Способ отбора селекционных образцов растений гречихи



Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи
Способ отбора селекционных образцов растений гречихи

 


Владельцы патента RU 2525134:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) (RU)

Изобретение относится к области биохимии, в частности к cпособу отбора селекционных образцов растений гречихи, обладающих устойчивостью к стрессовым воздействиям, включающий: выращивание селектируемой и контрольной популяций при нормальных условиях с последующим помещением части образцов каждой популяции в стрессовые условия; сбор образцов ткани растений селектируемой и контрольной популяций, подвергнутых и не подвергнутых стрессовому воздействию; определение в собранных образцах уровней экспрессии предварительно выявленных генов, маркирующих уровень ответа на анализируемый тип стресса; сравнение уровня экспрессии генов в образцах, помещенных в стрессовые условия, и образцов, выращенных при нормальных условиях; отбор тех образцов, у которых наблюдается максимальное изменение уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса, по сравнению с контрольной популяцией. Изобретение позволяет провести выделение перспективного селекционного материала без анализа нескольких поколений потомков. 15 з.п. ф-лы, 2 табл.

 

Область техники

Настоящее изобретение относится к области биотехнологии, в частности к способу отбора селекционных образцов растений гречихи, основанному на определении уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса.

Уровень техники

Основу классической селекции составляет поиск растений, характеризующихся необходимым состоянием хозяйственно ценного признака. Целью данного поиска является обнаружение растений, сочетающих в себе наибольшее количество таких признаков и создание на их основе линий, обладающих всем комплексом необходимых состояний признаков. Затем путем нескольких последовательных скрещиваний создаются чистые линии, гомозиготные по генам, контролирующим развитие искомых признаков. За этим следует проверка полученных растений в полевых условиях. Получение сортов с заданными свойствами методами классической селекции обычно занимает более десяти лет и представляет собой дорогостоящий процесс, так как хозяйственно ценные признаки обычно контролируются большим количеством генов, а потому для нахождения растений с заданными признаками требуется мониторинг тысяч растений в популяциях после каждого скрещивания (Witcombe J.R., Virk, D.S. 2001 Number of crosses and population size for participatory and classical plant breeding. Euphytica 122, 451-462.). Одним из способов, которые существенно ускоряют ведение селекционного процесса, является использование ДНК-маркеров. ДНК-маркеры могут использоваться для определения наличия аллельных вариантов генов, контролирующих хозяйственно ценные признаки (Collard ВС, Mackill DJ. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philos Trans R Soc Lond В Biol Sci. 2008 Feb 12; 63(1491):557-72; патентная заявка Японии JP 011188846).

Одними из часто используемых являются SSR-маркеры (Simple Sequence Repeats) благодаря высокой повторяемости результатов при их использовании, возможности выявления гетерозигот и относительной дешевизне. Однако зачастую эти маркеры требуют разделения продуктов амплификации в полиакриламидном геле (ПААГ), что затрудняет их использование в селекционных центрах. Другие типы маркеров основаны на известной нуклеотидной последовательности маркируемого участка ДНК: STS (sequence tagged site), SCAR или SNP (Shan, X., Blake, T. K. and Talbert, L.E. 1999 Conversion of AFLP markers to sequence-specific PCR markers in barley and wheat. Theor. Appl. Genet. 98, 1072-1078; Sharp P. J., Johnston S., Brown G., McIntosh RA., Pallotta M., Carter M., Bariana HS., Khartkar S., Lagudah ES., Singh RP., Khairallah M., Potter R., Jones MGK. 2001 Validation of molecular markers for wheat breeding. Aust. J. Agric. Res. 52, 1357-1366; Sanchez, А.С., Brar, D. S., Huang, N., Li, Z. and Khush, G.S. 2000 Sequence tagged site marker-assisted selection for three bacterial blight resistance genes in rice. Crop Sci. 40, 792-797). Также широко распространены маркеры, сцепленные с локусами, кодирующими количественные признаки (QTL). На сегодняшний день определено множество ДНК-маркеров, связанных с QTL, однако данные маркеры необходимо тестировать для каждого конкретного исследования, так как множество QTL на данный момент определены неточно (Melchinger, A.E., Utz H.F., Schon C.C. 1998 Quantitative trait locus (QTL) mapping using different testers and independent population samples in maize reveals low power of QTL detection and large bias in estimates of QTL effects. Genetics 149, 383-403; заявка РСТ WO 2009029771).

ДНК-маркеры, связанные с исследуемым признаком, способствуют существенному ускорению селекционного процесса, так как их использование проще, чем фенотипический анализ. Селекцию с использованием ДНК-маркеров можно проводить еще на стадии проростков, что существенно экономит время и ресурсы, а также возможность отбирать отдельные растения вместо выращивания множества растений для последующего отбора потомков (Ribaut, J.-M. and Hoisington, D. 1998 Marker-assisted selection: new tools and strategies. Trends Plant Sci. 3, 236-239.; Morris, M., Dreher, K., Ribaut, J. M. and Khairallah, M. 2003 Money matters (II): costs of maize inbred line conversion schemes at CIMMYT using conventional and marker assisted selection. Mol. Breed. 11, 235-247; заявка РСТ W09841655). Помимо этого их использование позволяет определить гетерозиготные состояния необходимых генов у образцов и прогнозировать получение потомства с необходимыми свойствами.

Существует множество примеров, когда селекция с использованием ДНК-маркеров способствовала ускорению работ по выведению новых сортов и форм растений. Например, были определены SSR и STS маркеры риса, использование которых проще и дешевле стандартных тестов на чистоту популяции (Yashitola, J., Thirumurugan, Т., Sundaram, R.M., Naseerullah, M.K., Ramesha, M.S., Sarma, N.P. and Sonti, R.V. 2002 Assessment of purity of rice hybrids using microsatellite and STS markers. Crop Sci. 42, 1369-1373; патентная заявка Китая CN101436229). Еще одним примером успешного использования маркеров является определение локуса, контролирующего развитие защитных механизмов пшеницы к фузариозу (одному из основных заболеваний пшеницы, вызываемых грибом Fusarium) (Liu, S.X. and Anderson, J.A. 2003 Marker assisted evaluation of Fusarium head blight resistant wheat germplasm. Crop Sci. 43, 760-766). На данный момент существует множество определенных ДНК-маркеров, ассоциированных с хозяйственно ценными признаками. ДНК-маркеры также используются для производства гибридных культур. Их использование направлено на получение данных о локусах, которые в результате гибридизации смогут показать наилучший уровень гетерозиса (Reif, J. С., Melchinger, A.E., Xia, X.С., Warburton, M.L., Hoisington, D.A., Vasal, S.K., Beck, D., Bohn, M. and Frisch, M. 2003 Use of SSRs for establishing heterotic groups in subtropical maize. Theor. Appl. Genet. 107, 947-957.). Также ДНК-маркеры используются для определения изменения аллельных частот во время селекционного процесса (Steele, K.А., Edwards, G., Zhu, J. and Witcombe, J. R. 2004 Marker-evaluated selection in rice: shifts in allele frequency among bulks selected in contrasting agricultural environments identify genomic regions of importance to rice adaptation and breeding. Theor. Appl. Genet. 109, 1247-1260.). ДНК-маркеры также используются в «пирамидировании» - комбинировании ряда генов в одном генотипе. «Пирамидирование» заключается в последовательной гибридизации растений с целью объединения генов, однако только с помощью ДНК-маркирования возможно определить, какое количество генов уже объединено в один генотип. Одним из основных направлений «пирамидирования» является комбинирование множества генов, контролирующих развитие устойчивости к различным болезням, что делает невозможным типирование полученного растения на уровне фенотипа (Hoppers, F.J. and Pretorius, Z. A. 1997 Effects of combinations amongst genes Lrl3, Lr34 and Lr37 on components of resistance in wheat to leaf rust. Plant Pathol. 46, 737-750.; Shanti, M.L., George, M.L.C., Cruz, C.M.V., Bernardo, M.A., Nelson, R.J., Leung, H., Reddy, J.N. and Sridhar, R. 2001 Identification of resistance genes effective against rice bacterial blight pathogen in eastern India. Plant Dis. 85, 506-512; Singh, S., Sidhu, J.S., Huang, N., Vikal, Y., Li, Z., Brar, D. S., Dhaliwal, H.S. and Khush, G.S. 2001 Pyramiding three bacterial blight resistance genes (xa5, xal3 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet. 102, 1011-1015). Так, например, удалось объединить ген, контролирующий качественную устойчивость к ржавчине у ячменя с двумя QTL, контролирующими количественное проявление данного признака (Castro, A.J. 2003 Mapping and pyramiding of qualitative and quantitative resistance to stripe rust in barley. Theor. Appl. Genet. 107, 922-930.). В теории метод пирамидирования может быть использован для объединения генов от трех и более родителей путем последовательных скрещиваний.

Также в отличие от классической селекции мониторинг с использованием ДНК-маркеров может быть осуществлен на любой стадии селекционного процесса. Это позволяет отбирать формы с неудачным сочетанием генов, снижая, таким образом, число растений, которые будут анализироваться в последующем поколении.

Однако несмотря на несомненные преимущества использования ДНК-маркеров в селекционном процессе у данного метода остается множество недостатков. Во-первых, ДНК-маркер сцеплен всего с одним локусом, в результате для проверки растения на наличие искомых аллельных вариантов необходимо использование нескольких маркеров. При этом даже большое количество маркеров не может охватить все локусы, участвующие в развитии признака. Также разработка новых маркеров занимает много времени, так как необходимо, чтобы полученный ДНК-маркер соответствовал ряду необходимых признаков, например был тесно сцеплен с исследуемым локусом, что невозможно определить только на одной популяции растений. Еще одно ограничение, связанное с использованием маркеров этого типа, вызвано тем, что различные локусы, контролирующие развитие количественных признаков, могут проявлять себя по-разному в зависимости от генетического фона и могут быть неприменимы для некоторых популяций (Liao, С.Y., Wu, P., Hu, В. and Yi, K.K. 2001 Effects of genetic background and environment on QTLs and epistasis for rice (Oryza sativa L.) panicle number. Theor. Appl. Genet. 103, 104-111).

Методом, который учитывает недостатки единичных ДНК-маркеров, стала геномная селекция (Meuwissen, Т.Н.Е., Hayes, В.J., and Goddard, М.Е. (2001). Prediction of total genetic value using genome-wide dense marker maps. Genetics 157, 1819-1829.). Принцип геномной селекции заключается в определении маркеров количественных признаков с использованием полногеномного генотипирования. На практике маркеры для проведения геномной селекции определяются на одной популяции, а проверяются на другой. Таким образом, оцениваются все вероятные ошибки (эффекты), связанные с разработкой маркера. В итоге с использованием данного метода возможно комплексное изучение сложных признаков с более высокой точностью. Однако на данный момент стоимость эксперимента по широкомасштабному генотипированию сильно превышает стоимость одиночных ДНК-маркеров, и пока используется только для компьютерных симуляций по разработке математических алгоритмов, позволяющих повысить точность исследуемых маркеров (Lorenz AJ., Chao SM., Asoro FG., Heffner EL., Hayashi Т., Iwata Н., Smith., Sorrells ME., Jannink JL 2011. Genomic selection in plant breeding: knowledge and prospects. Advances in Agronomy 110, 77-123.). Учитывая сложность генетических сетей контролирующих формирование признаков, возможность применения этого подхода нуждается в проведении дальнейших исследований.

Предлагаемый авторами настоящего изобретения метод основан на полногеномных исследованиях, но не геномов, а транскриптомов. Его использование позволяет проводить мониторинг функционирования генетической сети, контролирующей развитие того или иного селекционно значимого признака вне зависимости от конкретных состояний генов, что позволяет точнее охарактеризовать системы с большим числом степеней свободы, пропорциональным числу генов в сети регуляции. Помимо этого такой анализ позволяет находить узкие места в генетических сетях, в которых происходит падение сигнала, приводящего к развитию нужного состояния признака, и осуществлять направленную селекцию с отбором на функционирование данного участка генетической сети.

Раскрытие изобретения

Задачей предлагаемого изобретения является разработка способа отбора селекционных образцов растений гречихи, основанного на оценке состояния генетических сетей, контролирующих развитие хозяйственно-значимых признаков.

Технический результат настоящего изобретения заключается в снижении сроков проведения селекции, направленной на получение новых сортов. Настоящее изобретение позволяет проводить отбор на малых выборках растений в каждом поколении сразу по нескольким десяткам признаков, что может существенно ускорить селекционный процесс.

Поставленная задача решается тем, что способ отбора селекционных образцов растений гречихи включает выращивание селектируемой и контрольной популяций при нормальных условиях с последующим помещением части образцов каждой популяции в стрессовые условия; сбор образцов ткани растений селектируемой и контрольной популяций, подвергнутых и не подвергнутых стрессовому воздействию; определение в собранных образцах уровней экспрессии предварительно выявленных генов, маркирующих уровень ответа на анализируемый тип стресса; сравнение уровня экспрессии генов в образцах, помещенных в стрессовые условия, и образцов выращенных при нормальных условиях; отбор тех образцов, у которых наблюдается максимальное изменение уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса, по сравнению с контрольной популяцией.

Для отбора селекционных образцов растений проводят сравнение уровней экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса в селектрируемой и контрольной популяциях. При этом проводят отбор тех образцов из селектрируемой популяции, в которых наблюдается максимальный уровень изменения экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса по сравнению с контрольной популяцией.

Для этого на предварительном этапе проводят поиск генов маркирующих уровень ответа на анализируемый тип стресса. Поиск таких генов осуществляют путем сравнения уровня экспрессии генов в растениях, подвергнутых и не подвергнутых стрессовым воздействиям, на устойчивость к которым предполагается осуществлять селекцию. Анализ может осуществляться при помощи высокопроизводительных методов Microarray (Schena M, Shalon D, Davis RW, Brown PO. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science. 1995 Oct 20; 270(5235):4б7-70.) или RNA-seq (Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, Snyder M. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science. 2008 Jun 6; 320(5881): 1344-9. doi: 10.1126/science. 1158441. Epub 2008 May 1). В результате определяют список генов, имеющих значимое различие в уровне экспрессии у растений, подвергнутых и не подвергнутых стрессовому воздействию. На основании полученных списков выделяют гены, специфически маркирующие ответ каждый из проанализированных типов стрессам. Также выделяют стабильно экспрессирующиеся при всех видах стрессов гены, которые используют как референсные при анализе экспрессии методом полимеразной цепной реакции продуктов обратной транскрипции с детекцией результатов в режиме реального времени (ОТ-ПЦР РВ). К выбранным генам или их части подбирают праймеры для проведения ОТ-ПЦР РВ. В процессе отбора селекционных образцов в селектируемой популяции проводят анализ уровня экспрессии генов в образцах контрольной и селектируемой популяций, как подвергнутых так и не подвергнутых стрессовым воздействиям, методом ОТ-ПЦР РВ. На основании полученных результатов проводят обор образцов, характеризующихся максимальным изменением уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса, в направлении (увеличение или уменьшение), в котором оно происходит у контрольного образца.

Согласно настоящему изобретению в качестве образца для эксперимента по выявлению и анализу экспрессии генов, контролирующих ответ на воздействие стрессовых условий, может быть использовано растение возраста 12-14 дней, характеризующееся развитыми семядолями. В качестве образца ткани растения могут быть использованы любые части растения, в частности семядоли или части семядолей растений. При этом для специалиста очевидно, что предпочтительно осуществлять сбор образцов ткани в одно и то же время светового цикла.

Согласно настоящему изобретению под термином «селектируемая популяция» подразумевается набор образцов, из которых проводится выбор растений обладающих нужным признаком.

Согласно настоящему изобретению под термином «контрольная популяция» подразумевается набор образцов, с которым проводится сравнение, представляющих районированный сорт или исходную популяцию.

Анализ экспрессии генов представляет собой определение концентрации мРНК исследуемых генов в пробе, сравнение количества мРНК в образцах, подвергнутых воздействию стрессовых условий, с контрольными образцами. Методы проведения анализа экспрессии генов не ограничены каким-либо специальным образом. В частности, анализ экспрессии генов может осуществляться с помощью полимеразной цепной реакции продуктов обратной транскрипции с детекцией результатов в режиме реального времени (ОТ-ПЦР РВ). Принцип метода основывается на корреляции количества ПЦР-продукта с интенсивностью флуоресцентного сигнала. Детекция флуоресцентного сигнала происходит на каждом цикле, по завершении реакции рассчитывается пороговый цикл (Ct), на котором уровень флуоресценции превышает фоновое свечение. Метод основан на том, что чем больше было исходное количество исследуемой ДНК или кДНК, тем быстрее появляется флуоресцентный сигнал и тем меньше значение Ct.

Согласно настоящему изобретению предварительно могут быть выявлены гены, маркирующие уровень ответа на анализируемый тип стресса, путем выращивания образцов сорта гречихи при нормальных условиях с последующим помещением части образцов в различные стрессовые условия; сбора образцов ткани растений, подвергнутых и не подвергнутых стрессовым воздействиям; анализа уровня экспрессии всех генов в подвергнутых и не подвергнутых стрессовому воздействия образцах; сравнения уровней экспрессии генов в образцах, подвергнутых разным типам стрессов; выявления генов, специфически изменяющих уровень экспрессии в ответ на анализируемый тип стресса.

Согласно настоящему изобретению термин «гены, маркирующие уровень экспрессии анализируемого стресса» (или «гены, маркирующих уровень ответа на анализируемый тип стресса») означает гены, значимо изменяющие уровень экспрессии при данном типе стресса (увеличивающие или уменьшающие) по сравнению с контрольными образцами, в то время как при остальных типах стресса уровни экспрессии данных генов остаются неизменными. Также гены, не изменяющие уровень экспрессии, в то время как при всех остальных типах стресса уровни экспрессии данных генов значимо изменяются.

Согласно настоящему изобретению термин «гены, специфически изменяющие уровень экспрессии» означает гены, значимо увеличивающие или уменьшающие уровень экспрессии в ответ на определенный тип стрессового воздействия.

Термин «референсные гены» означает гены, экспрессирующиеся стабильно вне зависимости от стадии развития образца или от влияния факторов внешней среды. Используются при анализе экспрессии для нивелирования погрешностей эксперимента, а также для нормирования на исходное количество материала.

Частными примерами генов, маркирующих уровень ответа на анализируемый тип стресса, являются гены, характеризующиеся нуклеотидными последовательностями SEQ ID NO:1-32, а также гомологичные им гены, имеющие сходную нуклеотидную последовательность, имеющие общее происхождение и выполняющие сходные функции в исследуемых организмах, в частности гены, имеющие нуклеотидную последовательность на 95% гомологичную последовательности, представленной в SEQ ID NO:1-32. Гомология между последовательностями может быть установлена с использованием хорошо известных методов, например с помощью утилиты BLAST.

Согласно настоящему изобретению в качестве селектируемых образцов могут быть использованы межвидовые гибриды, представляющие собой формы, полученные в результате скрещивания растений, принадлежащих к различным видам. При этом в качестве контрольных образцов могут быть использованы дикие формы, представляющие собой растения, имеющие общее происхождение с культурными формами, однако не подвергавшиеся воздействию искусственного отбора.

Согласно настоящему изобретению в качестве селектируемых образцов может быть использован материал, полученный при проведении мутагенеза, а в качестве контрольных образцов - растения исходной линии, не подвергавшиеся действию мутагенеза. Под термином «мутагенез» понимается неспецифическое внесение изменений в нуклеотидную последовательность посредством химических или физических воздействий на организм, частные примеры которых хорошо известны специалисту в данной области техники.

Предлагаемый способ позволяет производить отбор растений, устойчивых к различным типам стресса (стрессовым условиям, стрессовым воздействиям). Частными примерами, не ограничивающими настоящее изобретение, являются кратковременное воздействие высокой температурой, долговременное воздействие высокой температурой, кратковременное воздействие низкой температурой, долговременное воздействие низкой температурой, долговременное воздействие избыточным освещением, долговременное воздействие недостаточным освещением, раневое воздействие. При этом для специалиста также очевидно, что раневой стресс может служить моделью биотического стресса.

Согласно настоящему изобретению растения гречихи до их помещения в стрессовые условия, а также растения, не подвергающиеся стрессовым воздействиям, выращивают при нормальных условиях, в частности растения могут быть выращены следующих параметрах: температура 22-24°С, освещенность 5000-7000 люкс, влажность 50-60%.

Осуществление изобретения

Гречиха занимает второе место по потреблению крупяных культур в России, уступая только рису, что делает ее одной из самых важных культивируемых культур в стране. На данный момент существует множество примеров успешного использования современных методов биотехнологии, в результате использования которых были выведены новые сорта растительных культур: например экспериментальная полиплоидия, химический мутагенез и т.д. В качестве примера успешной биотехнологической работы можно привести карликовые сорта злаков, которые характеризуются большей урожайностью в условиях орошения, где они имеют большее преимущество по сравнению с высокорослыми формами.

Центром происхождения гречихи является Юго-Восточная Азия, характеризующаяся влажным жарким климатом, из-за чего гречиха несмотря на введение в культуру более 5 тысяч лет назад остается чувствительной к низким температурам и засухе, что существенно ограничивает ареал ее культивирования в России.

Для получения исходных данных для поиска генов, маркирующих ответ на стрессовые воздействия, растения на стадии семядолей подвергались воздействию ряда основных абиотических стрессов. Использовались следующие типы воздействий: высокая температура (42°С), низкая температура (4°С), избыточное освещение (40000 люкс), отсутствие освещения, ранение как имитация ответа на биотический стресс. Все стрессовые воздействия, кроме изменения уровня освещенности были сделаны кратковременными (1 час) и долговременными (24 часа). Затем был проведен сбор и анализ полученных образцов методом RNA-seq.

В результате были получены уровни экспрессии всех генов гречихи относительно контрольного образца и определены несколько классов генов: участвующие в неспецифическом ответе на стресс, изменяющие экспрессию только при одном типе воздействия, гены, не изменяющие экспрессию ни при одном типе воздействий (табл. 1).

Таблица 1
Число генов, участвующих в ответе на стресс и/маркирующих разные виды стрессов
Тип стресса. Гены, маркирующие стрессы Гены, участвующие в ответе на стресс
увеличением экспрессии уменьшением экспрессии наблюдается увеличение экспрессии наблюдается уменьшение экспрессии
Темнота 24 часа 244 370 872 2162
Высокая 186 420 634 1857
температура, 1 час
Высокая температура, 24 часа 1020 304 1925 2173
Избыточное освещение, 24 часа 77 202 385 875
Низкая температура, 1 час 280 26 265 280
Низкая температура, 24 часа 425 237 947 1747
Ранение, 1 час(биотический стресс) 507 357 1430 1650
Ранение, 24 часа (биотический стресс) 292 75 727 382
Контрольные гены для анализа экспрессии методом ОТ ПЦР РВ 2651
Всего уникальных генов 3031 1991 3996 4317

На основании полученных данных были выделены гены, специфически маркирующие каждый вид воздействия. В таблице 2 приведены последовательности генов, специфически маркирующих ответ на 8 типов стрессовых воздействий, определенных в результате анализа образцов, и праймеры для амплификации этих генов при анализе их экспрессии.

В процессе проведения отбора селекционных образцов из растений контрольной и селектируемой популяций, подвергнутых и не подвергнутых стрессовому воздействию, проводили выделение РНК и процедуру обратной транскрипции по методу (Demidenko NV, Logacheva MD, Penin AA. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data. PLoS One. 2011 May 12; 6(5):el9434. doi: 10.1371/journal.pone.0019434.). Полученный образец использовали для определения уровней экспрессии генов методом ОТ-ПЦР РВ по стандартной методике (Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009 Apr; 55(4):611-22. doi: 10.1373/clinchem.2008. 112797. Epub 2009 Feb 26.). На основании полученных результатов проводили обор образцов, обладающих максимальным уровнем изменения уровня экспрессии генов, маркирующих стресс, по сравнению с контрольной популяцией.

Основным преимуществом использования подобных маркеров является то, что их использование позволяет проводить отбор на малых выборках растений в каждом поколении сразу по нескольким десяткам признаков, что может существенно ускорить селекционный процесс. В отличие от классически используемых ДНК-маркеров отдельных локусов, отвечающих за хозяйственно важные признаки, использование экспрессионных маркеров существенно расширяет возможности селекции, так как большинство признаков контролируется несколькими десятками, а в некоторых случаях и сотнями генов. Таким образом, мониторинг данных признаков с помощью анализа экспрессии ключевых регуляторов позволяет одновременно оценивать состояние всего пути, контролирующего данный признак.

1. Способ отбора селекционных образцов растений гречихи, обладающих устойчивостью к стрессовым воздействиям, включающий: выращивание селектируемой и контрольной популяций при нормальных условиях с последующим помещением части образцов каждой популяции в стрессовые условия; сбор образцов ткани растений селектируемой и контрольной популяций, подвергнутых и не подвергнутых стрессовому воздействию; определение в собранных образцах уровней экспрессии предварительно выявленных генов, маркирующих уровень ответа на анализируемый тип стресса, в качестве которых используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO: 1-32; сравнение уровня экспрессии генов в образцах, помещенных в стрессовые условия, и образцов, выращенных при нормальных условиях; отбор тех образцов, у которых наблюдается максимальное изменение уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса, по сравнению с контрольной популяцией.

2. Способ по п.1, характеризующийся тем, что выявление генов, маркирующих уровень ответа на анализируемый тип стресса, включает: выращивание образцов сорта гречихи при нормальных условиях с последующим помещением части образцов в различные стрессовые условия; сбор образцов ткани растений подвергнутых и не подвергнутых стрессовым воздействиям; анализ уровня экспрессии всех генов в подвергнутых и не подвергнутых стрессовому воздействию образцах; сравнение уровней экспрессии генов в образцах, подвергнутых разным типам стрессов; выявление генов, специфически изменяющих уровень экспрессии в ответ на анализируемый тип стресса.

3. Способ по п.1, характеризующийся тем, что отбирают селектируемые образцы, характеризующиеся максимальным изменением уровня экспрессии генов, маркирующих уровень ответа на анализируемый тип стресса, в направлении, в котором оно происходит у контрольного образца.

4. Способ по п.1, характеризующийся тем, что сбор образцов ткани проводят в одно и то же время светового цикла.

5. Способ по п.1, характеризующийся тем, что уровень экспрессии генов определяют методом полимеразной цепной реакции продуктов обратной транскрипции с детекцией результатов в режиме реального времени с использованием референсных генов.

6. Способ по п.5, характеризующийся тем, что в качестве референсных генов используют не менее двух генов, имеющих последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:33-37.

7. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют кратковременное воздействие высокой температурой, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:1-4.

8. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют долговременное воздействие высокой температурой, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:5-8.

9. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют кратковременное воздействие низкой температурой, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:9-12.

10. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют долговременное воздействие низкой температурой, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:13-16.

11. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют долговременное воздействие избыточным освещением, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:17-20.

12. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют долговременное воздействие недостаточным освещением, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:21-24.

13. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют раневое воздействие, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:25-28; при этом определение уровня экспрессии генов проводят через час после воздействия.

14. Способ по п.1, характеризующийся тем, что в качестве стрессового воздействия используют раневое воздействие, а в качестве гена(ов), маркирующего(их) уровень ответа на анализируемый тип стресса, используют один или несколько генов, имеющих нуклеотидную последовательность, выбранную из группы, включающей последовательности, представленные в SEQ ID NO:29-32; при этом определение уровня экспрессии генов проводят через 23-25 часов после воздействия.

15. Способ по п.1, характеризующийся тем, что в качестве селектируемых образцов используют межвидовые гибриды, а в качестве контрольных образцов дикие формы, устойчивые к анализируемым стрессовым воздействиям.

16. Способ по п.1 характеризующийся тем, что в качестве селектируемых образцов используют материал, полученный при проведении мутагенеза, а в качестве контрольных образцов используют растения исходной линии.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способу молекулярно-генетической идентификации стерильности/фертильности пыльцы подсолнечника. Способ включает анализ тотальной ДНК исследуемых образцов на наличие/отсутствие митохондриального гена orfH522 и маркерной последовательности ядерного гена Rf1 с помощью мультиплексной полимеразной цепной реакции с использованием первой пары праймеров: agtagcccgttccgtgtttatgga и ctttctatttgggtcatcgccgga, идентифицирующей ген orfH522 цитоплазматической мужской стерильности пыльцы (ЦМС РЕТ1), и второй пары праймеров: ggcatgatcaagtacataagcacagtc и tatgtacgggaatgagctccggtt, идентифицирующей маркерную последовательность гена Rf1 - восстановителя фертильности пыльцы ЦМС РЕТ1, при этом образец определяют как фертильный, если а) присутствует и orfH522, и маркер гена Rf1, б) отсутствует orfH522 и присутствует маркер гена Rf1, в) отсутствует и orfH522, и маркер гена Rf1, и образец определяют как стерильный, если присутствует orfH522 и отсутствует маркер гена Rf1.

Изобретение относится к области сельского хозяйства, в частности к способам генетико-селекционных исследований. Изобретение представляет собой способ оценки реализации элементарных двойных диплоидных геномов в полиплоидных полигеномных пшеницах, включающий выращивание в одинаковых условиях полиплоидных пшениц и мелкогабитусного диплоидного мутанта, анализ их количественных признаков и последующее сравнение результатов анализа, по которым оценивают реализацию диплоидного генома.
Изобретение относится к области физиологии растений. Изобретение представляет собой способ оценки устойчивости растений к засолению почвы.

Изобретения относятся к области сельского хозяйства. Способ включает высев на полях комплекса сортов пшеницы, расположенных совместно в регионе.
Способ относится к области сельского хозяйства, в частности к плодоводству и селекции. Способ включает промораживание однолетних побегов в период покоя в камере искусственного климата.

Изобретение относится к области селекции сельскохозяйственных растений. Изобретение представляет собой способ оценки кислотоустойчивости сельскохозяйственных растений, включающий размещение зерен в инертном носителе с дистиллированной водой с низкой (стресс-фактор) и нейтральной (контроль) pH, воду заменяют ежедневно в одно и то же время суток на дистиллированную воду с низкой и нейтральной pH соответственно, замеряют массу корней (mr), массу побегов (ms), общую массу растений (mp), длину побегов (l), оценку проводят по коэффициенту редукции, при этом, если Кред ≥1 - растение ацидофильное; 0,5<Кред<1 - растение толерантное к высокой кислотности; Кред<0,5 - растение кислоточувствительное.
Изобретение относится к области сельского хозяйства. Изобретение представляет собой способ ускоренной оценки устойчивости сортов гороха к Bruchus pisorum L.

Изобретение относится к области сельского хозяйства. Изобретение представляет собой способ отбора засухоустойчивых растений рапса (Brassica napus L.), включающий измерение длины левого и правого семядольных листьев растений рапса в образце, определение показателя флуктуирующей асимметрии, при этом в качестве засухоустойчивых растений рапса отбирают растения с величиной флуктуирующей асимметрии, равной или меньше 0,031±0,0060.

Изобретение относится к области сельского хозяйства, в частности к селекции растений. Способ включает отбор более устойчивых к растрескиванию стручков образцов путем анализа высоты плотной перегородки в области гинофора в фазу зеленого стручка.
Изобретение относится к области сельского хозяйства, в частности к селекции. .
Изобретение относится к области сельского хозяйства, в частности к интродукции, и может найти применение при внедрении новых сортов зернобобовых культур. В способе местные районированные сорта высевают широкорядно, на 2-3 недели раньше интродуцентов. После появления всходов осуществляют внекорневую подкормку 0,3-0,5% раствором парааминобензойной кислоты с последующим рыхлением междурядий и посевом в них интродуцируемых сортов. Способ позволяет упростить процесс интродукции и повысить его эффективность. 1 табл., 3 пр.
Изобретение относится к сельскому хозяйству. Изобретение представляет собой способ выращивания растений топинамбура и включает в себя оценку исходного материала, отбор среди них биотипов по хозяйственно-ценным признакам, выращивание растений топинамбура в пробирочной культуре на питательной агаризованной среде Мурасиге-Скуга, после высадки пробирочных ростков в пробирки на среду и достижения растениями 5-6 листочков и развития корневой системы производят черенкование, затем растения в фазе 10-15 листочков и развития корневой системы или образования микроклубней пересаживают в грунт, а оценку по здоровью проводят визуально, к здоровым относят растения, у которых не выделены экземпляры с признаками поражения болезнями, а отбор хозяйственно-ценных и морфологических признаков производят в период уборки по более высокой продуктивности с покустной оценкой каждого растения. Использование заявленного способа позволяет улучшить условия выращивания топинамбура, осуществить раннюю диагностику заболеваний, повысить надежность и эффективность отбора для семеноводческих хозяйств, повысить качество получения семенного материала, оздоровить семенной топинамбур. 1 табл., 2 пр.

Изобретение относится к сельскому хозяйству и биотехнологии. Гибридную линию яровой мягкой пшеницы, содержащую фрагмент хромосомы с двумя генами от Aegilops speltoides: ген, определяющий удлинение срока колошения (VRN-Asp1), и ген устойчивости к бурой ржавчине (LrAsp5), скрещивают с линией, содержащей ген устойчивости к мучнистой росе (Pm) из генома ржи Secale cereale, и растения поколения F1 самоопыляют до поколения F2. Из поколения F2 с помощью молекулярного ПЦР-маркера Pr1/Pr5 отбирают растения, содержащие гены VRN-Asp1 и LrAsp5 в гомозиготном состоянии. Отобранные с помощью ПЦР-маркера Pr1/Pr5 растения F2 с генами VRN-Asp1 и LrAsp5 проверяют ПЦР-маркером SCM009 для выявления растений с геном Pm устойчивости к мучнистой росе. Использование заявленного способа позволяет упростить известный способ и создать линии яровой мягкой пщеницы с удлиненным сроком колошения и с комплексной устойчивостью к грибным болезням. 2 ил., 3 табл.
Изобретение относится к области сельского хозяйства, в частности к селекции. Изобретение представляет собой способ повышения коэффициента размножения капусты белокочанной в условиях in vitro, включающий выращивание эксплантов, культирование их на питательной среде Мурасиге-Скуга, внесение в нее регуляторов роста тидиазурон в концентрации 1 мг/л в сочетании с индолил-3-уксусной кислотой - 0,5 мг/л, при использовании цветолож размером 0,2-0,3 мм, изолированных из бутонов длиной 0,5-0,7 мм, где цветоложе используют за 1-2 дня до распускания цветков и после выращивания их на питательных средах культивируют до образования почек в течение 14-21 суток. Способ позволяет получить большое количество растений-регенерантов с признаками ЦМС и получить генетически стабильный урожай селекционных образцов. 3 табл.

Изобретение относится к области сельского хозяйства, в частности к физиологии сельскохозяйственных растений и селекции. Способ включает отбор проб, определение площади листьев, биометрических показателей путем определения количества и массы отдельных органов растений по фазам роста и развития, учет накопления вегетативной массы всего растения и семян за период развития, фотосинтетического потенциала. Показатель продуктивности фотосинтетического потенциала рассчитывают по выражению П Ф П = Б П Ф П , где БП - биологическая урожайность семян с 1 га; ФП - фотосинтетический потенциал, сформированный за весь период вегетации на 1 га посева. Способ позволяет определять величину накопления органического вещества в вегетативных и репродуктивных органах на единицу фотосинтетического потенциала. 1 ил., 1 табл., 1 пр.

Изобретение относится к биотехнологии. Изобретение представляет собой способ выращивания ячменя с применением обработки защитно-стимулирующим комплексом, где семена ячменя замачивают водным раствором комплекса биологически активных веществ кормовой добавки Флоравит® с концентрацией 1*10-4 мг/мл и расходе 10 л/т семян и растения ячменя в фазу кущения опрыскивают водным раствором комплекса биологически активных веществ кормовой добавки Флоравит® с концентрацией 1*10-4 мг/мл и расходе раствора 200-250 л/га. Изобретение позволяет повысить урожайность и качественные показатели ячменя. 1 ил., 4 табл.
Изобретение относится к области фитопатологии, сельского хозяйства и экологии. Способ включает предпосевную обработку семян пшеницы мягкой диспергированной суспензией. При этом суспензия содержит наночастицы железа диаметром 80±5 нм. Причем в первый день обработки проводится однократный полив семян пшеницы 5 мл суспензии наночастиц железа в концентрациях 0,5·10-3-1·10-6 мг/л и полив дистиллированной водой в последующие 14 дней. Способ позволяет повысить устойчивость пшеницы мягкой к хлорозу за счет повышения содержания фотосинтетических пигментов. 1 табл.

Изобретение относится к области сельского хозяйства. Изобретение представляет собой способ определения всхожести семян льна-долгунца с учетом оценки степени развития проростков, включающий отбор проб семян, выделение семян из навесок при определении чистоты, отсчет четырех проб по 50 семян в каждой, проращивание семян между полосами фильтровальной бумаги, свернутыми в рулон в термостате при температуре 20°С в течение 5 суток, где проращивание семян проводят при ширине покровной полосы фильтровальной бумаги 2 см. Изобретение позволяет сократить время проведения анализа семян на двое суток и снизить расход материалов на 27%. 2 ил., 1 табл.
Изобретение относится к сельскому хозяйству. В качестве исходного материала, содержащего полиэмбриональные семена, используют самофертильные популяции. Увеличивают концентрацию полиэмбриональных семян в популяции двух и более кратным отбором, а после их проращивания и разделения близнецовых проростков растения доращивают до фазы кущения, отбирают с развитой корневой системой и удваивают набор хромосом колхицинированием. Изобретение позволяет увеличить производительность и продуктивность при снижении трудоемкости получения гомозиготных линий на основе гаплоидов, возникающих у растений при полиэмбрионии. 1 табл.

Изобретение относится к области сельского хозяйства, в частности к растениеводству. Способ включает отбор апробационного снопа растений и определение у них признаков прочности главного стебля. Апробационный сноп отбирают в фазу появления репродуктивных органов у растений. В качестве признаков прочности главного стебля измеряют максимальный di max и минимальный di min размеры в горизонтальной плоскости второго снизу узла каждого i стебля. По значению величины λ, определяемой выражением: λ = ∑ i = 1 n d i   min ∑ i = 1 n d i   max , где n - число стеблей в апробационном снопе, прогнозируют: при λ менее 1,1 - полегания нет, при λ=1,1÷1,7 - слабое полегание, при λ=1,7÷2,2 - среднее полегание, при λ=2,2÷3,0 - сильное полегание, при λ более 3,0 - очень сильное полегание. Способ позволяет снизить трудоемкость и повысить достоверность прогноза полегания сельскохозяйственных культур в полевых условиях в ранние фазы развития растений. 3 табл., 1 пр.
Наверх