Способ определения вирулентных и патогенных форм вирусов гриппа



Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа
Способ определения вирулентных и патогенных форм вирусов гриппа

 


Владельцы патента RU 2489488:

Общество с ограниченной ответственностью "ПАНАГЕН" (RU)

Изобретение относится к области медицины, и молекулярной биологии, и вирусологии. Способ определения вирулентных и патогенных форм вирусов гриппа основан на получении исходного образца ткани/физиологической жидкости от пациентов, предположительно больных гриппом, выделении и очистке препаратов РНК из исходного образца, синтезе кДНК на матрице РНК, анализе нуклеотидной последовательности полученной кДНК с целью определения мутационного статуса характерных положений сегментов вируса гриппа и расчете двух скоринг-факторов, по величине которых судят о степени вирулентности и патогенности вируса гриппа. Способ может быть использован для определения вирулентных и патогенных форм вирусов гриппа. 5 табл., 4 пр.

 

Настоящее изобретение относится к области медицины и молекулярной биологии, в частности, к вирусологии, и может быть использовано для выявления вирулентных и патогенных форм вирусов гриппа.

Известно изобретение, в котором предлагается антитело, применение которого позволяет проводить быстрое обнаружение пандемического вируса гриппа А подтипа H1N1 2009 г, и устройство, позволяющее проводить быстрое выявление пандемического вируса гриппа А подтипа H1N1 2009 г., а также метод детекции пандемического вируса гриппа А подтипа H1N1 2009 г. [WO/2011/087092].

Недостатком этого решения является относительно узкая область применения, поскольку оно позволяет обнаружить вирус гриппа, относящийся лишь к одной группе пандемических штаммов, но не позволяет ни выявить другие, в том числе пандемические вирусы гриппа, ни определять степень их опасности для человека.

Известно также изобретение, которое может быть использовано для обнаружения высокопатогенного вируса птичьего гриппа A/H5N1, в частности, метод и набор для проведения иммунологического анализа, позволяющий проводить быстрое, удобное обнаружение высокопатогенных штаммов вируса птичьего гриппа подтипа H5N1 с высокой степенью специфичности, а также иммунохроматографический набор для быстрого, удобного выявления высокопатогенных штаммов вируса птичьего гриппа подтипа H5N1 с высокой степенью специфичности, причем, показано, что моноклональные антитела 4G6, получаемые с использованием вируса H5N1 в качестве иммуногена (антигена), не взаимодействуют с вирусами гриппа подтипов H5N2 и H5N3, вступая в контакт исключительно с вирионами подтипа H5N1, а применение заявленного иммунохроматографического набора, основанного на антителах 4G6, позволяет проводить специфичное обнаружение вируса подтипа H5N1, причем, чувствительность проводимой иммунохроматографии может быть увеличена путем добавления неионных поверхносто-активных веществ и водорастворимых виниловых полимеров с полярной группой, в которую входят атомы кислорода и азота, в проявляющий раствор, используемый в иммунохроматографии [WO/2010/103583].

Недостатком этого решения также является относительно узкая область применения, поскольку оно позволяет обнаружить высокопатогенный вирус птичьего гриппа A/H5N1, но не позволяет ни обнаружить другие вирусы гриппа, ни оценить их степень вирулентности и патогенности.

Кроме этого, известны методы, основанные на применении олигонуклеотидных праймеров и проб для выявления вирусов гриппа (а также возбудителей многих других заболеваний) и их дискриминации на типы (А/В) и подтипы, в частности, описаны методы детектирования вируса гриппа, а также методы дифференциации на заявленные подтипы и типы (90% штаммов свиного и птичьего гриппа, включая все штаммы H5N1), согласно которым образец с подозрением на содержание вируса гриппа подвергается скринингу на предмет наличия или отсутствия характерной последовательности нуклеиновых кислот, при этом, присутствие в образце данной последовательности свидетельствует о наличии в образце вируса гриппа, причем, процесс скрининга осуществляется путем гибридизации фрагментов нуклеиновых кислот, содержащихся в образце, с пробами (например, пробами микрочипа), специфичными как для всех вирусов гриппа, так для определенного типа (А/В) вируса и для определенного подтипа вируса. Здесь же заявлены праймеры и пробы для осуществления такого детектирования и типирования, а также микрочипы, содержащие такие пробы [WO/2007/095155].

Это решение также обладает относительно узкой областью применения, поскольку с его помощью возможно обнаружение высокопатогенного вируса птичьего гриппа A/H5N1, но оно также не позволяет ни обнаружить вирусы гриппа других штаммов, ни провести оценку степени их вирулентности и патогенности.

Известен способ определения вирулентности микробов, основанный на подготовке суспензии тканей на 0,9% растворе хлорида натрия, делении ее на 3 части, одну часть суспензии 0,8-1,2 мл исследуют методом полимеразной цепной реакции (ПЦР) (0,3-0,4 мл) для обнаружения последовательности генов pFra, pCad, pPst, вторую часть по 0,1-0,15 мл суспензии высевают на плотную питательную среду Джексона-Берроуза с генцианвиолетом (0,02-0,03 мкг/мл) для обнаружения признака Pgm+ (детерминированного хромосомной последовательностью генов), третью часть по 0,1-0,15 мл суспензии высевают на агар Хоттингера с генцианвиолетом (0,02-0,03 мкг/мл) для определения чувствительности к антибиотикам методом бумажных дисков [RU 2160781, C1, C12Q 1/04, G01N 33/53, 20.12.2000].

Недостатком способа является относительно узкая область применения, поскольку способ может быть использован для эпидзначимости чумных микробов, а также относительно низкой точности, поскольку не позволяет определить, в частности, степень вирулентности, как количественной меры.

Наиболее близким по своей сущности к предложенному является способ, основанный на получении генетически модифицированного вируса гриппа и вирусных белков путем введения мутаций, делеций, вставок в участки вирусного генома, кодирующие каспазные или гранзимные сайты или их мотивы или создание дополнительных каспазных сайтов и их мотивов у вирусных белков путем осуществления сайт-направленного мутагенеза и процесса обратной генетики, причем, полученный модифицированный вирус гриппа обладает повышенными вирулентными свойствами, а модифицированные вирусные белки сопряжены с усилением токсичности для организма [RU 2366710, C1, C12N 7/04, 10.09.2009].

Недостатком способа является относительно узкая область применения, поскольку способ может быть использован для получения усиленных или ослабленных по вирулентности и патогенности вирусов гриппа, но не позволяет определить степень вирулентности и патогенности возбудителей, в том числе, как количественной меры.

Требуемый результат заключается в расширении области применения на основе количественного определения степени вирулентности и патогенности вирусов гриппа.

Требуемый результат достигается тем, что по способу, основанному на получении исходного образца ткани/физиологической жидкости от пациентов, предположительно больных гриппом, выделении и очистке препаратов РНК из исходного образца ткани/физиологической жидкости и проведении синтеза одноцепочечной или двуцепочечной кДНК на матрице РНК с использованием случайных олигонуклеотидных праймеров, дополнительно осуществляют реакцию амплификации фрагментов с использованием кДНК, синтезированной на матрице вирусной РНК и ряда наборов аллель-специфичных праймеров, осуществляют определение мутационного статуса сегментов вируса гриппа и рассчитывают скоринг-фактор вирулентности

V = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 H i / j = 1 H i W i , j ) + W H A M H A i = 1 S H i + W H A ,

по величине которого судят о степени вирулентности вируса гриппа, и скоринг-фактор патогенности

P = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 ( j = 1 H i W i , j j = 1 H i W i , j M i , j + 1 ) H i / j = 1 H i W i , j ) W S + W H A M H A i = 1 S H i + W H A

по величине которого судят о степени патогенности вируса гриппа,

где Mi,j - мутационный статус для аминокислотного положения номер j в полипептидной цепи, синтезируемой по сегменту номер i (значение Mi,j равно единице в случае, если аминокислотный остаток в данном положении характерен для вирусов, вирулентных сугубо для человека, равно нулю - для животных); характерные аминокислотные остатки приведены в таблице 1; значение Mi,j равно 0.5, если такая классификация не может быть произведена в соответствии с заявленными условиями;

MHA - мутационный статус гемагглютинина; равен единице в случае, если сегмент гемагглютинина может быть отнесен к классу человеческих, и нулю - к классу нечеловеческих; соотнесение сегмента гемагглютинина к одному из этих классов проводится согласно данным об аминокислотных заменах в характерных положениях в горячих точках, приведенным в таблицах 2 и 3; MHA равен 0.5, если такая классификация не может быть произведена в соответствии с заявленными условиями;

Wi,j - вес, относительная значимость аминокислотной замены в положении j полипептидной цепи, синтезируемой по сегменту i, определяющей вирулентный генотип вируса для человека (наиболее подходящие значения коэффициентов Wi,j указаны в таблице 4); применим для сегментов матричных белков M1, М2, неструктурных белков NS1, NS2, субъединиц полимеразы PA, PB1, РВ2, нуклеопротеина NP;

WS - общая относительная значимость аминокислотных замен в полипептидной цепях сегментов M1, M2, NS1, NS2, PA, PB1, PB2, NP; наиболее подходящее значение коэффициента WS равно 0.17;

WHA - вес, относительная значимость аминокислотных замен в полипептидной цепи гемагглютинина; наиболее подходящая величина коэффициента WHA составляет 2.45;

S - количество анализируемых сегментов/полипептидных цепей;

Hi - количество анализируемых положений аминокислотных замен в полипептидной цепи, синтезируемой по сегменту i.

Способ определения вирулентных и патогенных форм вирусов гриппа основан на проведении аллель-специфичной ПЦР и выявлении характерных замен в сегментах вирусах гриппа, на основании чего производится количественная оценка степени вирулентности и патогенности.

Способ включает последовательно выполнение следующих операций (стадий):

а) получение исходного образца ткани/физиологической жидкости от пациентов, предположительно больным гриппом;

б) выделение и очистка препаратов РНК из исходного образца;

в) синтез одноцепочечной или двуцепочечной кДНК на матрице РНК с использованием случайных олигонуклеотидных праймеров и/или сегмент-специфичных праймеров;

г) проведение реакции амплификации фрагментов с использованием кДНК, полученной на стадии в);

д) оценка результатов амплификации - определение мутационного статуса сегментов вируса гриппа;

е) расчет скоринг-фактора вирулентности

V = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 H i / j = 1 H i W i , j ) + W H A M H A i = 1 S H i + W H A ,

по величине которого судят о степени вирулентности вируса гриппа;

ж) расчет скоринг-фактора патогенности

P = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 ( j = 1 H i W i , j j = 1 H i W i , j M i , j + 1 ) H i / j = 1 H i W i , j ) W S + W H A M H A i = 1 S H i + W H A ,

по величине которого судят о степени патогенности вируса гриппа.

В формулах для расчетов скоринг-факторов:

Mi,j - мутационный статус для аминокислотного положения номеру в полипептидной цепи, синтезируемой по сегменту номер j (значение Mi,j равно единице в случае, если аминокислотный остаток в данном положении характерен для вирусов, вирулентных сугубо для человека, равно нулю - для животных); характерные аминокислотные остатки приведены в таблице 1; значение Mi,j равно 0.5, если такая классификация не может быть произведена в соответствии с заявленными условиями;

MHA - мутационный статус гемагглютинина; равен единице в случае, если сегмент гемагглютинина может быть отнесен к классу человеческих, и нулю - к классу нечеловеческих; соотнесение сегмента гемагглютинина к одному из этих классов проводится согласно данным об аминокислотных заменах в характерных положениях в горячих точках, приведенным в таблицах 2 и 3; MHA равен 0.5, если такая классификация не может быть произведена в соответствии с заявленными условиями;

Wi,j - вес относительная значимость аминокислотной замены в положении у полипептидной цепи, синтезируемой по сегменту г, определяющей вирулентный генотип вируса для человека (наиболее подходящие значения коэффициентов Wi,j указаны в таблице 4); применим для сегментов матричных белков M1, M2, неструктурных белков NS1, NS2, субъединиц полимеразы PA, PB1, PB2, нуклеопротеина NP;

WS - общая относительная значимость аминокислотных замен в полипептидной цепях сегментов M1, M2, NS1, NS2, PA, PB1, PB2, NP; наиболее подходящее значение коэффициента WS равно 0.17;

WHA - вес, относительная значимость аминокислотных замен в полипептидной цепи гемагглютинина; наиболее подходящая величина коэффициента WHA составляет 2.45;

S - количество анализируемых сегментов/полипептидных цепей;

Hi - количество анализируемых положений аминокислотных замен в полипептидной цепи, синтезируемой по сегменту i.

Таблица 2
Горячие точки замен (ГТ) в полипептидной цепи, синтезируемой по сегменту гемагглютинина, по которым осуществляется дискриминация гемагглютинина на классы человеческий/нечеловеческий.
Тип НА ГТ №1 ГТ №2 ГТ №3 ГТ №4 ГТ №5 ГТ №6
H1 240 242 262 382 390 391
Н2 236 238 258 378 386 387
Н3 241 243 263 383 391 392
Н4 239 241 261 381 389 390
Н5 238 240 260 384 392 393
Н6 239 241 261 382 390 391
Н7 235 237 257 379 387 388
Н8 239 241 261 382 390 391
Н9 234 236 256 376 384 385
Н10 236 238 258 378 386 387
Н11 238 240 260 380 388 389
Н12 238 240 260 380 388 389
Н13 238 240 260 380 388 389
Н14 243 245 265 385 393 394
Н15 235 237 257 387 395 396
Н16 239 241 261 380 388 389
Таблица 3
Аминокислотные остатки, по присутствию в которых в соответствующих горячих точках №№1-6 проводится дискриминация гемагглютинина на человеческий/нечеловеческий классы.
ГТ№1 ГТ №2 ГТ №3 ГТ №4 ГТ №5 ГТ №6
человеческий класс
Q G N Q N G
V S T L N Q
I S T L D Q
I S T L N Q
L S T L D Q
L S N L D Q
Q G N Q D G
L S T К D G
нечеловеческий класс
Q G T L D Е
Q G N K D G
Q G N L D Q
Q G T L D K
Q G N Y D Q
Q G T Q D G
Q G I L D Q
Q G N R D G
s G N Y D Q
L G N R D K
Q G T K D G
Q G N K D Q
Q G N R D K
Q G T R D G
N G N Y D Q
Q G N R D N

После вычисления скоринг-фактора P решение о вирулентности и патогенности исследованных вирусов гриппа производится по следующим критериям:

Если значение скоринг-фактора P меньше порогового значения 0.4, то принимается решение о присвоении незначительной степени патогенности для человека этого штамма - вероятнее всего, данный штамм относится к классу гриппа животных, не передающихся человеку. Если значения скоринг-фактора Р находится в интервале 0.4-0.8, то принимается решение о присвоении средней степени патогенности для человека этого штамма - вероятнее всего, представителей данного штамма можно отнести в группе вирусов сезонного гриппа, неопасных для человека. Если величина скоринг-фактора Р превосходит значение 1.0, то принимается решение о присвоении высокой степени патогенности данного штамма для человека - вероятнее всего, данный штамм можно классифицировать как пандемический, по всей видимости, возникший в результате мутаций в геноме вируса гриппа животных. Если величина скоринг-фактора P находится в диапазоне 0.8-1.0, решение неоднозначно - данный штамм не может быть классифицирован как пандемический, однако его появление в популяции людей может привести к серьезным эпидемиям с относительно высокой степенью летальности при протекании заболевания.

Также может быть оценена степень вирулентности данного штамма для человека: если значение V превосходит величину 0.22, то вирусы данного штамма достаточно хорошо могут передаваться от человека к человеку. Если значение V меньше заявленной величины, то передача вируса от человека к человеку, а также от животного к человеку затруднена или невозможна.

Данное изобретение стало возможным благодаря проведенному авторами биоинформационному исследованию изменений нуклеотидной и аминокислотной последовательности вируса гриппа A и B и открытия факта существования ряда характерных мутаций, наличие которых позволяет судить о принадлежности данного вируса к группам патогенных и вирулентных для человека.

Способы выделения РНК из образцов вирусов известны достаточно хорошо и, как правило, включают следующие стадии: лизис вирионов, выделение РНК и ее очистку, проверку (при достаточном количестве материала) качества РНК электрофорезом в 1%-ном агарозном геле в присутствии красителя бромида этидия или в денатурирующем полиакриламидном геле, а также спектрофотометрическое определение количества РНК. Для непосредственного выделения РНК могут быть использованы различные протоколы, широко известные специалистам в данной области. В классических методах выделения РНК используют сильные хаотропные агенты, такие, как гуани-динхлорид и гуанидинизотиоцианат, растворяющие белки, и последовательные экстракции фенолом и хлороформом для денатурации и удаления белков [Sambrook J., Fritsch E.F., Maniatis T. 1989. Molecular Cloning. A laboratory Manual. 2nd Edition ed. Cold Spring Harbour: CSHL Press]. Широко используют также метод с использованием реагента Trizol (GIBCO/Life Technologies). Для предотвращения разрушения РНК РНКазами могут быть использованы ингибиторы, такие как ингибитор RNAsin плацентарного или рекомбинантного происхождения или, например, ванадил-рибозидный комплекс - неспецифический ингибитор РНКаз широкого спектра действия.

Быстрое и качественное выделение РНК можно проводить с использованием ряда коммерчески доступных наборов (Клоноген, Санкт-Петербург; RNeasy kits (Qiagen); SV Total RNA Isolation System, Promega (США) и т.д.). Использование различных приборов, например, QuickGene-810 (Life Science, Япония), позволяет исключить работу с агрессивными агентами, ускорить и упростить выделение РНК. Для экстракции РНК в этом приборе используют 80-микрометровую пористую мембрану, которая в 12,5 раз тоньше традиционно используемого в таких приборах стеклянного фильтра (1000 мкм), что позволяет уменьшить деградацию РНК и увеличить ее выход.

Затем проводят реакцию амплификации фрагментов с использованием кДНК, полученной на стадии выделения РНК из исходных образцов тканей, т.е. реакцию обратной транскрипции: синтез кДНК на матрице РНК, выделенной из образцов тканей.

Реакция обратной транскрипции, в результате которой на РНК-матрице синтезируют одноцепочечную цепь ДНК, при необходимости, с достройкой второй цепи, позволяет перейти от нестабильных молекул РНК к более стабильным молекулам ДНК. Дальнейшая ПЦР-амплификация позволяет использовать очень малые количества исходной РНК (на уровне нескольких нанограмм), а, следовательно, и количество исследуемуго образцового материала, из которого выделяют РНК вируса.

Реакцию обратной транскрипции можно проводить с использованием коммерчески доступных препаратов обратных транскриптаз, таких как обратная транскриптаза вируса лейкоза мышей Молони (M-MLV), вируса миелобластоза птиц (AMV), PowerScript (точечная мутация M-MLV-RT), C.Therm Polymerase и др., с помощью которых можно получать продукты амплификации длиною до нескольких тысяч и даже несколько десятков тысяч пар нуклеотидов. Может быть использована термостабильная ДНК-полимераза Thermus thermophilus (Tth), обладающая обратной транскриптазной активностью в присутствии ионов Mn.

Для обратной транскрипции могут быть использованы различные праймеры, например:

1) Случайные гексануклеотидные праймеры («статистические затравки») гибридизуются с РНК в многочисленных участках. При обратной транскрипции с этими праймерами получают короткие кДНК. Случайные гексамеры используют для преодоления трудностей, связанных со вторичной структурой РНК, они более эффективны при обратной транскрипции 5'-областей мРНК;

2) Гексамеры или другие короткие олигонуклеотиды (10-12 нуклеотидов) случайного состава могут быть также использованы в комбинации с олигоdT-содержащими праймерами (в случае проведения обратной транскрипции и получения кДНК для мРНК генов человека);

3) Специфические олигонуклеотидные праймеры используют для транскрипции РНК-сегментов вирусов или участков мРНК человека, представляющих интерес для исследования. Эти праймеры успешно применяют для диагностических целей. Однако в связи со значительной вариабельностью генома вируса гриппа применение таких праймеров должно быть тщательно обосновано.

Существуют также специализированные наборы, ориентированные на выделение вирусной РНК, входящие в комплекс диагностических тест-систем, например, набор реагентов для выделения и последующего выявления РНК вируса гриппа А подтипа H5N1 методом ПЦР фирмы ДНК-технология (Москва). При недостатке исходного исследуемого материала могут быть применены такие методы, позволяющие существенно увеличить содержание ДНК/кДНК в анализируемом образце, как полногеномная или полнотранскриптомная амплификация (как с обогащением полиаденилированными фрагментами, так и тотальная амплификация кДНК, пригодная для наработки исследуемого генетического материала вируса гриппа).

Также для проведения предварительной амплификации кДНК вируса гриппа (для проведения последующего анализа методом микрочипов) могут быть использованы специфичные к широкому спектру штаммов вируса гриппа праймеры, описанные в биомедицинской литературе [С.Н. Chang, K.L. Lin, Y. Chan, Y.L. Wang, Y.T. Chi, H.L. Tu, H.K. Shieh, W.T. Liu. 2006. Amplification of the entire genome of influenza A vims H1N1 and H3N2 subtypes by reverse-transcription polymerase chain reaction, J Virol Methods.136, 38-43].

Выбор праймеров, специфичных к определенному участку РНК вируса гриппа, содержащему характерные мутации, в общем случае представляется сложной задачей в связи с ярко выраженной вариабельностью его генома. В процессе выбора праймеров должна учитываться не только локализация характерных мутаций и нуклеотидных замен, отражающих вирулентные и патогенные характеристики штамма, но и расположение консервативных участков вируса - в этом случае диагностический охват штаммов вируса гриппа может быть максимальным.

В общем случае выбор праймеров для аллель-специфичной ПЦР должен отвечать критерию расположения нуклеотида, мутационный статус которого требуется определить, в 3'-концевой области одного из праймеров. В другом случае допускается расположение TaqMan или другой специфичной пробы (или зондов типа Molecular beacon) непосредственно в месте нахождения мутации.

В общем случае для выбора специфических праймеров и зондов (TaqMan, molecular beacon и др.) используют имеющиеся программы, многие из которых находятся в свободном доступе в Интернете. Среди таких программ можно упомянуть Oligo, PrimerSelect (www.dnastar.com). Primer Express (Applied Biosystems, (USA), Primer Designer (ИМБ РАН), FastPCR (http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm), PrimerQuest (http://scitools.idtdna.com/Primerquest/), Primer3 и др. Существуют известные веб-сервисы для подбора праймеров и проб; среди них можно упомянуть NCBI Primer BLAST, позволяющий автоматизированно подбирать праймеры с минимальной вероятностью неспецифичного связывания, как относительно других участков генома вируса, так и генома человека. С учетом сложности анализируемых фрагментов, длина праймеров может быть выбрана в диапазоне от 16 до 25 п.н.

Существуют разнообразные, хорошо известные специалистам подходы к химическому синтезу олигонуклеотидных праймеров, например фосфо-диэфирный метод, гидрофосфорильный метод и т.д., но наибольшее распространение в настоящее время имеет фосфорамидитный метод. Синтез праймеров осуществляют, используя автоматические ДНК/РНК синтезаторы, например производства фирмы Applied Biosy stems (США).

Определение мутационного статуса сегментов вируса гриппа, которые используются для расчета скоринг-факторов V и P и дальнейшей оценки степени вирулентности и патогенности данного штамма для человека, может быть осуществлено с помощью аллель-специфичной ПЦР.

Проведение аллель-специфичной ПЦР осуществляется следующим образом.

Различные протоколы оценки наличия мутаций методом аллель-специфичной ПЦР хорошо известны специалистам, в частности, такая ПЦР может быть проведена, как описано ранее [S. Tanaka, A. Taniue, N. Nagao, S. Ohnoki, H. Shibata, Y. Okubo, H. Yamaguchi. 1995. Simultaneous DNA typing of human platelet antigens 2, 3 and 4 by an ancle-specific PCR method, Vox Sang. 68, 225-230]. Для проведения исследования мутационного статуса нескольких нуклеотидных положений в одном эксперименте обычно используют мультиплексную ПЦР, как традиционную, так и ПЦР в реальном времени. В случае проведения традиционной ПЦР регистрацию мутаций в различных положениях генома вируса проводят путем измерения интенсивности ДНК-полос в геле после проведения электрофоретического разделения продуктов амплификации. Такие продукты - ампликоны - должны значительно различаться по длине для различных положений мутаций. В случае проведения мультиплексной ПЦР в реальном времени допускается два варианта расположения праймеров и проб: а) различным положениям мутаций соответствуют различные олигонуклеотидные пробы, и в случае наличия мутаций происходит совершенное связывание пробы с кДНК-матрицей, после чего может быть зарегистрирован соответствующий флуоресцентный сигнал; б) положения, для которых могут наблюдаться мутации, соответствуют 3'-концевым участкам праймеров (по аналогии с традиционной аллель-специфичной ПЦР), и только в случае присутствия мутаций будет происходить высокоэффективная амплификация продукта, его экспоненциальное нарастание с каждым циклом реакции При этом уровень регистрируемого флуоресцентного сигнала прямо пропорционален его концентрации. В этом случае могут быть использованы ДНК-интеркалирующие неспецифические пробы, например, SYBR Green, EVA Green [J. Evans, H. Segal. 2010. Novel multiplex allele-specific PCR assays for the detection of resistance to second-line drugs in Mycobacterium tuberculosis, J Antimicrob Chemother. 65, 897-900]. Предпочтительнее использовать методику проведения аллельспецифичной ПЦР по п.6). В этом случае используются несколько наборов праймеров, каждый из которых позволят избирательно амплифицировать последовательность определенной аллели с максимальной эффективностью. При этом достижение порогового уровня флуоресценции, значительно отличающегося от фонового уровня, первым происходит для набора праймеров, соответствующего анализируемой аллели, на так называемом пороговом цикле CT.

Для реализации данного экспериментального подхода к регистрации мутаций также существует ряд специализированных наборов; среди них можно отметить наборы AmpHFlash и AmpliFlash+(GenExpert, Москва), предполагающие применение высокоспецифичных флуоресцентных зондов Scorpions типа Molecular beacon. Таким образом, поскольку в настоящее время в клинической практике активно применяется не только традиционная ПЦР с последующим электрофоретическим разделением продуктов амплификации, но ПЦР в реальном времени, это дает дополнительные возможности для выхода в практику настоящего изобретения.

В результате проведения описанных выше операций способа может быть вычислены Mi,j - мутационные статусы аминокислотных положени в сегментах M1, M2, NS1, NS2, PA, PB1, PB2, NP и MHA - мутационный статус сегмента гемагглютинина. Это позволяет произвести расчет скоринг-фактора вирулентности

V = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 H i / j = 1 H i W i , j ) + W H A M H A i = 1 S H i + W H A

по величине которого судят о степени вирулентности вируса гриппа, и скоринг-фактора патогенности

P = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 ( j = 1 H i W i , j j = 1 H i W i , j M i , j + 1 ) H i / j = 1 H i W i , j ) W S + W H A M H A i = 1 S H i + W H A

по величине которого судят о степени патогенности вируса гриппа.

После вычисления скоринг-факторов Р и V решение о вирулентности и патогенности исследованных вирусов гриппа производится по следующим критериям:

Если значение скоринг-фактора Р меньше порогового значения 0.4, то принимается решение о присвоении незначительной степени патогенности для человека этого штамма - вероятнее всего, данный штамм относится к классу гриппа животных, не передающихся человеку. Если значения скоринг-фактора Р находится в интервале 0.4-0.8, то принимается решение о присвоении средней степени патогенности для человека этого штамма - вероятнее всего, представителей данного штамма можно отнести в группе вирусов сезонного гриппа, неопасных для человека. Если величина скоринг-фактора Р превосходит значение 1.0, то принимается решение о присвоении высокой степени патогенности данного штамма для человека - вероятнее всего, данный штамм можно классифицировать как пандемический, по всей видимости, возникший в результате мутаций в геноме вируса гриппа животных. Если величина скоринг-фактора Р находится в диапазоне 0.8-1.0, решение неоднозначно - данный штамм не может быть классифицирован как пандемический, однако его появление в популяции людей может привести к серьезным эпидемиям с относительно высокой степенью летальности при протекании заболевания.

Также может быть оценена степень вирулентности данного штамма для человека: если значение V превосходит величину 0.22, то вирусы данного штамма достаточно хорошо могут передаваться от человека к человеку. Если значение V меньше заявленной величины, то передача вируса от человека к человеку, а также от животного к человеку затруднена или невозможна.

Применение расчета скоринг-фактора Р для оценки степени потенциальной опасности вирусного штамма для человека позволяет воплотить концепцию комплексного подхода к анализу мутаций в геноме вируса и соответствующих аминокислотных замен в полипептидных цепях белков. Скоринг-фактор отражает в себе баланс между мутациями и заменами, характерными, как для вирусов обычного, человеческого гриппа, так и обычного гриппа различных животных. Невысокие значения скоринг-фактора Р наблюдаются для сезонных вирусов (аминокислотные остатки в соответствующих положениях характерны для вирусов, вирулентных сугубо для человека), максимальные - для пандемических вирусов, содержащих в себе характеристики, как вирусов человека, так и вирусов животного происхождения, нулевые и близкие к нулю - для вирусов гриппа животных, неспособных передаваться человеку.

Далее настоящее изобретение иллюстрируется конкретными примерами реализации операций способа.

Пример 1. Выделение РНК из исследуемых образцов РНК из мокроты человека выделяли с использованием набора реагентов RNeasy Mini Kit («Qiagen», Германия) согласно протоколу. Основные этапы включали: 1) разрушение вирусных оболочек и других, клеточных структур, с использованием микро-десмембратора («Sartorius», Германия) и гомогенизацию разрушенного образца в лизирующем буфере RLT в расчете 600 мкл на 30 мкг ткани. 2) центрифугирование 3 минуты при 14000 об/мин (4°С); 2) добавление равного объема водного 70% этилового спирта к супер-натанту; 3) нанесение на колонку; 4) промывание колонки после сорбции РНК один раз буфером RW1 объемом 700 мкл и дважды буфером RPE объемом 500 мкл; 5) элюцию РНК водой, свободной от РНКаз. Концентрацию РНК определяли на спектрофотометре «NanoDrop ND1000», («NanoDrop Technologies Inc.», США) при длине волны 260 нм. Качество выделенной РНК проверяли с помощью электрофореза в 1% агарозном геле, в присутствии бромистого эти-дия, а также на приборе Bioanalyser Agilent 2100 («Agilent Technologies», США).

Пример 2. Реакция обратной транскрипции

Для проведения реакции обратной транскрипции брали по 1 мкг РНК, полученной вышеописанным методом, предварительно обработанной не содержащей РНКаз ДНКазой I (Invitrogene), 100 нг гексануклеотидных праймеров, 1 мМ dNTP, 1x реакционный буфер («Fermentas», Литва), содержащий 250 мМ Tris-HCl (рН 8.3, 25°С), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT, и 200 единиц обратной транскриптазы M-MuLV («Fermentas», Литва). Реакцию проводили в объеме 20 мкл при следующем температурном режиме: 25°С - 10 мин, 42°С - 60 мин, 50°С - 10 мин, 70°С - 10 мин.

Пример 3. Аллель-специфичная ПЦР в реальном времени для выявления нуклеотидных и аминокислотных замен в сегментах вируса гриппа A/chicken/Moscow/2/2007(H5N1).

На первом этапе подбирались условия для ПЦР, осуществлена оценка результатов амплификации, проводимой при различных концентрациях праймеров и хлорида магния MgCl2. Наиболее значимых различий в пороговых циклах удалось добиться при следующих концентрациях компонентов: 4 мМ MgCl2, 300 нМ каждого из праймеров (прямого и обратного для каждой реакции), 5 нг кДНК, полученной из вируса гриппа штамма A/chicken/Moscow/2/2007(H5N1), 1× Power SYBR Green PCR Master Mix (Applied Biosystems). Такой состав реакционной смеси был принят для проведения аллельного анализа сегментов вируса гриппа. Общий объем реакционной смеси 25 мкл. Термические условия ПЦР были следующими: начальная денатурация и активация фермента при 95°С - 10 мин; далее следовали 45 циклов амплификации: денатурация при 95°С - 5 сек, отжиг праймеров и полимеризация при 62°C - 60 сек. Каждую реакцию проводили в двойной реплике. Для количественных измерений использовали прибор ABI PRISM 7000 Sequence Detection System, Applied Biosystems, США. Были использованы наборы праймеров для 4 различных наиболее распространенных аллелей анализируемого участка сегмента РА, которому соответствует положение 225 по-липептидной цепи. Программное обеспечение Applied Biosystems использовали в режиме аллельной дискриминации.

Нуклеотидные последовательности прямых и обратных праймеров, использованных для дискриминации аллелей вируса гриппа, представлены в таблице 5.

Таблица 5
Последовательности праймеров и проб, используемых для аллельной дискриминации участков сегментов гриппа.
№ набора Тип Последовательность SEQ ID NO: Tm, °C Длина Длина ампликона
1 PA, аллель 1 (отмечена у 1171 штамма), соответствует а. о. цистеина (С) в положении 225, в случае присутствия данной аллели соответствующий коэфф. Mi,j=1
прямой CTCCCACCGAACTTCTCCT 1 58.3 19 69
обратный GCAGCCGTTCGGTTCG 2 58.0 16
2 РА, аллель 2 (отмечена у 6825 штаммов), соответствует а.о. серина (S) в положении 225, в случае присутствия данной аллели соответствующий коэфф. Mi,j=0
прямой CTCCCACCGAACTTCTCCA 3 58.3 19 69
обратный CCGTTCGGTTCGAATCCAT 4 58.0 19
3 PA, аллель 3 (отмечена у 1046 штаммов), соответствует а.о. цистеина (С) в положении 225, в случае присутствия данной аллели соответствующий коэфф. Mi,j=1
прямой CCCGCCGAACTTCTCCT 5 60.1 17 63
обратный CCGTTCGGTTCGAATCCAT 4 59.3 19
4 PB2, аллель 1 (отмечена у 3082 штаммов), соответствует а.о. аланина/треонина (A/T) в положении 588, в случае присутствия данной аллели соответствующий коэфф. Mi,j=0
прямой CAGTCTCTTGTCCCTAAGGCAAC 6 58.3 23 97
обратный CAGTGTCAAATGTCCCAAGCA 7 58.1 21
5 PB2, аллель 2 (отмечена у 1162 штаммов), соответствует а.о. изолейцина (I) в положении 588, в случае присутствия данной аллели соответствующий коэфф. Mi,j=1
прямой AATCTTTAGTCCCCAAGGCCAT 8 59.2 22 94
обратный GTGTCAAATGTCCCAAGTACGTCT 9 58.4 24
6 PB2, аллель 3 (отмечена у 819 штаммов), соответствует а.о. изолейцина (I) в положении 588, в случае присутствия данной аллели соответствующий коэфф. Mi,j=1
прямой TTCAATCTTTAGTTCCTAAGGCCAT 10 58.2 25 89
обратный TGTCCCAAGTACATCTCTCATTTGT 11 58.1 25
7 PB2, аллель 4 (отмечена у 641 штамма), соответствует а.о. аланина/треонина (A/T) в положении 588, в случае присутствия данной аллели соответствующий коэфф. Mi,j=0
прямой CAATCCTTGGTACCTAAAGCTGC 12 58.4 23 93
обратный ATCAAATGTCCCCAGTACGTCA 13 58.0 22

Согласно данным ПЦР в реальном времени, полученным с помощью программного обеспечения Applied Biosystems, значения CT, порогового цикла, на котором достигнут пороговый уровень флуоресценции, в случае использования реакционной смеси, в которую входят праймеры набора 2, было на 4.9±0.3 цикла меньше, чем для реакционной смеси, в которую входят праймеры из набора 1 и на 3.5±0.4 меньше, чем для смеси с праймерами набора 3. Таким образом, отсюда можно сделать вывод о том, что в положении 225 полипептидной цепи субъединицы полимеразы РА вируса гриппа штамма A/chicken/Moscow/2/2007(H5N1) находится остаток серина (S), что в соответствии с данными таблицы 1 позволяет рассматривать эту аминокислотную замену как характерную для вирусов сугубо животного гриппа. Таким образом, коэффициент Mi,j для этого положения равен нулю.

Для другого сегмента, РВ2, пороговый уровень флуоресценции был достигнут быстрее всего при использовании набора праймеров 7 - значение CT было на 6.2±0.2 циклов меньше ранее, чем для набора 4, на 5.8±0.5 цикла - для набора 6, в то время как при использовании набора 5 значение CT было на 7.4±0.4 цикла выше. Таким образом, коэффициент Mi,j для положения 588 полипептидной цепи PB2 также равен нулю.

Пример 4. Расчет скоринг-факторов вирулентности и патогенности для ряда штаммов пандемического, сезонного гриппа, а также гриппа животных.

В соответствии с указанными выше формулами был проведен расчет скоринг-факторов P, V исходя из данных о нуклеотидной последовательности цепей различных сегментов. Данные о нуклеотидных последовательностях сегментов получены с сервера NCBI [http://www.ncbi.nlm.nih.gov/nuccore]. Проведена виртуальная трансляция кодирующих областей сегментов M1, M2, NS1, NS2, NP, PA, PB1, PB2, HA. Результаты расчета скоринг-факторов в соответствии с заявляемыми формулами показаны ниже.

Штаммы пандемических вирусов:

1. Influenza A virus (A/USSR/90/1977(H1N1)), Р=2.58, V=7.75

2. Influenza A virus (A/USSR/46/1979(H1N1)) P=2.77, V=7.16

3. Influenza A virus (A/Hong Kong/I-9-MA21-1/1968(H3N2)), P=2.19, V=7.57

4. Influenza A virus (A/Albany/6/1970(H3N2)), P=2.19, V=7.57

5. Influenza A virus (A/Leningrad/134/17/1957(H2N2)), P=2.10, V=7.02

6. Influenza A virus (A/Hong Kong/483/1997(H5N1)), P=1.20, V=1.00

Штаммы вирусов сезонного гриппа:

1. Influenza A virus (A/Moscow/IIV01/2009(H1N1)), P=0.46, V=0.24

2. Influenza A virus (A/Moscow/WR1866N/2009(H1N1)), P=0.46, V=0.25

3. Influenza A virus (A/Moscow/IIV-33/2010(H1N1)), P=0.47, V=0.24

4. Influenza A virus (A/Moscow/IIV-83/2011(H1N1)), P=0.45, V=0.24

5. Influenza A virus (A/Moscow/WRAIR4316T/2011(H1N1)), P=0.46, V=0.24

5. Influenza A virus (A/New York/345/2001(HlNl)), P=0.57, V=3.45

6. Influenza A virus (A/Ekaterinburg/01/2009(HlNl)), P=0.55, V=0.37

7. Influenza A virus (A/Paris/2709/2009(H1N1)), P=0.47, V=0.25

8. Influenza A virus (A/Beijing/080302/2009(H3N2)), P=0.71, V=4.3

Штаммы вирусов гриппа животных:

1. Influenza A virus (A/equine/Califomia/103/1982(H3N8)), P=0.33, V=0.17

2. Influenza A virus (A/chicken/India/IVRI-0004/2010(H9N2)), P=0.10, V=0.04

3. Influenza A virus (A/avian/Japan/8KI0040/2008(H3N5)), P=0.35, V=0.18

4. Influenza A virus (A/equme/Jilin/l/1989(H3N8)), P=0.00, V=0.00

5. Influenza A virus (A/swine/Italy/526/1985(H3N2)), P=0.06, V=0.03

6. Influenza A virus (A/swine/Italy/671/1987(H1N1)), P=0.34, V=0.14

7. Influenza A virus (A/duck/France/080032/2008(H5N2)), P=0.35, V=0.17

8. Influenza A virus (A/duck/France/06436/2006(H5N3)), P=0.33, V=0.18

Как видно из полученных результатов, степени патогенности, определяемые по величине скоринг-фактора Р, соответствуют действительным, в то время как оценка вирулентности по величине V позволяет сделать правильные выводы о том, может ли вирус данного штамма передаваться от животного к человеку.

Таким образом, благодаря усовершенствованию известного способа достигается требуемый результат, поскольку введение новых операций способа, в частности анализа нуклеотидной последовательности полученной кДНК и определении на этой основе мутационного статуса характерных положений в сегментах вируса гриппа, позволяет количественно определить степень вирулентности и патогенности вирусов гриппа.

Способ определения вирулентных и патогенных форм вирусов гриппа, основанный на получении исходного образца ткани/физиологической жидкости от пациентов, предположительно больных гриппом, выделении и очистке препаратов РНК из исходного образца ткани/физиологической жидкости, дальнейшем синтезе кДНК, отличающийся тем, что дополнительно проводят анализ нуклеотидной последовательности полученной кДНК с целью определения мутационного статуса характерных положений в сегментах вируса гриппа, на основании чего определяют скоринг-фактор вирулентности
V = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 H i / j = 1 H i W i , j ) + W H A M H A i = 1 S H i + W H A ,
по величине которого судят о степени вирулентности вируса гриппа, и скоринг-фактора патогенности
P = i = 1 S ( ( j = 1 H i W i , j M i , j ) 2 ( j = 1 H i W i , j j = 1 H i W i , j M i , j + 1 ) H i / j = 1 H i W i , j ) W S + W H A M H A i = 1 S H i + W H A , , по величине которого судят о степени патогенности вируса гриппа,
где Mi,j - мутационный статус для аминокислотного положения номер j в полипептидной цепи, синтезируемой по сегменту номер i (значение Mi,j равно единице в случае, если аминокислотный остаток в данном положении характерен для вирусов, вирулентных сугубо для человека, равно нулю - для животных, равен 0,5, если такая классификация не может быть произведена в соответствии с заявленными условиями);
MHA - мутационный статус гемагглютинина (равен единице в случае, если сегмент гемагглютинина может быть отнесен к классу человеческих, и нулю - к классу нечеловеческих, равен 0,5, если такая классификация не может быть произведена в соответствии с заявленными условиями);
Wi,j - вес, относительная значимость аминокислотной замены в положении j полипептидной цепи, синтезируемой по сегменту i, определяющей вирулентный генотип вируса для человека;
WS - общая относительная значимость аминокислотных замен в полипептидной цепях сегментов M1, М2, NS1, NS2, PA, PB1, РВ2, NP;
WHA - вес, относительная значимость аминокислотных замен в полипептидной цепи гемагглютинина;
S - количество анализируемых сегментов/полипептидных цепей;
Hi - количество анализируемых положений аминокислотных замен в полипептидной цепи, синтезируемой по сегменту i,
при этом, если значение скоринг-фактора вирулентности V превосходит величину 0,22, то принимается решение о том, что вирусы данного штамма достаточно хорошо могут передаваться от человека к человеку, если значение V меньше заявленной величины 0,22, то принимается решение о том, что передача вируса данного штамма от человека к человеку, а также от животного к человеку затруднена или невозможна, если значение скоринг-фактора патогенности Р меньше порогового значения 0,4, то принимается решение о присвоении незначительной степени патогенности для человека этого штамма, если значения скоринг-фактора патогенности P находится в интервале 0,4-0,8, то принимается решение о присвоении средней степени патогенности для человека этого штамма, если величина скоринг-фактора патогенности P превосходит значение 1,0, то принимается решение о присвоении высокой степени патогенности данного штамма для человека, если величина скоринг-фактора патогенности P находится в диапазоне 0,8-1,0, то решение неоднозначно - данный штамм не может быть классифицирован как пандемический, однако его появление в популяции людей может привести к серьезным эпидемиям с относительно высокой степенью летальности при протекании заболевания.



 

Похожие патенты:

Изобретение относится к области молекулярной биологии и вирусологии. .

Изобретение относится к области биотехнологии, молекулярной биологии, медицины и ветеринарии. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.

Изобретение относится к областям молекулярной биологии, вирусологии, иммунологии и медицины. .

Изобретение относится к области вирусологии и биотехнологии. .

Изобретение относится к области биотехнологии, а именно к противовирусным средствам на основе ген-направленных каталитически активных нуклеиновых кислот. .

Изобретение относится к области химии и медицины и касается новых соединений, являющихся производными N-замещенного 1,4-диазабицикло[2.2.2.]октана. .

Изобретение относится к области ветеринарии и касается мутантного вируса бычьей диареи. .

Изобретение относится к области молекулярной биологии, генной инженерии и вирусологии. Предложен способ получения препарата, содержащего вирусные антигены, включающий а) инокуляцию клеток инфекционным вирусом в жидкости, b) репродукцию указанного вируса в указанных клетках, с) сбор указанного репродуцированного вируса, d) инактивацию указанного собранного вируса, и е) обработку указанного инактивированного вируса детергентом, приводящий к получению препарата, содержащего вирусные антигены. Способ может быть использован в медицине и фармакологии при получении вакцин. 3 н. и 18 з.п. ф-лы, 1 ил., 2 табл., 3 пр.

Изобретение относится к области молекулярной биологии, биоорганической химии и медицины. Заявляемые нанокомпозиты предназначены для направленного воздействия на генетический материал внутри клетки и подавления его дальнейшего функционирования. Нанокомпозиты, состоящие из наночастиц диоксида титана в аморфной или кристаллической (анатаз, брукит) форме, иммобилизованных полилизиновых производных олигонуклеотидов (PL-oligo) и фотоактивируемых арилазидных групп, введенных по аминогруппам полилизина. Все компоненты нанокомпозита выполняют определенную функцию: ТiO2-наночастицы способствуют трансфекции клеток; полилизин способствует иммобилизации олигонуклеотида на поверхность наночастиц и вносит функциональные группы (NH2), позволяющие вводить дополнительные реакционноснособные группы; олигонуклеотиды определенной последовательности направляют композит к целевым участкам вирусной РНК; фогоактивируемая перфторарилазидная группа после облучения светом способна разрушать нуклеиновые кислоты. 3 н. и 6 з.п. ф-лы, 3 ил., 15 пр.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен рекомбинантный вирус классической чумы свиней (1111), содержащий делецию по меньшей мере одной аминокислоты в домене «TAVSPTTLR» белка Е2, соответствующем положениям 829-837 родительского полипротеина CSFV, а также соответствующая вакцина, молекула кДНК, способ защиты животного от CSFV и способ дифференциации инфицированных CSFV животных. Изобретение может быть использовано для вакцинации животных от чумы свиней.5 н. и 12 з.п. ф-лы, 10 ил., 2 табл., 2 пр.
Настоящее изобретение относится к области биотехнологии и вирусологии. Описан химерный пестивирус, где указанный химерный пестивирус включает вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок. При этом указанный химерный пестивирус экспрессирует гетерологичный Erns белок, происходящий из другого пестивируса, или природный, синтетический или генетический вариант указанного гетерологичного Erns белка. Также описаны способы и наборы для лечения или предупреждения распространения инфекции, вызванной вирусом диареи крупного рогатого скота, а также способы и наборы для дифференцировки между вакцинированными животными и животными, инфицированными вирусом дикого типа. Изобретение может быть использовано в качестве иммуногенных композиций и вакцин в животноводстве. 12 н. и 1 з.п. ф-лы, 4 табл., 5 пр.

Группа изобретений относится к области вирусных вакцин для защиты собак от инфицирования парвовирусом, их получению и применению. Более конкретно, изобретение относится к аттенуированному рекомбинантному парвовирусу, который содержит последовательность ДНК из аттенуированного первого парвовируса типа 2, причем ДНК, кодирующая капсидный белок первого парвовируса, замещена на капсидный белок парвовируса типа 2с. Вакцина на основе указанного выше вируса способна индуцировать более высокие титры защитных антител от угрозы инфицирования парвовирусом типа 2с, в то же время, сохраняя хороший иммунитет против парвовируса типа 2. Штаммы рекомбинантного вируса также оставались аттенуированными. 4 н. и 2 з.п. ф-лы, 4 ил., 4 пр.

Изобретение относится к области химии и ветеринарной вирусологии и направлено на расширение арсенала противовирусных средств для нужд ветеринарии и получение поликатионного соединения, позволяющего справляться с большим спектром инфекционных заболеваний, в основе которых лежат РНК-вирусы. Указанный технический результат достигается в производном 1,4-диазабицикло[2.2.2]октана со структурной формулой Данный технический результат достигается в способе синтеза производного 1,5-бис-(4-тетрадецил-1,4-диазониабицикло[2.2.2]октан-1-ил)пентан тетрабромида (C47H100Br4N4), в котором бромид 1-тетрадецил-4-аза-1-азониабицикло[2.2.2]октана растворяют при нагревании до температуры 55°С в метаноле, к полученному раствору, в процессе перемешивания, добавляют двумя порциями 1,5-дибромпентан до получения реакционной смеси, которую затем перемешивают и охлаждают до температуры 18-22°C, после чего к указанной смеси добавляют 20 мл ацетонитрила с последующим отделением выпавшего осадка от маточного раствора, при этом выпавший осадок отфильтровывают и высушивают в вакууме, а полученный маточный раствор упаривают до получения вязкого сиропообразного остатка, к которому добавляют 40 мл ацетонитрила и перемешивают при кипении с обратным холодильником до получения суспензии, которую затем охлаждают до температуры 18-22°C и отфильтровывают образовавшийся осадок с последующим его высушиванием в вакууме и объединением с полученным ранее осадком для получения продукта. 2 н. и 5 з.п. ф-лы, 1 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии и вирусологии. Предложен новый рекомбинантный полипептид вируса гриппа, представляющий собой гемагглютинин. Описанный полипептид может быть использован для получения новых рекомбинантных реассортантных штаммов вируса гриппа. Также описаны рекомбинантная нуклеиновая кислота, кодирующая такой полипептид, способ получения реассортантных вирусов гриппа, реассортантный вирус гриппа и композиции, содержащие такой вирус. Изобретение может быть использовано в медицине. 7 н. и 9 з.п. ф-лы, 9 ил., 9 табл.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Раскрыта конструкция, которая, при экспрессии в клетке-хозяине, является способной продуцировать пустые вирусные капсиды. Конструкция включает нуклеотидную последовательность, кодирующую капсидный белок-предшественник; нуклеотидную последовательность, кодирующую протеиназу, способную расщеплять капсидный белок-предшественник; и контрольный элемент, который контролирует экспрессию протеиназы. При этом контроль осуществляется таким образом, что когда конструкция присутствует в клетке-хозяине, контрольный элемент вызывает экспрессию протеиназы на уровне, достаточном для расщепления капсидного белка-предшественника, но не достаточном для индукции значительной токсичности в клетке-хозяине. Также описаны вектор и клетка-хозяин, включающие указанную конструкцию, и их применение для генерации пустых вирусных капсидов. 8 н. и 11 з.п. ф-лы, 12 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Описан вирусный самоинактивирующийся (SIN) вектор на основе вируса саркомы и лейкоза птиц (ASLV) и расщепляющая-пакующая система. Система содержит помимо SIN-вектора первую хелперную плазмиду, предназначенную для экспрессии слитого вирусного белка gag-pol, и вторую хелперную плазмиду, предназначенную для экспрессии оболочечного белка (env) ретровируса. Первая и вторая хелперная плазмиды, содержащиеся в пакующей клеточной линии или применяемые для ее кратковременной трансфекции, служат для создания нереплицирующихся (RCR-некомпетентных) вирусных частиц. Вирусные частицы содержат РНК, содержащую на 3'-конце SIN-LTR, предлагаемый в изобретении, где РНК может иметь терапевтически эффективный сегмент, который, например, представляет собой трансген. Для этого в 3'-SIN-LTR предусмотрена обширная делеция U3-области, которая в процессе обратной транскрипции копируется в 5' LTR. Кроме того, из SIN-вектора удалены все кодирующие области ASLV, а также ретровирусные донорные сайты сплайсинга. Изобретение может быть использовано в генной терапии. 6 н. и 18 з.п. ф-лы, 15 ил., 2 табл., 4 пр.

Представленная группа изобретений касается вирусоподобной частицы и способов ее использования и получения. Предложенная вирусоподобная частица, по существу, не содержащая нуклеиновую кислоту вируса, сформирована из слитого белка, включающего белок оболочки растительного вируса и белок-мишень. Белок-мишень получен из полипептида клеточной поверхности внутриклеточного патогена, а белок оболочки растительного вируса выбирают из группы вируса мозаики люцерны, вируса мозаики сорго алеппского и Y-вируса картофеля. Иммуногенные составы, содержащие такие вирусоподобные частицы, могут быть введены в организмы пациентов для стимулирования защитных иммунных реакций. Способ создания вирусоподобных частиц включает операцию экспрессирования слитого белка в клетке-хозяине в условиях, которые обеспечивают возможность сборки вирусоподобной частицы из указанного слитого белка. Охарактеризованные изобретения позволяют воспроизводить желательную антигенную детерминанту или чужеродный пептид на поверхности вирусоподобной частицы, не содержащей нуклеиновую кислоту, для иммунизации. 6 н. и 18 з.п. ф-лы, 13 ил., 3 табл., 9 пр.
Наверх