Вирус диареи крупного рогатого скота с модифицированным белком erns


 


Владельцы патента RU 2524426:

Пфайзер Инк. (US)

Настоящее изобретение относится к области биотехнологии и вирусологии. Описан химерный пестивирус, где указанный химерный пестивирус включает вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок. При этом указанный химерный пестивирус экспрессирует гетерологичный Erns белок, происходящий из другого пестивируса, или природный, синтетический или генетический вариант указанного гетерологичного Erns белка. Также описаны способы и наборы для лечения или предупреждения распространения инфекции, вызванной вирусом диареи крупного рогатого скота, а также способы и наборы для дифференцировки между вакцинированными животными и животными, инфицированными вирусом дикого типа. Изобретение может быть использовано в качестве иммуногенных композиций и вакцин в животноводстве. 12 н. и 1 з.п. ф-лы, 4 табл., 5 пр.

 

Настоящее изобретение относится к новым химерным пестивирусам и к их применению в иммуногенных композициях и вакцинах. Оно также относится к способам и наборам для лечения или предупреждения распространения инфекции вирусом диареи крупного рогатого скота. Настоящее изобретение дополнительно относится к применению химерных пестивирусов в способах и наборах для дифференцировки между вакцинированными животными и животными, инфицированными вирусом дикого типа.

Предшествующий уровень техники

Пестивирусы, включая вирус диареи крупного рогатого скота (вирус BVD или BVDV), были выделены из нескольких видов животных, как домашних, так и диких. Идентифицированные хозяева BVDV включают буйвола, антилопу, северного оленя и разные виды оленя, в то время как уникальные виды пестивируса были идентифицированы у жирафов и вилорогой антилопы. BVDV представляет собой небольшой РНК-вирус из семейства Flaviviridae. Он является близкородственным в отношении других пестивирусов, которые являются возбудителями пограничной болезни у овец и классической свиной лихорадки у свиней. Недавно в качестве возбудителя фетальной инфекции поросят в Австралии был идентифицирован дивергентный пестивирус, названный пестивирус Бунгованна (Bungowannah).

Заболевание, вызванное BVDV, в частности, у крупного рогатого скота, является широко распространенным и может быть экономически разрушительным. Инфекция BVDV у крупного рогатого скота может приводить к проблемам при размножении и может вызывать выкидыши или преждевременные роды. BVDV способен проходить через плаценту беременных самок крупного рогатого скота и может приводить к рождению хронически инфицированных (PI) телят, которые являются иммунотолерантными в отношении данного вируса и устойчиво виремическими в течение остальной части их жизни. Инфицированный крупный рогатый скот также может проявлять «вирусную диарею», характеризующуюся повышенной температурой, диареей, кашлем и образованием язв на слизистой оболочке пищеварительной системы. Эти хронически инфицированные животные служат источником распространения вируса в стаде для последующих вспышек вирусной диареи и сильно предрасположены к инфекции микроорганизмами, ответственными за возникновение кишечных заболеваний или пневмонии.

BVDV классифицируют на один из двух биотипов. Вирусы биотипа «ср» индуцируют цитопатическое действие на культивируемые клетки, тогда как вирусы нецитопатического или «ncp» биотипа не индуцируют такое действие. Кроме того, распознают два главных генотипа (тип 1 и 2), оба из которых, как было показано, вызывают ряд клинических синдромов.

Вирионы BVDV имеют диаметр от 40 до 60 нм. Нуклеокапсид BVDV состоит из одной молекулы РНК и белка капсида С. Данный нуклеокапсид окружен липидной мембраной с двумя гликопротеинами, Е1 и Е2, заякоренными в ней. Третий гликопротеин, Erns, является слабо ассоциированным с данной оболочкой. Геном BVDV имеет длину приблизительно 12,5 тысяч пар оснований и содержит одну открытую рамку считывания, расположенную между 5' и 3' нетранслируемыми областями (NTR). Полипротеин приблизительно 438 кДа транслируется с этой открытой рамки считывания и подвергается процессингу клеточными и вирусными протеазами по меньшей мере на одиннадцать структурных и неструктурных (NS) вирусных белков (Tautz, et al., J. Virol. 71:5415-5422 (1997); Xu, et al., J. Virol. 71:5312-5322 (1997); Elbers, et al., J. Virol. 70:4131-4135 (1996); и Wiskerchen, et al., Virology 184:341-350 (1991)). Порядок генома BVDV представляет собой p20/Npro, р14/С, gp48/Erns, gp25/Е1, gp53/Е2, p54/NS2, p80/NS3, p10/NS4A, p32/NS4B, p58/NS5A и p75/NS5B. Три белка оболочки, gp48/Erns, gp25/Е1 и gp53/Е2, являются сильно гликозилированными. Ernz (ранее названный Е0 или gp48) образует гомодимеры, ковалентно связанные дисульфидами. Отсутствие гидрофобной мембранной якорной области свидетельствует о том, что Erns является слабоассоциированным с данной оболочкой. Erns индуцирует высокие титры антител у инфицированного крупного рогатого скота, но антисыворотка имеет ограниченную активность, нейтрализующую вирус.

Среди доступных в настоящее время вакцин против BVDV имеются вакцины, которые содержат химически инактивированный вирус дикого типа. Эти вакцины обычно требуют введения множества доз и приводят к кратковременному иммунному ответу; они также не защищают против переноса вируса плоду. Сообщали о субъединичной вакцине на основе очищенного белка Е2 у овец. Несмотря на то, что эта вакцина, по-видимому, защищает плоды от инфицирования, защита ограничена только гомологичным штаммом вируса и нет корреляции между титрами антител и защитой.

Модифицированные живые (ML) вакцины против BVDV продуцировали с использованием вируса, который был аттенуирован повторными пассированиями в клетках животных, являющихся представителями крупного рогатого скота или свиней, или посредством химически индуцированных мутаций, которые придают данному вирусу чувствительный к температуре фенотип. Оказалось, что одной дозы вакцины на основе MLV BVDV достаточно для обеспечения защиты от инфекции, и длительность иммунитета у вакцинированного крупного рогатого скота может сохраняться годами. Кроме того, сообщали о перекрестной защите при использовании вакцин на основе MLV (Martin, et al., In "Proceedings of the Conference of Research Workers in Animal Diseases", 75:183 (1994)). Однако существующие вакцины на основе MLV не обеспечивают возможность дифференцировки вакцинированных животных от животных, инфицированных естественным путем.

Таким образом, очевидно, что существует потребность в новых вакцинах для контролирования распространения BVDV. Такая вакцина(ы) может оказаться бесценной в будущих национальных или региональных программах по искоренению BVDV и также может быть объединена с другими вакцинами крупного рогатого скота, представляя существенное достижение в данной промышленности. Более эффективной вакциной для контролирования и мониторинга распространения BVDV является «маркерная» вакцина. Такая вакцина может либо содержать дополнительную антигенную детерминанту, которая не присутствует в вирусе дикого типа, либо не иметь антигенную детерминанту, которая присутствует в вирусе дикого типа. В отношении первой, у вакцинированных животных устанавливается иммунный ответ к «маркерной» иммуногенной детерминанте, тогда как у невакцинированных животных он не устанавливается. Используя иммунологический анализ, направленный против маркерной детерминанты, вакцинированных животных можно отличить от невакцинированных животных, инфицированных естественным образом, по присутствию антител к этой маркерной детерминанте. В случае последней стратегии, у животных, инфицированных вирусом дикого типа, устанавливается иммунный ответ к маркерной детерминанте, тогда как у неинфицированных вакцинированных животных не устанавливается в результате того, что данная детерминанта не присутствует в маркированной вакцине. Используя иммунологический анализ, направленный против маркерной детерминанты, инфицированных животных можно отличить от вакцинированных неинфицированных животных. В обоих случаях посредством отбраковки инфицированных животных стадо с течением времени может освободиться от BVDV. Помимо пользы устранения угрозы заболевания BVDV, сертификация стада как не содержащего BVDV имеет непосредственную экономическую пользу свободы торговли.

Краткое изложение сущности изобретения

В одном воплощении согласно настоящему изобретению предложен химерный пестивирус, где указанный химерный пестивирус включает вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок, и где указанный химерный пестивирус экспрессирует гетерологичный Erns белок, происходящий из другого пестивируса, или природный; синтетический или генетический вариант указанного гетерологичного Erns белка.

В другом воплощении согласно настоящему изобретению предложен химерный пестивирус, как он описан выше, где гетерологичный Erns белок указанного химерного пестивируса или природный, синтетический или генетический вариант указанного гетерологичного Erns белка происходят из пестивируса, выбранного из группы, состоящей из пестивируса северного оленя, пестивируса жирафа и пестивируса вилорогой антилопы.

В другом воплощении согласно настоящему изобретению предложен химерный пестивирус, как он описан выше, где гетерологичный Erns белок указанного химерного пестивируса имеет по меньшей мере один Erns эпитоп, который не присутствует в вирусе диареи крупного рогатого скота дикого типа.

В отдельном воплощении согласно настоящему изобретению предложен химерный пестивирус, как он описан выше, где в гетерологичном Erns белке указанного химерного пестивируса отсутствует по меньшей мере один Erns эпитоп, который присутствует в вирусе диареи крупного рогатого скота дикого типа.

В одном воплощении согласно настоящему изобретению предложена культура химерного пестивируса, как он описан выше.

В другом воплощении согласно настоящему изобретению предложена линия клеток или клетка-хозяин, содержащие химерный пестивирус, как он описан выше.

В еще одном воплощении согласно настоящему изобретению предложена молекула полинуклеотида, кодирующая химерный пестивирус, как он описан выше.

В другом воплощении согласно настоящему изобретению предложена иммуногенная композиция, содержащая данный химерный пестивирус, как он описан выше, и ветеринарно приемлемый носитель.

В отдельном воплощении согласно настоящему изобретению предложена иммуногенная композиция, как она описана выше, где ветеринарно приемлемый носитель представляет собой адъювант.

В еще одном воплощении согласно настоящему изобретению предложена иммуногенная композиция, как она описана выше, где указанный химерный вирус является живым аттенуированным.

В еще одном воплощении согласно настоящему изобретению предложена иммуногенная композиция, как она описана выше, где указанный химерный пестивирус является инактивированным.

В другом воплощении согласно настоящему изобретению предложена иммуногенная композиция, как она описана выше, дополнительно содержащая один или более чем один дополнительный антиген, полезный для лечения или предупреждения распространения одного или более чем одного дополнительного патогенного микроорганизма у животного.

В отдельном воплощении согласно настоящему изобретению предложена иммуногенная композиция, содержащая молекулу полинуклеотида, кодирующую химерный пестивирус, как он описан выше, и ветеринарно приемлемый носитель.

В одном воплощении согласно настоящему изобретению предложена вакцина, содержащая химерный пестивирус, как он описан выше, и ветеринарно приемлемый носитель.

В другом воплощении согласно настоящему изобретению предложена вакцина, как она описана выше, где ветеринарно приемлемый носитель представляет собой адъювант.

В другом воплощении согласно настоящему изобретению предложена вакцина, как она описана выше, где указанный химерный пестивирус является живым аттенуированным.

В еще одном воплощении согласно настоящему изобретению предложена вакцина, как она описана выше, где указанный химерный пестивирус является инактивированным.

В еще одном воплощении согласно настоящему изобретению предложена вакцина, как она описана выше, дополнительно содержащая один или более чем один дополнительный антиген, полезный для лечения или предупреждения распространения одного или более чем одного дополнительного патогенного микроорганизма у животного.

В отдельном воплощении согласно настоящему изобретению предложена вакцина, содержащая полинуклеотидную молекулу, кодирующую химерный пестивирус, как он описан выше, и ветеринарно приемлемый носитель.

В одном воплощении согласно настоящему изобретению предложен набор, содержащий в по меньшей мере одном контейнере вакцину, содержащую химерный пестивирус, как он описан выше.

В другом воплощении согласно настоящему изобретению предложен способ лечения или предупреждения распространения инфекции вирусом диареи крупного рогатого скота, где животному вводят вакцину, содержащую химерный пестивирус, как он описан выше.

В другом воплощении согласно настоящему изобретению предложен способ вакцинирования животного, где указанному животному вводят пестивирусную DIVA-вакцину (вакцину, разработанную с возможностью дифференцировки инфицированных животных от вакцинированных), и где указанная пестивирусная DIVA-вакцина содержит химерный пестивирус, как он описан выше, где дополнительно указанный химерный пестивирус имеет по меньшей мере один Erns эпитоп, который не присутствует в вирусе диареи крупного рогатого скота дикого типа.

В отдельном воплощении согласно настоящему изобретению предложен способ вакцинирования животного, где указанному животному вводят пестивирусную DIVA-вакцину, и где указанная DIVA-вакцина содержит химерный пестивирус, как он описан выше, где дополнительно в указанном химерном пестивирусе отсутствует по меньшей мере один Еrns эпитоп, который присутствует в вирусе диареи крупного рогатого скота дикого типа.

В еще одном воплощении согласно настоящему изобретению предложен способ дифференцировки между животным, вакцинированным вакциной, содержащей химерный пестивирус, как он описан выше, и животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, где животное, вакцинированное указанной вакциной, генерирует антитела к по меньшей мере одному Erns эпитопу, который присутствует в химерном пестивирусе указанной вакцины, но который не присутствует в вирусе диареи крупного рогатого скота дикого типа, включающий стадии:

а) получения образца сыворотки от животных;

б) проведения анализа указанных образцов на присутствие или отсутствие антител;

в) идентификации животного, имеющего указанные антитела, как вакцинированного указанной вакциной; и

г) идентификации животного, не имеющего указанные антитела, как инфицированного BVDV дикого типа.

В еще одном воплощении согласно настоящему изобретению предложен способ дифференцировки между животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, и животным, вакцинированным вакциной, содержащей химерный пестивирус, как он описан выше, где животное, инфицированное вирусом диареи крупного рогатого скота дикого типа, генерирует антитела к по меньшей мере одному Erns эпитопу, который присутствует в вирусе диареи крупного рогатого скота дикого типа, но который не присутствует в химерном пестивирусе указанной вакцины, включающий стадии:

а) получения образца сыворотки от животных;

б) проведения анализа указанных образцов на присутствие или отсутствие антител;

в) идентификации животного, имеющего указанные антитела, как инфицированного BVDV дикого типа; и

г) идентификации животного, не имеющего указанные антитела, как вакцинированного указанной вакциной.

В одном воплощении согласно настоящему изобретению предложен диагностический набор для дифференцировки между животным, вакцинированным вакциной, содержащей химерный пестивирус, как он описан выше, и животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, содержащий реагенты, способные к обнаружению антител к по меньшей мере одному Erns эпитопу, который присутствует в химерном пестивирусе данной вакцины, но который не присутствует в вирусе диареи крупного рогатого скота дикого типа.

В другом воплощении согласно настоящему изобретению предложен диагностический набор для дифференцировки между животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, и животным, вакцинированным вакциной, содержащей химерный пестивирус, как он описан выше, содержащий реагенты, способные к обнаружению антител к по меньшей мере одному Erns эпитопу, который присутствует в вирусе диареи крупного рогатого скота дикого типа, но который не присутствует в химерном пестивирусе данной вакцины.

В еще одном воплощении согласно настоящему изобретению предложено антитело, которое распознает эпитоп Erns, который присутствует в химерном пестивирусе, как он описан выше, но который не присутствует в вирусе диареи крупного рогатого скота дикого типа.

В другом воплощении согласно настоящему изобретению предложено антитело, которое распознает эпитоп, присутствующий в вирусе диареи крупного рогатого скота дикого типа, но который не присутствует в химерном пестивирусе, как он описан выше.

В другом воплощении химерный пестивирус, как он здесь описан, используют в изготовлении лекарственного средства для предупреждения или лечения инфекций, вызванных BVDV.

Подробное описание изобретения

Следующие определения можно применять в отношении терминов, используемых при описании воплощений данного изобретения. Следующими определениями заменяют любые противоречащие определения, содержащиеся в каждом отдельном источнике, включенном сюда посредством ссылки.

Если здесь не определено иначе, научные и технические термины, используемые в контексте настоящего изобретения, должны иметь значения, которые наиболее понятны обычным специалистам в данной области. Кроме того, если контекст не требует иного, термины в единственном числе должны включать множественное число, и термины во множественном числе должны включать единственное число.

Термин «аминокислота», как он использован здесь, относится к встречающимся в природе и синтетическим аминокислотам, а также к аналогам аминокислот и миметикам аминокислот, которые функционируют способом, аналогичным аминокислотам, встречающимся в природе. Встречающиеся в природе аминокислоты представляют собой аминокислоты, кодируемые генетическим кодом, а также те аминокислоты, которые позднее модифицируются, например гидроксипролин, карбоксиглутамат и O-фосфосерин. Стереоизомеры (например, D-аминокислоты) двадцати стандартных аминокислот, аминокислоты, не являющиеся природными, такие как a- и a-двухзамещенные аминокислоты, N-алкиламинокислоты, молочная кислота и другие нестандартные аминокислоты, также могут быть подходящими компонентами для полипептидов по настоящему изобретению. Примеры нестандартных аминокислот включают 4-гидроксипролин, γ-карбоксиглутамат, ε-N,N,N-триметиллизин, ε-N-ацетиллизин, O-фосфосерин, N-ацетилсерин, N-формилметионин, 3-метилгистидин, 5-гидроксилизин, σ-N-метиларгинин и другие подобные аминокислоты и иминокислоты.

Аналоги аминокислот относятся к соединениям, которые имеют ту же самую базовую химическую структуру, что и аминокислота, встречающаяся в природе, то есть углерод, который связан с водородом, карбоксильную группу, аминогруппу и группу R. Типичные аналоги аминокислот включают, например, гомосерин, норлейцин, метионинсульфоксид и метионин метилсульфония. Такие аналоги имеют модифицированные группы R (например, норлейцин) или модифицированные пептидные каркасы, но сохраняют ту же самую основную химическую структуру, что и аминокислота, встречающаяся в природе. Миметики аминокислот относятся к химическим соединениям, имеющим структуру, которая отличается от общей химической структуры аминокислоты, но которая функционирует аналогичным образом, что и аминокислота, встречающаяся в природе.

Аминокислоты могут здесь быть названы либо их общепринятыми трехбуквенными символами, либо однобуквенными символами, рекомендованными Комиссией по биохимической номенклатуре IUPAC-IUB (Международный союз теоретической и прикладной химии - Международный союз биохимии).

Подразумевается, что термин «животное», как он использован здесь, включает любое животное, которое является чувствительным к инфекциям BVDV, включая, но не ограничиваясь видами жвачных животных, овец, коз и свиней, как одомашненных, так и диких.

Термин «антитело» или «антитела», как он использован здесь, относится к молекуле иммуноглобулина, способной к связыванию с антигеном посредством распознавания эпитопа. Антитела могут быть поликлональной смесью или моноклональными. Антитела могут быть интактными иммуноглобулинами, происходящими из естественных источников или из рекомбинантных источников, или могут быть иммунореактивными частями интактных иммуноглобулинов. Антитела могут существовать в ряде форм, включая, например, такие как Fv, Fab', F(ab')2, а также в виде одиночных цепей.

Термин «антиген», как он использован здесь, относится к молекуле, которая содержит один или более чем один эпитоп (линейный, конформационный или оба), который при воздействии на субъекта будет индуцировать иммунный ответ, который является специфичным в отношении этого антигена. Термин «антиген» может относиться к аттенуированным, инактивированным или модифицированным живым бактериям, вирусам, грибам, паразитам или другим микробам. Термин «антиген», как он использован здесь, также может относиться к субъединичному антигену, который является отдельным и разобщен от целого организма, с которым данный антиген ассоциирован в природе. Термин «антиген» также может относиться к антителам, таким как антиидиотипические антитела или их фрагменты, и к мимеотопам синтетических пептидов, которые могут имитировать антиген или антигенную детерминанту (эпитоп). Термин «антиген» также может относиться к олигонуклеотиду или полинуклеотиду, который экспрессирует антиген или антигенную детерминанту in vivo, как, например, в подходах по иммунизации ДНК.

Термины «BVDV», «изоляты BVDV» или «штаммы BVDV», как они использованы здесь, относятся к вирусам диареи крупного рогатого скота, включая, но не ограничиваясь типом I и типом II, которые состоят из вирусного генома, ассоциированных белков и других химических компонентов (таких как липиды). Специалистам в данной области техники известен ряд вирусов диареи крупного рогатого скота типа I и типа II, и они доступны, например, в Американской коллекции типовых культур (АТТС®). Вирус диареи крупного рогатого скота имеет геном в форме РНК. РНК может подвергаться обратной транскрипции в ДНК для использования в клонировании. Таким образом, сделанные здесь ссылки на нуклеиновую кислоту и последовательности вируса диареи крупного рогатого скота, охватывают как последовательности вирусной РНК, так и последовательности ДНК, происходящие из последовательностей данной вирусной РНК.

Термины «линия клеток» или «клетка-хозяин», как они использованы здесь, означают прокариотическую или эукариотическую клетку, в которой вирус может реплицироваться и/или сохраняться.

Термин «химерный» или «химера», как он использован здесь, означает микроорганизм, например вирус, содержащий генетические или физические компоненты, происходящие из более чем одного предшественника.

Термин «культура», как он использован здесь, означает популяцию клеток или микроорганизмов, растущую в отсутствие других видов или типов.

Термин «DIVA», как он использован здесь, означает вакцину, которая способна дифференцировать инфицированных животных от вакцинированных.

«Эпитоп» представляет собой специфичный сайт антигена, который связывается с рецептором Т-клетки или со специфичным антителом и обычно содержит от примерно 3 аминокислотных остатков до примерно 20 аминокислотных остатков.

Термин «гетерологичный», как он использован здесь, означает происходящий из другого вида или штамма.

Термин «гомологичный», как он использован здесь, означает происходящий из того же самого вида или штамма.

Термин «иммуногенная композиция», как он использован здесь, означает композицию, которая генерирует иммунный ответ (то есть имеет иммуногенную активность), когда ее вводят животному саму по себе или с фармацевтически приемлемым носителем. Иммунный ответ может быть клеточным иммунным ответом, опосредованным главным образом цитотоксическими Т-клетками, или гуморальным иммунным ответом, опосредованным главным образом хелперными Т-клетками, которые, в свою очередь, активируют В-клетки, приводя к продуцированию антител.

Термин «патоген» или «патогенный микроорганизм», как он использован здесь, означает микроорганизм, например вирус, бактерию, гриб, простейшее или гельминт, который способен индуцировать или вызывать заболевание, болезнь или аномальное состояние у животного-хозяина.

Термин «пестивирус», как он использован здесь, означает РНК-вирус из рода Pestivirus семейства Flaviviridae. Пестивирусы включают, без ограничения, следующие: BVDV (тип 1 и тип 2), вирус классической чумы свиней (CSFV) и вирус пограничной болезни овец (BDV), а также пестивирусы, выделенные из таких видов как дикий кабан, буйвол, антилопа канна, бизон, альпака, олень пуду, бонго, разные виды оленей, жираф, северный олень, серна и вилорогая антилопа (Vilcekand Nettleton; Vet Microbiol. 116:1-12 (2006)).

Термин «полинуклеотидная молекула», как он использован здесь, означает органическую полимерную молекулу, состоящую из нуклеотидных мономеров, ковалентно связанных в цепь. ДНК (дезоксирибонуклеиновая кислота) и РНК (рибонуклеиновая кислота) являются примерами полинуклеотидов с различной биологической функцией.

Термины «предупреждать», «предупреждающий» или «предупреждение» и тому подобное, как они использованы здесь, означают ингибирование репликации микроорганизма, ингибирование передачи микроорганизма или ингибирование внедрения микроорганизма в хозяина. Эти термины и им подобные, как они использованы здесь, также могут означать ингибирование или блокирование одного или более чем одного признака или симптома инфекции.

Термин «терапевтически эффективное количество», как он использован здесь, означает количество микроорганизма, или субъединичного антигена, или полипептидов, или молекул полинуклеотидов и их комбинаций, которое является достаточным для индуцирования иммунного ответа у субъекта, которому его вводят. Иммунный ответ может включать, без ограничения, индукцию клеточного и/или гуморального иммунитета.

Термины «лечить», «лечащий» или «лечение» и тому подобное, как они использованы здесь, означают уменьшение или устранение инфекции микроорганизмом. Эти термины и им подобные, как они использованы здесь, также могут означать уменьшение репликации микроорганизма, уменьшение передачи микроорганизма или уменьшение способности микроорганизма к внедрению его в хозяина. Эти термины и им подобные, как они использованы здесь, также могут означать уменьшение, улучшение или устранение одного или более чем одного признака или симптома инфекции микроорганизмом или ускорение выздоровления от инфекции микроорганизмом.

Термины «вакцина» и «вакцинная композиция», как они использованы здесь, означают композицию, которая предупреждает или уменьшает инфекцию или которая предупреждает или ослабляет один или более чем один признак или симптом инфекции. Данные защитные эффекты вакцинной композиции против патогена обычно достигаются индуцированием у субъекта иммунного ответа, либо клеточно-опосредованного, либо гуморального иммунного ответа, либо комбинации их обоих. Говоря в общем, устранение или снижение распространения инфекции, уменьшение интенсивности признаков или симптомов или ускоренное устранение микроорганизма из инфицированных субъектов указывают на защитные эффекты вакцинной композиции. Вакцинные композиции по настоящему изобретению обеспечивают защитные эффекты против инфекций, вызванных BVDV.

Термин «вариант», как он использован здесь, относится к производному данной белковой и/или генной последовательности, где полученная последовательность по существу является той же, что и данная последовательность, не считая мутационных различий. Указанные различия могут быть встречающимися в природе или созданными синтетически либо генетически.

Термин «ветеринарно приемлемый носитель», как он использован здесь, относится к веществам, которые находятся в пределах объема надежной медицинской оценки, подходит для использования в контакте с тканями животных без нежелательной токсичности, раздражения, аллергической реакции и тому подобного, соответствует приемлемому отношению польза:риск и является эффективным для его намеченного применения.

Следующее описание приведено для того, чтобы помочь специалистам в данной области техники воплотить настоящее изобретение на практике. Тем не менее, данное описание не следует истолковывать как ограничивающее настоящее изобретение ненадлежащим образом, поскольку обычные специалисты в данной области могут сделать модификации и изменения в обсуждаемых здесь воплощениях без отступления от сущности или объема настоящего изобретения.

ВИРУСЫ. ИММУНОГЕННЫЕ КОМПОЗИЦИИ И ВАКЦИНЫ

Согласно настоящему изобретению предложены иммуногенные композиции и вакцины, содержащие один или более чем один химерный пестивирус, где указанные химерные пестивирусы включают вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок, но где указанный химерный пестивирус экспрессирует гетерологичный Erns белок, происходящий из другого пестивируса, или природный, синтетический или генетический вариант указанного гетерологичного Erns белка. Химерный пестивирус может быть выбран из группы, состоящей из химер BVDV/пестивирус северного оленя, BVDV/пестивирус жирафа и BVDV/пестивирус вилорогой антилопы, но не ограничен ими.

В одном воплощении химерный вирус на основе BVDV/пестивируса жирафа представляет собой штамм, депонированный как UC 25547 в Американскую коллекцию типовых культур (АТСС®), 10801 University Boulevard, Manassas, VA 20110-2209, США, которому присвоен номер депонирования в АТСС® РТА-9938. В одном воплощении химерный вирус на основе BVDV/пестивируса вилорогой антилопы представляет собой штамм, депонированный как UC 25548 в АТСС®, которому присвоен номер депонирования в АТСС® РТА-9939. В одном воплощении химерный вирус на основе BVDV/пестивируса северного оленя представляет собой штамм, депонированный как UC 25549 в АТСС®, которому присвоен номер депонирования АТСС® РТА-9940.

Химерные пестивирусы по настоящему изобретению можно размножать в клетках, линиях клеток и клетках-хозяевах. Указанные клетки, линии клеток или клетки-хозяева могут представлять собой, например, без ограничения, клетки млекопитающих и клетки организмов, не являющихся млекопитающими, включая клетки насекомых и растений. Клетки, линии клеток и клетки-хозяева, в которых можно размножать химерные пестивирусы по настоящему изобретению, хорошо известны и доступны обычным специалистам в данной области техники.

Химерные пестивирусы по настоящему изобретению можно ослабить или инактивировать перед применением в иммуногенной композиции или вакцине. Способы аттенуации и инактивации хорошо известны специалистам в данной области техники. Способы аттенуации включают, без ограничения, серийный пассаж в культуре клеток на подходящей линии клеток, ультрафиолетовое облучение и химический мутагенез. Способы инактивации включают, без ограничения, обработку формалином, бета-проприолактоном (BPL) или бинарным этиленимином (ВЕ1) или другие способы, известные специалистам в данной области техники.

Инактивацию формалином можно проводить смешиванием суспензии данного вируса с 37%-ным формальдегидом до конечной концентрации формальдегида 0,05%. Эту смесь вирус-формальдегид смешивают путем постоянного перемешивания в течение приблизительно 24 часов при комнатной температуре. Смесь инактивированного вируса затем тестируют на остаточный живой вирус путем оценки роста на подходящей линии клеток.

Инактивацию BEI можно проводить смешиванием суспензии вируса по настоящему изобретению с 0,1 М BEI (2-бром-этиламин в 0,175 н. NaOH) до конечной концентрации BEI 1 мМ. Эту смесь вирус-BEI смешивают путем постоянного перемешивания в течение приблизительно 48 часов при комнатной температуре с последующим добавлением 1,0 М тиосульфата натрия до конечной концентрации 0,1 мМ. Смешивание продолжают в течение еще двух часов. Смесь инактивированного вируса тестируют на остаточный живой вирус путем оценки роста на подходящей линии клеток.

Иммуногенные композиции и вакцины по настоящему изобретению могут включать один или более чем один ветеринарно приемлемый носитель. Термин «ветеринарно приемлемый носитель», как он использован здесь, включает все и любые растворители, дисперсионные среды, покрытия, адъюванты, стабилизаторы, разбавители, консерванты, антибактериальные и противогрибковые агенты, изотонические агенты, агенты, замедляющие всасывание, и тому подобное. Разбавители могут включать воду, физиологический раствор, декстрозу, этанол, глицерин и тому подобное. Изотонические агенты могут включать хлорид натрия, декстрозу, маннит, сорбит и лактозу, известные среди прочих специалистам в данной области техники. Стабилизаторы включают альбумин, известный среди прочих специалисту в данной области техники. Консерванты включают мертиолат, известный среди прочих специалисту в данной области техники.

Адъюванты включают, без ограничения, адъювантную систему RIBI (Ribi Inc.), квасцы, гель на основе гидроксида алюминия, эмульсии типа «масло-в-воде», эмульсии типа «вода-в-масле», такие как, например, полный и неполный адъюванты Фрейнда, блок-сополимер (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), адъювант AMPHIGEN®, сапонин, Quil A, QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL) или другие фракции сапонина, монофосфориллипид А, липид-аминный адъювант авридин, термолабильный энтеротоксин из Е. coli (рекомбинантный или иной), холерный токсин или мурамил-дипептид, известные среди многих других специалистам в данной области техники. Количества и концентрации адъювантов и добавок, полезных в контексте настоящего изобретения, могут быть легко определены квалифицированным специалистом. В одном воплощении согласно настоящему изобретению предусмотрены иммуногенные композиции и вакцины, содержащие от примерно 50 мкг до примерно 2000 мкг адъюванта. В другом воплощении адъювант включен в количестве от примерно 100 мкг до примерно 1500 мкг, или от примерно 250 мкг до примерно 1000 мкг, или от примерно 350 мкг до примерно 750 мкг. В другом воплощении адъювант включен в количестве примерно 500 мкг/2 мл дозу иммуногенной композиции или вакцины.

Иммуногенные композиции и вакцины также могут включать антибиотики. Такие антибиотики включают, без ограничения, антибиотики из классов аминогликозидов, карбапенемов, цефалоспоринов, гликопептидов, макролидов, пенициллинов, полипептидов, хинолонов, сульфонамидов и тетрациклинов. В одном воплощении в настоящем изобретении предусмотрены иммуногенные композиции и вакцины, содержащие от примерно 1 мкг/мл до примерно 60 мкг/мл антибиотика. В другом воплощении иммуногенные композиции и вакцины содержат от примерно 5 мкг/мл до примерно 55 мкг/мл антибиотика, или от примерно 10 мкг/мл до примерно 50 мкг/мл антибиотика, или от примерно 15 мкг/мл до примерно 45 мкг/мл антибиотика, или от примерно 20 мкг/мл до примерно 40 мкг/мл антибиотика, или от примерно 25 мкг/мл до примерно 35 мкг/мл антибиотика. В еще одном воплощении иммуногенные композиции и вакцины содержат менее чем примерно 30 мкг/мл антибиотика.

Иммуногенные композиции и вакцины по данному изобретению могут дополнительно включать один или более чем один другой иммуномодулирующий агент, такой как, например, интерлейкины, интерфероны или другие цитокины, подходящие количества которых могут быть определены квалифицированным специалистом.

Иммуногенные композиции и вакцины по настоящему изобретению могут включать одну или более чем одну полинуклеотидную молекулу, кодирующую химерный пестивирус. В иммуногенных композициях или вакцинах можно использовать молекулы либо ДНК, либо РНК, кодирующие весь геном химерного пестивируса, или одну или более чем одну открытую рамку считывания. Молекулу ДНК или РНК можно вводить в отсутствие других агентов или ее можно вводить совместно с агентом, облегчающим поглощение клеткой (например, с липосомами или катионными липидами). Общее содержание полинуклеотидов в иммуногенной композиции или вакцине в целом будет составлять от примерно 0,1 мкг/мл до примерно 5,0 мг/мл. В другом воплощении общее содержание полинуклеотидов в иммуногенной композиции или вакцине будет составлять от примерно 1 мкг/мл до примерно 4,0 мг/мл, или от примерно 10 мкг/мл до примерно 3,0 мг/мл, или от примерно 100 мкг/мл до примерно 2,0 мг/мл. Вакцины и методики вакцинации, в которых используют нуклеиновые кислоты (ДНК или мРНК), подробно описаны в данной области техники, например, в патенте США №5703055, патенте США №5580859, патенте США №5589466, которые все включены в данное описание посредством ссылки.

Иммуногенные композиции и вакцины по настоящему изобретению также могут включать дополнительные антигены BVDV, например антигены, описанные в патенте США №6060457, патенте США №6015795, патенте США №6001613 и патенте США №5593873, которые все включены в данное описание посредством ссылки.

В дополнение к одному или более чем одному химерному пестивирусу иммуногенные композиции и вакцины могут включать другие антигены. Антигены могут находиться в форме инактивированного цельного или частичного препарата микроорганизма или в форме антигенных молекул, полученных методиками генной инженерии или химическим синтезом. Другие антигены, подходящие для применения согласно настоящему изобретению, включают, без ограничения, антигены, происходящие от таких патогенных бактерий, как Haemophilus somnus, Haemophilus parasuis, Bordetella bronchiseptica, Bacillus anthracis, Actinobacillus pleuropneumonie, Pasteurella multocida, Mannhemia haemolytica, Mycoplasma bovis, Mycobacteriuin bovis, Mycobacterium paratuberculosis, Clostridial spp., Streptococcus uberis, Staphylococcus aureus, Erysipelothrix rhusopathiae, Chlamydia spp., Brucella spp., Vibrio spp., серовары Salmonella enterica и Leptospira spp. Антигены также могут происходить от патогенных грибов, таких как Candida, простейших, таких как Cryptosporidium parvum, Neospora canium, Toxoplasma gondii, Eimeria spp., Babes/a spp., Giardia spp., или гельминтов, таких как Ostertagia, Coopelia, Haemonchus и Fasciola. Дополнительные антигены включают патогенные вирусы, такие как коронавирус крупного рогатого скота, герпесвирусы-1,3,6 крупного рогатого скота, вирус парагриппа крупного рогатого скота, респираторно-синтициальный вирус крупного рогатого скота, вирус лейкоза крупного рогатого скота, вирус чумы, вирус ящура, вирус бешенства и вирус гриппа.

ФОРМЫ. ДОЗИРОВКИ. ПУТИ ВВЕДЕНИЯ

Иммуногенные композиции и вакцины по настоящему изобретению можно вводить животным для индуцирования эффективного иммунного ответа против BVDV. Соответственно, согласно настоящему изобретению предложены способы стимулирования эффективного иммунного ответа против BVDV путем введения животному терапевтически эффективного количества описанных здесь иммуногенной композиции или вакцины по настоящему изобретению.

Иммуногенные композиции и вакцины по настоящему изобретению могут быть изготовлены в разных формах, в зависимости от пути введения. Например, иммуногенные композиции и вакцины могут быть изготовлены в форме стерильных водных растворов или дисперсий, подходящих для применения посредством инъекции, или изготовлены в лиофилизированных формах с использованием методик сублимационной сушки. Лиофилизированные иммуногенные композиции и вакцины обычно хранят при примерно 4°С, и их можно растворять в стабилизирующем растворе, например физиологическом растворе и/или HEPES, с адъювантом или без него. Иммуногенные композиции и вакцины также могут быть изготовлены в форме суспензий или эмульсий.

Иммуногенные композиции и вакцины по настоящему изобретению включают терапевтически эффективное количество одного или более чем одного из вышеописанных химерных пестивирусов. Очищенные вирусы можно использовать непосредственно в иммуногенной композиции или вакцине или можно дополнительно аттенуировать или инактивировать. Типично иммуногенная композиция или вакцина содержит от примерно 1×102 до примерно 1×1012 вирусных частиц, или от примерно 1×103 до примерно 1×1011 вирусных частиц, или от примерно 1×104 до примерно 1×1010 вирусных частиц, или от примерно 1×105 до примерно 1×109 вирусных частиц, или от примерно 1×106 до примерно 1×108 вирусных частиц. Точное количество вируса в иммуногенной композиции или вакцине, эффективное для обеспечения защитного эффекта, может быть определено квалифицированным специалистом.

Иммуногенные композиции и вакцины обычно содержат ветеринарно приемлемый носитель в объеме от примерно 0,5 мл до примерно 5 мл. В другом воплощении объем носителя составляет от примерно 1 мл до примерно 4 мл или от примерно 2 мл до примерно 3 мл. В другом воплощении объем носителя составляет примерно 1 мл, или составляет примерно 2 мл, или составляет примерно 5 мл. Ветеринарно приемлемые носители, подходящие для применения в иммуногенных композициях и вакцинах, могут представлять собой любые из иммуногенных композиций и вакцин, описанных выше.

Специалисты в данной области техники могут легко определить, нужно ли аттенуировать или инактивировать вирус до введения. В другом воплощении настоящего изобретения химерный пестивирус можно вводить непосредственно животному без дополнительной аттенуации. Количество вируса, которое является терапевтически эффективным, может варьировать в зависимости от конкретного используемого вируса, состояния животного и/или уровня инфекции и может быть определено квалифицированным специалистом.

Согласно способам по настоящему изобретению животным можно вводить одну дозу, или альтернативно, могут иметь место две или более чем две инокуляции с интервалами от примерно двух до примерно десяти недель. Могут потребоваться схемы бустер-иммунизации, и схему дозировки можно адаптировать для обеспечения оптимальной иммунизации. Специалисты в данной области техники могут легко определить оптимальную схему введения.

Иммуногенные композиции и вакцины можно вводить непосредственно в кровоток, в мышцу или во внутренний орган. Подходящие способы парентерального введения включают внутривенное, внутриартериальное, внутрибрюшинное, внутриоболочечное, внутрижелудочковое, внутриуретральное, внутригрудинное, внутричерепное, внутримышечное и подкожное. Подходящие устройства для парентерального введения включают игольные (включая микроигольные) инъекторы, безыгольные инъекторы и методики инфузии.

Парентеральные препараты обычно представляют собой водные растворы, которые могут содержать эксципиенты, такие как соли, углеводы и буферы (предпочтительно с рН от примерно 3 до примерно 9, или от примерно 4 до примерно 8, или от примерно 5 до примерно 7,5, или от примерно 6 до примерно 7,5, или от примерно 7 до примерно 7,5), но для некоторых применений их можно приготовить в виде препарата более подходящим образом в виде стерильного неводного раствора или в виде сухой формы, подлежащей применению в сочетании с подходящим наполнителем, таким как стерильная апирогенная вода.

Приготовление парентеральных препаратов при стерильных условиях, например, посредством лиофилизации может быть легко осуществлено с использованием стандартных фармацевтических методик, хорошо известных специалистам в данной области техники.

Растворимость соединений, используемых в приготовлении парентеральных растворов, можно увеличить путем использования подходящих методик приготовления препаратов, известных квалифицированному специалисту, таких как включение агентов, увеличивающих растворимость, включая буферы, соли, поверхностно-активные вещества, липосомы, циклодекстрины и тому подобное.

Препараты для парентерального введения можно приготовить в виде препаратов с немедленным и/или модифицированным высвобождением. Препараты с модифицированным высвобождением включают препараты с отсроченным, замедленным, импульсным, контролируемым, направленным и запрограммированным высвобождением. Таким образом, соединения по данному изобретению можно приготовить в виде препарата в виде твердого, полутвердого вещества или тиксотропной жидкости для введения в виде имплантированного депо-препарата, обеспечивающего модифицированное высвобождение активного соединения. Примеры таких препаратов включают стенты, покрытые лекарственным средством, и микросферы из поли(с//-молочной-полигликолевой)кислоты (PGLA).

Иммуногенные композиции и вакцины по настоящему изобретению также можно вводить местно на кожу или слизистую, то есть дермально или трансдермально. Типичные препараты для этой цели включают гели, гидрогели, лосьоны, растворы, кремы, мази, присыпки, повязки, пены, пленки, накожные пластыри, облатки, имплантаты, губки, волокна, бандажи и микроэмульсии. Также можно использовать липосомы. Типичные носители включают спирт, воду, минеральное масло, жидкий вазелин, белый вазелин, глицерин, полиэтиленгликоль и пропиленгликоль. Могут быть включены усилители проникновения. См., например, Finnin and Morgan, J. Pharm Sci, 88(10):955-958(1999).

Другие способы местного введения включают доставку электропорацией, ионофорезом, фонофорезом, сонофорезом и микроигольную или безыгольную инъекцию (например, Powderject™, Bioject™ и так далее).

Препараты для местного введения можно приготовить в виде препарата с немедленным и/или модифицированным высвобождением. Препараты с модифицированным высвобождением включают препараты с отсроченным, замедленным, импульсным, контролируемым, направленным или запрограммированным высвобождением.

Иммуногенные композиции и вакцины также можно вводить интраназально или посредством ингаляции обычно в форме сухого порошка (либо одного, либо в виде смеси, например в сухой смеси с лактозой или в виде частиц из смешанных компонентов, например смешанных с фосфолипидами, такими как фосфатидилхолин), из ингалятора сухого порошка или в виде аэрозольного спрэя из контейнера под давлением, насоса, пульверизатора, распылителя (предпочтительно распылителя с использованием электрогидродинамики для создания мелкодисперсного тумана) или небулайзера, с использованием подходящего пропеллента, такого как 1,1,1,2-тетрафторэтан или 1,1,1,2,3,3,3-гептафторпропан, или без него. Для интраназального применения порошок может содержать биоадгезивный агент, например хитозан или циклодекстрин.

Контейнер под давлением, насос, пульверизатор, распылитель или небулайзер содержит раствор или суспензию соединения(й) по данному изобретению, содержащую, например, этанол, водный этанол или подходящий альтернативный агент для диспергирования, солюбилизирования или пролонгирования высвобождения активного агента, пропеллент(ы) в качестве растворителя и возможное поверхностно-активное вещество, такое как сорбитантриолеат, олеиновая кислота или олигомолочная кислота.

Перед применением в виде препарата в форме сухого порошка или суспензии лекарственный продукт обычно микронизируют до подходящего размера для доставки посредством ингаляции (обычно менее чем примерно 5 микрон). Этого можно достигнуть любым подходящим способом измельчения, таким как размол на спиральной струйной мельнице, размол на струйной мельнице с псевдоожиженным слоем, технология для сверхкритических жидкостей для образования наночастиц, гомогенизация под высоким давлением или сушка распылением.

Капсулы (изготовленные, например, из желатина или гидроксипропилметилцеллюлозы), блистеры и картриджи для применения в ингаляторе или инсуффляторе можно изготовить в виде препарата так, чтобы они содержали порошковую смесь соединения по данному изобретению, подходящую порошковую основу, такую как лактоза или крахмал, и модификатор эффективности, такой как лейцин, маннит или стеарат магния. Лактоза может быть безводной или находиться в форме моногидрата. Другие подходящие эксципиенты включают декстран, глюкозу, мальтозу, сорбит, ксилит, фруктозу, сахарозу и трегалозу.

Подходящий препарат в виде раствора для применения в распылителе с использованием электрогидродинамики для создания мелкодисперсного тумана может содержать от примерно 1 мкг до примерно 20 мг соединения по данному изобретению на одно срабатывание, и объем при срабатывании может варьировать от примерно 1 мкл до примерно 100 мкл. В другом воплощении количество соединения на одно срабатывание может варьировать от примерно 100 мкг до примерно 15 мг, или от примерно 500 мкг до примерно 10 мг, или от примерно 1 мг до примерно 10 мг, или от примерно 2,5 мкг до примерно 5 мг. В другом воплощении объем при срабатывании может варьировать от примерно 5 мкл до примерно 75 мкл, или от примерно 10 мкл до примерно 50 мкл, или от примерно 15 мкл до примерно 25 мкл. Типичный препарат может содержать соединение по данному изобретению, пропиленгликоль, стерильную воду, этанол и хлорид натрия. Альтернативные растворители, которые можно использовать вместо пропиленгликоля, включают глицерин и полиэтиленгликоль.

Препараты для введения ингаляцией/интраназального введения можно приготовить в виде препаратов с немедленным и/или модифицированным высвобождением с использованием, например, PGLA. Препараты с модифицированным высвобождением включают препараты с отсроченным, замедленным, импульсным, контролируемым, направленным и запрограммированным высвобождением.

В случае ингаляторов сухого порошка и аэрозолей единицу дозировки обычно определяют посредством клапана, который доставляет отмеренное количество. Единицы дозировки согласно данному изобретению обычно подгоняют так, чтобы вводить отмеренную дозу или «впрыск», содержащие от примерно 10 нг до примерно 100 мкг соединения по данному изобретению. В другом воплощении количество соединения, введенного в отмеренной дозе, составляет от примерно 50 нг до примерно 75 мкг, или от примерно 100 нг до примерно 50 мкг, или от примерно 500 нг до примерно 25 мкг, или от примерно 750 нг до примерно 10 мкг, или от примерно 1 мкг до примерно 5 мкг. Общая суточная доза обычно находится в интервале от примерно 1 мкг до примерно 100 мг, которую можно вводить в одной дозе или, более общепринято, в виде раздельных доз на протяжении суток. В другом воплощении общая суточная доза может варьировать от примерно 50 мкг до примерно 75 мг, или от примерно 100 мкг до примерно 50 мг, или от примерно 500 мкг до примерно 25 мг, или от примерно 750 мкг до примерно 10 мг, или от примерно 1 мг до примерно 5 мг.

Иммуногенные композиции и вакцины по настоящему изобретению также можно вводить в ротовую полость или перорально, то есть вводить в организм субъекта через рот или посредством ротовой полости, и это введение включает проглатывание или транспорт через слизистую рта (например, сублингвальное или трансбуккальное всасывание) или и то, и другое. В те препараты по изобретению, которые предназначены для введения в ротовую полость или перорального введения, можно добавлять подходящие корригенты, такие как ментол и левоментол, или подсластители, такие как сахарин или сахарин натрия.

Иммуногенные композиции и вакцины по настоящему изобретению можно вводить ректально или вагинально, например, в виде суппозитория, пессария или клизмы. Масло какао является традиционной основой суппозитория, но при необходимости могут быть использованы разные альтернативы. Препараты для ректального/вагинального введения могут быть приготовлены в виде препарата с немедленным и/или модифицированным высвобождением. Препараты с модифицированным высвобождением включают препараты с отсроченным, замедленным, импульсным, контролируемым, направленным и запрограммированным высвобождением.

Иммуногенные композиции и вакцины по настоящему изобретению также можно вводить непосредственно в глаз или в ухо, обычно в форме капель микронизированной суспензии или раствора в изотоничном стерильном физиологическом растворе с подведенным рН. Другие препараты, подходящие для глазного и ушного введения, включают мази, биоразлагаемые (например, губки с абсорбируемым гелем, коллаген) и бионеразлагаемые (например, силиконовые) имплантаты, облатки, линзы и системы в виде частиц или везикул, такие как ниосомы или липосомы. Полимер, такой как поперечно-сшитая полиакриловая кислота, поливиниловый спирт, гиалуроновая кислота, целлюлозный полимер, например гидроксипропилметилцеллюлоза, гидроксиэтилцеллюлоза или метилцеллюлоза, или гетерополисахаридный полимер, например желатиновая камедь, может быть включен вместе с консервантом, таким как хлорид бензалкония. Такие препараты также можно доставлять ионофорезом.

Препараты для глазного/ушного введения можно готовить в виде препаратов с немедленным и/или модифицированным высвобождением. Препараты с модифицированным высвобождением включают препараты с отсроченным, замедленным, импульсным, контролируемым, направленным и запрограммированным высвобождением.

Иммуногенные композиции и вакцины по настоящему изобретению можно использовать в изготовлении лекарственного средства для лечения или предупреждения распространения у животного инфекции вирусом диареи крупного рогатого скота.

Иммуногенные композиции и вакцины по настоящему изобретению можно использовать в изготовлении лекарственного средства для введения животному, где данное лекарственное средство представляет собой DIVA-вакцину на основе пестивируса, содержащую химерный пестивирус, включающий вирус диареи крупного рогатого скота, который не экспрессирует его гомологичный Erns белок, и где указанный химерный пестивирус экспрессирует гетерологичный Erns белок, происходящий из другого пестивируса, или природный, синтетический или генетический вариант указанного гетерологичного Erns белка. В одном воплощении химерный пестивирус имеет по меньшей мере один Erns эпитоп, который не присутствует в вирусе диареи крупного рогатого скота дикого типа. В другом воплощении химерный пестивирус не имеет по меньшей мере одного Erns эпитопа, который присутствует в вирусе диареи крупного рогатого скота дикого типа.

ДЕТЕКТИРОВАНИЕ. ДИАГНОСТИЧЕСКИЕ СПОСОБЫ

Согласно настоящему изобретению предложены способы определения происхождения пестивируса, присутствующего в животном субъекте.

Вакцинация, в которой используют DIVA-вакцину, т.е. вакцину, которая способна дифференцировать инфицированных животных от вакцинированных, обеспечивает средство определения происхождения пестивируса, присутствующего в животном субъекте. Эту дифференцировку можно осуществлять любым из разных диагностических способов, включающих, без ограничения, ELISA (твердофазный иммуноферментный анализ), Вестерн-блоттинг и ПЦР (полимеразная цепная реакция). Эти и другие способы полностью признаны и известны обычному специалисту в данной области техники.

Химерные пестивирусы по настоящему изобретению можно отличить от штаммов BVDV дикого типа как по их геномному составу, так и по экспрессируемым белкам. Такое отличие дает возможность установить различие между вакцинированными и инфицированными животными. Например, можно осуществить определение того, несет ли животное, тестируемое положительным в отношении BVDV в определенных лабораторных тестах, штамм BVDV дикого типа или химерный пестивирус по настоящему изобретению, полученный ранее посредством вакцинации.

Ряд анализов можно использовать для проведения данного определения. Например, вирус можно выделять из животного, тестируемого как положительное в отношении BVDV, и можно использовать анализы на основе нуклеиновых кислот для определения присутствия генома химерного пестивируса, указывающего на предшествующую вакцинацию. Анализы на основе нуклеиновых кислот включают саузерн- или нозерн-блоттинг, ПЦР и секвенирование. В качестве альтернативы, можно использовать анализы на основе белка. В анализах на основе белка клетки или ткани, подозреваемые на наличие инфекции, можно выделять из животного, тестируемого как положительное в отношении BVDV. Из таких клеток или тканей можно получить клеточные экстракты и можно подвергнуть их, например, вестерн-блоттингу с использованием соответствующих антител против вирусных белков, которые могут четко идентифицировать присутствие либо химерного пестивируса, инокулированного ранее, либо BVDV дикого типа.

Степень и природу иммунных ответов, индуцированных у животного, можно оценить с использованием ряда методик. Например, можно собрать сыворотку от инокулированных животных и протестировать ее на присутствие или отсутствие специфичных антител в отношении химерного вируса, например, в традиционном анализе по нейтрализации вируса. Обнаружение отвечающих цитотоксических Т-лимфоцитов (CTL) в лимфоидных тканях может быть достигнуто такими анализами, как пролиферация Т-клеток, в качестве указания на индукцию клеточного иммунного ответа. Релевантные методики хорошо описаны в данной области техники, например, Coligan et al. Current Protocols in Immunology, John Wiley & Sons Inc. (1994).

НАБОРЫ

Ввиду того, что может быть желательным введение иммуногенной композиции или вакцины в комбинации с дополнительными соединениями, например, с целью лечения конкретного заболевания или состояния, в пределах объема настоящего изобретения находится то, что иммуногенную композицию или вакцину можно с удобством включить или объединить в форме набора, подходящего для введения или совместного введения композиций.

Таким образом, наборы по настоящему изобретению могут содержать одну или более чем одну отдельную фармацевтическую композицию, по меньшей мере одна из которых представляет собой иммуногенную композицию или вакцину согласно настоящему изобретению, и средство для раздельного хранения указанных композиций, такое как контейнер, разделенная бутыль или разделенная упаковка из фольги. Примером такого набора является шприц и игла и тому подобное. Набор по настоящему изобретению является особенно подходящим для введения разных лекарственных форм, например пероральной или парентеральной, для введения отдельных композиций с разными интервалами дозирования или для титрования отдельных композиций относительно друг друга. Для помощи тому, кто вводит композицию по настоящему изобретению, данный набор обычно включает указания по введению.

Другой набор по настоящему изобретению может включать один или более чем один реагент, полезный для детекции и дифференцировки между животным, инфицированным BVDV, и животным, вакцинированным химерным пестивирусом. Набор может включать реагенты для анализа образца на присутствие целого BVDV или полипептидов, эпитопов или полинуклеотидных последовательностей BVDV, которые не присутствуют в химерном пестивирусе данной иммуногенной композиции или вакцины. В качестве альтернативы, наборы по настоящему изобретению могут включать реагенты для анализа образца на присутствие химерного пестивируса или полипептидов, эпитопов или полинуклеотидных последовательностей, которые не присутствуют в BVDV дикого типа. Присутствие вируса, полипептидов или полинуклеотидных последовательностей можно определить с использованием антител, ПЦР, гибридизации и других способов обнаружения, известных специалистам в данной области техники.

Другой набор по настоящему изобретению может предоставить реагенты для обнаружения антител против конкретных эпитопов. Данные эпитопы либо присутствуют в химерном пестивирусе по настоящему изобретению и не присутствуют в BVDV дикого типа, или альтернативно, присутствуют в BVDV дикого типа и не присутствуют в химерном пестивирусе по настоящему изобретению. Такие реагенты являются полезными для анализа образца на присутствие антител и хорошо известны и доступны обычному специалисту в данной области техники. Присутствие антител можно определить с использованием стандартных способов обнаружения, известных специалистам в данной области техники.

В определенных воплощениях наборы могут включать комплект напечатанных инструкций или этикетку, указывающую, что данный набор является полезным для детекции и дифференцировки животных, инфицированных BVDV, от животных, вакцинированных химерным пестивирусом.

АНТИТЕЛО. АНТИТЕЛА

Антитела могут быть либо моноклональными, поликлональными, либо рекомбинантными. Соответственно, антитела могут быть получены против иммуногена или его части. Например, синтетический пептид на основе аминокислотной последовательности иммуногена, или полученный рекомбинантно методиками клонирования, или продукт природного гена и/или его части могут быть выделены и использованы в качестве иммуногена. Иммуногены можно использовать для продуцирования антител стандартной методикой продукции антител, хорошо известной специалистам в данной области техники, как, например, в общем описано у Harlow and Lane, "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1988) и Borrebaeck, "Antibody Engineering - A Practical Guide", W.H. Freeman and Co. (1992). Фрагменты антител также можно получать из антител способами, известными специалистам в данной области техники, и они включают Fab, F(ab')2 и Fv.

При продуцировании антител скрининг на желательное антитело можно осуществлять стандартными в иммунологии способами, известными в данной области техники. Методики, которые не описаны конкретно, обычно представляют собой как описано в Stites, et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton and Lange, Norwalk, CT (1994) и Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W.H. Freeman and Co., New York (1980). В общем, предпочтительными типами иммуноанализов являются ELISA и вестерн-блоттинг. Оба анализа являются хорошо известными специалистам в данной области техники. В данных анализах можно использовать как поликлональные, так и моноклональные антитела. Антитело может быть связанным с субстратом на твердой подложке или конъюгированным с детектируемой группировкой, или как связанным, так и конъюгированным, как хорошо известно в данной области техники (для общего обзора по конъюгации флуоресцентных или ферментативных группировок см. Johnstone and Thorpe, "Immunochemistry in Practice", Blackwell Scientific Publications, Oxford (1982)). Связывание антител с субстратом на твердой подложке также хорошо известно в данной области техники (для общего обзора см. Harlow and Lane (1988) and Borrebaeck (1992)). Детектируемые группировки, предусмотренные для использования в настоящем изобретении, могут включать, без ограничения, флуоресцентные, металлические, ферментативные и радиоактивные маркеры, такие как биотин, золото, ферритин, щелочная фосфатаза, β-галактозидаза, пероксидаза, уреаза, флуоресцеин, родамин, тритий, 14С, а также йодирование.

Настоящее изобретение дополнительно проиллюстрировано, но не ограничивается следующими примерами.

Пример 1. Конструирование и серологическая характеризация химерных пестивирусов

E. coli К12 GM2163 [F-ara-14, leuB6, thi-1, fhuA31, lacY1, tsx-78, galK2, galT22, supE44, hisG4, rpsL136, (Str), xyl-5, mtl-1, dam13::Tn9(Camr), dcm-6, mcrB1, hsdR2(rk-mk-),mcrA] имеет плазмиду, содержащую полноразмерную геномную кДНК штамма NADL вируса диареи крупного рогатого скота (BVDV-NADL), полученную от доктора R. Donis, University of Nebraska.

Клетки RD (клетки бычьего яичка, трансформированные SV40; полученные от доктора R. Donis) поддерживали в OptiMEM, дополненной 3%-ной лошадиной сывороткой, 1% заменимых аминокислот (NEAA) в модифицированной среде Игла (MEM), 2 мМ GlutaMax и 10 мкг/мл гентамицина. Клетки ВК-6 приобретали у Pfizer Global Manufacturing (PGM). Клетки выращивали в среде Игла, модифицированной по Дульбекко (DMEM), дополненной 5%-ной лошадиной сывороткой или донорской телячей сывороткой (PGM), 2 мМ Glutamax и 1% антибиотиком и противогрибковым средством. Все компоненты среды, за исключением тех, где это указано, были приобретены у Invitrogen (Carlsbad, CA). Все клетки поддерживали при 37°С в среде с 5%-ным CO2.

Моноклональное антитело (MAb) 15C5, специфичное к Е1""5 BVDV, приобретали у IDEXX (Westbrook, ME). MAb 20.10.6 против BVDV NS3 было предоставлено доктором Е. Dubovi (Cornell University). MAb WS 363, WS 373 и WS 371, имеющие специфичность в отношении белка Erns вируса пограничной болезни овец (BVD), были получены в Агенстве ветеринарных лабораторий (Surrey, Великобритания). Образцы бычьей сыворотки №77, №816, №1281 и №1434 получали согласно внутреннему регламенту Pfizer.

Химерные пестивирусы создавали путем замены Erns гена штамма BVDV-NADL на Е"13 ген пестивируса жирафа (С-Erns), северного оленя (R-Erns) или вилорогой антилопы (Р-Erns) с использованием метода перекрывающейся ПЦР. Использовали либо ДНК-полимеразу PfuUltra™ fusion HS (Stratagene; La Jolla, CA), либо ДНК-полимеразу высокой точности Platinum® Taq (Invitrogen). Олигонуклеотидные праймеры (с сопровождающими SEQ ID NO) для перекрывающейся ПЦР и для создания полноразмерной вирусной ДНК перечислены в Таблице 1.

Таблица 1.
Олигонуклеотидные праймеры, использованные для ПРЦ-амплификации
SEQ ID N0 Название Происхождение Последовательности (5'-3') Сайт связывания праймера (подчеркнутая последовательность)
1 Олиго В-5 Т7+NADL GTGTTAATACGACTCACTATAG TATACGAGAATTAGAAAAGGC Промотор Т7
2 Олиго 84 NADL GGGGGCTGTTAGAGGTCTTCC
3 Олиго 127 G-E™+NADL AATTCCACTGGGTGATGTTCTCTC CCATTGTAACTTGAAACAAAACT N-конец G-Erns
4 Олиго 128 G-Erns GAGAACATCACCCAGTGGAA
5 Олиго 129 G-Erns TGCGTGGGCTCCAAACCATGT
6 Олиго 130 G-Erns+NADL AACATGGTTTGGAGCCCACGCAGCTTCCCCTTACTGTGATGTCG С-конец G-Erns
7 Олиго 131 P-Erns+NADL GGTTCCACTGTGTTATATTCTCTCCCATTGTAACTTGAAACAAAACT N-конец R-Erns
8 Олиго 132 R-Erns GAGAATATAACACAGTGGAACC
9 Олиго 133 R-Erns TGCATTAGCTCCGAACCACGTT
10 Олиго 134 Р-Erns+NADL AACGTGGTTCGGAGCTAATGCAGCTTCCCCTTACTGTGATGTCG С-конец R-Erns
11 Олиго 135 P-Erns+NADL GGTTCCACTGAGTTATATTCAC N-конец P-Erns
12 Олиго 136 P-Erns TCCCATTGTAACTTGAAACAGTGAATATAACTCAGTGGAACC
13 Олиго 137 P-Erns TGCCTGTGCCCCAAACCATGT
14 Олиго 138 Р-Erns+NADL AACATGGTTTGGGGCACAGGCA С-конец P-Erns
15 Олиго 175 NADL GCTTCCCCTTACTGTGATGTCGGTTATCAATAGTAGCCACAGAAT
16 Олиго 177 NADL TCCACCCTCAATCGACGCTAAA
17 Олиго 237 CM5960 CCCTGAGGCCTTCTGTTCTGAT
18 Олиго P7 CM5960 CACTTGTCGGAGGTACTACTACT
19 Олиго P8 CM5960 CTTGTCTATCTTATCTCTTATTGC
20 Олиго P3 CM5960 ACTATCTGAACAGTTGGACAGG
21 Олиго 296-1 T7+CM53637 GTGTTAATACGACTCACTATA Промотор Т7
22 Олиго 297 P-Erns+CM53637 GTATACGAGATTAGCTAAAGCCAGGTTCCACTGAGTTATATTCAC N-конец P-Erns
23 Олиго 298 Р-Erns+CM53637 TCCTGTTACCAGCTGAAGCAGAAAACATGGTTTGGGGCACAGGCA С-конец P-Erns
24 Олиго 299 СМ53637 TTAATGCCCTCCCTGTCTCTACCACCT
25 Олиго 300 СМ53637 AGGATGAGGATCTAGCAGTGGATCT
26 Олиго 303 СМ53637 CCATAGCCATCTGCTCAGACAGTA
27 Олиго 92-1 СМ53637 GGGGCTGTCAGAGGCATCCTCTAGTC
28 Олиго 321 СМ53637 AGCCACTACACCTGTCACGAGAAG
29 Олиго 250 NADL CACCATGAAAATAGTGCCCAAAGAATC С-конец NADL-C
30 Олиго 252 NADL TTAAGCGTATGCTCCAAACCACGTC С-конец NADL-Erns

Плазмиду, содержащую полноразмерную кДНК BVDV-NADL, экстрагировали из dam-Е. coli К12 GM2163. Данную плазмиду метилировали in vitro метилтрансферазой dam и S-аденозилметионином (New England Biolabs; Ipswich, MA). Синтезировали и клонировали в клонирующий вектор гены G-Erns, R- Erns и Р-Erns (номера доступа GenBank NC_003678, NC_003677 и AY781152, соответственно).

Для конструирования химерной ДНК BVDV-NADL/G-Erns фрагмент BVDV-NADL, кодирующий область от 5'UTR (нетранслируемая область) до 3'-конца гена С, амплифицировали посредством ПЦР из метилированной плазмиды с праймерами Олиго В-5 и Олиго 127. Ген С-Erns амплифицировали посредством ПЦР из плазмидной ДНК, содержащей ген G- Erns, с Олиго 128 и Олиго 129. Фрагмент BVDV, кодирующий область от Е1 до 3'UTR, амплифицировали посредством ПЦР из метилированной плазмиды с Олиго 130 и Олиго 84. ПЦР-продукты очищали на геле с использованием набора для экстракции геля QIAquick (Qiagen; Valencia, CA). Очищенные ПЦР-продукты обрабатывали Dpn I и экзонуклеазой 1 (New England Biolabs). Обработанные ПЦР-продукты подвергали сборке для создания полноразмерного химерного генома BVDV-NADL/G-Erns посредством ПЦР с использованием Олиго В-5 и Олиго 84.

Для конструирования химерной ДНК BVDV-NADL/R-Erns фрагмент BVDV-NADL, кодирующий область от 5'UTR до 3'-конца гена С, амплифицировали посредством ПЦР из метилированной плазмиды с праймерами Олиго В-5 и Олиго 131. Ген R-Erns амплифицировали посредством ПЦР из плазмиды, содержащей ген R-Erns, с Олиго 132 и Олиго 133. Фрагмент BVDV, кодирующий область от Е1 до 3'UTR, амплифицировали посредством ПЦР из метилированной плазмиды с Олиго 134 и Олиго 84. ПЦР-продукты очищали на геле с использованием набора для экстракции геля QIAquick. Очищенные ПЦР-продукты обрабатывали Dpn I и экзонуклеазой 1. Обработанные ПЦР-продукты подвергали сборке для создания полноразмерного химерного генома BVDV-NADL/R-Erns посредством ПЦР с использованием Олиго В-5 и Олиго 84.

Для конструирования химерной ДНК BVDV-NADL/P-Erns фрагмент BVDV-NADL, кодирующий область от 5'UTR до 3'-конца гена С, амплифицировали посредством ПЦР из метилированной плазмиды с праймерами Олиго В-5 и Олиго 135. Ген Р-Erns амплифицировали посредством ПЦР из плазмидной ДНК, содержащей ген Р-Erns, с Олиго 136 и Олиго 137. Фрагмент BVDV, кодирующий область от Е1 до 3'UTR, амплифицировали посредством ПЦР из метилированной плазмиды с Олиго 138 и Олиго 84. ПЦР-продукты очищали на геле с использованием набора для экстракции геля QIAquick. Очищенные ПЦР-продукты обрабатывали Dpn I и экзонуклеазой 1. Обработанные ПЦР-продукты подвергали сборке для создания полноразмерного химерного генома BVDV-NADL/P-Erns посредством ПЦР с использованием Олиго В-5 и Олиго 84.

Для подтверждения последовательности химерных Erns областей фрагмент, соответствующий области от 5'UTR до Е1 каждого собранного полноразмерного химерного генома, амплифицировали посредством ПЦР с использованием Олиго В-5 и Олиго 175, и ПЦР-продукты секвенировали и анализировали.

Из плазмиды, содержащей полноразмерную кДНК BVDV-NADL или ДНК химерного BVDV-NADL/Erns, генерировали полноразмерные вирусные геномные РНК-транскрипты с использованием набора mMessage mMachine T7 Ultra (Ambion; Austin, TX). Качество и количество каждого РНК-транскрипта определяли на РНК-геле и спектрофотометре Nanodrop (Nanodrop; Wilmington, DE). Культуры клеток RD, выращенные в течение ночи в лунках 6-луночных планшетов, трансфицировали вирусной РНК с использованием реагента липофектин (Invitrogen) согласно инструкциям производителя. После трансфекции клетки инкубировали при 37°С в течение 3 суток. Супернатанты собирали и хранили при -80°С.

Вирусные РНК из собранных супернатантов экстрагировали с использованием набора для выделения вирусной РНК МаgМах™ AI/ND (Ambion) согласно инструкциям производителя. РНК подвергали обратной транскрипции и область каждой химеры, кодирующую от Npro до Е1, амплифицировали с использованием праймеров Олиго 177 и Олиго 175 (Таблица 1) и системы ОТ-ПЦР (полимеразная цепная реакция с обратной транскрипцией) ThermoScript™ (Invitrogen) согласно инструкциям производителя. Затем секвенировали продукты ОТ-ПЦР.

Монослои клеток либо от трансфекции вирусной РНК, либо от инфекции вирусом фиксировали в 80%-ном ацетоне. Моноклональные антитела, специфичные в отношении BVDV или BDV, использовали в сочетании с набором антитела против мышиного IgG, конъюгированного с пероксидазой, АВС Elite (Vector Laboratories; Burlingame, CA). Окраска развивалась с использованием пероксидазного субстрата VIP (Vector Laboratories).

Титры химерного вируса определяли методом серийных разведений. Пробы вируса последовательно 10-кратно разводили и переносили в 96-луночные планшеты (100 мкл на лунку) с 4-6 повторностями на разведение. Затем в каждую лунку добавляли 100 мкл суспензии клеток ВК-6 и данные планшеты инкубировали при 37°С в течение 4-5 суток. Вирусную инфекцию определяли как по цитопатическому эффекту (СРЕ), так и по окрашиванию на MAb. Титры вируса рассчитывали с использованием метода Спирмана-Кэрбера.

Для получения биологических клонов каждой химеры пробы вируса сначала разводили в 100 раз с последующей серией 10-кратных разведений. 100 мкл разведенных вирусов переносили в каждую лунку 96-луночного планшета с 4 повторностями на разведение. Затем в каждую лунку добавляли 100 мкл клеток ВК-6 и планшеты инкубировали при 37°С в течение 4 суток. Супернатанты собирали, переносили в новые планшеты и хранили при -80°С. Клетки фиксировали и окрашивали. Супернатанты из лунок, содержащих одиночные очаги вируса, собирали и наращивали в качестве вирусных маточных растворов.

Исследования кинетики роста проводили в колбах Т-25, содержащих клетки ВК-6. Когда клетки достигали приблизительно 90%-ной конфлюентности, их инфицировали каждой химерой при MOI (множественность заражения) 0,02.

После адсорбции в течение 1 ч инокулят удаляли. Клетки промывали 3 раза PBS (фосфатно-солевой буферный раствор) и затем добавляли 3 мл свежей ростовой среды. Затем отбирали образцы в разные моменты времени от 0 до 144 ч для определений титра.

Для теста по нейтрализации вируса замороженные маточные растворы трех химер: BVDV-NADL/Erns, родительского BVDV-NADL и BVDV-CM5960 (BVDV типа I) разводили в DMEM приблизительно до 4000 ТСID50 (доза заражения 50% культуры ткани)/мл. Сыворотки от крупного рогатого скота, иммунизированного Bovi-Shield Gold (Pfizer; New York, NY) с заранее определенными титрами против BVDV типа I и II, двухкратно последовательно разводили DMEM. 50 мкл вируса (200 TCIDso) смешивали с равным объемом разведенной сыворотки крупного рогатого скота в 96-луночных планшетах для культуры ткани (4 повторности/разведение) и инкубировали при 37°С в течение 60 мин. Затем в каждую лунку добавляли 100 мкл клеток ВК-6 и планшеты инкубировали при 37°С в течение 3-6 суток. В каждый планшет в качестве контроля также включали сыворотку, отрицательную в отношении антител против BVDV. Титры конечной точки нейтрализации сыворотки определяли как СРЕ, так и иммуногистохимией (IHC) на сутки 3 и сутки 6.

Результаты. Были сконструированы химерные ДНК BVDV-NADL/Erns, в которых ген/белок NADL Erns был заменен на Erns пестивируса жирафа (С-Erns), северного оленя (R-Erns) или вилорогой антилопы (Р-Erns). Была секвенирована плазмидная ДНК, содержащая каждую из химерных Erns областей для подтверждения аутентичности последовательности. Следующие химерные пестивирусы были депонированы в Американскую коллекцию типовых культур (АТСС®), 10801 University Blvd., Manassas, VA, 20110, США 2 апреля 2009 года:

BVDV-NADL/G-Erns (PTA-9938), BVDV-NADL/P-E"18 (PTA-9939) и BVDV-NADL/R-Erns (РТА-9940), и их жизнеспособность была подтверждена АТСС® 23 апреля 2009 года.

Химерные вирусы BVDV-NADL/Erns высвобождали из клеток RD после трансфекции вирусной РНК, транскрибированной in vitro. Широкомасштабный цитопатический эффект (СРЕ) в клетках RD наблюдали через 48-72 часа после трансфекции РНК-транскриптами BVDV-NADL/G-Erns или BVDV-NADL/R-Erns. Однако при использовании вируса BVDV-NADL/P-Erns СРЕ не был явно заметным. Супернатанты культур собирали из каждой лунки и оставшиеся клетки фиксировали и окрашивали MAb антителом 20.10.6, специфичным в отношении BVDV NS3. Клетки, инфицированные одним из трех химерных пестивирусов, инкубировали с данным MAb. Вирусные РНК экстрагировали из собранных супернатантов и секвенировали для подтверждения генов Erns всех трех химер.

Данные три химеры BVDV-NADL/Erns тестировали на их реактивность с каждым из нескольких MAb против Erns, специфичных в отношении BVDV или BDV. Результаты показаны в Таблице 2. Химера BVDV-NADL/R-Erns реагировала со всеми тремя MAb против Erns BDV, тогда как ни BVDV-NADL/G-Erns, BVDV-NADL/P-Erns, ни родительский вирус BVDV-NADL не распознавались MAb против Erns BDV. BVDV-NADL/G-Erns, BVDV-NADL/R-Erns и родительский вирус NADL реагировали с пан-MAb 15С5 против Erns BVDV. MAb, специфичные в отношении либо Erns BDV, либо BVDV, не реагировали с химерой BVDV-NADL/P-Erns.

Таблица 2.
Реактивность химер BVDV-NADL/Erns в отношении Mab
MAb Специфичность Реактивность химеры
BVDV-NADL/G-Erns BVDV-NADUR-Erns BVDV-NADL/P-E™ BVDV-NADL
WS 371 BDV Erns - +++ - -
WS 373 BDV Erns - +++ - -
WS 363 BDV Erns - +++ - -
15С5 BVDV Erns +++ +++ - +++
20.10.6 Пестивирус NS3 +++ +++ ++ +++

Для того чтобы определить, имели ли химерные Erns белки в вирусах какое-либо влияние на распознавание вирусных нейтрализующих эпитопов антителами от крупного рогатого скота, вакцинированного BVDV, проводили анализ нейтрализации вируса с использованием трех химер: BVDV-NADL/Erns, BVDV-NADL и BVDV-CM5960 (BVDV типа I). Использовали сыворотку от 4 коров с титром нейтрализующих антител, варьирующим от 0 до более чем 40000 (определенным ранее против BVDV-CM5960). Результаты (Таблица 3) показывают то, что титры против всех трех химер были в целом сравнимы с титрами родительского BVDV-NADL и BVDV-CM5960. Нейтрализующие титры против BVDV-NADL/P-Erns были слегка ниже, чем нейтрализующие титры против двух других химер: BVDV-NADL и BVDV-CM5960.

Таблица 3.
Нейтрализующие титры бычьей антисыворотки против химер BVDV-NADL/Erns
Крупный рогатый скот № сыворотки Нейтрализующие титры
BVDV-NADL/G- Erns BVDV-NADL/R-Erns BVDV-NADL/P-Erns BVDV-NADL CM5960
816 <10 <10 <10 <10 <10
77 320 320 320 160 320
1281 6400 12800 3200 3200 25600
1434 51200 25600 6400 25600 51200

Три химеры BVDV-NADL/Erns биологически клонировали два раза серийным разведением. Получали три клона BVDV-NADL/G-Erns, четыре BVDV-NADL/R-Erns и три BVDV-NADL/P-Erns. Каждый из этих клонов наращивали в 1-3 раза. Результаты титрования показали, что подвергнутые наращиванию клон 1 BYDV-NADL/G-Erns, клоны 3 и 5 BVDV-NADL/R-Erns и клон 2 BVDV-NADL/P-Erns давали наивысшие титры.

Исследования кинетики роста проводили с клоном 1 BYDV-NADL/G-Erns, клоном 3 BVDV-NADL/R-Erns, клоном 2 BVDV-NADL/P-Erns и неклонированным BVDV-NADL/P-Erns. Кривые роста, генерированные от этих клонов, сравнивали с кривой родительского BVDV-NADL. Химеры BVDV-NADL/G-Erns и BVDV-NADL/R-Erns имели кинетику роста, подобную родительскому BVDV-NADL, тогда как BVDV-NADL/P-Erns рос медленнее и имел меньшие титры в каждый момент времени, чем родительский вирус и две другие химеры.

Создали три химерных вируса BVDV-NADL/Erns, в которых ген/белок NADL Erns заменяли на Erns пестивируса жирафа, северного оленя или вилорогой антилопы. Все три химеры были жизнеспособными и инфекционными как в клетках RD, так и в клетках ВК-6. Данные in vitro продемонстрировали, что химерные белки Erns не влияли на нейтрализацию данных химер антисывороткой от крупного рогатого скота, вакцинированного BVDV. Это свидетельствует о том, что нейтрализующие эпитопы на химерных вирусах, независимо от того, где они локализованы, не подвергались влиянию замен Erns.

Данные химерные вирусы имели разную кинетику роста и по-разному реагировали с моноклональными антителами против BVDV или BVDV Erns.

BVDV-NADL/G-Erns и BVDV-NADL/R-Erns имели кинетику роста, подобную родительскому вирусу, тогда как BVDV-NADL/P-Erns рос медленнее и до меньшего титра, чем родительский вирус. Как BVDV-NADL/G-Erns, так и BVDV-NADL/R-Erns реагировали с моноклональным антителом 15С5 против BVDV Erns, тогда как BVDV-NADL/P-Erns не реагировал. Результаты сравнения последовательности показали, что G-Erns и R-Erns имели более высокие сходства последовательности с BVDV NADL (75,8% и 76,2%, соответственно), чем Р-Erns (59%). Эти данные, взятые в совокупности с результатами по реактивности МАb, свидетельствуют о том, что G-Erns и R-Erns могут быть антигенно более сходными с родительским Erns, чем Р-Erns.

Пример 2. Конструирование, серологическая характеризация и тестирование эффективности вакцин-кандидатов на основе химерного пестивируса

Штамм СМ5960 BVDV типа 1 и штамм СМ53637 BVDV типа 2 получали от Pfizer Global Manufacturing. Вирусные РНК экстрагировали с использованием набора для выделения вирусной РНК MagMax™ AI/ND (Ambion) согласно инструкциям производителя. Данные РНК подвергали обратной транскрипции с генерированием кДНК, используя систему ОТ-ПЦР (полимеразная цепная реакция с обратной транскрипцией) ThermoScript™ (Invitrogen) согласно инструкциям производителя. Химерные пестивирусы создавали путем замены гена Erns СМ5960 и СМ53637 на ген Erns пестивируса вилорогой антилопы (Р-Erns), используя способ перекрывающейся ПЦР. Олигонуклеотидные праймеры, использованные для ПЦР, перечислены в Таблице 1.

Для конструирования химерной ДНК CM5960/P-Erns фрагмент кДНК СМ5960 между 5'UTR и 3'-концом гена С амплифицировали посредством ПЦР от кДНК СМ5960 с праймерами Олиго В-5 и Олиго 135. Ген Р-Erns амплифицировали посредством ПЦР из плазмидной ДНК, содержащей ген Р- Erns, с Олиго 136 и Олиго 137. Третий фрагмент между началом Е1 и 3'-концом Е2 амплифицировали посредством ПЦР из кДНК СМ5960 с праймерами Олиго 138 и Олиго 237.

Вышеописанные фрагменты очищали на геле с использованием набора для экстракции из геля QIAquick (Qiagen) и подвергали сборке посредством ПЦР для создания одного фрагмента с Олиго В-5 и Олиго 237. Фрагмент между областью Е1 и областью NS5B амплифицировали посредством ПЦР из кДНК СМ5960 с праймерами Олиго Р7 и Олиго Р8. Другой фрагмент между областью NS5A и концом 3'UTR амплифицировали посредством ПЦР из кДНК СМ5960 с праймерами Олиго РЗ и Олиго 84. Эти три фрагмента затем очищали на геле и подвергали сборке посредством ПЦР с Олиго В-5 и Олиго 84 для создания полноразмерного химерного генома СМ5960/Р-Erns.

Для конструирования химерной ДНК СМ53637/Р-Erns фрагмент кДНК СМ53637 между 5'UTR и 3'-концом гена С амплифицировали посредством ПЦР из кДНК СМ53637 с праймерами Олиго 296-1 и Олиго 297. Второй фрагмент между началом Е1 и 3'-концом Е2 амплифицировали посредством ПЦР из кДНК СМ53637 с праймерами Олиго 298 и Олиго 303. Эти два фрагмента очищали на геле и совместно с фрагментом, кодирующим ген Р-Erns (см. выше), подвергали сборке посредством ПЦР с созданием одного фрагмента, используя Олиго 296-1 и Олиго 303.

Фрагмент между областью Е1 и областью NS3 затем амплифицировали посредством ПЦР из кДНК СМ53637 с праймерами Олиго 298 и Олиго 299. Другой фрагмент между областью NS3 и концом 3'UTR также амплифицировали посредством ПЦР из кДНК СМ53637 с праймерами Олиго 300 и Олиго 92-1. Эти два фрагмента и фрагмент, приведенный выше, очищали на геле и собирали посредством ПЦР с Олиго 296-1 и Олиго 92-1 с созданием полноразмерного химерного генома CM53637/P-Erns.

РНК-транскрипты полноразмерного вирусного генома генерировали из ДНК химерного CM5960/P-Erns и химерного CM53637/P-Erns с использованием набора mMessage mMachine T7 Ultra (Ambion). Качество и количество каждого РНК-транскрипта определяли на РНК геле. Культуры клеток RD, выращенные в течение ночи в лунках 6-луночных планшетов, трансфицировали вирусной РНК с использованием реагента липофектин (Invitrogen) согласно инструкциям производителя. После трансфекции клетки инкубировали при 37°С в течение 3 суток. Данные клетки плюс супернатанты пассировали от одного до нескольких раз в клетках RD и/или ВК-6. Супернатанты затем серийно пассировали в клетках ВК-6. Супернатанты собирали и хранили при -80°С.

Для подтверждения идентичности высвобожденного рекомбинантного вируса вирусную РНК из собранных супернатантов экстрагировали с использованием набора для выделения вирусной РНК MagMax™ AI/ND (Ambion) согласно инструкциям изготовителя. Данные РНК подвергали обратной транскрипции с использованием системы ОТ-ПЦР ThermoScript™ (Invitrogen) согласно инструкциям производителя и область каждой химеры между 5'UTR и Е2 или р7 амплифицировали посредством ПЦР с использованием праймеров Олиго В-5 и Олиго 237 (для химеры СМ5960/Р-Erns) или Олиго 296-1 и Олиго 321 (для химеры СМ53637/Р-Erns) (Таблица 1). Продукты ОТ-ПЦР затем секвенировали.

Клеточные монослои либо от трансфекции вирусной РНК, либо от вирусной инфекции фиксировали в 80%-ном ацетоне. MAb, специфичные в отношении BVDV, использовали для иммуногистохимии в сочетании с набором антитела против мышиного IgG, конъюгированного с пероксидазой АВС Elite (Vector Laboratories). Окрашивание развивалось с использованием пероксидазного субстрата VI Р (Vector Laboratories).

Результаты. Были сконструированы и высвобождены химерные вирусы СМ53637/Р-Erns и СМ53637/Р-Erns. Области от 5'UTR до Е2, включающие области химерного Erns вилорогой антилопы, были подтверждены секвенированием. Обе химеры были жизнеспособными и инфекционными и в клетках RD, и в ВК-6. При иммуногистохимическом окрашивании обе химеры не были реактивными в отношении MAb 15С5, специфичного в отношении BVDV Erns, но реактивными в отношении MAb 20.10.6, специфичного в отношении BVDV NS3.

Последовательность химерного пестивируса (BVDV-CM5960 (BVDV типа О)/Р-Erns) представлена в перечне последовательностей как SEQ ID NO: 31. Последовательность химерного пестивируса (BVDV-CM53637 (BVDV типа И)/Р-Erns) представлена в перечне последовательностей как SEQ ID NO: 32.

Химера СМ5960/Р-Erns была биологически клонирована ограниченным разведением (относительно методологии см. приведенный выше Пример 1).

Пример 3. Тестирование эффективности вакцин-кандидатов на основе химерного пестивируса в модели респираторного заболевания телят

Приобретали BVDV-отрицательных здоровых телят, случайным образом распределяли их в группы исследования и содержали под надзором осуществляющего уход ветеринара. Тестируемую вакцину объединяют со стерильным адъювантом и вводят либо внутримышечной (IM), либо подкожной (SC) инъекцией, либо интраназальной инокуляцией (IN). Вакцину дают в виде одной или двух доз. Две дозы вакцины вводят с интервалом от 21 до 28 суток.

Животных затем подвергают контрольному заражению на сутки 21-28 после последней вакцинации штаммом BVDV типа 1 или типа 2. Заражающий инокулят дают интраназально в виде 4-мл разделенной дозы, по 2 мл в ноздрю. На протяжении данного исследования также содержали контрольные группы, состоящие из невакцинированных незараженных животных и/или из невакцинированных зараженных животных.

Ежесуточно отслеживают клинические параметры, включающие ректальную температуру, депрессию, анорексию и диарею. Титры нейтрализации сыворотки определяют анализом устойчивого снижения содержания вируса в сыворотке на культуре бычьих клеток, используя последовательные разведения сыворотки в сочетании со штаммом BVDV типа 1 или 2. Выделение BVDV в культуре бычьих клеток после заражения проводят из образцов периферической крови. BVDV-положительную культуру клеток определяют путем непрямой иммунофлуоресценции. Для демонстрации защиты после заражения демонстрируют снижение частоты возникновения инфекции в вакцинированных группах по сравнению с контрольными группами.

Пример 4. Тестирование эффективности вакцины на основе химерного пестивируса в модели беременной коровы/теленка

BVDV-отрицательных коров и нетелей половозрелого возраста приобретают и случайным образом распределяют в вакцинируемую тест-группу или группу плацебо (контрольная группа). Коров дважды прививают внутримышечной (IM) или подкожной (SC) инъекцией либо вакцины, либо плацебо с интервалом от 21 до 28 суток. После второй вакцинации все коровы получают IM инъекцию простагландина для синхронизации течки. Коров, демонстрирующих течку, осеменяют посредством искусственного осеменения сертифицированной BVDV-отрицательной спермой. Приблизительно на 60 сутки беременности статус беременности коров устанавливают путем ректальной пальпации.

Приблизительно через 6 недель из каждой тестируемой группы случайным образом выбирают коров с подтвержденными беременностями. Каждой из этих коров проводят контрольное заражение интраназальной инокуляцией BVDV типа 1 или 2. Образцы крови отбирают в сутки заражения и в кратные интервалы после заражения с целью выделения BVDV.

Через двадцать восемь суток после заражения проводят левосторонние лапаротомии и извлекают амниотическую жидкость от каждой коровы. Непосредственно перед хирургическим вмешательством у каждой коровы берут пробы крови для анализов нейтрализации сыворотки. После родоразрешения путем кесарева сечения у каждого плода берут пробу крови. Плоды затем умерщвляют и ткани асептически собирают с целью выделения BVDV. В случаях, когда происходят спонтанные аборты, пробы крови у самок берут при обнаружении выкидыша и через две недели. Парные пробы крови и абортированных плодов подвергают серологическому тестированию и выделению вируса. Эффективность вакцины демонстрируют по отсутствию или снижению инфекции плода и по аборту на поздних сроках.

Пример 5. Диагностические анализы для дифференцировки между вакцинированным и инфицированным естественным путем крупным рогатым скотом

Крупный рогатый скот, вакцинированный вакциной по настоящему изобретению, можно подвергнуть сравнению с крупным рогатым скотом, инфицированным естественным путем BVDV дикого типа. Крупный рогатый скот разного возраста вакцинируют вакциной на основе либо живого, либо инактивированного химерного пестивируса согласно предоставленным инструкциям. Пробы сыворотки отбирают через 2-3 недели или позднее после вакцинации. Для дифференцировки между крупным рогатым скотом, который получил вакцину на основе химерного пестивируса, от крупного рогатого скота, инфицированного полевым (дикого типа) штаммом BVDV, пробы сыворотки тестируют посредством дифференциального диагностического анализа. Химерный пестивирус вызывает продукцию специфичных антител, которые связываются с Erns белком химерного пестивируса, но не с Erns белком, присутствующим на BVDV дикого типа. В контексте BVDV дикого типа верно обратное: генерируются специфичные антитела, которые распознают Erns белок, присутствующий на BVDV дикого типа, но не Erns белок, присутствующий на химерном пестивирусе. Способы анализа специфичности связывания и аффинности антитела хорошо известны в данной области техники и включают, без ограничения, такие форматы иммуноанализа, как конкурентный ELISA, прямой пептидный ELISA, разновидности вестерн-блоттинга, непрямые иммуноферментные анализы и тому подобное.

Для конкурентного ELISA в качестве источника антигенов используют целые или частичные вирусные антигены пестивируса дикого типа или химерного пестивируса, включая Erns белок (полученный естественным путем, синтетически или рекомбинантно). После покрытия планшета ELISA антигеном в щелочных условиях пробы сыворотки крупного рогатого скота и разведения добавляют вместе с оптимизированным разведением MAb, специфичного в отношении либо Erns белка BVDV дикого типа, либо Erns белка химерного пестивируса, и инкубируют в течение 30-90 мин. Для обеспечения колориметрического обнаружения связывания пероксидазу хрена или щелочную фосфатазу конъюгируют с данным MAb. После промывки планшетов добавляют хромогенный субстрат, специфичный в отношении фермента, и после конечной стадии инкубации измеряют оптическую плотность каждой лунки при длине волны, подходящей для используемого субстрата. Степень ингибирования связывания меченого MAb зависит от уровня антител в сыворотке крупного рогатого скота, которые специфично распознают белок, покрывающий планшет.

В случае, когда тестируемым антигеном является химерный Erns белок (например, Erns вилорогой антилопы), присутствующий на химерном пестивирусе, отсутствие связывания mAb, специфичным в отношении Е"13 химерного пестивируса, указывает на присутствие в сыворотке крупного рогатого скота антител, которые распознают эпитоп, специфичный для данного химерного пестивируса, что указывает на вакцинацию. В противоположность этому, сыворотка от крупного рогатого скота, не иммунизированного, но инфицированного естественным путем, не будет содержать антитела, которые будут связываться с Erns белком химерного пестивируса, покрывающим планшет. Следовательно, данное mAb, специфичное в отношении Erns химерного пестивируса, будет связываться со связанным белком и приводить к последующему развитию окраски.

В случае, когда тестируемым антигеном является Erns белок, присутствующий на BVDV дикого типа, отсутствие связывания mAb, специфичным в отношении Erns BVDV дикого типа, указывает на присутствие в сыворотке крупного рогатого скота антител, которые распознают эпитоп, специфичный в отношении BVDV дикого типа, указывая на естественную инфекцию (BVDV дикого типа). В противоположность этому, сыворотка от крупного рогатого скота, иммунизированного вакциной на основе химерного пестивируса, не будет содержать антитела, которые будут связываться с Erns белком BVDV дикого типа, покрывающим планшет. Следовательно, mAb, специфичные в отношении Erns BVDV дикого типа, будут связываться со связанным белком и приводить к последующему развитию окрашивания.

Для разработки такого анализа использовали следующие способы.

Во-первых, сконструировали рекомбинантный бакуловирус, экспрессирующий Erns BVDV-NADL. Часть белка С BVDV плюс полноразмерный Erns ген амплифицировали посредством ПЦР из плазмиды, содержащей полноразмерную кДНК BVDV-NADL с праймерами Олиго 250 (SEQ ID NO: 29; 5'-CACCATGAAAATAGTGCCCAAAGAATC-3') и Олиго 252 (SEQ ID NO: 30; 5'-TTAAGCGTATGCTCCAAACCACGTC-3'). Данный ПЦР-продукт клонировали в pENTR™ /D-TOPO (Invitrogen) и трансформировали в компетентную Е. coli One Shot® (Invitrogen) согласно инструкциям производителя. Рекомбинантную плазмиду извлекали и вставку подтверждали секвенированием. Эту плазмиду обозначили pENTR-Erns. pENTR-Erns и бакуловирусную систему экспрессии BaculoDirect™ (Invitrogen) использовали для конструирования рекомбинантного бакуловируса, экспрессирующего Erns BVDV-NADL, согласно инструкциям производителя. Генерировали рекомбинантный бакуловирус, экспрессирующий Erns BVDV-NADL, очищали из бляшек, наращивали и хранили как при 4°С, так и при -80°С. Экспрессию Erns BVDV-NADL в данном рекомбинантном бакуловирусе подтверждали иммунофлуоресцентным окрашиванием и вестерн-блоттингом против MAb 15C5, специфичного в отношении Erns BVDV, следуя традиционным способам вестерн-блоттинга.

Для продукции антигена ELISA клетки SF21 в 100 мл суспензионной культуры инфицировали 0,5 мл маточного раствора рекомбинантного бакуловируса. Клетки собирали после 4 суток инкубации при 27°С. Клетки центрифугировали при низкой скорости (примерно 800 g) в течение 10 мин для того, чтобы собрать данные клетки, и один раз промывали PBS. Клетки лизировали 150 мМ NaCI, 50 мМ Tris HCI, pH 8,0 и 1% игепал (IGEPAL) CA-630. Эту смесь сперва инкубировали на льду в течение 10 минут и затем при -80°С в течение 1 часа. После оттаивания смесь осветляли центрифугированием при 1000 g в течение 15 минут. Супернатант дополнительно осветляли центрифугированием при 8000 g в течение 20 минут при 4°С. Конечный супернатант, обозначенный лизат бакуло-Erns, разделяли на аликвоты и хранили при -80°С.

При проведении данного анализа планшеты ELISA покрывали в течение ночи при 4°С 100 мкл/лунку моноклональным антителом MAb WB210 (Агенство ветеринарных лабораторий; тип 1, специфичное в отношении Erns BVDV), разведенным 1:1000 в карбонатно/бикарбонатном буфере (рН 9,0). На следующие сутки планшеты промывали три раза и блокировали блокирующим буфером (PBS, содержащий 1% натриевой соли казеина и 0,05% Tween 20) при 37°С в течение 1 часа. Данные планшеты затем промывали три раза блокирующим буфером, добавляли в каждую лунку 100 мкл лизата бакуло-Erns (разведенного в PBS 1:3200) и планшеты инкубировали при 37°С в течение 1 часа. После трех промывок блокирующим буфером в лунки добавляли 100 мкл неразведенных проб сыворотки крупного рогатого скота, за исключением одной колонки лунок (для того чтобы она служила в качестве неконкурирующих контролей 15C5-HRP), и инкубировали при 37°С в течение 1 часа. После еще трех промывок блокирующим буфером в каждую лунку добавляли 100 мкл конъюгата MAb 15C5-HRP (специфичного в отношении Erns BVDV, разведенного 1:20000 в блокирующем буфере) и инкубировали при 37°С в течение 1 часа. После трех промывок блокирующим буфером в каждую лунку добавляли 100 мкл субстрата ABTS (растворы пероксидазных субстратов А+В; KPL, США) и инкубировали при комнатной температуре в течение 20-60 минут для развития окрашивания. Оптическую плотность (ОП) измеряли при длине волны 405 нм. Процентную долю снижения ОП для каждой пробы сыворотки рассчитывали по следующей формуле:

[1 - (ОП пробы+средняя ОП контролей 15C5-HRP)]×100%.

Результаты

Все пробы сыворотки, которые были тестированы анализом на нейтрализацию вируса (VN) как положительные, имели более чем 82%-ное снижение ОП, за исключением пробы №13851 (Таблица 4). Все пробы сыворотки, которые были тестированы анализом на нейтрализацию вируса как отрицательные, имели менее чем 17%-ное снижение ОП, за исключением пробы №5150 (Таблица 4). Данное расхождение можно объяснить различиями в том, как проводятся данные анализы, так как в них измеряют разные антитела, и доля специфичных антител варьирует среди животных.

Таблица 4.
Пробы сыворотки, положительные и отрицательные в отношении BVDV, в конкурентном ELISA s MAb15C5

ряда
№ пробы ОП пробы Средняя ОП колонки, без сыворотки % снижения
1 40021 0,0615 0,907013 93,21950182
2 40014 0,0965 0,907013 89,36068171
3 40422 0,0639 0,907013 92,95489701
4 40372 0,0754 0,907013 91,68699897
5 40222 0,0634 0,907013 93,01002301
6 40152 0,0894 0,907013 90,14347093
7 13461 0,0663 0,907013 92,6902922
8 13851 0,641 0,907013 29,32846607
9 13801 0,1599 0,907013 82,37070472
10 13904 0,073 0,907013 91,95160378
11 40504 0,0625 0,907013 93,10924981
12 40471 0,0914 0,907013 89,92296693
13 35037 0,0639 0,907013 92,95489701
14 13690 0,159 0,907013 82,46993152
15 13797 0,0859 0,907013 90,52935294
16 6127 0,0886 0,907013 90,23167253
17 5138 0,7434 0,907013 18,03866097
18 5139 0,8423 0,907013 7,13473787
19 5141 0,7732 0,907013 14,75315128
20 5142 0,7475 0,907013 17,58662776
21 5144 0,8293 0,907013 8,568013909
22 5145 0,9488 0,907013 -4,607100449
23 5146 0,9451 0,907013 -4,199168038
24 5147 1,0138 0,907013 -11,77348064
25 5148 0,9322 0,907013 -2,7769172
26 5149 0,9794 0,907013 -7,980811741
27 5150 0,1157 0,907013 87,24384325
Ряды 1-16: Положительные пробы сыворотки крупного рогатого скота
Ряды 17-27: Отрицательные пробы сыворотки крупного рогатого скота
- Все пробы сыворотки в ELISA использовали неразведенными

Хотя настоящее изобретение описано со значительными подробностями со ссылкой на его определенные варианты, возможны и другие варианты. Следовательно, объем прилагаемой формулы изобретения не должен ограничиваться описанием содержащихся здесь вариантов.

1. Химерный вирус диареи крупного рогатого скота (BVDV), способный обеспечить возможность дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа, который не экспрессирует его гомологичный Erns белок, где дополнительно указанный химерный вирус экспрессирует гетерологичный Erns белок, происходящий из пестивируса вилорогой антилопы (Р-Erns).

2. Штамм химерного вируса диареи крупного рогатого скота CM5960/Р-Erns, полученный путем замены гена Erns штамма CM5690 BVDV на ген Erns пестивируса вилорогой антилопы (Р-Erns), для использования для дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа.

3. Штамм химерного вируса диареи крупного рогатого скота CM5960/Р-Erns, полученный путем замены гена Erns штамма СМ53637 BVDV на ген Erns пестивируса вилорогой антилопы (Р-Erns), для использования для дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа.

4. Штамм химерного вируса диареи крупного рогатого скота, депонированный как АТСС РТА-9939 в Американской коллекции типовых культур (АТССR), для применения для дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа.

5. Клетка-хозяин, содержащая химерный вирус по п.1, для репликации указанного вируса.

6. Полинуклеотидная молекула, кодирующая химерный вирус по п.1.

7. Иммуногенная композиция для изготовления лекарственного средства для предупреждения или лечения инфекций, вызванных BVDV, содержащая химерный вирус по п.1 и ветеринарно приемлемый носитель.

8. Иммуногенная композиция для изготовления лекарственного средства для предупреждения или лечения инфекций, вызванных BVDV, содержащая полинуклеотидную молекулу по п.6 и ветеринарно приемлемый носитель.

9. Вакцина, содержащая химерный вирус по п.1 и ветеринарно приемлемый носитель, для дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа.

10. Набор, содержащий вакцину по п.9 в по меньшей мере одном контейнере и комплект напечатанных инструкций, для дифференцировки между крупным рогатым скотом, вакцинированным указанным химерным вирусом, и крупным рогатым скотом, инфицированным вирусом диареи крупного рогатого скота дикого типа.

11. Вакцина по п.9 для применения в лечении или предупреждения распространения инфекции, вызванной вирусом диареи крупного рогатого скота.

12. Способ дифференцировки между животным, вакцинированным вакциной по п.9, и животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, где животное, вакцинированное указанной вакциной, генерирует антитела к по меньшей мере одному эпитопу гетерологичного Erns белка, происходящего из пестивируса вилорогой антилопы, включающий стадии:
а) получения пробы сыворотки от животных;
б) проведения анализа указанных проб на присутствие или отсутствие антител;
в) идентификации животного, имеющего указанные антитела, как вакцинированного указанной вакциной; и
г) идентификации животного, не имеющего указанные антитела, как инфицированного BVDV (вирус диареи крупного рогатого скота) дикого типа.

13. Способ дифференцировки между животным, инфицированным вирусом диареи крупного рогатого скота дикого типа, и животным, вакцинированным вакциной по п.9, где животное, инфицированное вирусом диареи крупного рогатого скота дикого типа, генерирует антитела к по меньшей мере одному Erns эпитопу, который присутствует в вирусе диареи крупного рогатого скота дикого типа, но который не присутствует в химерном пестивирусе указанной вакцины, включающий стадии:
а) получения пробы сыворотки от животных;
б) проведения анализа указанных проб на присутствие или отсутствие антител;
в) идентификации животного, имеющего указанные антитела, как инфицированного BVDV дикого типа; и
г) идентификации животного, не имеющего указанные антитела, как вакцинированного указанной вакциной.



 

Похожие патенты:

Группа изобретений относится к области биохимии. Предложен L-фукоза α1→6-специфичный лектин, экстрагируемый из базидиального гриба или сумчатого гриба, характеризующийся пиковым значением молекулярной массы около 4500 m/z, определяемым при масс-спектрометрическом анализе MALDI-TOF.
Изобретение относится к медицине, в частности к области лабораторной диагностики рака молочной железы, и описывает набор реагентов для иммунногистохимической диагностики рака молочной железы, который позволяет одновременно или раздельно выявлять рецепторы эстрогена, прогестерона и HER2-рецепторы.
Изобретение относится к медицине, а именно к неонатологии, и может быть использовано для лечения респираторного дистресс-синдрома у новорожденных детей, находящихся на искусственной вентиляции легких (ИВЛ).

Группа изобретений относится к области медицины и может быть использована для получения костного мозга (КМ) от доноров-трупов. Для этого пунктируют крылья подвздошных костей в передней и задней трети крыльев, устанавливая в каждое по два троакара.

Изобретение относится к биологическим исследованиям и медицине и предназначено для идентификации неблагоприятного воздействия фенола, поступающего из среды обитания, на здоровье населения.
Изобретение относится к медицине. Более подробно изобретение относится к диагностике ревматоидного артрита.
Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для прогнозирования наступления беременности у женщин с трубно-перитонеальным бесплодием в результате лечения методом экстракорпорального оплодотворения (ЭКО).

Изобретение относится к иммунологии, аналитической биохимии и диагностике и представляет собой тест-полоску для высокочувствительного иммунохроматографического анализа.

Настоящее изобретение относится к области иммунологии. Предложено однодоменное мини-антитело, специфически связывающее белок-рецептор эпидермального фактора роста HER2/ERBB2/neu человека, полученное при иммунизации двугорбого верблюда (Camelus bactrianus) препаратом опухолевых клеток SKBR3, и охарактеризованное аминокислотной последовательностью.

Изобретение относится к диагностическим методам в медицине и может быть использовано в онкологии при адъювантной терапии опухолей, а также при длительном наблюдении за пациентами после оперативного удаления опухолей.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен рекомбинантный вирус классической чумы свиней (1111), содержащий делецию по меньшей мере одной аминокислоты в домене «TAVSPTTLR» белка Е2, соответствующем положениям 829-837 родительского полипротеина CSFV, а также соответствующая вакцина, молекула кДНК, способ защиты животного от CSFV и способ дифференциации инфицированных CSFV животных.

Изобретение относится к области молекулярной биологии, биоорганической химии и медицины. Заявляемые нанокомпозиты предназначены для направленного воздействия на генетический материал внутри клетки и подавления его дальнейшего функционирования.

Изобретение относится к области молекулярной биологии, генной инженерии и вирусологии. Предложен способ получения препарата, содержащего вирусные антигены, включающий а) инокуляцию клеток инфекционным вирусом в жидкости, b) репродукцию указанного вируса в указанных клетках, с) сбор указанного репродуцированного вируса, d) инактивацию указанного собранного вируса, и е) обработку указанного инактивированного вируса детергентом, приводящий к получению препарата, содержащего вирусные антигены.

Изобретение относится к области медицины, и молекулярной биологии, и вирусологии. .

Изобретение относится к области молекулярной биологии и вирусологии. .

Изобретение относится к области биотехнологии, молекулярной биологии, медицины и ветеринарии. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.

Изобретение относится к областям молекулярной биологии, вирусологии, иммунологии и медицины. .

Изобретение относится к биотехнологии и представляет собой онколитический аденовирусный вектор, клетку и фармацевтическую композицию, содержащую указанный вектор, а также применение указанных векторов в производстве лекарственного средства для лечения рака у субъекта и к способу лечения рака у субъекта.
Наверх