Способ прогнозирования развития гематогенных метастазов после комбинированного лечения рака почки


 


Владельцы патента RU 2528100:

Федеральное государственное бюджетное учреждение "Научно-исследовательский институт онкологии" Сибирского отделения Российской академии медицинских наук (ФГБУ "НИИ онкологии" СО РАМН) (RU)

Изобретение относится к области медицины, а именно к онкологии, и может быть использовано для прогнозирования развития гематогенных метастазов после комбинированного лечения при раке почки. Для этого в ткани опухоли определяют экспрессию NF-kB p50, HIF-1α содержание сосудистого эндотелиального фактора роста VEGF. Рассчитывают дискриминантные функции Y1, Y2 по уравнениям: Y1=-3,2+0,026·Х1+0,03·Х2-0,02·Х3+0,34·Х4+0,3·Х5; Y2=-33,3-0,01·Х1+0,11-Х2-1,2·Х3+1,57·Х4+1,8·Х5, где X1 - тотальная активность протеасом ·10-3 МЕ/мг белка; Х2 - содержание VEGF, пг/мг белка ; Х3 - экспрессия HIF-1, УЕ/мг белка в лунке; Х4 - экспрессия NF-kВ p50, УЕ/мг белка в лунке. При значениях Y1>Y2 прогнозируют отсутствие, а при Y1<Y2 - развитие гематогенных метастазов. Использование данного способа позволяет прогнозировать прогрессирование рака почки, а следовательно, назначить своевременное назначение наиболее адекватных лечебных мероприятий. 1 табл., 2 пр.

 

Изобретение относится к области медицины, конкретно к онкологии, может быть использовано для определения прогрессирования заболевания в виде появления гематогенных метастазов у больных раком почки после проведения комбинированного лечения.

Заболеваемость раком почки в настоящее время неуклонно растет, что связано как с улучшением диагностики новообразований данного органа, так и с ростом истинной заболеваемости [6]. Ежегодно в мире регистрируется около 230 тыс. новых случаев рака почки (РП) и более 100 тыс. смертей от этого заболевания. В России заболеваемость данным видом опухоли возросла с 1998 по 2008 г. с 9,0 до 12,2 на 100 тыс. населения. Заболевание характеризуется отсутствием ранних симптомов, поздней клинической манифестацией и резистентностью к лучевой и химиотерапии. Основной причиной летальности при РП являются отдаленные метастазы.

По данным патентных источников выявлено, что отношение свободных 17-ОКС к их сумме в суточной моче позволяет прогнозировать наличие метастазов и рецидивов при раке почки [патент РФ №2064179, опубл. 20.07.1996]. В исследованной научно-медицинской литературе выявлена роль транскрипционного фактора HIF, а также ростового фактора bFGF и его рецептора, плацентарного фактора роста и тромбоспондина в качестве прогностического при развитии светлоклеточной почечноклеточной карциномы. Однако эти факты носят предварительный характер и они не подтверждены в патентных источниках.

Наиболее близким к заявляемому является способ прогнозирования течения заболевания у больных раком почки, предложенный Баклановой О.В. (Патент РФ №2373864, опубл. 27.11.2009), в котором для прогнозирования течения заболевания у больных раком почки, осложненного венозной инвазией, где учитываются объем оперативного вмешательства, наличие отдаленных метастазов и инвазии опухоли, определяют размер тромба и концентрацию фибриногена в сыворотке крови. Способ обеспечивает возможность прогноза ожидаемой продолжительности жизни больных в месяцах путем определения показателей стандартного обследования больного и с учетом проведенного хирургического лечения.

Недостатками данного способа являются:

отсутствие в данном способе чувствительности и специфичности данного способа, что не позволяет оценить ее практическую значимость и эффективность ее применения;

- также не учитывается биологическое поведение самой опухоли, что может оказывать выраженное влияние на прогноз заболевания

- способ не позволяет провести оценку риска развития гематогенных метастазов при раке почки.

Новая техническая задача - повышение точности и информативности способа. Для решения поставленной задачи в способе прогнозирования развития гематогенных метастазов после комбинированного лечения при раке почки путем исследования биологически активных молекул в ткани опухоли определяют тотальную активность протеасом, экспрессию NF-kB (nuclear factor kappa-light-chain-enhancer of activated В cells - ядерный транскрипционный фактор kB) р50, HIF-1α (hypoxia inducible transcription factor), содержание сосудистого эндотелиального фактора роста (VEGF) и рассчитывают дискриминантные функции Y1, Y2 по уравнениям: Y1=-3,2+0,026·Х1+0,03·Х2-0,02·Х3+0,34·Х4+0,3-Х5 (отсутствие гематогенных метастазов)

Y2=-33,3-0,01·Х1+0,11·Х2-1,2·Х3+1,57·Х4+1,8·Х5 (наличие гематогенных метастазов),

где X1 - тотальная активность протеасом - 10-3 МЕ/мг белка;

Х2 - содержание VEGF, пг/мг белка;

Х3 - экспрессия HIF-1, УЕ/мг белка в лунке;

Х4 - экспрессия NF-kВ p50, УЕ/мг белка в лунке;

Х5 - коэффициент NF-kВ p65/50

и при Y1>Y2 прогнозируют отсутствие, а при Y1<Y2, развитие гематогенных метастазов

Данные существенные признаки не выявлены из научно-медицинской литературы. Они явным образом не следуют из уровня техники для специалистов. Способ апробирован на базе клиник НИИ онкологии СО РАМН. Таким образом, данное техническое решение соответствует критериям «новизна», «изобретательский уровень», «промышленно применимо».

Способ осуществляют следующим образом.

Для прогнозирования развития гематогенных метастазов рака почки проводят флуорометрическое определение тотальной активности протеасом, активности 20S протеасом, а также иммуноферментное определение экспрессии NF-kB (nuclear factor kappa-light-chain-enhancer of activated В cells - ядерный транскрипционный фактор kB) p50, HIF-lα (hypoxia inducible transcription factor) в опухолевой ткани. Для этого из операционного материала берут образцы опухолевой ткани в течение 2-3 часов после операции, очищают от участков некроза, кровоизлияний и помещают в жидкий азот. Образцы тканей до определения активности ферментов хранят при температуре -70°C и размораживают не более 1 раза для исследования активности и содержания маркеров. Перед определением активности исследуемых ферментов замороженную опухолевую ткань гомогенизируют до порошкообразного состояния в жидком азоте. 20S протеасомы выделяют методом высаливания с помощью сульфата аммония до 70% насыщения [1]. Химотрипсинподобную активность 26S протеасом, осуществляющейся химотрипсинподобными центрами протеасом, оценивают по гидролизу флуорогенного олигопептида Suc-LLVY-AMC (Sigma, США) [4]. Образовавшийся продукт регистрируют на флуориметре «Hitachi-850» (Япония) при длине волны возбуждения 380 нм и эмиссии 440 нм. Для оценки активности примесных протеаз в образцах применяют специфический ингибитор протеасом - MG132. За единицу активности протеасом принимают количество фермента, при котором гидролизуется 1 нмоль Suc-LLVY-AMC в течение 1 мин. Удельную активность протеасом выражают в единицах активности на 1 мг белка. Содержание белка определяют по методу Лоури.

Приготовление ядерных экстрактов для определения NF-kB (p50 и p65 форм), HIF-la проводят в соответствии с рекомендациями фирмы производителя Caymanchem (США). Замороженную ткань (100 мг) гомогенизируют в жидком азоте, затем ресуспендируют. Гомогенат центрифугируют при 2400g и 4°C для получения осадка, который ресуспендируют в 50 мкл 50 mM Трис-HCl буфера (pH 7,5) и затем центрифугируют при 14000g и 4°C. Полученный супернатант используют для определения экспрессии транскрипционных факторов. Экспрессию форм NF-kB p50, p65 и HIF-1α определяют в ядерных экстрактах иммуноферментным методом. Результаты определения содержания транскрипционных факторов выражают в условных единицах на мг белка в лунке.

Такой подход к прогнозированию риска возникновения гематогенных метастазов ПКГШ обусловлен рядом предпосылок:

Одним из патогенетических механизмов, лежащих в основе развития и прогрессирования рака почки, является особенность неопластической трансформации при РП, связанные с мутацией гена VHL (von Hippel-Lindau), которая приводит к повышенной экспрессии внутриклеточного фактора транскрипции HIF (hypoxia inducible factor) за счет его неспособности утилизироваться в протеасомном комплекса [11,7]. Фактор транскрипции HIF активируется в условиях гипоксии, связан с ангиогенезом и приводит к усилению основного обмена, энергетического обмена и увеличению экспрессии сосудистого эндотелиального фактора роста (VEGF) [8]. Прогрессирование светлоклеточного рака почки тесно связано с активацией процессов неоангиогенеза, что влечет развитие гематогенных метастазов [3,2].

Протеасомы способны активировать NF-kB за счет быстрой деградации его собственного ингибитора IкВ, что способствует выработке p105 - предшественника p50 субъединицы NF-kB [5,10]. Известно, что посттрансляционная модификация p105 - предшественника NF-kB p50 осуществляется с помощью 20S протеасом без процесса убиквитинирования [9].

Информативность отобранных критериев обоснована наличием связи экспрессии NF-кВ p50, HIF-1α и VEGF с возникновением гематогенных метастазов рака почки, полученное при исследовании 65 больных почечноклеточным раком, наблюдавшихся в отделении общей онкологии ФГБУ НИИ онкологии СО РАМН с 2006 по 2012 год. Средний возраст больных был равен 58,0±1,4 лет. Мужчины составляли 58% (38 человек), женщины - 42% (27 человек). Объемы диагностики и лечения больных раком почки соответствовали рекомендуемым алгоритмам объемов диагностики и лечения злокачественных новообразований, утвержденным министерством здравоохранения и социального развития РФ. Проведение данной работы одобрено этическим комитетом ФГБУ НИИ онкологии СО РАМН.

Опухолевая ткань забиралась из операционного материала не позднее чем через 2-3 часа после операции, замораживалась в жидком азоте. Затем в опухолевой ткани определялась активность 26S протеасом, экспрессия NF-kВ p50 и HIF-1α. Оценку качества полученных функций проводили на 10 пациентах, не включенных в основную выборку. Чувствительность и специфичность полученной дискриминантной модели составила соответственно 96% и 90%, диагностическая точность - 93%.

В Таблице 1 представлены показатели, включенные в модель оценки риска развития гематогенных метастазов при раке почки. Примечание: Wilks Lambda -величина, отвечающая за выполнение условий о правомерности включения показателя в модель и значимости различий значений дискриминантной функции в группах, что является необходимым условием при создании модели; Toler. (толерантность) - величина, отражающая информативность переменной, которая является необходимым условием для включения переменной в модель; p-level - уровень значимости.

Показатели специфичности и прогностической значимости положительного результата (риска развития метастазов) свидетельствуют о высокой информативности заявляемого способа, который предполагает большее число возможных случаев гематогенного метастазирования, чем реально выявлено на момент клинического обследования. Выделение группы больных раком почки, характеризующихся высоким риском гематогенного метастазирования позволяет определить адекватные сроки динамического наблюдения (более частое посещение врача-онколога) и в случае прогрессирования заболевания принять своевременные лечебные меры.

Чувствительность и специфичность полученной дискриминантной модели составила соответственно 96% и 70%, диагностическая точность - 88,9%.

Пример 1. Больной С., 70 лет, обратился в НИИ онкологии СО РАМН г. Томска, где по результатам комплексного обследования у него был диагностирован рак почки, стадия T3N0M0.

После проведения комбинированного лечения выявлено прогрессирование заболевания, было проведено исследование согласно предлагаемому способу. Для этого из операционного материала брали образцы опухолевой ткани в течение 2-3 часов после операции, определяли следующие показатели: тотальную активность протеасом, активность 20S протеасом, а также проводили иммуноферментное определение экспрессии NF-kB (nuclear factor kappa-light-chain-enhancer of activated В cells - ядерный транскрипционный фактор kB) р50, HIF-1α (hypoxia inducible transcription factor).

Тотальная активность протеасом составила 36,1·1000 Ед/мг белка; содержание VEGF была равна 82,2 пг/мг белка; экспрессия HIF-1α - 4,3 УЕ/мг белка в лунке; экспрессия NF-κВ р50 - 2,2 УЕ/мг белка в лунке; коэффициент NF-κВ р65/р50 составил 2,1. Вычисление дискриминантных функций с использованием биохимических и клинико-морфологических показателей (Y1=1,49; что больше чем Y2=-22,5). Данный клинический случай был классифицирован как минимальным риск развития гематогенного метастазирования, что в дальнейшем подтвердилось результатами клинических наблюдений. При динамическом наблюдении в течение 20 месяцев с момента диагностирования опухоли не было выявлено прогрессирования заболевания.

Пример 2. Больной П., 52 лет, обратился в НИИ онкологии СО РАМН г. Томска, где по результатам комплексного обследования у него рак почки, стадия T3N0M0.

После проведения комбинированного лечения выявлено прогрессирование заболевания, было проведено исследование согласно предлагаемому способу. Для этого из операционного материала брали образцы опухолевой ткани в течение 2-3 часов после операции, определяли следующие показатели: тотальную активность протеасом, активность 20S протеасом, а также проводили иммуноферментное определение экспрессии NF-kB (nuclear factor kappa-light-chain-enhancer of activated В cells - ядерный транскрипционный фактор kB) р50, HIF-1α (hypoxia inducible transcription factor).

Тотальная активность протеасом составила 52,2·1000 Ед/мг белка; содержание VEGF была равна 261,5 пг/мг белка; экспрессия HIF-1α - 6,2 УЕ/мг белка в лунке; экспрессия NF-κВ р50 - 29,2 УЕ/мг белка в лунке; коэффициент NF-κВ р65/р50 составил 0,24. Вычисление дискриминантных функций с использованием биохимических и клинико-морфологических показателей классифицировало данный клинический случай как сопряженный с риском развития гематогенного метастазирования (Y1=22; что меньше чем Y2=47,2). При динамическом наблюдении через 25 месяцев с момента диагностирования опухоли были выявлены гематогенные метастазы. Период динамического наблюдения за больным составил 32 месяца.

Таким образом, предлагаемый способ позволяет с высокой точностью и информативностью прогнозировать прогрессирование заболевание и делает возможным наиболее своевременное назначение наиболее адекватных лечебных мероприятий.

Источники информации

1. Абрамова Е.Б., Астахова Т.М., Ерохов П.А., Шарова Н.П. Множественность форм протеасомы и некоторые подходы к их разделению // Изв. РАН Сер.биол. - 2006. - №2. - С.150-156.

2. Регуляция ангиогенеза при злокачественных новообразованиях почки и мочевого пузыря / Спирина Л.В., Кондакова И.В., Усынин Е.А., Винтизенко С.И. // Сибирский онкологический журнал. - 2008. - №4. - С.65-70.

3. Фактор роста эндотелия сосудов и его рецептор 2-го типа в опухолях и сыворотке крови больных раком почки / Кушлинский Н.Е., Трапезникова М.Ф., Герштейн Е.С., Глыбин П.А., Казанцева И.А., Кылычбеков М.Б. // Бюллетень экспериментальной биологии и медицины. - 2008. - №6. - С.691-694.

4. Ben-Shahar S., Komlosh A., Nadav Е. et al. 26 S proteasome-mediated production of an authentic major histocompatibility class I-restricted epitope from an intact protein substrate // The J of Biol. Chem. - 1999. - Vol.274. - No.31. - P.21963-21972.

5. Goldberg A.L. Functions of the proteasome: from protein degradation and immune surveillance to cancer therapy // Biochemical Society, Transactions - 2007 - Vol.35. - P.12-17.

6. Jonasch E. Presurgical therapy in metastatic renal cell carcinoma // Expert. Rev.

Anticancer Ther. - 2007. - Vol. 7 (1). - P.73-78.

7. Kaelin W.G. Jr. The von Hippel-Lindau tummor supressor gene and kidney cancer / W.G. Jr. Kaelin // Clin. Cancer Res. - 2004. - Vol.10(18 Pt 2). - P. 6290 - 6295.

8. mAKAP compartmentalizes oxygen-dependent control of HIF-lalpha. /Wong W., Goehring A.S., Kapiloff M.S., Langeberg L.K., Scott J.D. // Sci Signal. - 2008. - Vol.1 (51). - P.1-18.

9. Moorthy A.K., Savinova O.V., Ho J.Q., Wang V.Y., Vu D., Ghosh G. The 20S proteasome processes NF-kappaBl pl05 into p50 in a translation-independent manner. // EMBO J. - 2006. - Vol.25(9). - P.1945-56.

10. Shah S.A., Potter M.W., McDade T.P., Ricciardi R., Perugini R.A., Elliot P.J., Adams J., Gallery M.P. 26S proteasome inhibition induces apoptosis and limits growth of human pancreatic cancer. // J. Cell Biochem. - 2001. - Vol. 82(1). - P.110-122.

11. Understanding familial and non-familial renal cell cancer / D. Bodmer, W. van den Hirk, J.J. van Groningen et al. // Hum. Mol. Genet. - 2002. - Vol. 11. - P.2489-2498.

Таблица 1
показатели Wilks Lambda Toler. p-level
Тотальная активность протеасом 0,26 0,57 0,05
Содержание VEGF 0,29 0,41 0,009
Экспрессия HIF-1 0,30 0,42 0,005
Экспрессия NF-kВ p50 0,53 0,46 0,00001
Коэффициент NF-kB p65/50 0,35 0,46 0,0008
Wilks Lambda: 0,22; p<0,0001

Способ прогнозирования развития гематогенных метастазов после комбинированного лечения при раке почки путем исследования пациента, отличающееся тем, что в ткани опухоли определяют тотальную активность протеасом, экспрессию NF-kB р50, HIF-1α содержание сосудистого эндотелиального фактора роста VEGF и рассчитывают дискриминантные функции Y1, Y2 по уравнениям:
Y1=-3,2+0,026·Х1+0,03·Х2-0,02·Х3+0,34·Х4+0,3·Х5
Y2=-33,3-0,01·Х1+0,11·Х2-1,2·Х3+1,57·Х4+1,8·Х5,
где X1 - тотальная активность протеасом ·10-3 МЕ/мг белка;
Х2 - содержание VEGF, пг/мг белка;
Х3 - экспрессия HIF-1α, УЕ/мг белка в лунке;
Х4 - экспрессия NF-κВ р50, УЕ/мг белка в лунке;
Х5 - коэффициент NF-κВ р65/50;
и при Y1>Y2 прогнозируют отсутствие, а при Y1<Y2 прогнозируют развитие гематогенных метастазов.



 

Похожие патенты:
Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования задержки внутриутробного роста плода. Для этого в венозной крови женщины на ранних сроках беременности определяют относительное содержание CD3+CD16+56+-лимфоцитов, уровня С3-компонента комплемента и растворимого рецептора фактора некроза опухоли (sTNF-R).

Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования течения и исходов бактериальных гнойных менингитов (БГМ) различной этиологии у детей.

Группа изобретений относится к области медицины и может быть использована для получения костного мозга (КМ) от доноров-трупов. Для этого пунктируют крылья подвздошных костей в передней и задней трети крыльев, устанавливая в каждое по два троакара.

Изобретение относится к диагностическим методам в медицине и может быть использовано в онкологии при адъювантной терапии опухолей, а также при длительном наблюдении за пациентами после оперативного удаления опухолей.

Изобретение относится к области медицины, а именно к гепатологии, и может использоваться для прогнозирования эффективности противовирусной терапии у взрослых больных хроническим гепатитом C с генотипом 1b.
Изобретение относится к медицине, а именно к гематологии и иммунологии, и может быть использовано для прогнозирования развития инфекционного синдрома у больных острым лейкозом.

Изобретение относится к медицине. При осуществлении способа через 3 ч после перорального введения препарата «Аласенс» в дозе 15 мг/кг массы тела получают трехканальное RGB флуоресцентное изображение зоны интереса.

Изобретение относится к области медицины, а именно к иммунологии, и может быть использовано для количественного определения клеток-предшественников в кроветворной ткани.

Изобретение относится к области биотехнологии и касается способа количественного определения фиксированного вируса бешенства штамма «Москва 3253». Способ предусматривает обеззараживание и выделение РНК из вируссодержащего материала, постановку реакции обратной транскрипции и полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов в режиме «реального времени» с использованием специфичных праймеров RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' и зонда RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2.
Изобретение относится к области медицины, а именно к биохимии, и может быть использовано для определения протеолитической модификации клеточных рецепторов на модели выделенных лимфоцитов периферической крови.

Изобретение относится к медицине, а именно к онкологии и клинической биохимии. Сущность способа заключается в том, что фиксированные клетки периферической крови обрабатывают первичными антителами к эстроген-связываюшему белку, специфически взаимодействующими с антигенами на поверхности сегментоядерных гранулоцитов, затем к полученному комплексу антиген-антитело добавляют вторичные антивидовые флуоресцентно-меченные антитела, и при наличии окрашивания поверхности сегментоядерных гранулоцитов диагностируют злокачественные новообразования, а при отсутствии окрашивания поверхности сегментоядерных гранулоцитов диагностируют доброкачественные новообразования. Способ неинвазивен, позволяет быстро и со 100%-ной точностью дифференцировать пациенток, имеющих злокачественные опухоли молочной железы, от пациенток с доброкачественными новообразованиями и здоровых женщин. Данный тест может быть использован для экспресс-диагностики наличия рака молочной железы. 6 пр., 6 ил.

Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для прогнозирования риска сердечно-сосудистой летальности у пациентов с постинфарктной хронической сердечной недостаточностью, сочетающейся с сахарным диабетом 2 типа. Для этого проводят измерение циркулирующих в периферической крови прогениторных клеток иммунофенотипа CD34+, CD 133 dim, CD45-. При снижении вышеуказанных клеток ниже 300 клеток на миллион лейкоцитов прогнозируют неблагоприятный прогноз течения заболевания, проявляющийся в прогрессировании сердечной недостаточности и увеличении риска сердечно-сосудистой летальности. Изобретение обеспечивает прогнозирование показателей выживаемости у данной группы больных путем использования нового биомаркера крови. 1 з.п. ф-лы, 2 ил.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована для определения еx-vivo эффективности лечения рака. Для этого после введения одной или более доз иммуногенной композиции субъекту измеряют уровень активированных Т-лимфоцитов (CD3+ CD69+) в организме. Уровень активированных Т-лимфоцитов (CD3+ CD69+) выше приблизительно 10,4% свидетельствуют о том, что субъект является таким, который демонстрирует успешный клинический выход для лечения, то есть повышение коэффициента выживания. Использование уровня активированных Т-лимфоцитов (CD3+ CD69+) позволяет применять их в качестве биомаркера для мониторинга, модификации или корректировки лечения рака. 2 н. и 5 з.п. ф-лы, 1 пр., 2 ил.

Изобретение относится к медицине и описывает хемилюминесцентный реактив для определения присутствия и/или количества анализируемого вещества в образце с предполагаемым содержанием анализируемого вещества, при этом реактив является недисперсным и растворимым в водной среде и содержит партнера по связыванию для анализируемого вещества и хемилюминесцентную композицию, содержащую олефиновое соединение и хелат металла, где олефиновое соединение является соединением, которое способно реагировать с синглетным кислородом присоединением 2+2 с образованием диоксетана или которое способно реагировать с синглетным кислородом с циклоприсоединением 4+2 с диенами, и где металл или хелат металла представляет собой редкоземельный металл или металл Группы VIII, и где металл координирован с двумя или более атомами той же молекулы или хелирующего агента, где два или более атомов выбраны из группы, состоящей из кислорода, азота и серы. 2 н. и 19 з.п. ф-лы, 5 ил., 11 пр.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для диагностики наследственной оптической нейропатии (НОН). Для этого проводят клинические и цитологические исследования и дополнительно из кожи пациента получают культуру фибробластов плотностью 5000-10000 клеток на см2, окрашивают митохондриальным потенциалзависимым флюоресцентным красителем TMRE до конечной концентрации 25 нМ. Измеряют в культуре интенсивность флюоресценции митохондрий до и через 30 мин после добавления олигомицина до конечной концентрации 10 мкМ и при ее увеличении не более чем на 7% или снижении диагностируют НОН. Изобретение обеспечивает повышение точности диагностики заболевания для осуществления корректного лечения, прогнозирования течения заболевания у пробанда, прогноза для родственников и потомства пробанда, а также упрощение способа. 15 ил., 4 пр.

Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для диагностики пароксизмальной ночной гемоглобинурии. Для этого окрашивают исследуемый образец крови моноклональными антителами CD235a (FITC)/ CD59(PE)/CD71 (АРС). Наличие ПНГ-клона среди эритроцитов и ретикулоцитов оценивают по отсутствию защитного белка CD59 на мембране ретикулоцитов, выделенных по гейту CD235a - панэритроцитарному маркеру и CD71- рецептору к трансферрину. Для оценки ПНГ-клона среди ретикулоцитов в гейте CD71+ собирают не менее 20000 событий, в зависимости от гейта CD71+ строят график FSC(log) vs SSC(log), на котором с помощью дополнительного гейта CD71str выделяют ретикулоциты, очищая таким образом популяцию ретикулоцитов от дебриса и дуплетов методом последовательного гейтирования. При наличии 100% положительных по CD59 ретикулоцитов судят об отсутствии ПНГ-клона и диагностируют отсутствие заболевания пароксизмальной ночной гемоглобинурии. При выявлении у пациента с клиническими симптомами негативных CD59- ретикулоцитов и значении полученных показателей более 1% дают диагностическое заключение о наличии ПНГ-клона и для подтверждения диагностики пароксизмальной ночной гемоглобинурии рекомендуют дополнительное исследование по международному стандартизованному протоколу. При выявлении негативных по CD59-ретикулоцитов и значении полученных показателей 0,1-1% судят о наличии минорного ПНГ-клона и рекомендуют повторное определение ПНГ-клона через 6 мес на предмет увеличения его значения и развития пароксизмальной ночной гемоглобинурии, и при подтверждении такого размера клона диагностируют субклиническую форму пароксизмальной ночной гемоглобинурии без клинических признаков. Использование многопараметрического гейтирования CD71+ клеток позволяет добиться исключения из анализа дебриса, дублетов и от неспецифически связавшихся моноклональных антител. 1 ил.

Изобретение относится к медицине, а именно к гастроэнтерологии, и может быть использовано для диагностики нагноившейся постнекротической псевдокисты поджелудочной железы. Для этого в крови больного определяют активность фагоцитов по уровню экспрессии CD 14+/HLA-DR+ методом проточной цитометрии и статистического ROC-анализа. При содержании CD14+/HLA-DR+ ниже 85% диагностируют нагноившуюся постнекротическую псевдокисту поджелудочной железы. Использование данного способа позволяет диагностировать нагноившуюся постнекротическую псевдокисту поджелудочной железы, что позволяет определять тактику ведения таких больных и осуществлять выбор оперативного вмешательства. 2 пр., 1 табл.

Изобретение относится к медицине, а именно к онкогематологии, и может быть использовано для прогнозирования развития безрецидивной выживаемости у больных множественной миеломой после аутологической трансплантации гемопоэтических стволовых клеток. Целью изобретения является упрощение способа прогнозирования безрецидивной выживаемости у больных множественной миеломой после АТГСК. Способ прогнозирования безрецидивной выживаемости у больных множественной миеломой после аутологичной трансплантации гемопоэтических стволовых клеток (АТГСК), включает проточную цитометрию и оценку относительного содержания одной из популяций лимфоцитов с использованием ее порогового значения. В предложенном способе после процедуры афереза, перед трансплантацией в продукте афереза больного определяют относительное количество CD45+CD19+ В-клеток, и при содержании CD45+CD19+ В-клеток более 2,5% прогнозируют более короткий период безрецидивной выживаемости после АТГСК, а при содержании CD45+CD19+ В-клеток менее 2,5% прогнозируют более продолжительный период безрецидивной выживаемости после АТГСК. 1 ил.
Наверх