Способ определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ммр9-1562 с>т (rs3918242)


 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2548811:

Закрытое акционерное общество "Научно-производственная фирма ДНК-Технология" (RU)

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.

 

1. Область техники

Предложенный способ относится к области медицины, биологии и биотехнологии и может быть использован при диагностике заболеваний пародонта в ротовой полости, прогнозирования тяжести и скорости прогрессии заболевания и алгоритма лечения заболевания в зависимости от индивидуального генетического профиля пациента.

На протяжении многих лет заболевания пародонта стабильно занимают по распространенности одно из ведущих мест в мире. Несмотря на широкое развитие инструментальных и лабораторных методов исследования, ранняя и точная диагностика различных стоматологических заболеваний до сих пор остается крайне актуальным вопросом.

Известно, что развитие и течение любого заболевания бактериальной природы определяется силой ответной реакции организма, которая, в свою очередь, зависит не только от приобретенного иммунитета, но в значительной степени определяется генотипом человека. За последние 10-15 лет получены первые результаты по идентификации генетических маркеров пародонтита. Установлена ассоциация с пародонтитом полиморфных локусов генов цитокинов, коллагена 1 типа, антигенов HLA, рецептора витамина D, ряда ферментов и регуляторных молекул (Brett P.M. et al., 2005; Agrawal A.A. et al., 2006; Tervonen T. et al., 2007; Wagner J. et al., 2007; Pirhan D. et al., 2007; Houshmand B. et al., 2009; Chai L. et al., 2009; Erciyas K. et al., 2010; Scarel-Caminaga R.M. et al., 2011).

Впервые выявлена взаимосвязь варианта - 1562Т (rs3918242) гена матриксной металлопротеиназы ММР9 с развитием хронического генерализованного пародонтита, что указывает на участие генетически детерминированной системы «протеолиз-антипротеолиз» в патогенезе заболеваний пародонта (Зорина, 2011).

2. Уровень техники

Широко распространен способ определения типа нуклеотида, находящегося в определенном месте ДНК, основанный на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР по окончании реакции с помощью электрофореза. При использовании ПЦР с регистрацией результатов в ходе реакции известны различные способы определения генотипа исследуемого образца.

Существуют способы, позволяющие определить тип нуклеотида, находящегося в определенном месте ДНК, основанные на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР непосредственно в ходе реакции с помощью использования флуоресцентно-меченых проб (олигонуклеотидов) (Andreas R. Tobler at all, "THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping", Journal of Biomolecular Techniques, V.16, issue 4, Desember 2005).

Например, в наборах производства Applied Biosystems используют одну пару праймеров для каждого аллеля и два зонда с различными флуорецентными метками, в зависимости от генотипа аллеля фиксируют разгорание различных меток ("TaqMan SNP Genotyping Assays", Applied Biosistems, Prodakt Bulletin, USA, 06/2006). Недостатком способа, используемого в данных наборах, является сравнительно невысокая достоверность результатов исследования из-за небольшой разницы между получаемыми кривыми флуоресценции для разных аллелей.

Предлагаемым подходом к детекции генетического полиморфизма является использование двух аллель-специфичных и меченых разными флуоресцентными метками олигонуклеотидов, а также олигонуклеотида, несущего гаситель флуоресценции и гибридизирующегося на матрицу рядом с аллель-специфичным олигонуклеотидом. Гибридизация аллель-специфичного олигонуклеотида на матрицу ведет к переносу энергии с находящегося на нем флуорофора-донора на гаситель флуоресценции расположенного рядом «гасящего» олигонуклеотида. Регистрацию результатов амплификации ведут по окончании ПЦР путем снятия спектра флуоресценции при изменении температуры реакционной смеси в диапазоне от 25 до 80 градусов по Цельсию (так называемые «кривые плавления»). При получении графиков флуоресценции возможен как нагрев, так и охлаждение реакционной смеси в указанном интервале температур.

Предлагаемое изобретение делает определение вариабельных позиций в ДНК более надежным и удешевляет подобные исследования благодаря использованию стандартного оборудования.

3. Раскрытие изобретения

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является повышение надежности и доступности подобных исследований, поскольку способ может быть осуществлен на стандартном известном оборудовании. Также он обеспечивает возможность проводить исследование в одной пробирке, что снижает затраты на исследование.

Использованный нами способ генотипирования является вариантом классического метода «примыкающих проб». При определении замен одиночных нуклеотидов вначале проводили ПЦР с праймерами, общими для обоих вариантов последовательности, затем температуру реакционной смеси снижали для гибридизации полученной матрицы с олигонуклеотидными пробами. Для определения варианта последовательности использовали два типа олигонуклеотидов, гибридизирующихся на матрицу рядом. Один из олигонуклеотидов метили флуорофором, другой - гасителем флуоресценции.

В реакции использовали один общий олигонуклеотид с гасителем флуоресценции и пару аллель-специфичных (сиквенс-специфичных) олигонуклеотидов, несущих флуорофор. Олигонуклеотидные пробы, соответствующие тому или иному варианту последовательности, метили различными флуорофорами, что позволило определять оба варианта в одной пробирке. Определение генотипа проводили после ПЦР и гибридизации путем измерения уровня флуоресценции в ходе температурной денатурации дуплексов олигонуклеотидов и полученных матриц (или, наоборот, гибридизации). Данное измерение проводили в режиме реального времени, его результатом являлись кривые плавления.

Условия реакции подбирали так, чтобы максимизировать разницу в температурах плавления совершенного и несовершенного дуплексов. Таким образом, если анализируемый образец содержал только один вариант последовательности, т.е. был гомозиготен по данному полиморфизму, температура плавления для пробы, образующей совершенный дуплекс, была существенно выше, нежели для пробы ,образующей несовершенный дуплекс. Если же анализировали гетерозиготный образец, температуры плавления были практически одинаковы.

Указанный результат достигается путем использования при постановке ПЦР флуоресцентно-меченых аллель-специфичных олигонуклеотидных проб и праймеров:

MMP9-1562s CGAAACCAGCCTGGTCAACG
ММР9-1562а TCTGCCTCCCGGGTTCAAGC
ММР9-1562р1 GGCGCACGCCTATAA-FAM
ММР9-15662р2 GGCGCATGCCTATAA-HEX
ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции.

Состав амплификационной смеси (на одну реакцию):

Компонент Концентрация Объем
ПЦР - буфер* 1,25 кратный 18 мкл
Смесь dNTP 0,25 мМ (каждого) 0,24 мкл
Праймеры 100 пМ/мкл по 0,14 мкл
Олигонуклеотиды, меченые флуорофорами 100 пМ/мкл по 0,07 мкл
Олигонуклеотид, меченый гасителем флуоресценции 100 пМ/мкл 0,14 мкл
Tag-полимераза 10 ед. активности/мкл 0,5 мкл
Н2О (деионизированная) - до 30 мкл
Геномная ДНК - 5 мкл

* Состав буфера для проведения ПЦР

84 мМ Трис-HCl рН 8,6

21 мМ (NH4)2SO4

3,1 мМ MgCl2

0,003% Tween-20

0,003% NP-40

6,25% глицерин

4. Осуществление изобретения

В качестве материала для исследования рекомендуется использовать кровь, соскобы буккального эпителия, биоптаты мягких тканей человека или иной стандартный биологический материал. Выделение ДНК из биоматериала производится с использованием комплекта реагентов для выделения ДНК (не является предметом данного патента).

Полимеразную цепную реакцию и определение температуры плавления олигонуклеотидных проб проводили с помощью детектирующего амплификатора «ДТпрайм» (000 «НПО ДНК-Технология», Россия). Использовали следующий температурный режим амплификации: 94°С - 10 с, 64°С - 30 с в течение 50 циклов. По завершении реакции амплификации реакционную смесь остужали до 25°С со скоростью 2°С/сек. Кривые плавления получали следующим образом: температуру реакционной смеси повышали с 25°С до 75°С с шагом ГС, измеряя уровень флуоресценции на каждом шаге.

Результаты, т.е. отнесение образца к гомозиготе или гетерозиготе по данному аллелю, оцениваются по форме кривых плавления ДНК (рис. 1).

Список литературы:

1. Agrawal A.A., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B 13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J.Periodontol. - 2006. - Vol.77. - P.1515-1521.

2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J.Dent. Res. - 2005. - Vol.84, №12. - P.1149-1153.

3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J.Clin. Periodontol. - 2008. - Vol.35, №10. - P.862-870.

4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J.Clin. Periodontol. - 2003. - Vol.30. - P.341-345.

5. Tervonen Т., Raunio Т., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J.Clin. Periodontol. - 2007. - Vol.34. - P.377-383.

6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J.Clin. Periodontol. - 2007. - Vol.34. - P.823-827.

7. Зорина О.А. Взаимосвязь качественного и количественного состава биоценозов ротовой полости и индивидуального генетического профиля на фоне воспалительных заболеваний пародонта. // Автореферат диссертации - M., 2011.

Способ определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242), основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами, отличающийся тем, что используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава:

MMP9-1562s CGAAACCAGCCTGGTCAACG
ММР9-1562а TCTGCCTCCCGGGTTCAAGC
ММР9-1562р1 GGCGCACGCCTATAA-FAM
ММР9-1562р2 GGCGCATGCCTATAA-HEX
ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции;
отнесение образца к гомозиготе или гетерозиготе по данному аллелю оцениваются по форме кривых плавления ДНК (по максимуму первой производной графиков флуоресценции).



 

Похожие патенты:

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного.

Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для прогнозирования риска сердечно-сосудистой летальности у пациентов с постинфарктной хронической сердечной недостаточностью, сочетающейся с сахарным диабетом 2 типа.

Изобретение относится к медицине, а именно к онкологии и клинической биохимии. Сущность способа заключается в том, что фиксированные клетки периферической крови обрабатывают первичными антителами к эстроген-связываюшему белку, специфически взаимодействующими с антигенами на поверхности сегментоядерных гранулоцитов, затем к полученному комплексу антиген-антитело добавляют вторичные антивидовые флуоресцентно-меченные антитела, и при наличии окрашивания поверхности сегментоядерных гранулоцитов диагностируют злокачественные новообразования, а при отсутствии окрашивания поверхности сегментоядерных гранулоцитов диагностируют доброкачественные новообразования.
Изобретение относится к области медицины, а именно к онкологии, и может быть использовано для прогнозирования развития гематогенных метастазов после комбинированного лечения при раке почки.
Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования задержки внутриутробного роста плода. Для этого в венозной крови женщины на ранних сроках беременности определяют относительное содержание CD3+CD16+56+-лимфоцитов, уровня С3-компонента комплемента и растворимого рецептора фактора некроза опухоли (sTNF-R).

Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования течения и исходов бактериальных гнойных менингитов (БГМ) различной этиологии у детей.

Группа изобретений относится к области медицины и может быть использована для получения костного мозга (КМ) от доноров-трупов. Для этого пунктируют крылья подвздошных костей в передней и задней трети крыльев, устанавливая в каждое по два троакара.

Изобретение относится к диагностическим методам в медицине и может быть использовано в онкологии при адъювантной терапии опухолей, а также при длительном наблюдении за пациентами после оперативного удаления опухолей.

Изобретение относится к области медицины, а именно к гепатологии, и может использоваться для прогнозирования эффективности противовирусной терапии у взрослых больных хроническим гепатитом C с генотипом 1b.
Изобретение относится к медицине, а именно к гематологии и иммунологии, и может быть использовано для прогнозирования развития инфекционного синдрома у больных острым лейкозом.

Изобретение относится к медицине, к хирургии, к онкологии и может быть использовано при дооперационном определении объема хирургического лечения высокодифференцированного рака щитовидной железы.
Изобретение относится к медицине, а именно к способу прогнозирования высокого риска формирования хронической патологии адено-тонзиллярной системы у часто болеющих детей (ЧБД).
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования судорожного синдрома у детей с перинатальными поражениями ЦНС в раннем неонатальном периоде.
Изобретение относится к области медицины, а именно к неонатологии и педиатрии, и может быть использовано для прогнозирования развития детского церебрального паралича у недоношенных новорожденных с экстремально низкой массой тела при рождении.
Изобретение относится к области медицинской микробиологии, а именно к способу диагностики токсигенных штаммов Clostridium difficile. Сущность способа состоит в том, что пробу кала пациента выдерживают в абсолютном 96% спирте 30-60 мин при соотношении спирта и кала 1:1, центрифугируют 15-20 минут, далее обрабатывают пробу кала 1% раствором дезоксихолата натрия при соотношении 1:1 30-60 минут, центрифугируют, удаляют надосадочную жидкость, затем проводят первичный посев осадка на среде с добавлением 1% лактозы и 0,5-1,0 мМ арабинозы, инкубируют в анаэростате в течение 24-48 ч, выросшие колонии наносят на стандартные диски, пропитанные хромогенным субстратом - орто-нитрофенил-β-D-галактозидазой.

Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии, и может быть использовано для количественного определения бенз(а)пирена в крови, для оценки риска здоровью человека и разработки мероприятий по обеспечению химической безопасности.
Изобретение относится к области медицины, в частности к способу диагностики когнитивных нарушений у детей при воздействии марганца техногенного происхождения. Сущность способа: по результатам клинической диагностики и нейропсихологического тестирования устанавливают у ребенка наличие когнитивных нарушений.

Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии, и может быть использовано для количественного определения пентахлорфенола в крови.

Изобретение относится к области медицины, в частности к способам лабораторной диагностики токсического действия никеля, и описывает способ диагностики окислительного стресса у детского населения в условиях внешнесредового воздействия никеля, при этом осуществляют определение содержания никеля в пробе крови и определение лабораторных показателей: в сыворотке крови - содержание гидроперекиси липидов, а в моче - содержание 8-гидрокси-2-деоксигуанозина, далее проводят корреляционный анализ между указанными лабораторными показателями и уровнем никеля в крови, и при одновременном установлении достоверных зависимостей: повышенное содержание в крови ребенка никеля более 0,083 мг/дм3 и повышенное, по сравнению с референтным уровнем, содержание гидроперекиси липидов в сыворотке крови и повышенное, по сравнению с референтным уровнем, содержание 8-гидрокси-2-деоксигуанозина в моче, диагностируют наличие окислительного стресса в организме на уровне ДНК клетки и мембраны клетки.

Изобретение относится к биологии и токсикологической химии и может быть использовано в практике химико-токсикологических, экспертно-криминалистических и клинических лабораторий.

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине.
Наверх