найти применение в терапевтических, диагностических способах, для валидации мишеней, изучения генома, генетической инженерии и для фармакогеномных исследований. Конъюгированный полинуклеотид обладает улучшенными характеристиками поглощения клеткой по сравнению с таким же неконъюгированным полинуклеотидом.

Парентеральные пути введения включают внутрисосудистые (внутривенные, внутриартериальные), внутримышечные, внутрипаренхимные, внутрикожные, субдермальные, подкожные, внутриопухолевые, внутрибрюшинные, внутритрахеальные, субдуральные, эпидуральные и внутрилимфатические инъекции, для которых используют шприц и иглы или катетеры. В контексте настоящего описания понятие «внутрисосудистый» означает «находящийся внутри трубчатой структуры, которую называют сосудом, соединенной с тканью или органом в организме». Внутрь полости трубчатой структуры общая вода организма втекает или вытекает в организм. Примерами общей воды организма являются кровь, спинномозговая жидкость (СМЖ), лимфатическая жидкость или желчь. Примерами сосудов являются артерии, артериолы, капилляры, венулы, синусоидные капилляры, вены, лимфатические, желчные протоки и протоки слюнных или других экзокринных желез. Внутрисосудистый путь включает введение через кровеносные сосуды, такие как артерия или вена. Кровеносная система обеспечивает системное распространение фармацевтических агентов. Подразумевается, что путь введения через слизистую мембрану включает назальное введение, введение в бронхи, ингаляцию в легкие или введение через глаза. Внутрипаренхимный путь включает непосредственную инъекцию в ткань, такую как печень, легкое, сердце, мышца (скелетная мышца или диафрагма), селезенка, поджелудочные железы, головной мозг (включая внутрижелудочковую инъекцию), спинной мозг, ганглии, лимфатические узлы, жировая ткань, ткань щитовидной железы, надпочечники, почки, предстательная железа и опухоли. Для чрескожных путей введения используют пластыри и ионофорез. Другие эпителиальные пути включают оральный, назальный, респираторный, ректальный и вагинальный пути введения.

Конъюгаты можно инъецировать в фармацевтически приемлемом носителе в виде раствора. Понятие «фармацевтически приемлемый» относится к свойствам и/или субстанциям, приемлемым для млекопитающего с фармакологической/токсикологической точки зрения. Фраза «фармацевтически приемлемый» относится к молекулярным субстанциям, композициям и свойствам, которые являются физиологически переносимыми и, как правило, не вызывают аллергическую или другую нежелательную реакцию при введении млекопитающему. Предпочтительно в контексте настоящего описания понятие «фармацевтически приемлемый» относится к субстанции, утвержденной регулирующим агентством Федерального или государственного управления или разрешенной Фармакопеей США или другой принятой фармакопеей для применения на животных и более конкретно на человеке.

Терапевтическое действие

В изобретении предложено введение полинуклеотида, приводящее к экспрессии гена или ингибированию генной экспрессии репортерных генов и эндогенных генов в специфических тканях. Уровни экспрессии репортерных (маркерных) генов, определенные после введения полинуклеотида, свидетельствуют о том, что можно ожидать таких же уровней генной экспрессии, которые наблюдаются при введении других полинуклеотидов. Показатель лечения, который обычный специалист в данной области рассматривает, как благоприятный, отличается от заболевания к заболеванию, например, гемофилия А и В связана с дефицитом Х-сцепленных факторов свертывающей системы крови VIII и IX соответственно. На их клиническую картину главным образом влияет процентное содержание относительно уровней в сыворотке здоровых людей фактора VIII или IX: <2%, серьезная; 2-5%, умеренная; и 5-30% слабая. Таким образом, повышение содержания фактора с 1% до 2% относительно уровня в кровотоке здорового человека у страдающих серьезной формой гемофилии следует рассматривать как благоприятное воздействие. Уровни, превышающие 6%, предупреждают спонтанное кровотечение, но не те кровотечения, которые являются вторичными, связанными с хирургическим вмешательством или повреждением. Аналогично этому, ингибирование гена не обязательно должно быть 100% для проявления благоприятного действия. Обычный специалист в области генной инженерии может с уверенностью определить уровни экспрессии гена, специфического для заболевания, на основе данных о достаточных уровнях маркерного гена. Например, в случае гемофилии, если в результате экспрессии маркерных генов уровень образовавшего белка, сопоставим с 2 об.% относительно уровней фактора VIII у здорового человека, то можно с большей долей уверенности ожидать, что ген, кодирующий фактор VIII, должен экспрессироваться с подобными же уровнями. Таким образом, репортерные или маркерные гены, такие как гены люциферазы и β-галактозидазы, служат в качестве ценных примеров, характеризующих экспрессию внутриклеточных белков в целом. Аналогично этому, репортерные или маркерные гены, секретирующие щелочную фосфатазу (SEAP), служат ценными примерами, характеризующими секретируемые белки в целом.

Терапевтическое действие белка, экспрессируемого с введенного полинуклеотида, в отношении ослабления или предупреждения болезни, состояния или симптома можно определять по белку, либо присутствующему в клетке, сохранившемуся в прикрепленном состоянии к клеточной мембране, либо секретируемому и диссоцированному из клетки, при этом он может проникать в общую систему кровообращения и кровь. Секретируемые белки, которые могут являться терапевтическими, включают гормоны, цитокины, факторы роста, факторы свертывающей системы крови, антипротеазные белки (например, альфа-антитрипсин) и другие белки, которые присутствуют в крови. Мембранные белки обладают терапевтическим действием, представляя собой рецептор для клетки, с которым связывается белок или липопротеин. Например, рецептор липротеина низкой плотности (ЛПНП) можно экспрессировать в гепатоцитах и понижать уровни холестерина и тем самым предупреждать атеросклеротические повреждения, которые могут вызывать «удар» или инфаркт миокарда. Терапевтические белки, которые могут оставаться внутри клетки, могут представлять собой ферменты, которые осуществляют клиренс находящихся в кровотоке токсических метаболитов, например, при фенилкетонурии. Они могут также обусловливать более низкую пролиферацию раковых клеток или их злокачественность (например, снижать метастатическое действие). Белок внутри клетки может также влиять на репликацию вируса.

Печень является одной из наиболее важных тканей-мишеней для генной терапии, поскольку она играет основную роль в метаболизме (например, метаболизм липопротеинов при различных гиперхолестеринемиях) и секреции белков кровотока (например, факторы свертывающей системы крови при гемофилии). По меньшей мере сто различных генетических нарушений потенциально можно корректировать с помощью направленной на печень генной терапии. Кроме того, приобретенные нарушения, такие как хронический гепатит и цирроз, являются широко распространенными и их также можно лечить с помощью направленных на печень терапий, основанных на применении полинуклеотидов. Генные терапии, включающие гетеротропную генную экспрессию, могут расширять также спектр нарушений, которые можно лечить с помощью направленного переноса гена в печень. Например, сахарный диабет можно лечить путем экспрессии гена инсулина в гепатоцитах, которые по физиологическим показаниям могут осуществлять регулируемую глюкозой секрецию инсулина.

Помимо увеличения или снижения уровня экспрессии генов, участвующих в метаболизме или в заболевании, введение полинуклеотидов в клетку in vivo можно применять также для стимуляции иммунной системы, стимуляции иммунной системы в отношении разрушения раковых клеток, инактивации онкогенов или введения генов-супресссоров опухоли. Полинуклеотиды можно вводить также для индукции иммунитета к патогенам или для блокады экспрессии патогенных генов.

Различные определения

В контексте настоящего описания in vivo относится к процессу, осуществляемому внутри организма и более конкретно к процессу, осуществляемому в живой ткани целого живого многоклеточного организма (животного), такого как млекопитающее, в отличие от части организма или мертвого организма.

В контексте настоящего описания in vitro относится к процессу, осуществляемому в искусственной среде, созданной вне живого многоклеточного организма (например, в лабораторной пробирке или культуральном планшете), которую используют в экспериментальных исследованиях для изучения болезни или процесса. В контексте настоящего описания in vitro включает процессы, осуществляемые в интактных клетках, которые выращивают в культуре.

В контексте настоящего описания in situ относится к процессам, которые осуществляют в интактной ткани. Однако ткань может находиться в живом организме или быть удалена из организма.

В контексте настоящего описания ex vivo относится к процессу, осуществляемому в искусственной среде вне организма на живых клетках или тканях, которые удалены из организма и затем возвращены в организм.

Перекрестносшивающие агенты представляют собой бифункциональные молекулы, которые применяют для соединения двух молекул вместе, т.е. они образуют связь между двумя молекулами. Бифункциональные молекулы могут быть гомо- или гетеробифункциональными.

В контексте настоящего описания поверхностно-активный полимер снижает поверхностное натяжение воды и/или межфазное натяжение с другими фазами и вследствие этого положительно абсорбируется на границе раздела жидкость/пар.

Антитело представляет собой любой иммуноглобулин, включая антитела и их фрагменты, которые связываются со специфическим эпитопом. Под понятие подпадают поликлональные, моноклональные и химерные антитела. Антигенсвязывающий центр антитела представляет собой структурную область молекулы антитела, которая содержит вариабельные области и гипервариабельные участки тяжелых и легких цепей, которые специфически связывает антиген. Под понятие молекула антитела и его различные грамматические формы в контексте настоящего описания подпадают как интактная молекула иммуноглобулина, так и иммунологически активная часть молекулы иммуноглобулина. Примерами молекул антител являются интактные молекулы иммуноглобулинов, практически интактные молекулы иммуноглобулинов и те участки молекул иммуноглобулинов, которые содержат паратоп, в том числе участки, известные в данной области как Fab-, Fab′-, F(ab′)2- и F(v)-фрагменты, которые являются предпочтительными для применения в терапевтических способах, предлагаемых в настоящем изобретении. Fab- и F(ab′)2-фрагменты молекул антител получают с помощью протеолитической реакции с использованием папаина и пепсина соответственно, которой подвергают практически интактные молекулы антител с помощью методов, хорошо известных в данной области. Понятие моноклональное антитело и его различные грамматические формы относится к антителу, несущему только один вид антигенсвязывающих центров антитела, который обладает иммунореактивностью в отношении конкретного антигена. Таким образом, моноклональное антитело, как правило, характеризуется одной аффинностью к связыванию любого антигена, в отношение которого оно обладает иммунореактивностью. Поэтому моноклональное антитело может представлять собой молекулу антитела, содержащую несколько антигенсвязывающих центров антитела, каждый из которых обладает иммуноспецифичностью в отношении различных антигенов; например, может представлять собой биспецифическое (химерное) моноклональное антитело.

Примеры

Пример 1. Синтез и сборка полинуклеотидов. Применяли следующие синтетические олигонуклеотиды РНК (фирма Dharmacon, Лафаетт, шт. Колорадо). Смысловые цепи РНК содержали первичный амин с шестью углеродными спейсерами на 5′-конце, что позволяло осуществлять конъюгацию с предназначенным для введения носителем. У защищенных с помощью 2′АСЕ олигонуклеотидов удаляли защитные группы перед осуществлением стадии репатурации согласно инструкциям производителя. SiPHK имели следующие последовательности:

ароВ (Ensembl# ENSMUST00000037520);

siPHK apoB-1

смысловая 5′-NH4-GAAmUGmUGGGmUGGmCAAmCmUmUmUmA*G, SEQ ID 1,

антисмысловая 5′-P-AmAAGUUGCCACCCACAUUCmA*G, SEQ ID 2;

siPHK apoB-2

смысловая 5′-NH4-GGAmCAmUGGGmUmUCCAAAmUmUAmC*G, SEQ ID 3,

антисмысловая 5′-P-UmAAUUUGGAACCCAUGUCCmC*G, SEQ ID 4;

ppara (GenBank# NM_011144);

siPHK ppara-1,

смысловая 5′-NH4-mUmCAmCGGAGmCmUmCAmCAGAAmUmUmC*U-3′, SEQ ID 5,

антисмысловая 5′-P-AmAUUCUGUGAGCUCCGUGAmC*U-3′, SEQ ID 6;

siPHK ppara-2

смысловая 5′-NH4-mUmCCCAAAGCmUCCmUmUmCAAAAmU*U-3′, SEQ ID 7,

антисмысловая 5′-P-mUmUUUGAAGGAGCUUUGGGAmA*G-3′, SEQ ID 8;

контрольная siPHK (репортерный ген люциферазы GL-3),

смысловая 5′-NH4-mCmUmUAmCGmCmUGAGmUAmCmUmUmCGAmU*U-3′; SEQ ID 9,

антисмысловая 5′-P-UmCGAAGUACUCAGCGUAAGmU*U; SEQ ID 10;

m = замена 2′-O-СН3,

* = фосфоротиоатная связь и

Р = PO4.

Смысловые и антисмысловые олигонуклеотиды для каждой последовательности-мишени ренатурировали, для чего их смешивали в эквимолярных количествах и нагревали до 94°С в течение 5 мин, охлаждали до 90°С в течение 3 мин, затем понижали температуру поэтапно на 0,3°С 250 раз, выдерживая каждый раз по 3 с.

Пример 2. Статистические сополимеры простого винилового эфира

А. Синтез мономера простого винилового эфира

2-Винилоксиэтилфталимид получали взаимодействием простого 2-хлорэтилвинилового эфира (25 г, 0,24 моля) и фталимида калия (25 г, 0,135 моля) при 100°С в ДМФ (75 мл), используя бромид тетра-н-бутиламмония (0,5 г) в качестве межфазного катализатора. Этот раствор нагревали в течение 6 ч и затем сливали в воду и фильтровали. Указанный твердый продукт затем перекристаллизовывали дважды из метанола, получая кристаллы белого цвета.

Б. Полимеры амин + простой алкилполивиниловый эфир.

Серии сополимеров синтезировали из мономеров простого винилового эфира с различными соотношениями алкильных и аминогрупп и с использованием алкильных групп, которые содержали от 1 до 4 атомов углерода (фиг.1, R и R′ могут быть одинаковыми или различными). Активность в отношении мембран зависела от размера (длина алкильной цепи) и соотношения гидрофобных мономеров (Wakefield 2005). На моделях липосом установлено, что пропильные и бутильные полимеры обладали литической активностью в отношении мембран, в то время как содержащие метил и этил полимеры не обладали таким действием. В контексте настоящего описания эти полимеры обозначены как простые метил-, этил-, пропил- или бутиламиновиниловые эфиры (PMAVE, PEAVE, PPAVE или PBAVE соответственно). Эти полимеры несут достаточно высокий заряд для того, чтобы образовывать комплексы с ДНК при физиологических концентрациях солей. В противоположность этому, небольшие обладающие литической активностью в отношении мембран катионные пептиды, такие как мелиттин, оказались слишком слабыми и не обладали совсем способностью конденсировать ДНК в изотонических солевых растворах. Больший размер синтетических амфипатических полимеров не только приводил к повышению способности к связыванию ДНК, но также обусловливал их более высокую по сравнению с мелиттином литическую активность на молярном уровне. Способность вызывать лизис мембран с использованием меньшего количества молекул полимера должна облегчать введение in vivo нуклеиновых кислот. При создании изобретения была определена с использование меченной флуорофором ДНК плотность заряда синтезированных полимеров и подтверждена их стабильность в солевых растворах.

В. Синтез водорастворимых, амфипатических, обладающих активностью в отношении мембран тройных сополимеров простого винилового эфира-полиамина.

Х мол.% несущего защищенный амин простого винилового эфира (например, 2-винилоксиэтилфталимид) добавляли в высушенную в печи круглодонную колбу в защитном слое азота в безводном дихлорметане. К этому раствору добавляли Y мол.% простого алкил- (например, этил-, пропил- или бутил-)винилового эфира, а затем Z мол.% простого алкил- (додецил-, октадецил-) винилового эфира (фиг.1). Хотя приведенные в качестве примеров полимеры состояли из 2-3 различных мономеров, изобретение не ограничено конкретным составом мономеров простого винилового эфира. Под объем изобретения подпадают также полимеры, содержащие большее количество мономеров или различные мономеры. Раствор доводили до -78°С в бане сухой лед/ацетон. К этому раствору добавляли 10 мол.% BF3EtOEt и реакции давали протекать в течение 2-3 ч при -78°С и затем прекращали с помощью метанольного раствора гидроксида аммония. Полимер высушивали досуха при пониженном давлении и затем вносили в 30 мл смеси 1,4-диоксан/метанол (2/1). Добавляли 20 мол. эквивалентов гидразина на фталимид для удаления защитной группы амина. Раствор кипятили с обратным холодильником в течение 3 ч, затем сушили досуха при пониженном давлении. Твердый продукт вносили в 20 мл 0,5 М HCl, кипятили с обратным холодильником в течение 15 мин, разводили 20 мл дистиллированной воды и кипятили с обратным холодильником в течение еще 1 ч. Затем раствор нейтрализовали NaOH, охлаждали до комнатной температуры, переносили в целлюлозное трубчатое устройство для диализа, отсекающее соединения с молекулярной массой 3500, подвергали диализу в течение 24 ч (2×20 л) в противотоке дистиллированной воды и сушили вымораживанием. Молекулярную массу полимеров определяли с помощью аналитических колонок для гель-фильтрации согласно стандартным процедурам. Хотя в этих примерах описаны полимеры, содержащие указанные мономеры простых виниловый эфиров, изобретение не ограничено конкретными мономерами.

После удаления фталимидных групп путем последовательной обработки гидразином и HCl полимеры переносили в целлюлозное трубчатое устройство для диализа, отсекающее соединения с молекулярной массой 3500, подвергали диализу в течение 24 ч (2×20 л) в противотоке дистиллированной воды и сушили вымораживанием. Затем полимеры растворяли в воде и вносили в колонку, заполненную сефадексом G-15. Полимеры, полученные после хроматографии па сефадексе G-15, выделяли и концентрировали лиофилизацией. Затем определяли молекулярные массы полимеров, используя GPC, с помощью серий колонок Eprogen Inc. CATSEC100, CATSEC300 и CATSEC1000. Подвижный буфер содержал 50 мМ NaCl, 0,1% ТФК и 10% МеОН. В качестве калибровочных кривых применяли поливинилпиридиновые стандарты. Молекулярные массы полимеров составляли 10000-100000 Да, при этом для большинства полимерных препаратов молекулярная масса превышала 20000 Да.

Г. Синтез DW1360.

Тройной сополимер простого амин/бутил/октадецилполивинилового эфира синтезировали из мономеров 2-винилоксиэтилфталимида (3,27 г, 15 ммолей), простого бутилвинилового эфира (0,40 г, 4 ммоля) и простого октадецилвинилового эфира (0,29 г, 1 ммоль). Мономеры растворяли в 30 мл безводного дихлорметана. Затем эти растворы добавляли в баню сухой лед/ацетон при -78°С. Через 2 мин добавляли BF3·OEt2 (0,042 г, 0,3 ммоля) и реакции давали протекать в течение 3 ч при -78°С. Затем полимеризацию прекращали, добавляя смесь 50/50 гидроксида аммония в метаноле или раствор борогидрида лития. Затем растворители удаляли с помощью роторного испарителя. После чего полимер растворяли в 30 мл смеси 1,4-диоксан/метанол (2/1). К этому раствору добавляли гидразин (0,44 г, 138 ммолей) и смесь нагревали до температуры дефлегмации в течение 3 ч. Затем растворители удаляли с помощью роторного испарителя и образовавшееся твердое вещество вносили в 20 мл 0,5 М HCl и кипятили с обратным холодильником в течение 15 мин, разводили 20 мл дистиллированной воды и кипятили с обратным холодильником в течение еще 1 ч. Затем этот раствор нейтрализовали с помощью NaOH, охлаждали до КТ, переносили в целлюлозное трубчатое устройство для диализа, отсекающее соединения с молекулярной массой 3500, подвергали диализу в течение 24 ч (2×20 л) в противотоке дистиллированной воды и лиофилизировали.

Аналогично можно синтезировать другие полимеры, содержащие различные соотношения аминогрупп, бутильных и октадецильных групп. Кроме того, можно включать другие мономеры. В частности, в полимеры можно включать простой трет-бутилвиниловый эфир, простой додецилвиниловый эфир и простой олеинвиниловый эфир.

Согласно одному из вариантов осуществления изобретения можно синтезировать тройные сополимеры простого амин/(низш.)алкил/(высш.)алкилполивинилого эфира, используя мономеры при степени загрузки 15 аминовых мономеров: 4 (низш.)алкильных мономера: 1 (высш.)алкильный мономер. При указанных выше условиях установлено, что уровень включения составлял примерно 5,4-7,5 аминовых мономеров: 3-3,5 (низш.)алкильных мономеров: 1 (высш.)алкильный мономер. Согласно другому варианту осуществления изобретения синтезировали тройные сополимеры простого амин/(низш.)алкил/(высш.)алкилполивинилого эфира, используя мономеры при степени загрузки 4-8 аминовых мономеров: 3-5 (низш.)алкильных мономеров: 1 (высш.)алкильный мономер. В предпочтительном варианте осуществления изобретения полимеры являются водорастворимыми (примерно 1 мг/мл или более при 25°С) и обладают поверхностной активностью.

В одним из вариантов осуществления изобретения полимеры фракционировали, получая полимеры с молекулярной массой от примерно 5 до примерно 50 кДа и более предпочтительно от примерно 10 до примерно 30 кДа.

Д. Другие тройные сополимеры.

Аналогичные полимеры можно синтезировать, модифицируя различные каркасы полимеров, включая, но не ограничиваясь только ими: поли-L-лизин (PLL), поливиниламин (PVA) и полиаллиламин (РАА). Путем присоединения алкильных групп к различным основным цепям этих полимеров можно создавать тройные полимеры с соотношением амин: (низш.)алкил: (высш.)алкил примерно 6:3:1.

Е. Лизис липосом.

10 мг фосфатидилхолина куриного яйца гидрировали с помощью 1 мл буфера, содержащего 100 мМ карбоксифлуоресцеин (CF) и 10 мМ HEPES, рН 7,5. Затем липосомы экструдировали через поликарбонатные фильтры с размером пор 100 им (фирма Nucleopore, Плезантон, шт. Калифорния) Несвязанный CF удаляли с помощью гель-фильтрации на сефарозе 4 В-200, осуществляя элюцию 10 мМ HEPES, рН 8, 0,1 М NaCl. Аликвоты по 200 мкл загруженных CF липосом добавляли в 1,8 мл изотоничного буфера. Флуоресценцию (λex=488, λem=540) определяли через 30 мин после добавления 0,25 мкг полимеров или мелиттина в суспензии пузырьков. В конце каждого эксперимента пузырьки разрушали, добавляя 40 мкл 1%-ного раствора Тритон Х-100 для определения максимального лизиса.

Пример 3. Маскирующие агенты

А. Синтез 2-пропионово-3-метилмалеинового ангидрида (гидроксиметилмалеиновый ангидрид или CDM).

К суспензии гидрида натрия (0,58 г, 25 ммолей) в 50 мл безводного тетрагидрофурана добавляли триэтил-2-фосфорнопропионат (7,1 г, 30 ммолей). После прекращения выделения газообразного водорода добавляли диметил-2-оксоглутарат (3,5 г, 20 ммолей) в 10 мл безводного тетрагидрофурана и перемешивали в течение 30 мин. Затем добавляли 10 мл воды и тетрагидрофуран удаляли с помощью роторного испарителя. Образовавшуюся смесь твердого вещества и воды экстрагировали 3×50 мл этилового эфира. Эфирные экстракты объединяли, сушили над сульфатом магния и концентрировали, получая масло желтого цвета. Масло очищали гель-фильтрацией на силикагеле, используя для элюции смесь 2:1 простой эфир: гексан, в результате чего получали 4 г (выход 82%) чистого сложного триэфира. Затем получали 2-пропионово-3-метилмалеиновый ангидрид в результате растворения этого сложного триэфира в 50 мл смеси 50/50 воды и этанола, содержащей 4,5 г (5 экв.) гидроксида калия. Этот раствор нагревали до температуры дефлегмации в течение 1 ч. Затем этанол удаляли с помощью роторного испарителя и раствор подкисляли до рН 2 с помощью соляной кислоты. Этот водный раствор затем экстрагировали 200 мл этилацетат, выделяли, сушили над сульфатом магния и концентрировали с получением твердого вещества белого цвета. Затем это твердое вещество перекристаллизовывали из дихлорметана и гексана, получая 2 г (выход 80%) 2-пропионово-3-метилмалеинового ангидрида.

Сложные тиоэфиры, сложные эфиры и амиды можно синтезировать на основе CDM путем превращения CDM в хлорангидрид с помощью оксалилхлорида с последующим добавлением тиола, сложного эфира или амина и пиридина. CDM и его производные можно модифицировать с помощью стандартных методов, известных в данной области, добавляя обеспечивающие направленный перенос лиганды, стабилизаторы стерической конфигурации, заряженные группы и другие реактивные группы. Образовавшиеся молекулы можно применять для обратимой модификации аминов.

Б. Содержащие галактозу обеспечивающие направленный перенос группы.

Основой наиболее широко изученных обеспечивающих направленный перенос в гепатоциты лигандов является галактоза, которая связывается с азиалогликопротеиновым рецептором (ASGPr) на гепатоцитах. Установлено, что присоединение галактозы облегчает направленный перенос в гепатоциты нескольких хорошо растворимых в воде незаряженных полимеров, включая: олигосахарид хитозан, производное полистирола и полиакриламид НРМА. Галактозные обеспечивающие направленный перенос группы легко получать с помощью лактозы, дисахаридов галактоза-глюкоза путем модификации глюкозного фрагмента. Лактобионовую кислоту (LBA, производное лактозы, в котором глюкоза окислена до глюконовой кислоты) можно включать в производное малеинового ангидрида с помощью стандартных методов амидного сочетания. На фиг.2 показана структура двух производных LBA, которые получали путем сочетания галактозы с малеиновым ангидридом CDM.

Малеаматная модификация приводит к превращению положительно заряженной аминовой группы в отрицательно заряженную. Такая модификация заряда может снижать неспецифические взаимодействия полимера с отрицательно заряженными клетками и компонентами сыворотки. Однако слишком высокий отрицательный заряд может усиливать взаимодействия с рецепторами-«мусорщиками» (скавенджер-рецепторами). Имеющее чистый нейтральный заряд содержащее галактозу производное малеинового ангидрида можно получать путем инсерции положительно заряженной группы третичного амина в маскирующий агент, в результате чего образуется цвиттерион. Такое соединение, т.е. CDM-Pip-LBA, можно создавать из следующих компонентов: CDM, пропиламинопиперазин и лактобионовая кислота (фиг.2).

В. Синтез стабилизатора стерической конфигурации CDM-ПЭГ и обеспечивающей направленный перенос группы CDM-NAG (N-ацетилгалактозамин) (фиг.2).

К раствору CDM (Rozema 2003) (300 мг, 0,16 ммоля) в 50 мл метиленхлорида добавляли оксалилхлорид (2 г, 10 мас. экв.) и диметилформамид (5 мкл). Реакции давали протекать в течение ночи, после чего избыток оксалилхлорида и метиленхлорида удаляли с помощью роторного испарителя, получая хлорангидрид CDM. Хлорангидрид растворяли в 1 мл метиленхлорида. К этому раствору добавляли 1,1 молярного эквивалента простого монометилового эфира полиэтиленгликоля (средняя ММ 450) для CDM-ПЭГ или (аминоэтокси)этокси-2-(ацетиламино)-2-дезокси-β-D-глюкопиранозида (т.е. аминобисэтоксилэтил NAG) для CDM-NAG, и пиридин (200 мкл, 1,5 экв.) в 10 мл метиленхлорида. Затем раствор перемешивали в течение 1,5 ч. Затем растворитель удаляли и образовавшееся твердое вещество растворяли в 5 мл воды и очищали с помощью ЖХВР с обращенной фазой, используя градиент 0,1% ТФК в воде/ацетонитрил (фиг.2).

Пример 4. Обратимое присоединение полинуклеотида к полимеру.

Модификация олигонуклеотидов амино-siPHK с помощью S-ацетильных групп приводила к получению стабильно защищенных тиолов, которые могли высвобождаться в основный раствор (рН≥9) в присутствии содержащего амин поликатиона. Стандартные условия удаления защитной группы для удаления сложной тиоэфирной группы предусматривают инкубацию с гидроксиламином. Однако указанные условия удаления защитной группы приводят к образованию в значительных количествах связанных дисульфидным мостиком димеров siPHK. Как правило, взаимодействие между алкиламином и сложным тиоэфиром является относительно медленным, но в комплексе между полианионной siPHK и поликатионным амином реакция между функциональными группами становится в значительной степени внутримолекулярной и значительно ускоряется (см. стадию 2а на фиг.3). Помимо ускорения удаления защитной группы в значительной степени ускоряется реакция высвободившихся тиольных групп с активированными дисульфидными группами на поликатионе (стадия 2б). Активированный дисульфидный пиридилтиол (PD) гарантирует избирательное образование дисульфида, и его легко присоединять к поликатиону с помощью поступающих в продажу реагентов. Результатом этих взаимодействий внутри частиц была >90% конъюгация дисульфида с поликатионом.

Пример 5. Обратимая конъюгация полинуклеотида с полимером

А. SATA-модифицированный полинуклеотид.

Модифицированные N-сукцинимидил-3-ацетилтиоацетатом (SATA) полинуклеотиды синтезировали путем взаимодействия модифицированной 5′-амином siPHK с 1 массовым эквивалентом (мас. экв.) реагента SATA (фирма Pierce) и 0,36 мас. экв. NaHCO3 в воде при 4°С в течение 16 ч. Защищенные тиолом модифицированные siPHK осаждали путем добавления 9 объемов этанола и инкубировали при -78°С в течение 2 ч. Осадок выделяли, растворяли в 1× буфере для siPHK (фирма Dharmacon) и количественно оценивали абсорбцию при длине волны 260 нм.

Полимер, в данном примере PBAVE или DW1360 (30 мг/мл в 5 мМ TAPS, рН 9), модифицировали путем добавления 1,5 мас.% 4-сукцинимидилоксикарбонил-α-метил-α-[2-пиридилдитио]толуола (SMPT, фирма Pierce). Через 1 ч после добавления SMPT добавляли 0,8 мг SMPT-полимера к 400 мкл изотонического раствора глюкозы, содержащего 5 мМ TAPS, рН 9. К этому раствору добавляли 50 мкг SATA-модифицированной siPHK. Для экспериментов по оценке дозовой зависимости, в которых концентрация PBAVE оставалась постоянной, добавляли различные количества siPHK. Затем смесь инкубировали в течение 16 ч. Таким путем полинуклеотид конъюгировали с полимером посредством обратимого дисульфидного мостика. Применение дисульфидного мостика для конъюгации между полимером и siPHK необходимо для обратимости в восстанавливающей среде цитоплазмы. Конъюгат siPHK-полимер маскировали, добавляя к раствору, содержащему 5,6 мг HEPES в виде свободного основания, с последующем добавлением смеси, включающей 3,7 мг CDM-NAG и 1,9 мг CDM-ПЭГ. Затем раствор инкубировали в течение 1 ч при комнатной температуре (КТ) до инъекции.

Б. Количественная оценка конъюгированного полинуклеотида.

Для определения количества конъюгированной siPHK аликвоты по 10 мкл конъюгата siPHK-полимер, содержащего 1 мкг siPHK, обрабатывали 2 мкл 1М ДТТ при КТ в течение 16 ч или не обрабатывали ДТТ. К образцам добавляли 100 мкг полиакриловой кислоты и 300 мкг NaCl для нейтрализации электростатических взаимодействий. После инкубации в течение 2 ч образцы подвергали электрофорезу на 2%-ном агарозном геле и siPHK визуализировали путем окрашивания бромидом этидия. Полосы, соответствующие siPHK, количественно оценивали, используя программное обеспечение Kodak Molecular Imaging Software, версия 4.0. Количество неконъюгированной siPHK стандартизовали относительно количества, высвободившегося после обработки ДТТ, для определения процента конъюгированного продукта. Количество конъюгированной siPHK, как правило, составляло 70-90%.

Можно применять другие варианты химии, основанной на дисульфидной конъюгации, когда тиол защищен в виде дисульфида или не защищен вообще. Кроме того, полимер можно модифицировать с помощью других активированных дисульфидных групп, тиольных групп или защищенных тиольных групп.

Пример 6. Обратимое присоединение CDM-маскирующих агентов к конъюгатам полинуклеотид-полимеры.

Конъюгаты полинуклеотид-полимер можно модифицировать, например, с помощью производных малеиновой кислоты, с целью обратимой модификации полимера (фиг.3, стадия 4.). Конъюгат siPHK-полимер маскировали, добавляли к раствору, содержащему 5,6 мг HEPES в виде свободного основания, с последующим добавлением смеси, содержащей 3,7 мг CDM-NAG и 1,9 мг CDM-ПЭГ. Затем раствор инкубировали в течение 1 ч при комнатной температуре (КТ) до инъекции in vivo.

Пример 7. Обеспечивающая направленный перенос активность замаскированных конъюгатов.

Для демонстрации способности CDM-Pip-LBA (содержащих галактозу) агентов обеспечивать направленный перенос в печень амфипатического простого поливинилового эфира 25/75 (25:75 бутил:амин) PBAVE, полимер метилфлуорофором Су3 с последующей модификацией с помощью CDM-ПЭГ с добавлением или без добавления CDM-Pip-LBA. По 100 мкг замаскированного полимера в 400 мкл изотонического раствора глюкозы инъецировали в хвостовую вену мышей. Образцы печени получали через 1 ч после инъекции и подготавливали замороженные срезы печени, которые обрабатывали для иммуногистохимического анализа (фиг.4). Как видно из фиг.4, обнаружена выраженная локализация полимера, для направленного переноса которого использовали CDM-Pip-LBA, в гепатоцитах (Б), в то время как для полимера, не имеющего обеспечивающих направленный перенос агентов, обнаружена локализация в основном в макрофагах печени (А).

Модифицированный с помощью CDM-LBA PBAVE является высокоанионным и, как установлено, обнаружен в основном в макрофагах (данные не представлены). Модифицированные с помощью CDM-Pip-LBA (цвиттерионный маскирующий агент) полимеры имели заряд, близкий к нейтральному, и характеризовались повышением количества полимера, направленно перенесенного в печень вообще и, что более важно, в гепатоциты в частности (фиг.4Б). Заряд, например, отрицательный заряд, можно защищать также с помощью стабилизаторов стерической конфигурации, включая маскирующие агенты CDM-ПЭГ.

Пример 8. Направленный перенос полинуклеотида в гепатоциты.

Создавали конъюгат олигонуклеотид-полимер согласно описанному выше методу и маскировали его с помощью CDM-Pip-LBA. 20 мкг SATA/Су3-модифицированной siPHK конъюгировали с 1,8 мг PD-модифицированной PLL и модифицировали с использованием CDM-Pip-LBA. Замаскированный конъюгат инъецировали в 400 мкл физиологического раствора в хвостовую вену мышей. Такой же раствор для инъекции содержал 100 мкг модифицированного с помощью CDM-Pip-LBA 25/75-PBAVE, меченного с помощью Oregon Green. Конъюгаты растворялись и не образовывали агрегатов в физиологических условиях. Через 1 ч после инъекции получали образцы печени и подготавливали замороженные срезы печени, которые обрабатывали для иммуногистохимического анализа. Для окраски клеточных ядер применяли ТО-PRO-3®. После инъекции в хвостовую вену мышей меченные олигонуклеотиды и PBAVE обнаружены в гепатоцитах (верхняя левая панель на фиг.5).

Пример 9. Активность конъюгатов in vivo.

Способность замаскированных конъюгатов полинуклеотид-полимер обеспечивать введение siPHK с целью ингбирования эндогенного гена в печени мышей оценивали с использованием альфа-рецептора, активируемого пролифераторами пероксисом (PPARa). Мышам линии С57В (n=4) инъецировали в хвостовую вену модифицированного с помощью CDM-Pip-LBA конъюгат PPARa siPHK-PLL (20 мкг siPHK, 1,8 мг PD-PLL) и 25/75-PBAVE (100 мкг) в 400 мкл изотонического раствора глюкозы. РНК получали из печени через 48 ч после инъекции. Уровни мРНК PPARa определяли с помощью количественной ПЦР в реальном времени (qRT-ПЦР). Уровни мРНК стандартизовали относительно уровней в животных, которым инъецировали антилюциферазную siPHK. Изменения уровней мРНК стандартизовали относительно эндогенной GAPDH. Осуществляли три независимых эксперимента. Как видно из фиг.6, обнаружено 20%-ное ингибирование уровней мРНК PPARa.

Пример 10. Введение/активность конъюгатов in vivo.

Самцов мышей возрастом 6-8 недель (линия C57BL/6, 20-25 г) получали от фирмы Harlan Sprague Dawley (Индианаполис, шт. Индиана). Мышей выдерживали в течение по меньшей мере 10 дней перед инъекцией. Животные имели свободный доступ к корму для грызунов типа Harlan Teklad Rodent Diet (фирма Harlan, Мэдисон, шт. Висконсин). Мышам вводили путем инфузии в хвостовую вену общий объем 0,4 мл забуференного HEPES (5 мМ, рН 7,5) изотонического раствора глюкозы. Мышам инъецировали конъюгаты либо ДНК, либо siPHK.

Мышам не давали корм в течение 4 ч до получения образцов сыворотки путем взятия крови из заглазничного сплетения и получения образцов печени. Сыворотку применяли для анализа методом Вестерн-блоттинга и добавляли к равному объему смеси полного ингибитора протеаз (Complete Protease Inhibitor Cocktail), содержащей ЭДТК (фирма Roche, Индианаполис, шт. Индиана) и хранили при -20°С. Общую РНК выделяли из печени непосредственно после получения образцов с помощью TRI-REAGENT® согласно протоколу производителя (фирма Molecular Research Center, Цинциннати, шт. Огайо).

Для анализа направленного переноса в гепатоциты получали поликонъюгат, содержащий 10 мкг меченной с помощью Су3 21-мерной dsДНК, согласно описанному выше методу в общем объеме 0,2 мл и вводили самцам мышей линии ICR (20-25 г, фирма Harlan Sprague Dawley) путем i.v.-инъекции. Через 1 ч после инъекции мышей умерщвляли и получали образцы печени. В некоторых экспериментах получали также образцы тканей легкого, почки, селезенки, головного мозга и поджелудочной железы. Образцы тканей фиксировали в смеси 4% параформальдегида/ЗФР в течение 6 ч и помещали в раствор 30% сахарозы/ЗФР, который выдерживали в течение ночи при 4°С. Фиксированные образцы тканей затем переносили в держатель для блоков, содержащий среду для замораживания ОСТ (фирма Fisher Scientific, Питтсбург, шт. Пенсильвания) и быстро замораживали в жидком азоте. Замороженные срезы тканей (8-10 мкм) получали с помощью криостата типа Microm HM 505N (фирма Carl Zeiss, Thornwood, шт. Нью-Йорк) и помещали на предметные стекла для микроскопа Superfrost-Plus (фирма Fisher Scientific). Срезы тканей подвергали контрастному окрашиванию с помощью ALEXA®-488-фаллоидина (13 нМ, фирма Invitrogen, Карлсбад, шт. Калифорния) и TO-PRO-3® (40 нМ, фирма Invitrogen) в ЗФР в течение 20 мин. Предметные стекла выдерживали в реагенте Vectashield (фирма Vector Laboratories, Берлингейм, шт. Калифорния) и анализировали с помощью конфокального микроскопа типа LSM510 (фирма Carl Zeiss).

Полученные с помощью конфокального микроскопа микрофотографии срезов печени мышей через 1 ч после инъекции конъюгата полинуклеотид-полимер, содержащего меченную с помощью Су3 21-мерную двухцепочечную ДНК, представлены на фиг.7 (верхний левый квадрат на каждой панели). Данные, полученные для актина, представлены в верхних правых квадратах для обозначения контуров клеток. Данные для ядер представлены в нижних левых квадратах. Объединенные изображения показаны в нижних правых квадратах. Накопление меченной с помощью Су3 dsДHK в гепатоцитах обнаружено, в том случае, когда полимер содержал обеспечивающие направленный перенос остаток NAG, при этом обнаружено минимальное поглощение клетками Купфера или накопление в синусоидных капиллярах печени (фиг.7А). Распределение было практически однородным в различных долях печени. Оценка других органов позволила выявить наличие невысокого уровня Су3-флуоресценции в селезенке и почке, обнаруженные уровни оказались по меньшей мере в 20 раз ниже, чем в печени. Инъекция неконъюгированного полинуклеотида + полимера или замена CDM-NAG на предназначенном для введения носителе на CDM-глюкозу, приводила к резкому снижению поглощения гепатоцитами и повышенному уровню поглощения селезенкой и почкой (фиг.7Б и В соответственно), что согласуется с низкой аффинностью глюкозы к азиалогликопротеиновому рецептору. Замена CDM-NAG на предназначенном для введения носителе на CDM-маннозу, приводила к увеличению направленного переноса в макрофаги и эндотелиальные клетки печени (фиг.7Г).

Количественная ПЦР и анализ с помощью системы INVADER® (анализы внедрения).

При подготовке препаратов для анализа с помощью количественной ПЦР общую РНК (500 нг) подвергали обратной транскрипции с помощью SUPERSCRIPT III® (фирма Invitrogen) и праймеров олиго-dT согласно протоколу производителя. Количественную оценку осуществляли с помощью системы для быстрой ПЦР в реальной времени, модель 7500 (фирма Applied Biosystems, Фостер-Сити, шт. Калифорния). Систему TAQMAN® для анализа экспрессии генов в случае ароВ и ppara применяли для осуществления биплексных реакций в трех повторностях с использованием праймеров мРНК и зонда GAPDH, которые используются в универсальной мастер-смеси для ПЦР в системе TAQMAN® (Universal PCR Master Mix) (фирма Applied Biosystems). Ниже представлены последовательности праймеров и зонда GAPDH (фирма IDT, Коралвилл, шт. Айова):

GAPDH-«прямой» праймер 5′-AAATGGTGAAGGTCGGTGTG-3′, SEQ ID 11;

GAPDH-«обратный» праймер 5′-CATGTAGTTGAGGTCAATGAAGG-3′, SEQ ID 12;

GAPDH-зонд 5′-Hex/CGTGCCGCCTGGAGAAACCTGCC/BHQ-3′, SEQ ID 13.

Непосредственное измерение уровней мРНК ppara осуществляли с помощью созданной на заказ системы для анализа мРНК INVADER® согласно инструкциям производителя (фирма Third Wave Technologies, Мэдисон, шт. Висконсин). Биплексные реакция осуществляли в трех повторностях с использование набора зондов для убикитина согласно инструкциям производителя.

Анализ методом Вестерн-блоттинга АроВ, анализы цитокинов и токсичности для печени и панели метаболитов.

Для отделения сывороточных белков (0,1 мкл) использовали электрофорез в 3-8%-ных полиакриламидных гелях в присутствии ДСН. Выделенные белки переносили электрофоретически на ПВДФ-мембрану и затем инкубировали с разведением 1:5000 кроличьего поликлонального антитела к АроВ (фирма Biodesign International, Сако, шт. Мэн). Затем блот инкубировали с разведением 1:80000 козьего антикроличьего антитела, конъюгированного с пероксидазой из хрена (фирма Sigma), связывание антитела выявляли с помощью набора для ускоренного выявления хемилюминисценции (фирма Amersham Biosciences, Пискатавей, шт. Нью-Джерси). Уровни в сыворотке мышиных цитокинов TNF-α и IL-6 определяли с помощью двухвалентной («сэндвич») ELISA с использованием реагентов, предложенных в инструкциях производителя (фирма R&D Systems, Миннеаполис, шт. Миннесота). Уровни в сыворотке мышиного IFN-α оценивали с помощью набора для «сэндвич»-ELISA согласно инструкциям производителя (фирма PBL Biomedical, Пискатавей, шт. Нью-Джерси). Уровни в сыворотке АЛТ, ACT, холестерина и триглицеридов определяли с помощью автоматической системы Marshfield Clinic Laboratories Veterinary Diagnostic Division (Маршфилд, шт. Висконсин).

Уровни в сыворотке цитокинов и ферментов печени у мышей, обработанных включающим siPHK конъюгатом

Обработка TNF-α (пг/мл) IL-6 (пг/мл) IFN-α (пг/мл) АЛТ (ед/л) ACT (ед/л)
Физиологический раствор 6 ч <6 <2 206±51
48 ч <6 <2 321±77 60±21 149±21
контрольная siPHK 6 ч 7,9±2,9 60,2±2,4 207±86
48 ч <6 4,0±1,3 211±16 97±26 176±62
siPHK ароВ-1 б ч 57,9±7,2 48,6±2,5 494±165
48 ч <6 <2 257±70 71±30 144±34
n=5, данные представлены в виде средних значений ± С.К.О.

Пример 11. «Выключение» генов-мишеней в печени мышей.

Для демонстрации способности системы обеспечивать введение siPHK и «выключение» экспрессии гена-мишени in vivo конъюгат, содержащий siPHK ароВ-1 (800 мкг полимера, 50 мкг siPHK), инъецировали мышам линии С57 В1/6. Также как и в опытах по направленному переносу in vivo конъюгат, содержащий siPHK, вводили путем инфузии в хвостовую вену. Получали образцы печени мышей через 2 дня после инъекции и анализировали уровни мРНК ароВ с помощью количественной ПЦР с обратной транскриптазой (ОТ-qПЦР). Уровни мРНК ароВ оценивали относительно уровня мРНК GAPDH и общей введенной РНК (в мкг) для того, чтобы снизить вероятность любых отличий в относительных уровнях мРНК ароВ, связанных с неспецифическими воздействиями на экспрессию конститутивных генов. Как видно на фиг.8А, при оценке через 2 дня после инъекции у мышей, обработанных содержащим siPHK ароВ-1 конъюгатом, существенно снижались уровни мРНК ароВ по сравнению с уровнями, которые обнаружены у мышей, которым вводили контрольную siPHK, не связанную с ароВ, или у мышей, которых обрабатывали только физиологическим раствором (n=5, р<0,00001). В частности, средний уровень мРНК ароВ у мышей, которым вводили содержащий siPHK ароВ-1 конъюгат, понижался на 76±14% по сравнению с обработанной физиологическим раствором группой по сравнению с уровнями мРНК GAPDH, а уровни мРНК ароВ у мышей, которым вводили контрольную siPHK, не изменялись. Аналогичные результаты получали при оценке уровней мРНК ароВ относительно общей РНК. Анализ методом Вестерн-блоттинга уровней белка ароВ-100 в сыворотке отражал снижение уровней мРНК ароВ в печени (фиг.8Б).

Для подтверждения специфичности «выключения» ароВ отдельную группу мышей обрабатывали siPHK, мишенью которой была другая область мРНК ароВ. У мышей, которым вводили содержащий siPHK ароВ-2 конъюгат, также обнаружено значительное снижение уровней мРНК ароВ (снижение на 60±6%, n=5, р<0,00001, фиг.8А). Анализ методом Вестерн-блоттинга уровней белка ароВ-100 в сыворотке отражал снижение уровней мРНК ароВ в печени (фиг.8А). Экспрессия мРНК ароВ не снижалась в тощей кишке, другой ткани, в которой происходит экспрессия гена ароВ, что позволяет предположить, что для конъюгата эта ткань не является мишенью. Тканеспецифическая активность согласуется с направленным переносом в гепатоциты.

При создании изобретения получали также конъюгаты, содержащие siPHK, мишенью которых является альфа-рецептор, активируемый пролифераторами пероксисом (ppara), важный ген для контроля метаболизма жирных кислот в печени (Kersten 1999, Schoonjans 1996). Введение двух различных siPHK, мишенью которых является ppara, привело к выраженному снижению («выключению») уровней мРНК ppara, что проанализировано двумя независимыми методами количественной оценки уровней мРНК (фиг.8В). По сравнению с уровнями в мышах, которых обрабатывали контрольной siPHK, уровни мРНК ppara у мышей, которых обрабатывали siPHK ppara-1, снижались от 40±9% до 64±9% по данным, полученным с помощью IINVADER® или ОТ-qПHP соответственно. Аналогичное снижение уровней мРНК ppara обнаружено у мышей, которым инъецировали предназначенный для введения носитель, содержащий siPHK ppara-2, мишенью которой является другая область последовательности мРНК ppara.

Потенциальную токсичность предназначенной для введения системы оценивали по уровням в сыворотке печеночных ферментов и цитокинов. Через 48 ч после инъекции небольшое повышение уровней АЛТ и ACT обнаружено у мышей, которым вводили конъюгаты, содержащие контрольную siPHK или siPHK ароВ-1, по сравнению с уровнями у мышей, которых обрабатывали физиологическим раствором. Однако повышенные уровни оказались не достоверными (р<0,05) и гистологическая оценка срезов печени не подтвердила признаков токсичности для печени. Аналогично этому анализ уровней TNF-α и IL-6 в сыворотке с помощью ELISA позволил установить, что оба эти уровня слегка повышались через 6 ч после инъекции конъюгата siPHK-полимер, но возвращались в основному уровню через 48 ч. Обнаруженное через 6 ч повышение, как ожидается, не может вызывать существенной стимуляции иммунной системы и по меньшей мере на 4 порядка ниже, чем уровни, обнаруженные при стимуляции липополисахаридом (Matsumoto 1998, Matsuzaki 2001), и на 1-3 порядка ниже, чем уровни после инъекции аденовируса (Lieber 1997, Benihoud 2007). Не обнаружено существенных различий в уровнях в сыворотке INF-α в любой момент времени, за исключением небольшого повышения через 6 ч после инъекции содержащего siPHK ароВ-1 конъюгата. Эти результаты свидетельствуют о хорошей переносимости предназначенной для направленного переноса системы.

Пример 12. Анализ дозовой зависимости и фенотипический анализ.

При создании изобретения осуществляли изучение дозовой зависимости двумя путями: понижая количество содержащего siPHK конъюгата, вводимого мышам, и удерживая количество полимера на постоянном уровне, но снижая количество конъюгированной siPHK. Путем сравнения результатов этих экспериментов, при создании изобретения предпринята попытка определить, какой из двух компонентов предназначенного для введения носителя ограничивал введение: эндосомолитический полимер или сама siPHK.

Инъекция простых серийных разведении содержащего siPHK ароВ-1 конъюгата мышам приводила к прогрессивному снижению количества «выключенной» мРНК ароВ в печени (фиг.9А). При использовании наиболее высокой из инъецируемых доз (800 мкг полимера, 50 мкг siPHK, т.е. 2,5 мг/кг), уровни мРНК ароВ в печени снижались на 84±5% относительно мРНК GAPDH через 2 дня после инъекции по сравнению с мышами, которым инъецировали только физиологический раствор. Аналогичные результаты получали, когда уровни мРНК ароВ оценивали относительно общей РНК. Инъекция в 2 раза более низкого количества содержащего siPHK конъюгата (400 мкг полимера, 25 мкг siPHK) приводила к снижению на 50±8% относительных уровней мРНК ароВ. Инъекция в 4 раза более низкого количества не приводила к «выключению» ароВ по сравнению с обработанной физиологическим раствором контрольной группой. Сохранение на постоянном уровне количества полимера, но снижение количества конъюгированной siPHK ароВ-1 в предназначенном для введения носителе приводило к количественно таким же результатам, которые получены при использовании серийных разведении (фиг.9Б). Эти данные позволяет предположить, что количество эндосомолитического полимера, присутствующего в предназначенном для введения носителе, не является лимитирующим фактором для осуществления «выключения», на этот фактор скорее оказывает влияние количество или эффективность конъюгированной с ним siPHK.

Критерием дефицита ароВ является наличие пониженных уровней сывороточного холестерина из-за нарушения сборки ЛОНП (липопротеиды очень низкой плотности) и транспорта холестерина из печени (Burnett Zimmermann 2006, 02). Для решения вопроса о том, является ли уровень «выключения» ароВ, который показан на фиг.10, достаточным для того, чтобы вызывать физиологический ответ у мышей, при создании изобретения оценивали общие уровни сывороточного холестерина. При наиболее высокой из вводимых доз siPHK (50 мкг) обнаружено существенное снижение средних уровней сывороточного холестерина (30±7%, n=5, р<0,001) по сравнению с уровнями в мышах, которым вводили контрольную siPHK или только физиологический раствор (фиг.10). Аналогичные результаты были получены для животных, обработанных содержащим siPHK ароВ-2 конъюгатом. Снижение количества вводимой siPHK приводило к прогрессивному снижению количества холестерина пониженной плотности, что согласуется с понижением уровня «выключения» мРНК ароВ, обнаруженным у этих животных.

Нарушение сборки ЛОНП в печени и, как следствие, снижение экспорта ЛОНП, может приводить также к изменению уровней печеночных триглицеридов, поскольку триглицериды также включаются в частицы ЛОНП (Gibbons 2004). Действительно, у трансгенных мышей, экспрессирующих укороченную форму ароВ, которая аналогична укороченной версии, обнаруженной у пациентов с семейной гипобеталипопротеинемией, также выявлена пониженная способность транспортировать печеночные триглицериды (Chen, 2000). Для оценки влияния «выключения» ароВ на транспорт триглицеридов при создании изобретения проводили окрашивание масляным красным срезов печени, полученных из мышей, которым инъецировали содержащий siPHK ароВ-1 конъюгат. Оценка срезов печени продемонстрировала очень резкое снижение содержания липидов в печени по сравнению с контрольными мышами (фиг.11). На панели А показаны результаты, полученные для мыши, обработанной siPHK ароВ. На панели Б показаны результаты, полученные при обработке применяемой в качестве отрицательного контроля siPHK GL3. На панели В показаны результаты, полученные для мыши, которым инъецировали только физиологический раствор. У этих мышей обнаружены также пониженные уровни сывороточных триглицеридов, что является дополнительным доказательством пониженной способности к экспорту печеночных триглицеридов. В сочетании эти результаты свидетельствуют о том, что простая i.v.-инъекция содержащего siPHK apoB-1 конъюгата приводила к функциональному введению полинуклеотида в гепатоцит и, как следствие, к «выключению» экспрессии ароВ в печени, что приводило к ожидаемым фенотипическим признакам.

Для анализа накопления в печени жира образцы печени, полученные из обработанных содержащим siPHK конъюгатом и контрольных мышей, замораживали в среде для замораживания ОСТ и получали срезы замороженной ткани (8-10 мкм) согласно описанному выше методу. Высушенные на воздухе срезы тканей фиксировали в смеси 4% формальдегида/ЗФР в течение 20 мин, промывали, осуществляя несколько замен, дистиллированной водой и затем быстро промывали 60%-ным изопропанолом. Маточный раствор масляного красного О приготавливали путем смешения 0,5 г масляного красного О в 100 мл изопропанола в течение ночи и фильтрации через фильтровальную бумагу Whatman №1. Рабочий раствор масляного красного О приготавливали смешением 20 мл воды с 30 мл маточного раствора масляного красного О и фильтрации с использованием устройства для фильтрации с размером пор 0,2 мкм типа Nalgene (фирма Fisher Scientific). Фиксированные срезы окрашивали свежеприготовленным рабочим раствором масляного красного О в течение 15 мин, быстро промывали 60%-ным изопропанолом. Для контрастного окрашивания ядер использовали 7-кратное погружение предметных стекол в модифицированный по Гаррису раствор гематоксилина (фирма Sigma, Сент-Луис, шт. Миссури) и отмывку в дистиллированной воде. Отмытые предметные стекла затем заливали в среду, используя гель Mount (фирма Biomedia Corp., Фостер Сити, шт. Калифорния). Окрашенные предметные стекла анализировали с помощью микроскопа типа Zeiss Axioplan 2, снабженного цифровой камерой (типа Axiocam, фирма Carl Zeiss). Цифровые изображения записывали с помощью программы Axio Vision (фирма Carl Zeiss).

Пример 13. Введение siPHK посредством конъюгации с обладающим активностью в отношении мембран полимером с использованием CDM или дисульфидной лабильной связи.

Связанный дисульфидной связью конъюгат: 50 нг siPHK, мишенью которой является ген люциферазы, которая имеет на 5′-конце смысловой цепи аминогруппу, подвергали взаимодействию с 1 мкг N-сукцинимидил-S-ацетилтиоацетата в присутствии HEPES-основания, рН 7,5. Отдельно синтезировали 50 мкг простого поливинилового эфира, синтезированного из смеси 50/50 мономеров простого винилового эфира с защищенным амином и простого бутилвинилового эфира, которую подвергали взаимодействию с 5 мкг N-гидроксисукцинимидного эфира 3-(2-пиридилдитио)пропионовой кислоты в присутствии HEPES, рН 7,5. Затем модифицированную siPHK и модифицированный полимер объединяли, давая произойти ковалентному присоединению siPHK к полимеру. Через 6-24 ч конъюгат полимер-siPHK подвергали взаимодействию с 200 мкг 2-пропионово-3-метилмалеинового ангидрида в присутствии HEPES-основания. Частицы добавляли к мышиным гепатоцитам линии НЕРА, которые стабильно экспрессировали ген люциферазы. В качестве контроля к клеткам добавляли CDM-модифицированный полимер (без siPHK). В клетках, обработанных конъюгатом полимер-полинуклеотид, экспрессия люциферазы подавлялась на 75% относительно клеток, обработанных только полимером, что свидетельствует о введении функциональной siPHK в клетки.

Связанный с помощью CDM конъюгат: 50 нг siPHK, мишенью которой является ген люциферазы, которая имеет на 5′-конце смысловой цепи аминогруппу, подвергали взаимодействию с 2 мкг тиоэфира CDM в присутствии HEPES рН 7,9. К siPHK добавляли 50 мкг простого поливинилового эфира, синтезированного из смеси 50/50 мономеров простого винилового эфира с защищенным амином и простого бутилвинилового эфира. Через 6-24 ч конъюгат полимер-siPHK подвергали взаимодействию с 200 мкг 2-пропионово-3-метилмалеинового ангидрида в присутствии HEPES-основания. Частицы добавляли к мышиным гепатоцитам линии НЕРА, которые стабильно экспрессировали ген люциферазы. В качестве контроля к клеткам добавляли CDM-модифицированный полимер (без siPHK). В клетках, обработанных конъюгатом полимер-полинуклеотид, экспрессия люциферазы подавлялась на 86% относительно клеток, обработанных только полимером, что свидетельствует о введении функциональной siPHK в клетки.

Процент ингибирования люциферазной активности после трансфекции клеток линии HEPA-Luc с помощью конъюгатов: обладающий активностью в отношении мембран полимер-siPHK

Конъюгация с помощью дисульфидной связи Конъюгация с помощью CDM
75% 86%

Пример 14. Продолжительность «выключения» ароВ и его фенотипическое действие.

При создании изобретения осуществляли длительный эксперимент с целью определения продолжительности «выключения» ароВ и снижения уровня холестерина у мышей после инъекции одой дозы содержащего siPHK apoB-1 конъюгата. В соответствии с результатами, описанными в предыдущих примерах, инъекция содержащего siPHK apoB-1 конъюгата (800 мкг полимера, 50 мкг siPHK) через 2 дня приводила к снижению средних уровней мРНК ароВ на 87±8% относительно контрольных мышей (фиг.12А). Снижение экспрессии ароВ сопровождалось снижением на 42±5% уровней общего сывороточного холестерина (фиг.12Б). Снижение экспрессии мРНК ароВ сохранялось в значительной степени в течение 10 дней и возвращалось к уровню, близкому к контрольному, к 15-ому дню. Снижение в сыворотке уровня холестерина сохранялось на достоверном уровне в течение 4 дней (n=5, р<0,01) и не полностью возвращалось к контрольным уровням вплоть до дня 10. Эти результаты свидетельствуют о длительном «выключении» ароВ и создании фенотипа, который можно получать после одной инъекции содержащего siPHK конъюгата, и что фенотип можно со временем обращать при возвращении экспрессии ароВ к нормальному уровню.

Пример 15. Введение фосфородиамидатморфолиноолигонуклеотида (РМО) в клетки с помощью конъюгатов полимер-РМО.

С использованием основного на применении перекрестносшивающего агента CDM-тиоэфир, применяемого для сцепления siPHK и полимера, можно также получать обратимые конъюгаты олигонуклеотидов и полимеров других типов. В частности, при создании изобретения изучено введение РМО в клетки. 5 нмолей амино-РМО (который блокирует мутантный сайт сплайсинга в мутантном транскрипте люциферазы), либо в нативном виде («голый»), либо гибридизованный с комплементарной цепью ДНК, подвергали взаимодействию с 2 мкг CDM-тиоэфира в присутствии HEPES рН 7,9 или не подвергали указанному взаимодействию. Для осуществления взаимодействия добавляли 200 мкг простого поливинилого эфира, синтезированного из 50% простого аминовинилового эфира, 45% простого бутилвинилого эфира и 5% простого додецилвинилого эфира (DW550). Через 3 или более часов полимер + РМО или конъюгат полимер-РМО подвергали взаимодействию с 500 мкг CDM в присутствии HEPES для поддержания рН>7,5. Помимо CDM конъюгаты подвергали взаимодействию со сложными ПЭГ-эфирами CDM, которые получали из хлорангидридов CDM и простых монометиловых эфиров ПЭГ с различной молекулярной массой. Затем конъюгаты вносили к клеткам линии HeLa Luc/705 (фирма Gene Tools, Филомат, шт. Орегон), выращенных в условиях, принятых для клеток линии HeLa. Клетки высевали в 24-луночиые культуральные планшеты с плотностью 3×106 клеток/лунку и инкубировали в течение 24 ч. Среды заменяли на 1,0 мл среды DMEM, содержащей 2,5 нмолей комплексов амино-РМО. Клетки инкубировали в течение 4 ч в увлажняющем 5% СО2-инкубаторе при 37°С. Затем среды заменяли на среду DMEM, содержащую 10% фетальной бычьей сыворотки. Клетки инкубировали в течение еще 48 ч. Затем клетки собирали и лизировали и в лизатах анализировали экспрессию люциферазы. Результаты демонстрируют увеличение введения незаряженного полинуклеотида, когда агентом для трансфекции является конъюгат полимера, представляющего собой содержащий DW550 простой поливиниловый эфир, и РМО.

Введение незаряженных полинуклеотидов в клетки
Носитель для трансфекции Кратность индукции люциферазы
отсутствие связи
DW550 + «голый» РМО 2
DW550 +РМО, гибридизованный с ДНК 2
конъюгат полимер-РМО
DW550-CDM-«голый» РМО 7,5
DW550-CDM-гибридизованный РМО 10

Пример 16. Введение конъюгата, содержащего siPHK, в мышцу. 40 мкг siPHK PPARa или контрольной (GL3) siPHK конъюгировали с PBAVE-полимером и осуществляли введения маскирующих групп согласно описанному выше методу. 250 мкл конъюгата инъецировали в икроножную мышцу мышей (n=3). Скорость инъекции составляла примерно 25 мкл/с. Уровни экспрессии PPARa определяли согласно описанному выше методу.

Ингибирование PPARa в мышце после непосредственной инъекции замаскированного конъюгата

Конъюгат siPHK Уровни мРНК PPARa относительно:
мРНК GAPDH общей мРНК
GL3 1,00±0,26 1,00±0,15
PPARa 0,62±0,07 0,54±0,13

Пример 17. Введение in vivo кассеты экспрессии siPHK. 20 мкг созданной с помощью ПЦР линейной кассеты экспрессии siPHK SEAP, которая экспрессирует siPHK SEAP под контролем промотора U6, объединяли в комплекс с 400 мкг обладающего активностью в отношении мембран полимера DW1453 (который получали полимеризацией 75 мол.% амино-, 21 мол.% (низш.)алкильных (бутильных) и 4 мол.% (высш.)алкильных (С18, октадецильных) групп и модифицировали галактозой с помощью лактобионовой кислоты (LBA)). Лактобионилирование осуществляли, добавляя 43 мг LBA к 60 мг полимера с последующим добавлением 34 мг EDC и 24 мг NHS. В качестве контроля создавали также кассету, экспрессирующую siPHK люциферазы (GL3). ДНК конъюгировали с полимером путем добавления 0,65 мас. эквивалентов глутарового альдегида. После конъюгации в течение ночи комплексы модифицировали с помощью 40 мол.% NHS-ацетата для восстановления заряда полимера.

500 мкг лактотионилированного DW1453 модифицировали с использованием 7 мас. эквивалентов маскирующего агента CDM-ПЭГ (в среднем 10 звеньев) в присутствии 14 мас. эквивалентов HEPES-основания и инъецировали в хвостовую вену мышей, экспрессирующих секретируемую щелочную фосфатазу (SEAP). Через 10 мин после инъекции замаскированного полимера инъецировали предназначенные для совместного целенаправленного введения конъюгаты ДНК-полимер DW1453. В день 1 и 14 брали образцы крови и анализировали уровни SEAP.

siPHK Активность SEAP через 14 дней относительно активности в день 1
siPHK SEAP 48±13
siPHK GL3 87±17

Активность представлена в виде среднего значения для 4 животных ± СКО.

Пример 18. Введение антител.

35 мкг антитела в виде кроличьего IgG (фирма Sigma) модифицировали 2 мас.% SPDP (фирма Pierce). DW1360 (30 мг/мл в 5 мМ TAPS, pH 9) модифицировали, добавляя 2 мас.% иминотиолана. Добавляли 530 мкг имминотиолана-PBAVE к 400 мкл изотонического раствора глюкозы, содержащего 5 мМ TAPS, pH 9. К этому раствору добавляли 35 мкг SPDP-модифицированного антитела. Через 16 ч конъюгат антитело-полимер модифицировали 7 мас. экв. смеси 2:1 CDM-NAG и CDM-ПЭГ. Конъюгат инъецировали в хвостовую вену мыши. Через 20 мин после инъекции мышь умерщвляли и изымали печень и обрабатывали для микроскопического анализа. Оценка ткани печени продемонстрировала значительное накопление антитела в гепатоцитах (фиг.13). В верхнем левом квадрате показаны результаты для меченых антител, в верхнем правом квадрате - для актина, в нижнем левом квадрате - для ядер и в нижнем правом квадрате показано объединенное изображение.

Пример 19. Замаскированный конъюгат полинуклеотид-полимер в качестве реагента для трансфекции in vitro.

Первичные гепатоциты получали из взрослых мышей (линии C57BL/6), используя ранее описанную процедуру двухступенчатой коллагеназной перфузии (Klaunig 1981). Жизнеспособность гепатоцититов составляла 85-90% по данным метода исключения трипанового синего. Гепатоциты высевали с плотностью 1,5×105 клеток на лунку в покрытые коллагеном 12-луночные планшеты в 1 мл среды, содержащей 10% фетальной телячьей сыворотки. Через 24 ч после посева клетки во взятых в трех повторностям лунках трансфектировали без замены среды siPHK с использованием TRANSIT-SIQUEST® (фирма Mirus Bio, Мэдисон, шт. Висконсин) согласно протоколу производителя или с использованием различных количеств содержащего siPHK конъюгата. Гепатоциты собирали через 24 ч после трансфекции и выделяли общую РНК с помощью реагента TRIREAGENT® (фирма Molecular Research Center, Цинциннати, шт. Огайо).

Для демонстрации способности осуществлять трансфекцию in vitro описанных замаскированных конъюгатов полинуклеотид-полимер, специфическую для аполипопротеина В (ароВ) siPHK вводили в первичные гепатоциты с использованием поступающих в продажу реагентов для трансфекции siPHK или описанных конъюгатов полинуклеотидов. Трансфекция первичных гепатоцитов конъюгатом оказалась высокоэффективной, приводящей к «выключению» примерно 80% мРНК ароВ (фиг.14). Уровень введения siPHK, оцененный по «выключению» гена-мишени, сравнивали с уровнем при использовании поступающего в продажу реагента SIQUEST®. Как и ожидалось, снижение количества конъюгата, добавленного к клеткам, приводило к прогрессивному снижению «выключения» ароВ.

Пример 20. Замаскированный конъюгат полинуклеотид-полимер в качестве реагента для трансфекции in vitro.

Клетки линии Нера-1с1с7 трансфектировали плазмидами, кодирующими люциферазы светляка и морских перьев (Renilla) с использованием TRANSIT LT1® (фирма Minis Bio). Через 4 ч после плазмидной трансфекции в клетки добавляли 100 нг siPHK люциферазы, конъюгированной с 9 мкг PD-PLL и модифицированной затем CDM-Pip-LBA (45 г). В некоторых образцах в клетки добавляли также модифицированный CDM-Pip-LBA 25/75-PBAVE (5 мкг). Через 48 ч после добавления siPHK клетки собирали и анализировали в отношении люциферазы светляка и морских перьев. Уровень экспрессии люциферазы светляка стандартизовали относительно уровня экспрессии люциферазы морских перьев для каждого образца и относительно уровня в клетках, которые не обрабатывали siPHK, для каждой группы. Конъюгаты, содержащие только PLL-siPHK не обладали способностью вводить siPHK в клетки in vitro (белый столбец, фиг.15). Добавление замаскированного малеаматом литического для мембран полимера PBAVE приводила к активности, такой же как у поступающего в продажу реагента для трансфекции (черный столбец). В целом для трансфекции ДНК и siPHK, вероятно, требуется избыток реагента. Избыток описанного выше высвобождающегося полимера, необходимый для взаимодействия с siPHK, может повышать функциональное введение in vitro и in vivo (высвобождение из эндосом). Из-за близкого размера и заряда у конъюгатов siPHK-полимер и полимеров, они могут одновременно осуществлять направленный перенос в гепатоциты in vivo, В подтверждении этого положения при создании изобретения было установлено, что при совместной инъекции меченной с помощью Су3 siPHK, конъюгированной с PLL, и меченного с помощью Oregon Green полимера 25/75-PBAVE действительно происходила совместная локализация в гепатоцитах (см. выше).

Активность in vitro siPHK, конъюгированной с обеспечивающими введение полимерами, такая же, как в неконъюгированной siPHK, для трансфекции которой применяли поступающий в продажу реагент TRANSIT TKO® (фиг.15). Параллельные эксперименты с использованием необратимой связи siPHK и полимера на основе йодацетамидного алкилирования (IA-конъюгат, обозначенный точками столбец на фиг.15) продемонстрировали, что конъюгаты siPHK-полимер не обладают активностью, если конъюгация не является обратимой, что позволяет предположить, что дисульфидный мостик должен быть восстановлен для осуществления функционального введения siPHK (обнаруженное 20%-ное «выключение» является следствием того, что примерно 10% олигонуклеотидов не были конъюгированы, что установлено с помощью анализа с использованием геля). Обнаруженная активность малеамилированных конъюгатов позволяет предположить, что даже, если полимер уже не является положительно заряженным и взаимодействует с олигонуклеотидом посредством электростатических сил, содержащий siPHK конъюгат является устойчивым к расщеплению нуклеазами в сыворотке. Можно применять также модифицированные аналоги siPHK, устойчивые к нуклеазам.

Пример 21. Лабильные связи для присоединения маскирующих агентов и полинуклеотидов к обладающему активностью в отношении мембран полимеру.

А. рН-лабильая связь с ПЭГ-спейсером. Один из вариантов группы лиганда, мишенью которого является ASGP-R, можно получать следующим образом:

(аминоэтокси)этильные производные

2-ацетамидо-3,4,6-три-O-ацетил-2-дезокси-β-D-галактопиранозида

N-ацетил-галактозамин-ПЭГ-метилмалеиновый ангидрид

Соединение I применяли в качестве предшественника для создания соединения II, которое несет содержащую галактозу обеспечивающую направленный перенос группу маскирующего агента, который обладает способностью обратимо модифицировать содержащие амин обладающие активностью в отношении мембран полимеры, такие как PBAVE-полимеры. Взаимодействие малеинового ангидрида с аминогруппой на полимерах приводит к образованию рН-лабильной связи между галактозой и полимером. Модификация PBAVE-полимера соединением II приводит к получению:

Модификация аминогрупп PBAVE соединением III (молярное соотношение 0,75:1 соединения III и полимерного амина) и CDM-ПЭГ500 (молярное соотношение 0,25 CDM-ПЭГ и полимерного амина) приводила к получению конъюгата, который обладал способностью обеспечивать направленный перенос в гепатоциты in vivo. При использовании спейсерных этиленовых групп различной длины (n=1, 2, 3 или 7) во всех случаях введение siPHK в гепатоциты in vivo оказалось эффективным, о чем свидетельствовало «выключение» экспрессии гена-мишени.

Б. рН-лабильная связь с алкильным спейсером. Можно применять также алкильные спейсерные группы, проиллюстрированные в соединении V. Однако алкильные спейсеры повышают гидрофобность маскирующего агента, что приводит к меньшей растворимости маскирующего агента и конъюгата.

маскирующий агент, представляющий собой N-ацетилгалактозамин-С6-метилмалеиновый ангидрид

В. Мультивалентные обеспечивающие направленный перенос группы.

Можно применять также обеспечивающие направленный перенос группы с более высокой валентностью. Примеры мульвалентных содержащих галактозу обеспечивающих направленный перенос групп приведены ниже. Двухвалентные (VI) и трехвалентные (VII) содержащие галактозу лиганды могут обладать более высокой аффинностью в отношении ASGP-R.

Г. Отрицательно заряженные обеспечивающие направленный перенос лиганды. Родственные обеспечивающие направленный перенос группы, которые обладают существенно более низкой аффинностью к клетке-мишени, можно применять в качестве отрицательного контроля при определении эффективности предпочтительных обеспечивающих направленный перенос групп. Например, ASGP-R гепатоцитов связывается с галактозой, но не связывается с глюкозой. Таким образом, содержащие глюкозу обеспечивающие направленный перенос группы (VIII) могут служить в качестве отрицательного контроля в анализах по оценке направленного переноса в клетки.

Д. Содержащая маннозу обеспечивающая направленный перенос группа.

Известно, что макрофаги и печеночные клетки Купфера несут рецепторы, которые связываются с содержащими маннозу сахаридами. Поэтому обеспечивающие направленный перенос группы с остатками маннозы (IX) можно применять для направленного переноса в эти клетки.

Е. Связи с различной лабильностью. Связи с различной лабильностью (с позиций кинетики расщепления) можно применять для соединения маскирующего агента или полинуклеотида с обладающим активностью в отношении мембран полимером.

Для введения антисмысловых полинуклеотидов можно повышать продолжительность «выключения» путем снижения скорости высвобождения полинуклеотида из конъюгата. Можно создавать дисульфидные мостики с различными кинетическими характеристиками расщепления в восстанавливающей среде, типичной для клеток млекопитающих. Более медленное высвобождение маскирующего агента из полимера может удлинять время нахождения конъюгата в кровотоке in vivo. Например, 5-метил-2-имминотиолан (M2IT, связь X) характеризуется в 4 раза более медленной скоростью расщепления, чем SMTP-связь (соединение XI).

Ожидается, что скорость расщепления соединения XII будет примерно в 30 раз более медленной, чем дизамещенных связей, образуемых с помощью маленнового ангидрида.

Пример 22. Характеристика PBAVE и конъюгатов полинуклеотид-PBAVE

А. Анализ амфипатичности. Флуоресценция 1,6-дифенил-1,3,5-гексатриена (DPH, фирма Invitrogen) (λex=350 нм; λem=452 нм) повышалась в гидрофобной среде. Этот флуорофор применяли для анализа полимера PBAVE (DW1360). 0,5 мкМ (конечная концентрация) DPH добавляли к 10 мкг PBAVE в присутствии 40 мкг плазмидной ДНК в 0,5 мл 50 мМ HEPES-буфера, рН 8,0 или без плазмидной ДНК. Затем в растворе оценивали накопление DPH в гидрофобной среде путем определения флуоресценции DPH. Повышение флуоресценции DPH в присутствии конъюгатов свидетельствовало об образовании гидрофобной среды с помощью полимера. Добавление избытка не приводила к существенному изменению флуоресценции DPH (фиг.16).

Б. Молекулярная масса. Молекулярную массу DW1360 определяли с помощью ЖХВР-гель-фильтрации и с использованием набора полиэтилгликолей в качестве стандартов (American Polymer Standard Corp.). Полимеры разделяли с помощью GPC ЖХВР на колонке типа Shodec SB-803 HQ с использованием для элюции 0,2 М LiClO4, 5% АсОН в метаноле. Элюция PBAVE-полимера из колонки позволила установить, что средняя молекулярная масса полимера составляла примерно 12,8 кДа (фиг.17)

В. Молекулярная масса конъюгата полинуклеотид-полимер. Молекулярную массу замаскированного конъюгата полинуклеотид-полимер определяли с помощью FPLC-(жидкостная хроматография быстрого разрешения)-гель-фильтрации и с использованием меченных с помощью Су3-нуклеиновых кислот в качестве стандартов. Конъюгат и стандарты разделяли с помощью Shimadzu-FPLC на колонке 1×22 см Sephacryl S-500 и элюировали 50 мМ HEPES, рН 8,0 со скоростью 1 мл/мин. Элюция конъюгата из колонки позволила установить, что средняя молекулярная масса полимера составляла примерно 77 кДа (фиг.18).

Г. Стехиометрия конъюгатов. Экспериментально установлено, что средняя молекулярная масса полимера PBAVE составляла примерно 13 кДа. Экспериментально установлено, что средняя молекулярная масса замаскированного конъюгата полинуклеотид-полимер составляла примерно 77 кДа. Экспериментально установлено, что средняя молекулярная масса на заряд (амин) полимера PBAVE составляла примерно 200 Да. Рассчитано, что средняя молекулярная масса маскирующего агента CDM должна составлять примерно 550 Да. Экспериментально установлено, что средняя степень модификации полимера PBAVE составлял примерно 75% от содержания доступных аминогрупп. Рассчитано, что средняя молекулярная масса конъюгированной siPHK должна составлять примерно 14 кДа. На основе этих значений рассчитано, что средняя молекулярная масса замаскированного с помощью маскирующего агента CDM полимера PBAVE должна составлять примерно 30 кДа. Таким образом, установлено, что близкое к стехиометрическому соотношение siPHK и замаскированного полимера составляло примерно 1:2.

Д. Размер частиц и зета-потенциал. Размеры конъюгатов, инъецируемых in vivo, определяли с помощью рассеяния света при 532 им, используя устройство Brookhaven Instruments Corporation, ZetaPlus Particle Sizer, 190. Унимодальный анализ пиков осуществляли при длине волны от 100 до 30 нм. С помощью мультимодального анализа установлено, что пик, соответствующий наибольшему количеству (>95%) частиц, включал частицы размером менее 50 нм и более предпочтительно менее 20 нм. Можно определять также размер поликонъюгатов с помощью аналитического ультрацентрифугирования или атомно-силовой микроскопии. Одновременно зета-потенциал конъюгатов измеряли с помощью устройства Brookhaven Instruments Corporation ZetaPALS. Зета-потенциал замаскированных CDM конъюгатов находился в диапазоне от 0 и -30 мВ и главным образом от 0 и -20 мВ. Зета-потенциал измеряли в изотоническом растворе глюкозы, забуференном до рН 9 с помощью 5 мМ TAPS. Стабильные не образующие агрегатов конъюгаты образовывались также при значении зета-потенциала от 0 до -10 мВ и от 0 до -5 мВ в таких же условиях. Можно ожидать, что при рН 7 конъюгаты приобретут определенный положительный заряд в результате протонирования части аминов.

Пример 23. Введение in vivo конъюгата бестимусным мышам, несущим ксенотрансплантат человеческой гепатомы. Для демонстрации того, что описанные конъюгаты можно применять для направленного переноса в опухолевую клетку-мишень, конъюгат, содержащий модифицированный с помощью CDM-NAG олигонуклеотид-DW1360, инъецировали мышам, которым были имплантированы подкожно (SC) в бок клетки человеческой гепатокарциномы линии HepG2. Шестинедельных бестимусных самок мышей получали от фирмы Harlan Spraque Dawley (Индианаполис, шт. Индиана). Мышами инокулировали 2 миллиона клеток линии HepG2 в 300 мкл ЗФР подкожно в левый бок. В качестве контроля клетки карциномы ободочной кишки линии НТ-29 (2 миллиона в 300 мкл ЗФР) инокулировали SC в правый бок спустя 2 недели. Последнюю инъекцию осуществляли для компенсации более высокой скорости роста. Когда введенные SC опухоли достигали примерно 8 мм в ширину и длину, через хвостовую вену инъецировали модифицированный с помощью CDM-NAG или CDM-ПЭГ конъюгат, содержащий 10 мкг меченной с помощью Су3 21-мерной dsДНК в 200 мкл буфера для введения.

Высокий (в %) уровень накопления меченного с помощью NAG конъюгата обнаружен в массе SC-гепатом (30-60%, n=4, фиг.19А). Репрезентативная площадь опухолевых клеток, в которых обнаружено поглощение, показана на фиг.19А. Очень невысокий уровень направленного переноса в опухоль обнаружен, когда мышам вводили конъюгат, в котором в качестве агента для направленного переноса применяли глюкозу (фиг.19Б, <5% от массы опухоли, n=3). В контрольных опухолях карциномы ободочной кишки, которые не имели рецептора галактозы, никакого сигнала в клетках не обнаружено ни при использовании модифицированных NAG, ни при использовании модифицированных глюкозой конъюгатов (фиг.19 В-Г, n=2). Аналогичные результаты получены при использовании для создания ксенотрансплантата клеток гепатокарциономы линии HuH-7.

Пример 24. Модификация полимера с помощью обратимой ПЭГ-модификации перед конъюгацией. 400 мкг полимера DW1360 (при создании использовали степень загрузки простых амин-: бутил-: октадецилвиниловых эфиров 75:20:5) модифицировали с помощью 1,5 мас.% SMPT. Через 1 ч к полимеру добавляли 2 мас. эквивалента смеси 2:1 (мас.:мас.) CDM-NAG (N-ацетилгалактозамин) и CDM-ПЭГ (в среднем 11 звеньев) в присутствии 5,6 мг HEPES-основания. К этому раствору добавляли 20 мкг SATA/Су3-модифицированных 22-мерных олигонуклеотидов ДНК. После инкубации в течение ночи к конъюгату добавляли 5 мас. эквивалентов смеси 2:1 (мас.:мас.) CDM-NAG и CDM-ПЭГ. Замаскированный конъюгат инъецировали в 400 мкл физиологического раствора в хвостовую вену мыши. Было установлено, что модификация полимера с помощью CDM-NAG и CDM-ПЭГ перед конъюгацией не снижала эффективность конъюгации. Через 1 ч после инъекции изымали печень и готовили срезы замороженной печени и обрабатывали для осуществления иммуногистохимического анализа. Для окрашивания ядер клеток применяли TO-PRO-3®. После инъекции в хвостовую вену мышей меченый олигонуклеотид обнаружен в гепатоцитах.

Пример 25. Количественное определение аминогрупп в конъюгате после модификации с помощью CDM-реагента. Конъюгат олигонуклеотид-полимер DW1360 синтезировали согласно описанному ранее методу с последующей обработкой 14 мас. эквивалентами HEPES-основания и 7 мас. эквивалентами смеси 2:1 (мас.:мас.) CDM-NAG и CDM-ПЭГ (в среднем 11 звеньев). Через 1 ч содержание амина в обработанном производным малеинового ангидрида оценивали, используя обработку тринитробензолсульфоновой кислотой (TNBS) в 100 мМ NaHCO3. При сравнении с конъюгатом, который не был модифицирован малеаматом, было установлено, что количество модифицированных аминогрупп составляло примерно 75% от общего количества. Указанную степень модификации можно изменять, изменяя количество добавленного малеинового ангидрида.

Пример 26. Электрофорез конъюгата олигонуклеотид-полимер и его полученных с помощью малеинового ангидрида производных. Конъюгаты олигонуклеотид-полимер DW1360 получали согласно описанному ранее методу. Затем конъюгат, содержащий 1 мкг олигонуклеотида, модифицировали различными количествами CDM-ПЭГ (в среднем 11 звеньев) и CDM-NAG. Затем конъюгаты вносили в агарозные гели (2 мас.%) и подвергали электрофорезу. При окрашивании бромидом этидия установлено, что заряд конъюгатов изменялся в зависимости от количества эквивалентов производного малеинового ангидрида с положительного на нейтральный и на отрицательный.

Приведенное выше описание дано только с целью иллюстрации принципов изобретения. Кроме того, с учетом того, что в изобретении могут быть сделаны различные модификации и изменения, очевидные специалистам в данной области, изобретение не должно быть ограничено конкретной описанной конструкцией и операцией. Таким образом, все приемлемые модификации и эквиваленты подпадают под объем изобретения.

1. Композиция, предназначенная для введения молекулы в клетку, которая содержит конъюгат формулы
N-L1-P-(L2-M)y,
в которой N обозначает не обладающую способностью проникать через мембраны молекулу или молекулу с низкой способностью проникать через мембрану,
L1 обозначает первое обратимое сцепление, содержащее лабильную в физиологических условиях связь,
Р обозначает полимер, обладающий активностью в отношении мембраны,
L2 обозначает второе обратимое сцепление, содержащее ортогональную лабильную в физиологических условиях связь,
М обозначает маскирующий агент, выбранный из группы, включающей стабилизаторы стерической конфигурации, обеспечивающие направленный перенос группы, и агенты, модифицирующие заряд, и
y обозначает целое число, большее 0.

2. Композиция по п.1, в которой молекула выбрана из группы, включающей: полинуклеотид, белок, пептид, антитело и не обладающее способностью проникать через мембраны лекарственное средство.

3. Композиция по п.2, в которой полинуклеотид выбран из группы, включающей: модифицированный полинуклеотид, ДНК, РНК, siPHK, миРНК и кассету экспрессии.

4. Композиция по п.1, в которой полимер имеет массу, превышающую 10 кДа.

5. Композиция по п.4, в которой обладающий активностью в отношении мембран полимер представляет собой полиамин.

6. Композиция по п.5, в которой обладающий активностью в отношении мембран полиамин состоит из статистического сополимера простого поливинилового эфира.

7. Композиция по п.6, в которой статистический сополимер простого поливинилового эфира состоит из трех или большего количества различных мономеров.

8. Композиция по п.7, в которой три или большее количество различных мономеров включают мономер, представляющий собой аминсодержащий простой виниловый эфир мономер, мономер, представляющий собой простой низший алкилвиниловый эфир, и мономер, представляющий собой простой высший алкилвиниловый эфир.

9. Композиция по п.8, в которой мономер в виде простого низшего алкилвинилового эфира, представляет собой мономер в виде простого бутилвинилового эфира, а мономер в виде простого высшего алкилвинилового эфира, представляет собой мономер в виде простого октадецилвинилового эфира или мономер в виде простого додецилвинилового эфира.

10. Композиция по п.1, в которой полимер представляет собой биоразложимый полимер.

11. Композиция по п.10, в которой первое обратимое и второе обратимое сцепления содержат лабильные в физиологических условиях связи, которые независимо друг от друга выбраны из группы, включающей: лабильную в физиологических условиях связь, лабильную в физиологических условиях клетки связь, лабильную при определенных значениях рН связь, очень лабильную при определенных значениях рН связь, чрезвычайно лабильную при определенных значениях рН связь, малеаматную связь, ферментативно расщепляемую связь и дисульфидную связь.

12. Композиция по п.1, в которой у обозначает 2 или число, превышающее 2.

13. Композиция по п.12, в которой маскирующие агенты являются одинаковыми или различными.

14. Композиция по п.13, в которой по меньшей мере один из маскирующих агентов содержит обеспечивающую направленный перенос группу, выбранную из группы, включающей: соединение, которое обладает аффинностью к расположенной на клеточной поверхности молекуле, лиганд клеточного рецептора, антитело, которое обладает аффинностью к расположенной на клеточной поверхности молекуле, сахарид, галактозу, производное галактозы, N-ацетилгалактозамин, маннозу, производное маннозы, витамины, фолат, биотин, аптамер, пептид, RGD-содержащий пептид, инсулин и EGF.

15. Композиция по п.14, в которой маскирующие агенты независимо выбраны из группы, включающей: диметилмалеиновый ангидрид, карбоксидиметилмалеиновый ангидрид (CDM), CDM-тиоэфир, производные CDM, CDM-стабилизаторы стерической конфигурации, CDM-ПЭГ, CDM-лиганд, CDM-галактозу, CDM-лактобионовую кислоту (LBA), CDM-Pip-LBA и CDM-NAG.

16. Композиция по п.1, которая содержит также избыток полимера.

17. Композиция по п.1, в которой конъюгат имеет зета-потенциал от +30 до -30 мВ при рН 7.

18. Композиция по п.1, в которой диаметр конъюгата меньше 20 нм.



 

Похожие патенты:
Изобретение относится к средству в форме мази для лечения и профилактики грибковых заболеваний кожи. .

Изобретение относится к составу для нанесения сахарных покрытий методом распыления непосредственно на материал ядра с получением твердой лекарственной формы. .

Изобретение относится к области медицины и фармакологии и представляет собой инъецируемую полимерную композицию, содержащую: соль пептидного агента, образованную сильной кислотой, выбранной из группы, состоящей из соляной кислоты, бромистоводородной кислоты, йодистоводородной кислоты, серной кислоты, азотной кислоты, хромовой кислоты, метансульфоновой кислоты, трифторметансульфоновой кислоты, трихлоруксусной кислоты, дихлоруксусной кислоты, бромуксусной кислоты, хлоруксусной кислоты, циануксусной кислоты, 2-хлорпропановой кислоты, 2-оксобутановой кислоты, 2-хлорбутановой кислоты, 4-цианобутановой кислоты, перхлорной кислоты и фосфорной кислоты; нерастворимый в воде биоразлагаемый полимер; фармацевтически приемлемый органический растворитель, который растворяет биоразлагаемый полимер и смешивается или диспергируется в водной или в биологической жидкости, и возможно один или более чем один фармацевтически приемлемый эксципиент, где пептидный агент имеет N-конец, который не является первичным амином, и где пептидный агент содержит по меньшей мере одну основную группу.
Изобретение относится к медицине и может быть использовано для производства жидких составов наружного применения, обладающих антимикробными свойствами и предназначенных для профилактики и лечения заболеваний кожных покровов у людей, лечения ран и язв, для стимулирования регенерации и заживления раневой поверхности при синдроме диабетической стопы.
Изобретение относится к профилактической мази для диабетической стопы, которая содержит антисептические агенты, такие как водный раствор полигексанида с полиэтиленгликолем 4000 и наноструктурный порошок бентонита, интеркалированный ионами серебра (Ag+).
Изобретение относится к противовоспалительному ранозаживляющему средству, основой которого являются полиэтиленоксиды (ПЭО-400 и ПЭО-1500), содержащему активные субстанции - 0,5-0,75 мас.% хлорамфеникола и 3-4 мас.% метилурацила, а также потенцирующие агенты - стабилизированный золь наночастиц серебра в количестве 4-8 мас.% и стабилизированный золь наночастиц железа в количестве 4-6 мас.%.

Изобретение относится к области биотехнологии и медицины. .

Изобретение относится к области медицины и касается оптимизированной композиции для инъекции РНК. .

Изобретение относится к медицине, конкретно к фармакологии, и касается средств, влияющих на иммунную и кроветворную системы. .

Изобретение относится к средству для ингибирования фермента поли(АДФ-рибозо)полимеразы-1 человека, представляющему собой производные нуклеозидов общей формулы (I), где Х - Н или OR1; один или два из заместителей R1, R 2, R3 - моносахаридные остатки, остальные - протоны водорода; В - азотистое основание, присоединенное в - или -положении.

Изобретение относится к олигонуклеотиду с последовательностью SEQ ID NO:1 или к его функциональному гомологу (нуклеотидная последовательность раскрыта в тексте описания).

Изобретение относится к аптамерам, которые описаны в таблице 1 ниже. .

Изобретение относится к области биотехнологии и касается варианта ДНК, связанного с гиполактазией взрослого типа. .

Изобретение относится к экспериментальной медицине и может быть использовано при разработке молекулярных способов лечения коронарной недостаточности
Наверх