Способ дифференциальной диагностики респираторных вирусных инфекций методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления



Способ дифференциальной диагностики респираторных вирусных инфекций методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления
Способ дифференциальной диагностики респираторных вирусных инфекций методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления

 


Владельцы патента RU 2460803:

Российская Федерация, от имени которой выступает Министерство промышленности и торговли Российской Федерации (Минпромторг России) (RU)

Изобретение относится к биотехнологии, медицинской вирусологии, молекулярной биологии и эпидемиологии. Описан способ дифференциальной диагностики респираторных вирусных инфекций методом мультиплексной обратной транскрипции и ПЦР с детекцией в режиме реального времени. Способ предусматривает анализ каждого исследуемого образца на наличие нуклеиновых кислот 11 респираторных вирусов в 3-х реакционных смесях. Способ позволяет дифференциально выявлять в биологических образцах нуклеиновые кислоты основных возбудителей ОРВИ - вирусов гриппа А и В, коронавирусов, вирусов парагриппа 1, 2, 3, 4 типов, аденовирусов, респираторно-синцитиального вируса, риновирусов и энтеровирусов. Наличие в изучаемой пробе нуклеиновых кислот того или иного респираторного вируса определяется ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей. Изобретение может быть использовано в эпидемиологических службах для мониторинга эпидемиологической обстановки и быстрой расшифровки вспышек ОРВИ. 2 н. и 4 з.п. ф-лы, 4 табл., 6 пр.

 

Изобретение относится к области лабораторной диагностики, медицинской вирусологии, молекулярной биологии и эпидемиологии. Изобретение предназначено для выявления и идентификации в клинических образцах 11 групп респираторных вирусов (вирусов гриппа А и В (ВГА и ВГВ), коронавирусов (КВ), вирусов парагриппа 1, 2, 3, 4 типов (ВПГ 1, 2, 3, 4), аденовирусов (АДВ), респираторно-синцитиального вируса (РСВ), риновирусов (РВ) и энтеровирусов (ЭВ) в присутствии внутреннего положительного контроля (ВПК) посредством мультиплексной ПЦР с детекцией в режиме реального времени. Данный подход позволяет усовершенствовать технику ПЦР-анализа для диагностики острых респираторных вирусных инфекций (ОРВИ) и может найти применение в эпидемиологических службах для мониторинга эпидемиологической обстановки и быстрой расшифровки вспышек ОРВИ.

Уровень техники

ОРВИ относятся к повсеместно распространенным болезням, которые на протяжении многих лет по числу случаев превосходят все другие инфекционные заболевания вместе взятые. ОРВИ характеризуются очень большим разнообразием возбудителей, которые могут вызывать заболевания со схожими симптомами. Основной вклад в структуру ОРВИ вносят вирусы гриппа, парагриппа, респираторно-синцитиальный вирус, коронавирусы, аденовирусы, риновирусы и некоторые энтеровирусы. C точностью идентифицировать респираторные вирусные инфекции можно только при помощи лабораторных методов диагностики. Широкое разнообразие респираторных вирусов чрезвычайно затрудняет этиологическую диагностику. Традиционные методы идентификации респираторных вирусов имеют недостатки, прежде всего связанные с недостаточной чувствительностью (иммунофлуоресцентные методы), большой длительностью, трудоемкостью, неуниверсальностью процедуры (культуральный метод). Выявление антител к вирусам в сыворотке пациентов с помощью твердофазного ИФА является ретроспективным методом (выявляет не самого возбудителя, а регистрирует ответ организма на инфекцию). Выявление методом ИФА вирусных антигенов в клинических образцах ограничено недостаточной чувствительностью. Использование иммунохимических и серологических методов затрудняет также высокое антигенное разнообразие некоторых групп респираторных вирусов - аденовирусов, риновирусов, энтеровирусов и др. Традиционные методы, в силу перечисленных ограничений, не позволяют одновременно и с высокой чувствительностью выявлять в клинических образцах основные группы респираторных вирусов.

Решение данной проблемы в последние годы связывают с развитием молекулярных методов амплификации нуклеиновых кислот (МАНК), специфичность которых основана на уникальности нуклеотидных последовательностей вирусных геномов. К числу МАНК относятся различные модификации полимеразной цепной реакции (ПЦР), в том числе ПЦР с детекцией в режиме реального времени (ПЦР-РВ). Внедрение метода ПЦР в лабораторную практику стало одним из наиболее важных событий в клинической лабораторной диагностике. Достоинствами метода ПЦР являются высокая специфичность, чувствительность, универсальность процедуры, простота и удобство проведения анализа, автоматизация процессов, возможность выявления сразу нескольких патогенов в одной пробирке при условии наличия в реакционной смеси нескольких пар соответствующих праймеров (мультиплексная ПЦР). Мультиплексный формат ПЦР-РВ сокращает трудоёмкость, стоимость и продолжительность анализа.

Все МАНК включают три этапа:

- подготовка образца, обычно заключающаяся в выделении и концентрировании нуклеиновых кислот (НК), а также в освобождении от присутствующих в образце ингибиторов;

- ферментативная амплификация НК;

- выявление продуктов амплификации.

Известны научные публикации, в которых описано применение ПЦР для выявления и идентификации респираторных вирусов в биологических образцах (J Med Virol. - 2004. - №72. - Р.484-495; J Clin Microbiol. - 2007. - №45. - Р.2965-2670; J Clin Microbiol. - 2004. - №42. - Р.1564-1569, J Clin Virol. - 2008, №41, Р.53-56), а также ряд патентов (США № 6881835 B2, № 0229211 A1, № 0014140 A1, № 0172835 A1, № 0233314 A1, WO 2007/058499 A1, WO 2008/042450 A2). В перечисленных публикациях и патентах описаны различные форматы ПЦР, которые применяются для диагностики ОРВИ, в том числе мультиплексная ПЦР с детекцией в агарозном геле, гибридизационно-ферментный анализ и ПЦР-РВ. Наиболее близкими аналогамим являются ПЦР-тест-системы, представленные в публикации Templeton K. с соавторами (J Clin Microbiol. - 2004. - №42. - Р.1564-1569) и патенте WO 2008/042450 A2. Признаками, отличающими настоящее изобретение от перечисленных аналогов, являются:

- нуклеотидные последовательности праймеров и зондов, приведенные в перечне последовательностей;

- возможность проведения дифференциальной диагностики риновирусной и энтеровирусной инфекции;

- использование внутреннего положительного контроля, представленного РНК-содержащим вирусом, который добавляется непосредственно в клинический образец перед выделением нуклеиновых кислот и позволяет контролировать эффективность выделения НК и наличие ингибиторов.

Технической задачей изобретения является создание способа идентификации респираторных вирусов с помощью мультиплексного ПЦР-анализа с детекцией продуктов амплификации в режиме реального времени. Данный подход позволяет одновременно выявлять в биологических образцах нуклеиновые кислоты 11 групп респираторных вирусов, не прибегая к использованию дополнительных методов выявления ампликонов (электрофорез ДНК в агарозном геле, ДНК-микрочипы), тем самым сокращая риск контаминации продуктами амплификации, процент технологических ошибок. Мультиплексный формат ПЦР-РВ сокращает трудоёмкость, стоимость и продолжительность анализа.

1. Указанная задача достигается за счет того, что способ дифференциальной диагностики респираторных вирусных инфекций, характеризующийся выявлением в клинических образцах нуклеиновых кислот основных возбудителей респираторных вирусных инфекций человека - вирусов гриппа А и В, коронавирусов, вирусов парагриппа 1, 2, 3, 4 типов, аденовирусов, респираторно-синцитиального вируса, риновирусов и энтеровирусов в присутствии внутреннего положительного контроля, предусматривающий проведение мультиплексной реакции обратной транскрипции (ОТ) и ПЦР-амплификации с детекцией в режиме реального времени, причем в качестве клинических образцов используют по выбору: мазки из носа, горла, носоглотки, носоглоточные аспираты, назальные смывы, мокроту, бронхоальвеолярный лаваж, секционный материал, образцы культуральной жидкости, отличается тем, что для его осуществления используют олигонуклеотиды - SEQ ID NO 1-45, на основе которых готовят смеси праймеров, зондов для проведения ПЦР-РВ; затем с использованием подобранных праймеров и зондов формируют реакционные смеси для мультиплексной ОТ и ПЦР, в которых флуоресцентномеченные зонды распределяют по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями; затем проводят мультиплексную реакцию обратной транскрипции и мультиплексную ПЦР-РВ (каждый образец анализируется в трех реакционных смесях); наличие в изучаемой пробе нуклеиновых кислот того или иного респираторного вируса определяют ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей; причем при проведении анализа проводят ряд контролей для исключения ложноположительных и ложноотрицательных результатов, для чего формируют пулы положительных контрольных образцов (ПКО), которые наряду с внутренним положительным контролем (ВПК) анализируются при анализе каждой серии образцов, а в состав пулов положительных контролей входят лабораторные штаммы респираторных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 31-33 цикле; в том случае когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК, это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при выделении РНК или постановке реакции; такой образец анализируют повторно. Кроме того, для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого используют дистиллированную воду. Кроме того, на стадии ПЦР с детекцией в режиме реального времени используют следующие олигонуклеотиды (распределенные по трем реакционным смесям): смесь №1: SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17; смесь №2: SEQ ID NO 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33; смесь №3: SEQ ID NO 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45. Кроме того, каждый вирусспецифический набор праймеров и зондов может быть использован для выявления в образцах нуклеиновых кислот соответствующих вирусов в моноспецифическом формате, в том числе для выявления аденовирусов - SEQ ID NO 1, 2, 3; коронавирусов SEQ ID NO 4, 5, 6, 7, 8, 9, 10, 11; энтеровирусов - SEQ ID NO 12, 13, 14; вируса гриппа В - SEQ ID NO 18, 19, 20; респираторно-синцитиального вируса - SEQ ID NO 21, 22, 23; вирусов гриппа А - SEQ ID NO 24, 25, 26; риновирусов - SEQ ID NO 27, 28, 29, 30, 31, 32, 33; вируса парагриппа 1 типа - SEQ ID NO 34, 35, 36; вируса парагриппа 2 типа - SEQ ID NO 37, 38, 39; вируса парагриппа 3 типа - SEQ ID NO 40, 41, 42; вируса парагриппа 4 типа - SEQ ID NO 43, 44, 45. Кроме того, анализ предусматривает выявление ВПК, представленного РНК-содержащим вирусом с целью контроля эффективности и качества выделения нуклеиновых кислот, в том числе наличие в образце ингибиторов реакций обратной транскрипции и ПЦР. Кроме того, при анализе образцов в реакционных смесях №1 и №2 проводят дифференциальное выявление риновирусов и энтеровирусов.

Способ позволяет дифференциально выявлять в биологических образцах нуклеиновые кислоты основных возбудителей ОРВИ - вирусов гриппа А и В, коронавирусов, вирусов парагриппа 1, 2, 3, 4 типов, аденовирусов, респираторно-синцитиального вируса, риновирусов и энтеровирусов. Наличие в изучаемой пробе нуклеиновых кислот того или иного респираторного вируса определяется ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей.

Способ может быть реализован на основе следующего перечня последовательностей.

Нуклеотидные последовательности праймеров и зондов для мультиплексной ПЦР-РВ.

Поставленная задача была решена путем подбора 12 наборов вирусспецифических праймеров (специфичные 11 респираторным вирусам и ВПК) для этапов анализа ОТ и ПЦР-РВ, а также формированием оптимальных реакционных смесей для проведения анализа. Выбор праймеров для ПЦР-РВ ограничивался несколькими критериями, такими как специфичность по отношению к геномным последовательностям вирусов соответствующей группы, высокая эффективность ПЦР, температура плавления 55-60°С, соотношение G/C в пределах от 40 до 65%, размер ПЦР-продуктов до 250 п.о.

Также были подобраны последовательности 12 гибридизационных зондов, нацеленных на область между праймерами. 5'-концевой нуклеотид каждого зонда модифицирован одним из 4 флуоресцентных красителей (FAM, ROX, R6G, Cy5 или аналогичными), а 3'-конец - одним из гасителей флуоресценции (BHQ1, BHQ2, BHQ3 или аналогичными). «Разгорание» флуоресцентного сигнала при накоплении специфического ампликона в процессе ПЦР-РВ происходит по принципу выщепления 5'-концевой метки зонда. Праймеры и зонды были направлены к следующим участкам вирусных геномов: ВГА и ВГВ - к M-гену; КВ - к гену NSP13; РСВ - к гену полимеразы L; ЭВ и РВ - к 5'-нетранслируемому региону генома (НТР); АДВ - к гену гексона; ВПГ 1-3 - к гену гемагглютининнейраминидазы HN; ВПГ4 - к гену фосфопротеина. Праймеры и зонды синтезируют в компании Синтол (Россия) либо в другой компании, специализирующейся на синтезе олигонуклеотидов и флуоресцентно-меченных зондов для ПЦР-РВ.

Последовательности праймеров и зондов для ПЦР-РВ, соответствующие им расчетные размеры продуктов амплификации, выявляемые с их помощью вирусы и гены-мишени представлены в перечне последовательностей и в табл.1.

Таблица 1

Характеристика олигонуклеотидов для мультиплексной ПЦР-РВ.

Название Размер ПЦР-продукта, п.о. Выявляемый вирус,
ген-мишень
SEQ ID NO 1 159 Аденовирусы,
ген гексона
SEQ ID NO 2
SEQ ID NO 3
SEQ ID NO 4 94-103 Коронавирусы,
SEQ ID NO 5 ген NSP13
SEQ ID NO 6
SEQ ID NO 7
SEQ ID NO 8
SEQ ID NO 9
SEQ ID NO 10
SEQ ID NO 11
SEQ ID NO 12 162 Энтеровирусы,
5'НТР
SEQ ID NO 13
SEQ ID NO 14
SEQ ID NO 15 119 ВПК
SEQ ID NO 16
SEQ ID NO 17
SEQ ID NO 18 146 Вирус гриппа В
М-ген (7 сегмент)
SEQ ID NO 19
SEQ ID NO 20
SEQ ID NO 21 120 Респираторно-синцитиальный вирус,
L-ген
SEQ ID NO 22
SEQ ID NO 23
SEQ ID NO 24 227 Вирус гриппа А
М-ген (7 сегмент)
SEQ ID NO 25
SEQ ID NO 26
SEQ ID NO 27 204 Риновирусы,
5'НТР
SEQ ID NO 28
SEQ ID NO 29
SEQ ID NO 30
SEQ ID NO 31
SEQ ID NO 32
SEQ ID NO 33
SEQ ID NO 34 162 Вирус парагриппа 1 типа,
ген HN
SEQ ID NO 35
SEQ ID NO 36
SEQ ID NO 37 241 Вирус парагриппа 2 типа,
ген HN
SEQ ID NO 38
SEQ ID NO 39
SEQ ID NO 40 143 Вирус парагриппа 3 типа,
ген HN
SEQ ID NO 41
SEQ ID NO 42
SEQ ID NO 43 199 Вирус парагриппа 4 типа,
ген фосфопротеина
SEQ ID NO 44
SEQ ID NO 45

С использованием подобранных праймеров и зондов сформированы 3 реакционных смеси для мультиплексной ОТ и ПЦР, которые включают оптимальные комбинации праймеров и зондов: смесь №1 - для выявления АДВ, КВ, ЭВ, ВПК; смесь №2 - ВГА, ВГВ, РВ, РСВ; смесь №3 - ВПГ 1, 2, 3, 4 (табл.2). Флуоресцентномеченные зонды распределены по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями.

Таблица 2

Распределение вирусспецифических праймеров и зондов по реакционным смесям в мультиплексной ПЦР-РВ.

Краситель Реакционная смесь
№1 №2 №3
FAM АДВ ВГВ ВПГ1
ROX КВ РСВ ВПГ2
R6G ЭВ ВГА ВПГ3
Cy5 ВПК РВ ВПГ4

Так как все перечисленные вирусы (кроме аденовирусов) являются РНК-содержащими, то для их выявления необходимо проведение стадии обратной транскрипции (ОТ). В качестве праймеров для проведения мультиплексной реакции обратной транскрипции используют олигонуклеотиды, комплементарные фрагменту вирусного генома, представляющие собой либо часть соответствующего праймера для ПЦР-РВ, либо олигонуклеотиды, комплементарные участку вирусного генома за пределами области амплификации. Праймеры для проведения ОТ характеризуются температурой плавления ниже 50°С и особенностями первичной структуры, которые снижают вероятность неспецифического отжига праймеров для ОТ на РНК-матрице и праймеров для ПЦР-РВ на матрице кДНК, увеличивая тем самым эффективность амплификации в образцах с высоким содержанием неспецифических НК.

Применение разработанной мультиплексной ПЦР-РВ подразумевает, что для анализа одного образца на наличие 11 респираторных вирусов его необходимо проанализировать в 3-х реакционных смесях (табл.2). Наличие в изучаемой пробе нуклеиновых кислот того или иного респираторного вируса определяется ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей.

При проведении анализа предусмотрен ряд контролей для исключения ложноположительных и ложноотрицательных результатов. Для этого сформированы пулы положительных контрольных образцов (ПКО-1, ПКО-2, ПКО-3), которые наряду с ВПК анализируются при анализе каждой серии образцов и контролируют все этапы анализа - выделение нуклеиновых кислот, ОТ и ПЦР. В состав пулов положительных контролей входят лабораторные штаммы респираторных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 31-33 цикле. ПКО-1 содержит инактивированные препараты АДВ, КВ, ЭВ, ВПК; ПКО-2 - ВГА, ВГВ, РСВ, РВ; ПКО-3 - ВПГ-1, 2, 3, 4. Положительные контрольные образцы разводят для того, чтобы контролировать возможность выявления вирусов в образцах с низким содержанием вируса. В каждый исследуемый образец включают ВПК, который при отсутствии ингибиторов должен определяться на 30-33, но не позднее 34 цикла. В том случае когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК, это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при постановке реакции (например, ВПК вместо 30-33 цикла определяется на 36-37 либо не определяется совсем). Такой образец необходимо анализировать повторно. Таким образом, постановка ряда контролей позволяет исключить ложноотрицательные образцы. Для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого можно использовать дистиллированную воду.

Таким образом, сущность изобретения заключается в том, что разработан подход для одновременного выявления в клинических образцах нуклеиновых кислот основных возбудителей респираторных вирусных инфекций человека - вирусов гриппа А и В, коронавирусов, вирусов парагриппа 1, 2, 3, 4 типов, аденовирусов, респираторно-синцитиального вируса, риновирусов и энтеровирусов в присутствии внутреннего положительного контроля (ВПК). В качестве образцов для исследования могут быть использованы мазки из носа, горла, носоглотки, носоглоточные аспираты, назальные смывы, мокрота, бронхоальвеолярный лаваж, секционный материал, образцы культуральной жидкости.

Способ дифференциальной диагностики респираторных вирусных инфекций методом мультиплексной ПЦР с детекцией в режиме реального времени включает следующие этапы:

1) подготовка смесей праймеров, зондов для проведения ОТ и ПЦР-РВ и контрольных образцов (ВПК, ПКО1, ПКО2, ПКО3 и ОКО);

2) выделение нуклеиновых кислот респираторных вирусов из исследуемых и контрольных образцов;

3) проведение мультиплексной реакции обратной транскрипции и мультиплексной ПЦР-РВ (каждый образец анализируется в трех пробирках);

4) учет и интерпретация результатов анализа.

Этап 2 (проведение мультиплексной реакции обратной транскрипции и мультиплексной ПЦР-РВ) проводится в одном из трех вариантов.

1-й вариант - «Двухэтапная ОТ и ПЦР-РВ», предусматривающая последовательное проведение реакций ОТ и ПЦР в отдельных пробирках. После завершения реакции ОТ часть продуктов ОТ (кДНК) переносится в пробирки, стрипы или 96-луночные ПЦР-планшеты для проведения ПЦР-РВ, в которые затем добавляется необходимое количество реакционной смеси для ПЦР-РВ.

2-й вариант - «Двухэтапная ОТ и ПЦР-РВ в одной пробирке», предусматривающая последовательное проведение реакций ОТ и ПЦР в одной пробирке. Реакция ОТ проводится в пробирках, стрипах или 96-луночных ПЦР-планшетах, пригодных для проведения ПЦР-РВ, в небольшом объеме - до 25 мкл. После завершения реакции ОТ в пробирки с продуктами ОТ (кДНК) вносится реакционная смесь для проведения ПЦР-РВ.

3-й вариант - «Одноэтапная ОТ и ПЦР-РВ», предусматривающая проведение реакций ОТ и ПЦР в одной пробирке в реакционной смеси, изначально содержащей все необходимые компоненты для реакций ОТ и ПЦР-РВ. «Одноэтапная ОТ и ПЦР» представляет собой наиболее удобный и наименее трудоемкий вариант постановки ОТ и ПЦР.

Осуществление изобретения

Пример 1. Выделение вирусных нуклеиновых кислот

Суммарную нуклеиновую кислоту (НК) выделяют при помощи одного из коммерческих наборов: «QIAmp Viral RNA mini kit» (Qiagen, Германия), ZR Viral RNA Kit™ (Zymo Research, США), «РИБО-сорб» (ИнтерЛабСервис, Россия) либо других специализированных коммерческих наборов для одновременного выделения вирусной РНК и ДНК, руководствуясь инструкцией фирмы-производителя. В основе перечисленных коммерческих наборов лежат модификации метода выделения НК, предложенного Boom R. с соавторами [Boom R. et al. Rapid and simple method for purification of nucleic acids// J Clin Microbiol. - 1990. - №28. - P.495-503]. Перед выделением НК к каждому исследуемому образцу и ОКО добавляют 10 мкл ВПК, при этом образец ВПК должен быть разведен таким образом, чтобы в ПЦР-РВ он определялся на 30-33, но не позднее 34 цикла. Одновременно с выделением НК из исследуемых образцов выделяют НК из контрольных образцов - ПКО1, ПКО2, ПКО3 и ОКО.

Пример 2. Проведение ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ»

На первом этапе анализа в мультиплексной реакции ОТ получают кДНК, которая на этапе ПЦР служит матрицей для амплификации. В состав реакционной смеси для мультиплексной ОТ входят праймеры, разделенные на 3 группы, которые вносят в пробирки, стрипы или планшеты для ПЦР в количестве 6 пкмоль каждого праймера (в объеме 2 мкл) на реакционную смесь.

В качестве праймеров для проведения мультиплексной реакции обратной транскрипции используют олигонуклеотиды, комплементарные фрагменту вирусного генома, представляющие собой либо часть соответствующего праймера для ПЦР-РВ, либо олигонуклеотиды, комплементарные участку вирусного генома за пределами области амплификации. Праймеры для проведения ОТ характеризуются температурой плавления ниже 50°С и особенностями первичной структуры, которые снижают вероятность неспецифического отжига праймеров для ОТ на РНК-матрице и праймеров для ПЦР-РВ на матрице кДНК, увеличивая тем самым эффективность амплификации в образцах с высоким содержанием неспецифических НК.

В пробирки с праймерами добавляют по 10 мкл РНК, выделенной из исследуемых образцов ПКО-1, ПКО-2, ПКО-3 и ОКО, прогревают в течение 5 минут при 65ºС, затем охлаждают до комнатной температуры в течение 3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее доводят объем реакционной смеси до 30 мкл заранее приготовленной смесью, содержащей Буфер для M-MLV-ревертазы, дНТФ 0,5 мМ, 30 ед. ревертазы вируса лейкоза Молони, и в течение 30 минут при 42°C получают кДНК. Все реагенты для реакции ОТ производства компании Синтол (Россия) или аналогичные. Для инактивации фермента смесь прогревают при 95°C в течение 5 минут и после охлаждения центрифугируют с целью осаждения конденсата. Далее с образцами кДНК проводят ПЦР-РВ.

Реакцию мультиплексной ПЦР-РВ проводят в пробирках, стрипах или планшетах для ПЦР в объеме 50 мкл. Каждый образец анализируется в 3 пробирках (реакционная смесь №1, №2 и №3), каждая из которых содержит реакционную смесь для ПЦР («Набор реагентов для проведения ПЦР-РВ с Taq ДНК-полимеразой и ингибирующими активность фермента антителами», кат. №М-428, «Синтол», Россия или аналогичную), смесь 4-х наборов праймеров (по 6 пмоль каждого праймера - табл.3), 4 зонда (по 5 пмоль каждого зонда - табл.3), 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами («СибЭнзим», кат. №E351, Россия или аналогичной) и 5 мкл кДНК. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. Программа ПЦР: 95˚C - 120 сек - 1 цикл; 95˚C - 20 сек, 58˚C - 40 сек - 45 циклов. Определение значений пороговых циклов осуществляют согласно руководству к прибору.

Таблица 3

Олигонуклеотиды, используемые в составе реакционных смесей в мультиплексной ПЦР-РВ.

Реакционная смесь
№1 №2 №3
Название праймеров и зондов SEQ ID NO 1
SEQ ID NO 2
SEQ ID NO 3
SEQ ID NO 5
SEQ ID NO 6
SEQ ID NO 7
SEQ ID NO 9
SEQ ID NO 10
SEQ ID NO 11
SEQ ID NO 13
SEQ ID NO 14
SEQ ID NO 15
SEQ ID NO 17
SEQ ID NO 18
SEQ ID NO 19
SEQ ID NO 21
SEQ ID NO 22
SEQ ID NO 23
SEQ ID NO 24
SEQ ID NO 25
SEQ ID NO 26
SEQ ID NO 27
SEQ ID NO 28
SEQ ID NO 29
SEQ ID NO 30
SEQ ID NO 31
SEQ ID NO 32
SEQ ID NO 33
SEQ ID NO 34
SEQ ID NO 35
SEQ ID NO 36
SEQ ID NO 37
SEQ ID NO 38
SEQ ID NO 39
SEQ ID NO 40
SEQ ID NO 41
SEQ ID NO 42
SEQ ID NO 43
SEQ ID NO 44
SEQ ID NO 45

При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в трех реакционных смесях на наличие НК 11 респираторных вирусов. Качество каждой реакционной смеси контролируют соответствующим ПКО и ОКО. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать по 36 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующих ПКО и ОКО) (Табл.4).

Таблица - 4. Схема анализа 10 клинических образцов.

Образцы после выделения НК 1 2 3 4 5 6 7 8 9 10 ПКО-1 ПКО-2 ПКО-3 ОКО
Реак. смесь №1 1 2 3 4 5 6 7 8 9 10 11 12
Реак. смесь №2 13 14 15 16 17 18 19 20 21 22 23 24
Реак. смесь №3 25 26 27 27 29 30 31 32 33 34 35 36

Пример 3. Проведение ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке»

Существенное отличие ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» от ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ» заключается в отсутствии необходимости переноса кДНК из пробирок с продуктами ОТ в отдельные пробирки для проведения ПЦР-РВ. Реакции ОТ и ПЦР-РВ проводят в одной пробирке (в пробирках, стрипах, планшетах, удовлетворяющих требованиям оборудования для проведения ПЦР-РВ). ПЦР-анализ в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» проводят следующим образом. При постановке реакции ОТ смеси праймеров вносят в пробирки, стрипы или планшеты для ПЦР в количестве 3 пкмоль каждого праймера (в объеме 1 мкл) на реакционную смесь.

В качестве праймеров для проведения мультиплексной реакции обратной транскрипции используют олигонуклеотиды, комплементарные фрагменту вирусного генома, представляющие собой либо часть соответствующего праймера для ПЦР-РВ, либо олигонуклеотиды, комплементарные участку вирусного генома за пределами области амплификации. Праймеры для проведения ОТ характеризуются температурой плавления ниже 50°С и особенностями первичной структуры, которые снижают вероятность неспецифического отжига праймеров для ОТ на РНК-матрице и праймеров для ПЦР-РВ на матрице кДНК, увеличивая тем самым эффективность амплификации в образцах с высоким содержанием неспецифических НК.

В пробирки с праймерами добавляют по 5 мкл РНК, выделенной из исследуемых образцов ПКО-1, ПКО-2, ПКО-3 и ОКО и прогревают в течение 5 минут при 65ºС, затем охлаждают до комнатной температуры в течение 3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее доводят объем реакционной смеси до 25 мкл заранее приготовленной смесью для ОТ, содержащей реакционную смесь для проведения ПЦР-РВ (кат. №М-428, Синтол, Россия, или аналогичную), 30 ед. ревертазы вируса лейкоза Молони, и в течение 30 минут при 42°C получают кДНК. Для инактивации фермента смесь прогревают при 95°C в течение 5 минут. После стадии ОТ образцы центрифугируют с целью осаждения конденсата, после чего к образцам кДНК добавляют реакционную смесь для ПЦР-РВ (кат. №М-428, Синтол, Россия, или аналогичную), смесь 4-х наборов праймеров (по 6 пмоль каждого праймера - табл.3), 4 зонда (по 5 пмоль каждого зонда - табл.3), 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами («СибЭнзим», кат. №E351, Россия, или аналогичной), доводя объем смеси до 50 мкл, и проводят реакцию ПЦР-РВ. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в трех реакционных смесях в присутствии контрольных образцов. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать 36 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующих ПКО и ОКО) (Табл.4).

Пример 4. Проведение ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ»

При постановке ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ» используются те же исходные реагенты, что и в примере 3. Существенным отличием ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ» от ПЦР-анализа в форматах «Двухэтапная ОТ и ПЦР-РВ» и «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» заключается в отсутствии необходимости открывания пробирок с продуктами ОТ с целью внесения реакционной смеси для ПЦР-РВ, т.к. в реакционной смеси изначально присутствуют все необходимые компоненты для реакций ОТ и ПЦР. Смеси праймеров вносят в пробирки, стрипы или планшеты, удовлетворяющие требованиям оборудования для проведения ПЦР-РВ, в количестве 6 пкмоль каждого праймера на реакционную смесь (в объеме 2 мкл).

В качестве праймеров для проведения мультиплексной реакции обратной транскрипции используют олигонуклеотиды, комплементарные фрагменту вирусного генома, представляющие собой либо часть соответствующего праймера для ПЦР-РВ, либо олигонуклеотиды, комплементарные участку вирусного генома за пределами области амплификации. Праймеры для проведения ОТ характеризуются температурой плавления ниже 50°С и особенностями первичной структуры, которые снижают вероятность неспецифического отжига праймеров для ОТ на РНК-матрице и праймеров для ПЦР-РВ на матрице кДНК, увеличивая тем самым эффективность амплификации в образцах с высоким содержанием неспецифических НК.

В пробирки с праймерами добавляют по 10 мкл исследуемой РНК и РНК, выделенной из ПКО-1, ПКО-2, ПКО-3 и ОКО, и прогревают в течение 5 минут при 65ºС, затем охлаждают до комнатной температуры в течение 3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее доводят объем реакционной смеси до 50 мкл заранее приготовленной смесью, содержащей реакционную смесь для ПЦР, смесь 4-х наборов праймеров (по 6 пмоль каждого праймера - табл.3), 4 зонда (по 5 пмоль каждого зонда - табл.3), 30 ед. ревертазы вируса лейкоза Молони, 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. Программа для проведения одноэтапной ОТ и ПЦР-РВ: 42ºС - 5 мин, 95˚C - 120 сек - 1 цикл; 95˚C - 20 сек, 58˚C - 40 сек - 45 циклов. Определение значений пороговых циклов осуществляют согласно руководству к прибору. При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в трех реакционных смесях в присутствии контрольных образцов. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать 36 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующих ПКО и ОКО) (Табл.4).

Пример 5. Учет и интерпретация результатов анализа

Учет результатов анализа, расчет пороговых циклов производят с помощью программного обеспечения к тому прибору для ПЦР-РВ, на котором проводился анализ, руководствуясь инструкцией производителя. Положительным считается образец, при анализе которого наблюдается рост флуоресцентного сигнала на одном из цветовых каналов амплификатора. Для интерпретации результатов анализа следует пользоваться таблицей 2. Например, при анализе образца в смеси №3 рост сигнала на канале FAM свидетельствует о присутствии в образце НК вируса парагриппа 1 типа, на канале ROX - вируса парагриппа 2 типа, R6G - вируса парагриппа 3 типа, Cy5 - вируса парагриппа 4 типа и т.д. При анализе клинических образцов положительными считаются образцы, которые определяются до 33 цикла. Если образец определяется на 34 цикле или позже, но при этом значения пороговых циклов ПКО и ВПК - в пределах нормы, а отрицательный контроль не определяется, он считается спорным и анализируется повторно. Если при повторной постановке результат сохраняется, образец считается положительным. Следует обращать внимание на значения пороговых циклов для ПКО и ВПК. В состав ПКО входят лабораторные штаммы респираторных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 30-33 цикле. Также в каждое исследование включают ВПК, который при отсутствии ингибиторов должен определяться на 30-33, но не позднее 34 цикла. Если при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК, например, вместо 30-33 цикла он определяется на 36-37 либо не определяется совсем, это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, на ошибки при постановке реакции или на ошибки при выделении НК. Такой образец должен быть проанализирован повторно. Таким образом, постановка контролей с ПКО и ВПК позволяет исключить ложноотрицательные образцы. Для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого можно использовать дистиллированную воду.

Пример 6. Дифференциальное выявление риновирусов и энтеровирусов.

Риновирусы и энтеровирусы по современной классификации относятся к одному роду (Enterovirus) семейства Picornaviridae и, следовательно, являются филогенетически родственными вирусами. Каждая из названных групп включает более 100 серологических типов. Праймеры и зонды для выявления риновирусов и энтеровирусов в реакции ОТ и ПЦР-РВ направлены к высококонсервативному для всего семейства нетранслируемому участку генома, что обуславливает риск перекрестных реакций, затрудняющих интерпретацию результата анализа. При интерпретации результатов анализа образцов в реакционных смесях №1 и №2 следует пользоваться следующими правилами.

1. Если отмечается одновременное нарастание сигнала флуоресценции на канале R6G в реакционной смеси №1 и на канале Cy5 в смеси №2 либо только на канале R6G в смеси №1, то такой образец считать положительным по энтеровирусу.

2. Если рост флуоресцентного сигнала наблюдается только в смеси для №2 на канале Cy5, то такой образец считать положительным по риновирусу.

1. Способ дифференциальной диагностики респираторных вирусных инфекций, характеризующийся выявлением в клинических образцах нуклеиновых кислот основных возбудителей респираторных вирусных инфекций человека - вирусов гриппа А и В (ВГА и ВГВ), коронавирусов (KB), вирусов парагриппа 1, 2, 3, 4 типов (ВПГ 1, 2, 3, 4), аденовирусов (АДВ), респираторно-синцитиального вируса (РСВ), риновирусов (РВ) и энтеровирусов (ЭВ) в присутствии внутреннего положительного контроля (ВПК), предусматривающий проведение мультиплексной реакции обратной транскрипции и ПЦР-амплификации с детекцией в режиме реального времени, причем в качестве клинических образцов используют по выбору: мазки из носа, горла, носоглотки, носоглоточные аспираты, назальные смывы, мокроту, бронхоальвеолярный лаваж, секционный материал, образцы культуральной жидкости, отличающийся тем, что для его осуществления используют олигонуклеотиды - SEQ ID NO 1-45, на основе которых готовят смеси праймеров, зондов для проведения ОТ и ПЦР-РВ; затем с использованием подобранных праймеров и зондов формируют реакционные смеси для мультиплексной ПЦР, в которых олигонуклеотиды SEQ ID NO 1-45 распределены по трем реакционным смесям следующим образом: смесь №1: SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17; смесь №2: SEQ ID NO 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33; смесь №3: SEQ ID NO 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45; причем флуоресцентномеченные зонды распределяют по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями в соответствии с таблицей 2, затем проводят мультиплексную реакцию обратной транскрипции и мультиплексную ПЦР-РВ (каждый образец анализируется в трех реакционных смесях); наличие в изучаемой пробе нуклеиновых кислот того или иного респираторного вируса определяют ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей в соответствии с приведенной выше таблицей; причем при проведении анализа проводят ряд контролей для исключения ложноположительных и ложноотрицательных результатов, для чего формируют пулы положительных контрольных образцов, которые, наряду с ВПК, анализируются при анализе каждой серии образцов, а в состав пулов положительных контролей входят лабораторные штаммы респираторных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 31-33 цикле; в том случае, когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК - это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при постановке реакции; такой образец анализируют повторно.

2. Способ по п.1, отличающийся тем, что каждый вирусспецифический набор праймеров и зондов может быть использован для выявления в образцах нуклеиновых кислот соответствующих вирусов в моноспецифическом формате, в том числе для выявления аденовирусов - SEQ ID NO 1, 2, 3; коронавирусов SEQ ID NO 4, 5, 6, 7, 8, 9, 10, 11; энтеровирусов - SEQ ID NO 12, 13, 14; вируса гриппа В - SEQ ID NO 18, 19, 20; респираторно-синцитиального вируса - SEQ ID NO 21, 22, 23; вирусов гриппа А - SEQ ID NO 24, 25, 26; риновирусов - SEQ ID NO 27, 28, 29, 30, 31, 32, 33; вируса парагриппа 1 типа - SEQ ID NO 34, 35, 36; вируса парагриппа 2 типа - SEQ ID NO 37, 38, 39; вируса парагриппа 3 типа - SEQ ID NO 40, 41, 42; вируса парагриппа 4 типа - SEQ ID NO 43, 44, 45.

3. Способ по п.1, отличающийся тем, что для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого используют дистиллированную воду.

4. Способ по п.1, отличающийся тем, что анализ предусматривает выявление внутреннего положительного контроля, представленного РНК-содержащим вирусом с целью контроля эффективности и качества выделения нуклеиновых кислот, в том числе наличие в образце ингибиторов реакций обратной транскрипции и ПЦР.

5. Способ по п.3 или 4 отличающийся тем, что при анализе образцов в реакционных смесях №1 и №2, проводят дифференциальное выявление риновирусов и энтеровирусов.

6. Набор для осуществления способа дифференциальной диагностики респираторных вирусных инфекций по п.1 включает праймеры и зонды для мультиплексной ПЦР-РВ со следующими нуклеотидными последовательностями:
5'-3'
SEQ ID NO 1 CTCCAGCAACTTCATGTCYATGGG
SEQ ID NO 2 CACTCTGACCACGTCGAARACTTC
SEQ ID NO 3 FAM-AGGGTGGGCTCRTCCATGGGRTCCA-BHQ1
SEQ ID NO 4 GTGGCTGGGATGATATGTT
SEQ ID NO 5 TTATGGTGGTTGGAATAATATGTT
SEQ ID NO 6 GCGGGTGGGATAATATGTT
SEQ ID NO 7 TGGCATAGCACGATCACA
SEQ ID NO 8 TGTTAGGCAAAGCTCTATCACA
SEQ ID NO 9 GAGGGCATAGCTCTATCACA
SEQ ID NO 10 ROX-ATGGGTTGGGATTATCCTAAGTGTGAT-BHQ2
SEQ ID NO 11 ROX-ATGGGATGGGACTATCCTAAGTGTGAT-BHQ2
SEQ ID NO 12 CTCCGGCCCCTGAAT
SEQ ID NO 13 RATTGTCACCATAAGCAGCC
SEQ ID NO 14 R6G-CGGAACCGACTACTTTGGGTGTCCG-BHQ1
SEQ ID NO 15 GTCATCACCCACCGTTGT
SEQ ID NO 16 CCTTCTGGAGGTCCTCCAT
SEQ ID NO 17 Cy-5-AGAGCCCCAGGGTGCCCGAAT-BHQ3
SEQ ID NO 18 GGAATGGGRACAACAGCAAC
SEQ ID NO 19 AGGTACATGACCATGAGACAR
SEQ ID NO 20 FAM-CATGAAGCATTTGAAATAGCAGAAGGC-BHQ-1
SEQ ID NO 21 CAGTCAGTAGTAGACCATGTGAATTC
SEQ ID NO 22 ATATCTTCATCWCCATACTTTTCTGT
SEQ ID NO 23 ROX-GTTCTATAAGCTGGTATTGATGCAGGGA-BHQ2
SEQ ID NO 24 TTCTAACCGAGGTCGAAACG
SEQ ID NO 25 CGTCTACGYTGCAGTCC
SEQ ID NO 26 R6G-TGGCTAAAGACAAGACCAATCCTGTCACC-BHQ-1
SEQ ID NO 27 TGCGTGGCTGCCTGC
SEQ ID NO 28 TGCGTGGCGGCCAAC
SEQ ID NO 29 TGCGTGGCGGCCAGC
SEQ ID NO 30 CTGCGTGGCTGCCT
SEQ ID NO 31 AGCCYGCGTGGTGC
SEQ ID NO 32 AACACGGACACCCAAAGTAGT
SEQ ID NO 33 Cy-5-TTAGCCRCATTCAGGGGCCG-BHQ3
SEQ ID NO 34 CTATGACATCAACGACAACAGG
SEQ ID NO 35 TTTGGTCTTTCCCTTGAGATCTA
SEQ ID NO 36 FAM-TGCAGGAACAAGGGGTTATCAGTTATG-BHQ1
SEQ ID NO 37 CAGGACTATGAAAACCATTTACCT
SEQ ID NO 38 TGCAGGATTGATTGTGGC
SEQ ID NO 39 ROX-CTGATCTAGCTGAACTGAGACTTGCTTTC-BHQ2
SEQ ID NO 40 ATGGYTCAATCTCAACAACAAG
SEQ ID NO 41 TTGGATGTTCAAGACCTCCAT
SEQ ID NO 42 R6G-TACCCATCTGTTGGACCAGGGATATACT-BHQ1
SEQ ID NO 43 CCTGGAGTCCCATCAAAAGTAAG
SEQ ID NO 44 GCATCTATACGAACRCCTGCTC
SEQ ID NO 45 Cy5-TTTGTTGATCAAGACAATACAATTACACTTGA-BHQ3;
где FAM, ROX, R6G, Cy5 - флуоресцентные красители; BHQ1, BHQ2, BHQ3 - гасители флуоресценции; R - А или G, Y - С или Т.



 

Похожие патенты:

Изобретение относится к области молекулярной биологии и биохимии и может быть использовано в молекулярной диагностике, связанной с выявлением РНК-мишеней. .

Изобретение относится к области биотехнологии, а именно к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации РНК энтеровирусов.
Изобретение относится к медицине, а именно к клинической лабораторной диагностике, и может быть использовано для выявления и дифференциальной диагностики манифестной и асимтпомной форм уретрита, обусловленного условно-патогенными микроорганизмами, у мужчин репродуктивного возраста.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при определении наследственной предрасположенности к развитию заболеваний, ассоциированных с носительством полиморфных вариантов гена тиоредоксинредуктазы-1.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при определении наследственной предрасположенности к развитию заболеваний, ассоциированных с носительством полиморфных вариантов гена пероксиредоксина-1.
Изобретение относится к области медицинской диагностики, а именно к кардиологии и медицинской генетике. .

Изобретение относится к области биотехнологии, а именно к способу диагностики биоматериалов на наличие в них агробактерий. .

Изобретение относится к области медицинской микробиологии, в частности к идентификации токсигенных штаммов Vibrio cholerae O1, определению их биовара (классического или эльтор) и дифференциации V.

Изобретение относится к микробиологии и молекулярной генетике микроорганизмов и касается способов выявления экспрессирующихся генетических детерминант патогенных микроорганизмов рода Burkholderia с использованием реакций обратной транскрипции и сопряженной амплификации (ОТ-ПЦР) для их последующего структурно-функционального анализа, что, в свою очередь, позволит оценить влияние адаптационных изменений клеток при изменении условий внешней среды на выраженность важнейших биологических характеристик микроорганизмов, в частности вирулентности и устойчивости к антимикробным препаратам.

Изобретение относится к области биохимии и касается посттрансляционной модификации экспонируемых бактериофагом полипептидов. .

Изобретение относится к медицинским методам диагностики хламидиоза, гарднереллеза, трихоманиаза, уреаплазмоза, микоплазмоза по составу равновесной газовой фазы над цервикальной слизью и может быть использовано для определения наличия их возбудителей в пробе цервикальной слизи.
Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается вакцины против вирусной диареи крупного рогатого скота (ВД КРС). .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.

Изобретение относится к области вирусологии. .

Изобретение относится к области вирусологии и биотехнологии и касается штамма вируса иммунодефицита человека первого типа (ВИЧ-1). .
Изобретение относится к области медицинской микробиологии и касается штамма Pseudomonas aeruginosa. .

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. .
Наверх