Способ идентификации генов стафилококковых экзотоксинов, с высокой структурной гомологией с суперантигенами, методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления


 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2532225:

Федеральное бюджетное учреждение науки "Казанский научно-исследовательский институт эпидемиологии и микробиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к биотехнологии и микробиологии и представляет собой способ идентификации кластера генов, кодирующих стафилококковые белки, являющиеся экзотоксинами. Для осуществления настоящего способа проводят мультипраймерную полимеразную цепную реакцию в один прием в двух реакционных смесях, первая из которых содержит праймеры к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, а вторая - к генам set1, set2, set3, set4, set5, кодирующим экзотоксины. Затем проводят анализ путем сравнения амплицированных фрагментов генов, полученных в двух аликвотах образца, с положительным контрольным образцом в соответствии с идентификационной таблицей. Настоящее изобретение также раскрывает тест-систему для осуществления указанного способа, которая содержит компоненты для выделения ДНК, компоненты для проведения ПЦР и компоненты для анализа результатов. При этом компоненты для проведения ПЦР содержат 10-кратный буферный раствор, рН 8,4, деионизированную стерильную воду, один положительный контрольный образец, фермент Taq-полимеразу, смесь четырёх дНТФ, смесь праймеров №1, содержащую epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, и смесь прамеров №2, содержащую set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R в соотношении 1:1:1:1:1:1:1:1:1:1. Настоящее изобретение позволяет выявить кластер генов, кодирующих стафилококковые белки, молекулярная масса которых составляет от 25 до 35 кДа, состоящих почти из 200 аминокислотных остатков и имеющих третичную структуру, высокогомологичную с некоторыми суперантигенами стафилококка (энтеротоксины, TSST-1 токсин) и с пирогенным стрептококковым экзотоксином C. 2 н.п. ф-лы, 3 табл., 1 пр.

 

Изобретение относится к микробиологии и может быть использовано в медицинской микробиологии для определения генов экзотоксинов в клинических штаммах стафилококков.

Данный способ позволяет выявить с помощью ПЦР-анализа кластер генов, кодирующих стафилококковые белки, молекулярная масса которых составляет от 25 до 35 кДа, состоящих почти из 200 аминокислотных остатков и имеющих третичную структуру высокогомологичную с некоторыми суперантигенами стафилококка (энтеротоксины, TSST-1 токсин) и с пирогенным стрептококковым экзотоксином C [2].

Данные белки - экзотоксины стафилококков в отличие от суперантигенов характеризуются отсутствием поликлональной активацией лимфоцитов, но способны вызывать продукцию провоспалительных цитокинов макрофагами, а также специфически взаимодействовать с Toll-подобными рецепторами 2 (TLR2) [3] на человеческих иммунекомпетентных клетках, например на макрофагах. Установлена также способность этих белков блокировать TLR2 рецепторы клеток [4], ингибировать связывание сывороточных IgA с рецепторами на фагоцитах, снижая бактерицидную активность последних [5, 6], связывать молекулы IgG, предотвращая их взаимодействие с компонетном комплимента Clq и Feγ рецепторами на нейтрофилах [10]. Экзотоксины стафилококка также способны взаимодействовать с другим рецепторным белком для молекул Р-селектина (Р-selectin гликопротеин лиганда 1, PSGL-1), тем самым ингибируя взаимодействие PSGL-1 с P-селектином на эндотелии и тромбоцитах [7]. Экзотоксины ингибируют протеолитическую активность матриксной металлопротеиназы 9 (ММП-9) в тканях воздействуя на миграцию нейтрофилов [8], способны также изменять хемотаксис опухолевых клеток [9].

Таким образом, экзотоксины стафилококка способны нарушать функционирование иммунных механизмов элиминации патогенных и условно-патогенных бактерий и могут выступать в качестве дополнительных факторов, модифицирующих известные представления об основных звеньях патогенеза стафилококковых инфекций.

Детектируемые гены set1, set2, set3, set4, set5 [2], как правило, содержаться в т.н. патогенных остравах генома стафилококка и представлены кластером генов. В заявленном способе предлагается детектировать гены, образующие кластер, состоящий из 5 генов, следующих друг за другом set2-set3-setl-set5-set4, между генами располагаются межгенные участки или вставки (нуклеотидные последовательностей размером от 339 до 446 п.н.) [2].

Известен способ идентификации токсигенных штаммов v. Cholerae O1, определения их биовара и дифференциации штаммов биовара эльтор на типичные и измененные методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления [1], который является прототипом данного изобретения, отличающийся тем, что объектом исследования в данном изобретении являются грамположительные микрорганизмы, относящиеся к роду Staphylococcus spp., и идентифицированные на коагулазопозитивные или коагулазонегативные, имеющие важное медицинское значение в патологии человека.

Таким образом, в медицинской микробиологии существует очевидная потребность в разработке высокочувствительного, специфичного и быстрого способа, генотипической идентификации способности к экзотоксинообразованию у клинически значимых штаммов стафилококков, выделяемых от человека, и объектах медицинского назначения, а также тест-системы для его осуществления, которая может быть применима в практике современных бактериологических лабораторий.

Техническим результатом изобретения является молекулярно-генетическая идентификации кластера генов, включающего гены set1, set2, set3, set4, set5, кодирующих экзотоксиноподобные белки, в выделенной культуре штаммов стафилококков, с использованием оригинальных праймеров, разработанных и предложенных в изобретении.

Технический результат достигается способом идентификации праймер-специфических участков генов setl, set2, set3, set4, set5 в ДНК стафилококковых штаммов методом мультиплексной полимеразной цепной реакции, характеризующимся тем, что ПЦР проводят в двух реакционных смесях, каждая из которых содержит специально подобранное сочетание праймеров к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза, у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, нуклеотидная последовательность которых была использована из работы японских исследователей Shintaro Н., Takashi S. et al., 2011 [12], в первой (№1), и оригинальных праймеров, специфичных к генам set1, set2, set3, set4, set5, с нуклеотидной последовательностью, предложенной в изобретении, во второй (№2), с температурой отжига праймеров 59°C в течение 10 с, при числе циклов амплификации, равном 25, с последующим анализом путем сравнения амплифицированных фрагментов генов исследуемых и контрольных штаммов. Для штаммов стафилококков, содержащих гены экзотоксинов, характерно наличие ампликонов генов set1, set2, set3, set4, set5, идентичных контрольным образцам штаммов. В качестве контрольных образцов используется ДНК, выделенная из штаммов S.aureus MRSA 252, S.aureus RF122, S. epidermidis АТСС12228

Технический результат достигается тест-системой для «Идентификации генов стафилококковых экзотоксинов», включающей компоненты для выделения ДНК и компоненты для проведения ПЦР: 10-кратный ПЦР-буферный раствор, pH 8,4; деионизованную стерильную воду; один положительный контроль; фермент Taq-полимеразу; смесь четырех дНТФ; смесь праймеров №1, содержащую (epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R) в соотношении 1:1:1:1:1:1:1:1:1:1:1, соответственно; смесь праймеров №2, содержащую (setl-F, setl-R, set2-F, set2-R, setS-F, set3-R, set4-F, set4-R, set5-F, set5-R) в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, а также компоненты для анализа результатов.

В качестве положительного контроля были выбраны образцы ДНК штаммов S. aureus RF122, S. aureus 252, S. epidermidis АТСС12228, содержащие в своем составе гены экзотоксинов set1, set2, set3, set4, set5, штаммы получены из ГИСК им. Тарасевича. Праймеры для выявления генов экзотоксинов сконструированы авторами с помощью программ Primer-Blast и vector NT 9.01 на основании представленных в базе Genbank нуклеотидных последовательностей генов штамма S.aureus RF122 и являются высокоспецифичными, праймеры были синтезированы по оригинальным последовательностям в ЗАО «Синтол», Москва, Россия.

Последовательности праймеров (epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R) для видовой генотипической идентификации стафилококков взяты из работы японских исследователей Shintaro Н., Takashi S. et al., 2011 [12] и были синтезированы ЗАО «Синтол», Москва, Россия. Праймеры и их последовательности приведены в таблице 1.

Таблица 1
Праймеры, используемые для видовой идентификации штаммов
праймер последовательность (5′-3′) ПЦР-продукт (ампликон), н.п. Вид штамма, которому соответствует ПЦР-продукт (ампликон)
epi-F TTGTAAACCATTCTGGACCG 251 S.epidermidis
epi-R ATGCGTGAGATACTTCTTCG
aur-F TCGCTTGCTATGATTGTGG 359 S.aureus
aur-R G CCAATG TTCTACCATAG С
hae-F TAGTGGTAGGCGTATTAGCC 434 S.haemolyticus
hae-R ACGATATTTGCCATTCGGTG
lug-F TCCAATGATGGTAACGAGGC 695 S.lugdunensis
TTTTGCGCCTCGTTTTGTGC
sap-F sap-R TTTTGGATGCGATAGATTGG 843 S.saprophyticus
TCTTCAGACTTTTCAAAGGC

Праймеры, используемые в заявляемом способе, для идентификации генов экзотоксинов в штаммах стафилококков, характеризуются как: set1-F и set1-R - праймеры на ген setl (кодирующий superantigen-like protein), обеспечивающие образование фрагмента размером 576 п.н. и имеющие прямую и обратную последовательности: set1-F 5′-TCAGCCAGTAAAAGCAGACGA-3′, set1-R 5′-TCACCCATACGGTGTGTTTGT-3′; set2-F и set2-R - праймеры на ген set2 (кодирующий superantigen-like protein), обеспечивающие образование фрагмента размером 330 п.н. и имеющие прямую и обратную последовательности: set2-F 5′-AACAGAGGCTCATTCCAGCC-3′, set3-R 5′-ATTGGGGCACTGACAACTCC-3′; set3-F и set3-R - праймеры на ген set3 (кодирующий экзотоксин superantigen-like protein 5), обеспечивающие образование фрагмента размером 147 п.н. и имеющие прямую и обратную последовательности: set3-F 5′-GCAAAGGTGGCAAGCACTAC-3′ set3-R 5′-CGTTGCGATTTTCCGCTTCT-3′; set4-F и set4-R - праймеры на ген set4 (кодирующий экзотоксин superantigen-like protein), обеспечивающие образование фрагмента размером 201 п.н. и имеющие прямую и обратную последовательности: set4-F 5′-ACAACAGAGGCCCATTCAGG-3′, set4-R 5′-ACGGTACTCATCTCCAGGCA-3′; set5-F и set5-R - праймеры на ген set5 (кодирующий экзотоксин), обеспечивающие образование фрагмента размером 78 п.н. и имеющие прямую и обратную последовательности: set5-F 5′-CGGCATATATAGCGTTGGCG-3′, set5-R 5′-TGCAGTCCCGGATGACTTAC-3′.

Праймеры подобраны на уникальные последовательности генов set1, set2, set3, set4, set5 в геноме S.aureus RF122 и S.aureus MRSA 252 таким образом, чтобы минимизировать вероятность их неспецифичного отжига. Праймеры проверены на возможность образования шпилечных структур с высокими температурами плавления, а также образования димерных соединений как одноименных праймеров, так и двух праймеров между собой. Выбор длины и GC% состава праймеров производился в соответствии с режимом отжига других праймеров, входящих в набор. Размеры получаемых фрагментов были подобраны для упрощения процесса учета результатов таким образом, чтобы амплифицируемые фрагменты были визуально отделимы от прочих.

Экспериментально установлен оптимальный состав реакционной смеси для проведения мультиплексной полимеразной цепной реакции, подобрано сочетание праймеров, необходимое и достаточное соотношение компонентов реакционной смеси и определен режим постановки ПЦР, что является важным при проведении ПЦР анализа.

Для подтверждения специфичности праймеров с помощью ПЦР было изучено 36 клинических штаммов стафилококков, 2 штамма стрептококков Str. piogenes, 1 штамм Lactobacillus acidophilus, выделенный из препарата "Лактобактерин", 1 штамм Е.coli. Результаты тестирования штаммов представлены в таблице 3.

Заявляемая тест-система разделена на 3 комплекта:

комплект 1 содержит компоненты для выделения ДНК, упакованные в шесть пластиковых флаконов, содержащих раствор 1 (деионизированная стерильная вода не содержащая нуклеаз) 1 мл;

комплект 2 содержит компоненты для проведения ПЦР и включает 2 пластиковые пробирки со смесью №1 по 500, мкл (праймеры, дНТФ и вода), 2 пластиковые пробирки со смесью №2 по 500, мкл (праймеры, дНТФ и вода), 1 пластиковую пробирку с 10-кратным буфером, 1 пластиковую пробирку, содержащую Taq-полимеразу, 1 пластиковую пробирку с ТЕ-буфером, 1 пластиковую пробирку, содержащую контрольный положительный образец лиофильно высушенной ДНК штаммов S.aureus MRSA 252, S.aureus RF122, S.epidermidis ATCC12228;

комплект 3 содержит компоненты для учета результатов анализа и включает 1 пластиковый флакон, содержащий ТАЕ буфер, 2 флакона с агарозой для электрофореза и 1 флакон с буфером для нанесения проб.

Тест-система предназначена для определения методом мультиплексной полимеразной цепной реакции генов стафилококковых экзотоксинов, с высокой структурной гомологией с суперантигенами.

Система рассчитана на проведение 100 определений, включает 1 контрольный образец.

Заявляемый способ идентификации включает следующие этапы.

а) Выделение ДНК (комплект 1).

б) Проведение ПЦР (комплект 2).

ПЦР проводят в 2 этапа (первый - генотипическая видовая идентификация стафилококков и второй идентификация генов setl-set5) по следующей программе:

1-й этап, включает предварительную денатурацию 95°C - 5 мин, 30 циклов из 95°C - 30 с, 58°C - 30 с, 72°C - 70 с, заключительная достройка цепи 72°C - 2 мин;

2-й этап, включает предварительную денатурацию 96°С - 2 мин, 25 циклов из 96°С - 10 с, 58,2°С - 10 с, 72°С - 30 с, заключительную достройку цепи 72°С - 5 мин.

в) Анализ результатов (комплект 3).

Детекцию амплифицированной ДНК после ПЦР осуществляют методом горизонтального гельэлектрофореза в 1,5% агарозном геле. Учет результатов ПНР-анализа проводят путем сравнения полученных ампликонов с контрольным образцом в соответствии с идентификационной таблицей (табл.2).

Способ осуществляют следующим образом.

Подготовку проб проводят согласно МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности» в боксе биологической безопасности III класса в защитной одежде в резиновых или латексных перчатках.

Выделение ДНК осуществляют с использованием комплекта 1.

Комплект для выделения ДНК извлекают из холодильника и выдерживают при комнатной температуре.

Экстрацию ДНК из бактерий проводят по методу, прописанному в работе Zhang К., McClure Jo-Ann et al., 2005 [11]. Штаммы стафилококков, выращенные на плотных питательных средах в течение 18 часов, забирают бактериологической петлей и ресуспендируют в 50,0 мкл стерильной деионизованной воде, не содержащей нуклеаз, с последующим разведением этой же водой до концентрации 2 млрд мк. т. на 1 мл и нагревают в термостате до 99°C в течение 10 мин. Затем центрифугируют при 30000 g в течение 1 мин. Полученный супернатант переносят в две пробирки (аликвоты) и используют в качестве матрицы для проведения ПЦР. После выполнения. данной процедуры материал считается обеззараженным.

2. Для проведения ПЦР готовят необходимое количество микропробирок, соответствующее 2-кратному числу исследуемых проб, а также еще по две для каждой реакционной смеси: 1 положительный контроль, в качестве которого берут образцы ДНК контрольных штаммов и 1 отрицательный контроль (деионизированная стерильная вода).

Компоненты комплекта №2 извлекают из морозильной камеры, размораживают содержимое пробирок и готовят реакционные смеси для проведения ПЦР.

Для приготовления реакционной смеси №1 смешивают 10,0 мкл смеси 1, содержащей сочетание праймеров epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, смесь дНТФ и деионизованную воду с 5,0 мкл 10-кратного ПЦР буфера и 0,5 мкл Taq-полимеразы.

Для приготовления реакционной смеси №2 смешивают 10,0 мкл смеси №2, содержащей сочетание праймеров set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, смесь дНТФ и деионизованную воду с 5,0 мкл 10-кратного буфера и 0,5 мкл Taq-полимеразы.

В подготовленные пробирки вносят по 10,0 мкл пробы из аликвот. В пробирку, обозначенную как отрицательный контроль, вносят 10,0 мкл деионизованной воды, а в пробирку с положительным контролем соответственно по 10,0 мкл ДНК из штаммов S.aureus MRSA 252, S.aureus RF122, S.epidermidis АТСС'12228 (контроль K+).

Амплификацию ДНК осуществляют с использованием многоканального программируемого термостата "Терцик" (ДНК-Технология, Россия) либо используют его аналоги при следующих температурных режимах (по матричному способу регулирования):

для 1-го этапа (первая аликвота образца) - предварительная денатурация 95°C - 5 мин, 25 циклов: 95°C - 30 с, 58°C - 30 с, 72°C - 70 с, заключительная достройка цепи 72°C - 2 мин;

для 2-го этапа (вторая аликвота образца) предварительная денатурация - 96°C в течение 2 мин; 25 циклов: 9°C - 10 с, 59°C - 10 с, 72°C - 30 с, заключительная достройка цепи 72°C - 5 мин.

Амплификацию контрольных образцов: К+, отрицательный контроль, проводят одновременно с исследуемыми аликвотами образцов в том же приборе и при тех же условиях.

3. Для подготовки 50 мл 1,5% агарозного геля к 750 мг агарозы добавляют 50 мл ТАЕ буфера, разведенного в 50 раз. Агарозу доводят до кипения, охлаждают до 50°C и заливают в специальную ванночку, затем устанавливают гребенку и оставляют застывать. После полимеризации осторожно извлекают гребенку и переносят гель в камеру для проведения электрофореза. Затем к амплификату добавляют 5 мкл буфера для нанесения проб, перемешивают при помощи того же наконечника и вносят в карманы геля. Камеру подключают к источнику тока и задают напряжение 12 B/см.

Электрофоретическое разделение продолжают в течение 45 мин до прохождения лидирующим красителем около 1/3 длины трека (рекомендуемая длина трека - 10 см), после чего гель извлекают из камеры и помещают на стекло трансиллюминатора с УФ-излучением 310 нм. Фрагменты анализируемой ДНК проявляются в виде светлых полос.

Оценивают результаты путем сравнения полученных в ПЦР ампликонов с идентификационной таблицей (табл.2).

Выявление ампликонов размером 251 п.н. в смеси №1 указывает на присутствие в пробе образца ДНК штамма S.epidermidis, а присутствие ампликонов размером 575 или 147 п.н. в смеси №2 указывает на присутствие в пробе штамма S.epidermidis экзотоксигенного, содержащего ген set1 или set3 (S.epidermidis set1+ или set3+). Только отсутствие в смеси №2 ампликонов указывает на штамм S. epidermidis, не содержащий локусов генов set 1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 359 п.н. в смеси №1 указывает на присутствие в пробе образца ДНК штамма S.aureus, а присутствие ампликонов размером 576, 147, 201, 78 п.н. в смеси №2 указывает на присутствие в пробе экзотоксигенного штамма S. aureus, содержащего гены set1, set3, set4, set5 (S.aureus set1+, set3+, set4, set5). Только отсутствие в смеси №2 ампликонов указывает на не экзотоксигенный штамм S. aureus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 434 п.н. в смеси №1 указывает на присутствие в пробе образца ДНК штамма S.hemolyticus, а присутствие ампликона размером 147 п.н. в смеси №2 указывает на присутствие в пробе экзотоксигенного штамма S.hemolyticus, содержащего ген set3 (S.hemolyticus set3+). Только отсутствие в смеси №2 ампликонов указывает штамм S. hemolyticus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Выявление ампликонов размером 695 п.н. в смеси №1 указывает на присутствие в пробе образца ДНК штамма S.lugdunensis, а присутствие ампликона размером 330, 147, 78 п.н. в смеси №2 указывает на присутствие в пробе экзотоксигенного штамма S.lugdunensis, содержащего гены set2, set3, set5 (S.lugdunensis set2+set3+set5+). Только отсутствие в смеси №2 ампликонов указывает на штамм S.lugdunensis, не содержащий локусов генов set1+, set2,+set3+, set4, set5.

Выявление ампликонов размером 843 п.н. в смеси №1 указывает на присутствие в пробе образца ДНК штамма S.saprophytics, а присутствие ампликона размером 147, 201, 78 п.н. в смеси №2 указывает на присутствие в пробе экзотоксигенного штамма S.saprophyticus, содержащего гены set3, set4, set5 (S.saprophyticus set2+set3+set5+). Только отсутствие в смеси №2 ампликонов указывает на штамм S. saprophyticus, не содержащий локусов генов set1+, set2, +set3+, set4, set5.

Специфичность заявляемого способа и тест-системы подтверждена на основе использования штаммов таких видов, как Str. Piogenes - 2 штамма, Lactobacillus acidophilus - 1 штамм, выделенный из препарата "Лактобактерин", Е.coli - 1 штамм. Результаты ПЦР тестирования указанных штаммов были отрицательными: отсутствовали в смеси №1, №2 ампликоны, что указывало на отсутствие образцов, принадлежащих экзотоксигенным штаммам стафилококков.

Изобретение, иллюстрируется следующим примером.

Пример 1. Для определения эффективности заявляемого способа и тест-системы исследовано 23 клинических штамма коагулазопозитивных стафилококков, выделенных из образцов, полученных со слизистой носа, кожи, наружного уха, и 13 штаммов коагулазоотрицательных стафилококков, выделенных со слизистой носа, мочи, кожи, грудного молока пациентов, обследованных в лаборатории микробиологии (штаммы любезно предоставлены зав. лаб. микробиологии ФБУН КНИИЭМ Л.Т.Баязитовой).

Установлено, что у 5 из 23 (5/23) изолятов коагулазопозитивных штаммов стафилококков идентифицированы кластеры генов экзотоксинов, так как в образцах от этих штаммов происходила амплификация фрагментов ДНК размером 576, 147, 201 и 78 п.н. в реакционной смеси №2, что свидетельствует о присутствии в их геноме кластера генов, содержащих экзотоксины set1, set3, set4, set5 соответственно, у коагулазоотрицательных штаммов только 1 из 13 (1/13) штаммов идентифицирован как S. lugdunensis, в образцах которого происходила амплификация фрагментов ДНК размером 330, 147 п.н. в реакционной смеси №2, что свидетельствует о присутствии в их геноме кластера генов, содержащих экзотоксины set2, set3, соответственно (табл.3).

Таблица 3
Кол-во штаммов Результаты видовой генетической идентификации (реакционная смесь №1) Результаты идентификации экзотоксигенности (реакционная смесь №2)
23 штамма коагулазопозитивных стафилококков 23 образца содержали амплифицированый фрагмент ДНК размером 359 п.н. - S.aureus у 5 образцов содержали амплификацированые фрагменты ДНК размерами 576, 147, 201 и 78 - гены set1, set3, set4, set5
13 штаммов коагулазоотрицательных стафилококков 1 - образец содержал амплифицированый фрагмент ДНК размером 695 п.н. - S.lugdunensis амплификация фрагментов ДНК размером 330, 147 п.н. - гены set2, set3
4 - образца содержали амплифицированый фрагмент ДНК размером 843 п.н. - S.saprophytics амплификация фрагментов отсутствовала
1 - образец содержал амплифицированый фрагмент ДНК размером 434 п.н. - S.haemolyticus амплификация фрагментов отсутствовала
7 - образецов содержал амплифицированый фрагмент ДНК размером 251 п.н. - S.epidermidis амплификация фрагментов отсутствовала
1 штамм Lactobacillus acidophilus Фрагментов ДНК не выявлено амплификация фрагментов отсутствовала
1 штамм Е.coli Фрагментов ДНК не выявлено амплификация фрагментов отсутствовала
2 штамма стрептококков Str. piogenes Фрагментов ДНК не выявлено амплификация фрагментов отсутствовала

Таким образом, предлагаемый способ и мультипраймерная ПЦР тест-система позволяют быстро и достоверно идентифицировать штаммы таких видов коагулазоположительных и коагулазоотрицательных стафилококков, как S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, и определить в составе их генома кластер генов set1, set2, set3, set4, set5, кодирующий белки, гомологичные стафилококковым энтеротоксинам, TSST-1 токсину и пирогенному стрептококковому экзотоксину С.

Литература

1. Патент РФ 2458141. Способ идентификации токсигенных штаммов v. Cholerae O1, определенияих биовара и дифференциации штаммов биовара эльтор на типичные и измененные методом мультиплексной полимеразной цепной реакции и тест-система для его осуществления // Смирнова Н.И., Горяев А.А., Шубина А.В., Заднова С.П., Кутырев В.В., 10.08.2012, Бюл. №22.

2. Rachel J.W., John M.W., В.Henderson, et al. Identification of a novel gene cluster encoding Staphylococcal exotoxin-like proteins: characterization of the prototypic gene and its protein product, SET1 // Nair Infect Immun. 2000 68(8).

3. Fournier B, Philpott D.J. Recognition of Staphylococcus aureus by the innate immune system // Clin. Microbiol. Rev. 2005. 18:521-540.

4. Yokoyama R., Itoh S., Kamoshida G., et al. Staphylococcal superantigen-like protein 3 binds to the Toll-like receptor 2 extracellular domain and inhibits cytokine production induced by Staphylococcus aureus, cell wall component, or lipopeptides in murine macrophages // Infect Immun. 2012 August; 80(8): 2816- 2825.

5. Bestebroer J, et al. Functional basis for complement evasion by staphylococcal superantigen-like 7 // Cell. Microbiol. 2010. 12:1506-1516.

6. Langley R, et al. The staphylococcal superantigen-like protein 7 binds IgA and complement C5 and inhibits IgA-Fca RJ binding and serum killing of bacteria // J. Immunol. 2005. 174:2926-2933.

7. Bestebroer J, et al. Staphylococcal superantigen-like 5 binds PSGL-1 and inhibits P-selectin-mediated neutrophil rolling // Blood 2007.109:2936-2943.

8. Itoh S, et al. Staphylococcal superantigen-like protein 5 inhibits matrix metalloproteinase 9 from human neutrophils// Infect. Immun. 2010.78:3298-3305.

9. Walenkamp A.M, et al. Staphylococcal superantigen-like 10 inhibits CXCL12-induced human tumor cell migration // Neoplasia 2009. 11:333-344.

10. Patel D., Wines B.D., Langley R.J., et al. Specificity of staphylococcal superantigen-like protein 10 toward the human IgGl Fc domain // J. Immunol. 2010. 184:6283-6292.

11. Zhang K., McClure Jo-Ann, Elsayed S., et al. Novel multiplex PCR assay for characterization and concomitant subtyping of Staphylococcal cassette chromosome mec Types I to V in methicillin-resistant Staphylococcus aureus // J Clin Microbiol. 2005; 43(10): 5026-5033.

12. Shintaro H., Takashi S., Kyoko Kuwahara-Arai, Keiichi H. Rapid and Accurate Identification of Human-Associated Staphylococci by Use of Multiplex PCR. Clin Microbiol. 2011 October; 49(10): 3627-3631.

Таблица 2
Идентификационная таблица для учета результатов, полученных патентуемым способом идентификации генов стафилококковых экзотоксинов на основе анализа образцов методом мультиплексной ПЦР
Образец Интерпретация результата анализа образца
аликвота 1 (размер ампликона, п.н.) аликвота 2 (размер ампликона, п.н.)
251 359 434 695 843 78 201 147 330 576
- - - - - - - - - - К отриц нет ампликонов
К1+
- - - - - - - S.epidermidis: экзотоксигенный штамм set1+
- - - - - S.aureus: экзотоксигенный штамм set 1+, set3+set4+set5+
- - - - S.aureus: экзотоксигенный штамм set1+, set2+, set3+ set4+ set5+
- - - - - - - - S.hemolyticus: экзотоксигенны штамм set3+
- - - - _ S.lugdunensis: экзотоксигенный штамм set2+ set3+ set5+
- - - - - - S.saprophyticus экзотоксигенный штамм set3+ set4+ set5+
- - - - - - - - S lug: не экзотоксигенный штамм
- - - - - - - - - S.saprophyticus: не экзотоксигенный штамм
- - - - - - - - - S.epidermidis: не экзотоксигенный штамм
- - - - - - - - S aureus: не экзотоксигенный штамм
- - - - - - - - - S.hemolyticus: не экзотоксигенный штамм
- - - - - - - - - S.saprophyticus: не экзотоксигенный штамм

1. Способ идентификации кластера генов, кодирующих стафилококковые белки, получившие название суперантигено-подобные экзотоксины, характеризующийся тем, что проводят мультипраймерную полимеразную цепную реакцию в один прием в двух реакционных смесях, каждая из которых содержит специально подобранное сочетание праймеров к генам, кодирующим такие белки стафилококков, как термонуклеаза, бета-глюкозидаза у видов S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, в первой реакционной смеси и к генам set1, set2, set3, set4, set5, кодирующим белки экзотоксины, во второй реакционной смеси, с температурой отжига праймеров 58°C в течение 30 с при числе циклов амплификации, равном 25, для первой реакционной смеси, и температурой отжига праймеров 59°C в течение 10 с при числе циклов амплификации, равном 25, для второй реакционной смеси, с последующим анализом путем сравнения амплифицированных фрагментов генов, полученных в двух аликвотах образца, с положительным контрольным образцом в соответствии с идентификационной таблицей 2; для экзотоксигенных штаммов стафилококков характерно наличие ампликонов генов set1, set2, set3, set4, set5, идентичных контрольному положительному образцу.

2. Тест-система для осуществления способа по п.1 методом мультипраймерной полимеразной цепной реакции, характеризующаяся тем, что включает компоненты для выделения ДНК, компоненты для проведения ПНР, компоненты для анализа результатов, при этом компоненты для проведения ПЦР содержат: 10-кратный буферный раствор, pH 8,4, деионизированную стерильную воду, один положительный контрольный образец, фермент Taq-полимеразу, смесь четырех дНТФ, смесь праймеров №1, содержащую epi-F epi-R, aur-F aur-R, hae-F hae-R, lug-F lug-R, sap-F sap-R в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно; и смесь праймеров №2, содержащую (set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R) в соотношении 1:1:1:1:1:1:1:1:1:1, соответственно, а также компоненты для анализа результатов.



 

Похожие патенты:

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры.

Изобретение относится к области молекулярной биологии и вирусологии. Предложены праймеры, зонды и их наборы, для амплификации и обнаружения HPV типа 52 в исследуемом образце.

Изобретение относится к молекулярной биологии, генной инженерии, медицине и онкологии. Предложен способ детекции стволовых раковых клеток, основанный на инкубации образцов клеток с флуоресциентными красителями и последующей идентификации раковых клеток в ультрафиолетовом свете, где при инкубации образцов клеток, которая проводится с флуоресцентным красителем, ковалентно инкорпорированным во фрагменты двуцепочечной ДНК, обеспечивается интернализация экстраклеточных экзогенных фрагментов двуцепочечной ДНК во внутриклеточное пространство стволовых клеток, входящих в состав образцов клеток, путем проведения инкубации образцов клеток в растворе препарата фрагментированной двуцепочечной ДНК в соотношении 0.5-1 мкг ДНК на 1000000 клеток, находящихся в суспензии или на срезе ткани в течение 60-120 минут, а идентификацию раковых клеток в качестве стволовых осуществляют в ультрафиолетовом свете с длиной волны, соответствующей максимуму поглощения введенного в молекулы фрагментов двуцепочечной ДНК флуорохрома, причем, в качестве фрагментов двуцепочечной ДНК используют фрагменты ДНК Alu повтора человека, энзиматически меченые предшественником, содержащим ковалентно пришитый флуорохромный краситель, или меченые прямым химическим введением флуорохрома.
Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для идентификации вируса блютанга 6, 14 и 21 серотипов. Охарактеризованные праймеры комплементарны участкам вариабельного 2-го сегмента генома вируса блютанга нуклеотипа С (6, 14 и 21 серотипы) используются в ОТ-ПЦР с электрофоретической детекцией продуктов амплификации для идентификации вируса блютанга 6, 14 и 21 серотипов и имеют следующий состав (5'-3'): Прямой: GRAYATGRTGGATATWCCG Обратный: GGCTGCACRTCCAYYGARTC Представленное изобретение позволяет определить генетическую группу нуклеотипа C вируса блютанга в образцах исследуемого биологического материала с помощью ОТ-ПЦР в короткие сроки.

Изобретение относится к биотехнологии. Описан набор праймеров для амплификации фрагментов гена CFTR.

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого.

Изобретение относится к медицине и микробиологии. Предложен способ определения микобактерий туберкулеза генотипа Beijing в режиме реального времени путем определения вставки элемента IS6110 в локусе генома dnaA-dnaN, отличающийся тем, что применяют ПЦР в режиме реального времени с использованием двух специфических праймеров 5`-AGATCAGAGAGTCTCCGGACTCA и 5`-CGCCGGGACTGTATGAGTCT и флуоресцентно-меченого зонда R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2, оценку результата производят путем регистрации сигнала флуоресценции по каналу R6G с длиной волны 555нм, причем при наличии в образце ДНК штамма микобактерий туберкулеза генотипа Beijing экспоненциальный рост сигнала флуоресценции ПЦР при анализе чистой ДНК происходит между 10-15 циклами, а при анализе клеточных лизатов - между 15 и 20 циклами.

Изобретение относится к биотехнологии. Описан способ проведения ПЦР для эффективной идентификации аллельных вариантов Waxy-генов пшеницы.
Изобретение относится к биотехнологии, а именно к генетической инженерии. Техническим результатом изобретения является возможность определения генетической группы - нуклеотипа B вируса блютанга с помощью ОТ-ПЦР, что позволит существенно сократить материальные затраты и время проведения работ по определению серотипа вируса блютанга в образцах исследуемого биологического материала.

Цель изобретения - разработка эффективного способа генотипирования крупного рогатого скота по DGAT1-гену на основе ПЦР-ПДРФ-анализа. Разработанный способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся от ближайшего прототипа [1] тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1) DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2) DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3), а на этапе ПДРФ применяется другая эндонуклеаза рестрикции - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp (фиг.1 и 2).

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры.
Изобретение относится к области микробиологии. Готовят две взвеси.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.
Изобретение относится к биотехнологии. Способ предусматривает отбор проб почвы, внесение в почву метсульфурон метила (МСМ) в заданном количестве с последующей инкубацией и определением удельной метаболической активности (УМА) сапрофитного комплекса почвы при помощи мультисубстратного тестирования (МСТ) и учета числа КОЕ (колониеобразующих единиц) на разбавленной агаризованной среде.

Группа изобретений относится к биотехнологии. Предложен способ выращивания колоний микробных клеток на поверхности пористой пластины.

Изобретение относится к микробиологии и может быть использовано при мониторинговых эколого-микробиологических исследованиях контроля качества морской воды для определения численности нефтеокисляющих микроорганизмов.

Изобретение относится к биотехнологии. Предложен способ оценки токсичности продукции из полимерных и текстильных материалов.

Изобретение относится к области биотехнологии и представляет собой способ определения неспецифической устойчивости патогенных микроорганизмов к антибиотикам и факта присутствия бактериальных биопленок на основании измерения каталитической активности фосфодиэстераз, расщепляющих циклический дигуанозинмонофосфат, с пороговой чувствительностью 50 пг/мл, включающий: 1) выделение фосфодиэстеразы-мишени из лизированных бактериальных клеток; 2) связывание фосфодиэстеразы биотинилированными антителами, специфичными к некаталитическим доменам фосфодиэстеразы; 3) аффинную очистку комплексов, сформированных фосфодиэстеразой-мишенью и биотинилированным антителом при помощи парамагнитных частиц, содержащих нейтравидин или его аналоги, связывающие биотин; 4) взаимодействие комплексов фосфодиэстераза/биотинилированное антитело, иммобилизованных на парамагнитных частицах, с комплексами, содержащими с-di-GMP в форме G-квадруплексов с интеркалированным красителем, сопровождающееся падением интенсивности флуоресценции по мере разрушения комплексов интеркалирующего красителя c-di-GMP; 5) измерение падения флуоресценции при гидролизе c-di-GMP и разрушении комплекса c-di-GMP с интеркалирующим красителем с последующим количественным определением активности фосфодиэстеразы на основании калибровочных кривых, построенных с использованием известных количеств рекомбинантного фермента фосфодиэстеразы, идентичного исследуемой мишени; 6) выявление повышенного уровня фосфодиэстеразной активности, обнаруживаемого тестируемыми антибиотикоустойчивыми бактериальными штаммами, способными к формированию биопленок, по сравнению с уровнем фосфодиэстеразной активности, обнаруживаемым для контрольных штаммов бактерий того же вида, не обладающих антибиотикоустойчивостью и способностью к формированию биопленок.
Изобретение относится к области медицинской микробиологии и касается способа определения активации плазминогена бактериями. Способ включает внесение протамина сульфата в подготовленный супернатант, инкубацию полученной смеси, осаждение клеток центрифугированием, инкубацию супернатанта с протамин сульфатом, осаждение белка и регистрацию активации плазминогена бактериями по количеству отщепившегося аргинина, содержание которого определяют методом Сакагуши по окрашиванию проб в красный цвет.

Изобретение относится к биотехнологии. Предложен контейнер для изоляции и идентификации микроорганизма.

Изобретение относится к области биохимии, в частности к способу уничтожения сорняков, предусматривающему стадию нанесения гербицида РРО-ингибиторного типа на культивируемую часть растения, где указанное растение обладает устойчивостью к указанному гербициду и экспрессирует белок со способностью превращать вышеуказанный гербицид в гербицид с более низкой гербицидной активностью.
Наверх