Штамм вируса гриппа а/17/виктория/2011/89 (h3n2) для производства живой гриппозной интраназальной вакцины для взрослых и для детей


 


Владельцы патента RU 2532844:

Федеральное государственное бюджетное учреждение "Научно-исследовательский институт эскпериментальной медицины" Северо-западного отделения Российской Академии медицинских наук (ФГБУ "НИИЭМ" СЗО РАМН) (RU)

Изобретение относится к медицинской вирусологии и биотехнологии. Штамм А/17/Виктория/2011/89 (H3N2) активно размножается в развивающихся куриных эмбрионах при оптимальной температуре 32°С. Характеризуется температурочувствительностью и холодоадаптированностью. Реассортант унаследовал гены, кодирующие поверхностные антигены вируса гемагглютинин (НА) и нейраминидазу (NA), от эпидемического родительского вируса и остальные шесть генов, кодирующих внутренние негликозилированные белки, от донора аттенуации. Штамм депонирован в Государственной коллекции вирусов ФГБУ «Научно-исследовательский институт вирусологии им. Д.И. Ивановского» под номером 2724. Изобретение может быть использовано в практическом здравоохранении для профилактики заболеваемости сезонным гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из указанного штамма. 1 ил., 6 табл.,

 

Изобретение относится к медицинской вирусологии и может быть использовано в здравоохранении для профилактики заболеваемости гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из штамма вируса гриппа А, семейства Orthomyxoviridae, рода Influenzavirus А, А/17/Виктория/2011/89 (H3N2).

Известный вакцинный штамм вируса гриппа А/17/Брисбен/07/1 сероподтипа (H3N2) - прототип изобретения [Патент РФ № 2416640, дата приоритета 11.01.2010. Опубл. БИ №11, 2011, 27.06.2011] - утратил антигенную актуальность и, вследствие этого, не сможет вызвать защитную реакцию во время эпидемии гриппа, вызванной штаммом вируса гриппа, аналогичным вирусу А/Виктория/361/2011 (H3N2).

Задачей, на решение которой направлено заявляемое изобретение, является получение вакцинного штамма актуальной антигенной разновидности для взрослых и для детей на основе нового дрейфового варианта вируса гриппа А/Виктория/361/2011 (H3N2). Штаммы вирусов гриппа для живых вакцин, применяемые в настоящее время, получают методом генетической реассортации эпидемически актуальных вирусов с холодоадаптированными штаммами - донорами аттенуации [Александрова Г.И. Применение метода генетической рекомбинации для получения вакцинных штаммов вируса гриппа // Вопр. Вирусол. - 1977. - №4. - С.387-395.]. Донором аттенуации для гриппозных вакцин типа А является А/Ленинград/13 4/17/57 (H2N2) -холодоадаптированный (са) температурочувствительный (ts) штамм вируса гриппа, разрешенный для получения безвредных живых интраназальных вакцин для взрослых и детей [Александрова Г.И., Климов А.И. Живая вакцина против гриппа. - СПб.: Наука. - 1994. 151 с.].

Цель реассортации - получить штамм с вакцинной формулой генома 6:2. Гены, кодирующие антигенно значимые поверхностные белки вируса гриппа гемагглютинин (НА) и нейраминидазу (NA), наследуются от циркулирующего эпидемического вируса, а шесть генов, кодирующих внутренние и неструктурные белки (РВ2, РВ1, PA, NP, M, NS), от безопасного донора аттенуации.

В результате предлагаемого изобретения получен вакцинный штамм А/17/Виктория/2011/89 (H3N2), для чего использовали метод генетической реассортации эпидемического вируса А/Виктория/361/2011 (H3N2) с донором аттенуации А/Ленинград/134/17/57 (H2N2). Изобретение осуществили посредством инфицирования развивающихся куриных эмбрионов (РКЭ) смесью родительских вирусов в эквивалентных инфекционных дозах и последующей селекции клонов с заданными свойствами при пониженной до 25°С температуре инкубации в присутствии антисыворотки к донору аттенуации. Клоны дополнительно очищали трехкратным клонированием методом предельных разведений под прессом антисыворотки к донору при пониженной (25°С) и оптимальной (32°С) температурах инкубации. Чистые клоны были проверены по фенотипическим характеристикам (ts-, са-фенотип) и по формуле генома на соответствие требованиям к вакцинному штамму.

Заявляемый вакцинный штамм характеризуется следующими свойствами. Ответственный за антигенную специфичность поверхностный белок вакцинного штамма - гемагглютинин (НА) - в РТГА идентичен вирусу А/Виктория/361/2011 (H3N2), антисывороткой к которому полностью нейтрализуется.

Формула генома 6:2 вакцинного штамма А/17/Виктория/2011/89 (H3N2) соответствует требованиям, предъявляемым к штаммам живой гриппозной вакцины, т.е. гены, кодирующие поверхностные белки НА и NA, принадлежат эпидемическому родительскому вирусу А/Виктория/361/2011 (H3N2), а гены, кодирующие внутренние

Таблица 1
Праймеры для скрининга реассортантных вирусов гриппа сероподтипа A (H3N2) - кандидатов в живую вакцину на основе эпидемически актуального вируса и донора аттенуации
Сегмент генома Родительский вирус Нуклеотидная позиция Последовательность прямого праймера (5'→3') Последовательность обратного праймера (5'→3')
ЭВa 1477-2115 GGTGTGGATGAATACTCCAGTA CATATCCCTCATGCACADTTAGC
РВ2 донор attb 1273-2118 GGTGATCTGAATTTCGTTAATAGG GCCCATTTTGCTGACTCTTAAC
РВ1 ЭВ 1755-2223 GAAGCTGTGGGATCAAACCCAA GTTAATGCTCTAATTAGGTAAC
донор att 1206-2169 TCTCCTAATAGATGGCACAGTC AGTTTGGTCCTCCATCCGAAAT
PA ЭВ 970-1851 GGATGGAAAGAACCTTATATAGTC GCCTGAACAATGAGGAGCAAC
донор att 914-1712 ACGAAGGAGAGGGAATACCAC GTCCTGCAGTTCTGCCAGTAAT
ид ЭВ 29-593 CATGAAGACCATCATTGCTTTGAGCTAC CCACCCATCTACCATTCC
tLr\ донор att 6-858 AAGCAGGGGTTATACCATAGACAACCAAAA CCTTCTGTTTTCATGATCCCTGAACTACCT
NP ЭВ 135-1122 GAAGATGATTGATGGAATTGGGA GATCCTTCATTACTCATGTCAAAG
донор att 640-1331 CGTGGGATCAATGATCGGAAC GAAAGTTTCCCCCTTGGGAT
NA ЭВ 34-568 AAAGATAATAACRATTGGCTCTGTT TATTTTAGTACAGCCAC
донор att 902-1334 TGGAAAGGCTCTAATAGGCCCGTTA CCATCAGTCATTACTACTG
M ЭВ 51-547 CGTATGTTCTCTCTATCGTTCCA CACATATAAGGCCAAATGCTGA
донор att 53-887 TACGTTCTCTCTATCGTCCCG TTTTCAGACCGTGTTTAAAGAAG
мс ЭВ 86-78 ACAAGTTGTAGACCAAGAACTGA AGCCATCTTATTTCTTCAAACTTC
11 0 донор att 13-726 GTGACAAAGACATAATGGATCCT ATTTGCTCAAAACTATTCTCTGTTA
a - Эпидемически актуальные вирусы гриппа А сероподтипа (H3N2).
b - Донор аттенуации А/Ленинград /134/17/57 (H2N2).

белки (РВ2, РВ1, PA, NP, M, NS), принадлежат донору аттенуации А/Ленинград/134/17/57 (H2N2). Это установлено методом «да-нет» PCR. Метод основан на сравнении ДНК-копий участков РНК вирусов, амплифицированных с помощью селективно работающих праймеров (табл.1).

Подобраные праймеры специфично работают либо только с последовательностями генов донора аттенуации, либо только с последовательностями современных эпидемических вирусов [Киселева И.В., Voeten J.T.M., Teley L.C.P. и др. Анализ состава генома штаммов сезонной и пандемической живой гриппозной вакцины // Молекулярная генетика, микробиология и вирусология. - 2011. - №4. - С.29-36].

На фиг.1, в качестве примера, представлен электрофорез в 1.7%-ном агарозном геле, содержащем 0.5 мкг/мл этидиума бромида, амплифицированных ДНК фрагментов гена, кодирующего белок РА с праймерами специфичными (а) - для эпидемического вируса гриппа А/Виктория/361/2011 (H3N2), (б) - для донора аттенуации А/Ленинград/134/17/57 (H2N2). Обозначения: 1-я дорожка - маркер молекулярного веса; 2 и 5-я дорожки - РА ген донора аттенуации А/Ленинград/134/17/57 (H2N2), 3, 4 и 6-я дорожки - РА ген кандидата в вакцинный штамм А/17/Виктория/2011/89 (H3N2), 7-я дорожка - РА ген эпидемического вируса гриппа А/Виктория/361/2011 (H3N2).

Результаты анализа всех генов в составе генома вакцинного штамма А/17/Виктория/2011/89 (H3N2) представлены в таблице 2.

Таблица 2 Состав генома реассортантного вакцинного штамма вируса гриппа А/17/Виктория/2011/89 (H3N2)
Ген Родительские вирусы Реассортантный вакцинный штамм А/17/Виктория/2011/89 (H3N2)
Эпидемический вирус А/Виктория/361/2011 (H3N2) Донор аттенуации А/Ленинград/134/17/57(H2N2)
РВ2 ЭВ1 Лен172 Лен17
РВ1 ЭВ Лен 17 Лен17
РА ЭВ Лен17 Лен17
НА ЭВ Лен17 ЭВ
NP ЭВ Лен17 Лен17
NA ЭВ Лен17 ЭВ
М ЭВ Лен17 Лен17
NS ЭВ Лен17 Лен17
1 - Ген принадлежит эпидемическому вирусу гриппа А/Виктория/361/2011 (H3N2).
2 - Ген принадлежит донору аттенуации А/Ленинград/134/17/57(H2N2).

В экспериментах in vitro определены фенотипические свойства полученного штамма. Вакцинный штамм А/17/Виктория/2011/89 (H3N2) является температурочувствительным (ts маркер: <1 lg ЭИД50/мл при 40°С, где ЭИД50 - эмбриональная инфекционная доза, вызывающая гибель 50% РКЭ) и холодоадаптированным (са маркер: 6,7 lg ЭИД50/мл при 26°С).

Стабильность его фенотипических признаков подтверждена анализом способности к репродукции при оптимальной температуре (32°С) и при температурах за пределами температурного оптимума (25°С и 40°С) до и после его пятикратного пассирования в куриных эмбрионах (табл.3).

Таблица 3 Фенотипические свойства вакцинного штамма А/17/Виктория/2011/89 (H3N2) до и после его пассирования в куриных эмбрионах
Вирус Титр, lg ЭИД50/0.2 мл RCT25 RCT40 Фенотип
32°С 25°С 40°С
А/Ленинград/134/17/57 8.2 6.5 2.0 1.7 6.2 ts, ca
А/Виктория/361/2011 7.5 1.3 7.0 6.2 0.5 non-ts, non-ca
А/17/Виктория/2011/89 (H3N2), до пассирования 8.5 7.3 <1.0 1.2 >7.5 ts, ca
А/17/Виктория/2011/89 (H3N2), 5-й пассаж 8.2 7.0 <1.0 1.2 >7.2 ts, ca

У созданного штамма установлена генетическая стабильность кодирующих мутаций. Генетическую стабильность вакцинного штамма А/17/Виктория/2011/89 (H3N2) изучали сравнением сохранности кодирующих мутаций во внутренних генах «до» и «после» пятикратного пассирования вакцинного штамма в куриных эмбрионах. Секвенированием генов кандидата в вакцинный штамм продемонстрирована идентичность мутаций во всех внутренних генах донора аттенуации А/Ленинград/134/17/57 (H2N2) и вакцинного штамма А/17/Виктория/2011/89 (H3N2) «до» и «после» его пятикратного пассирования, в том числе, в генах полимеразного комплекса (РВ2, РВ1, РА), ответственных за аттенуирующий фенотип (табл. 4).

Таблица 4. Кодирующие мутации в геноме вакцинного штамма А/17/Виктория/2011/89 (H3N2) по сравнению с донором аттенуации А/Ленинград/13 4/17/57 (H2N2) и его диким предшественником, вирусом А/Ленинград/13 4/5 7 (H2N2)
Ген Нуклеотид Аминокислота Мутации
Лен/wt1 Лен 17 А/17/Виктория/2011/89 (H3N2)
до пассирования 5 пассаж
РВ2 1459 478 Val Leu Leu Leu
РВ1 819 265 Lys Asn Asn Asn
1795 591 Val He He He
PA 107 28 Leu Pro Pro Pro
1045 341 Val Leu Leu Leu
NP NP ген донора аттенуации не содержит мутаций
Ml 68 15 He Val Val Val
NS2 798 100 Met He He He
1 Наличие мутаций в геноме вакцинного штамма А/17/Виктория/2011/89 (H3N2) определяли сравнением его аминокислотных последовательностей с последовательностями дикого предшественника донора аттенуации А/Ленинград/134/17/57 (H2N2), а именно, с вирусом дикого типа А/Ленинград/134/57 (H2N2), с помощью секвенирования.
Обозначения: Лен 17 - донор аттенуации А/Ленинград/134/17/57 (H2N2); Лен/wt вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

У созданного штамма была проверена чувствительность к неспецифическим гамма-ингибиторам сыворотки крови, реакции торможения гемагглютинации (РТГА) с нормальной (неиммунной) сывороткой крови лошади, прогретой 10 минут при 80°С. Продемонстрировано, что вакцинный штамм А/17/Виктория/2011/89 (H3N2), равно как и его эпидемический родитель А/Виктория/361/2011 (H3N2), высоко устойчивы к гамма-ингибиторам сыворотки крови лошади.

Изучение острой токсичности вакцинного штамма А/17/Виктория/2011/89 (H3N2) проводили в экспериментах на белых мышах обоего пола. Мышам вводили вирус внутрибрюшинно однократно в объеме 0.5 мл. Животным контрольной группы не вводили ничего. Безвредность вакцинного штамма А/17/Виктория/2011/89 (H3N2) оценивали по выживаемости животных и прибавке в весе. Вирус вводили в дозе 71g ЭИД50/0.2мл. В результате испытаний установлена безвредность вакцинного штамма для лабораторных животных при его внутрибрюшинном введении. Отмечена прибавка в весе животных при их 100%-ной выживаемости (табл. 5).

Таблица 5. Результаты изучения безвредности вакцинного штамма в экспериментах на мышах
Пол Введено Выжило Прибавка веса, г
Самцы ВШ в/б 10/10 +1.2
Самки ВШ в/б 10/10 +1.4
Самцы контроль 10/10 +1.4
Самки контроль 10/10 +1.3
Обозначения: ВШ - вакцинный штамм А/17/Виктория/2011/89 (H3N2);
в/б - внутрибрюшинное введение.

У нового штамма определяли аттенуацию и нейровирулентность для мышей. Изучение аттенуирующих свойств вакцинного штамма А/17/Виктория/2011/89 (H3N2) проводили в экспериментах на белых мышах после их интраназального заражения, оценивая степень репродукции вируса в легких по сравнению с уровнем репродукции донора аттенуации А/Ленинград/134/17/57 (H2N2) и его дикого предшественника, вируса А/Ленинград/134/57 (H2N2).

Отсутствие нейровирулентной активности у вакцинного штамма А/17/Виктория/2011/89 (H3N2) изучали путем интраназального заражения мышей с последующим выделением вируса из ткани мозга. В качестве контроля был использован нейровирулентный штамм вируса гриппа A/WSN/33 (H1N1). Вирусы вводили в дозе 7 lg ЭИД50/0.2мл.

Опыты показали, что вакцинный штамм А/17/Виктория/2011/89 (H3N2) выделялся из легких и носовых ходов мышей в титрах, аналогичных донору аттенуации А/Ленинград/13 4/17/5 7 (H2N2). При этом вирусы дикого типа, такие как А/Ленинград/134/57 (H2N2) и A/WSN/33 (H1N1), использованные в тестировании созданного штамма, активнее репродуцировались в легких мышей по сравнению с холодоадаптированными вирусами (табл. 6), что подтверждает аттенуированный фенотип вакцинного штамма А/17/Виктория/2011/89 (H3N2). Установлено полное отсутствие проникновения вакцинного штамма А/17/Виктория/2011/89 (H3N2) в мозг инфицированных животных после их интраназального заражения при активной репродукции в мозговой ткани нейровирулентного вируса A/WSN/33 (H1N1).

Таблица 6 Изучение репродукции вакцинного штамма во внутренних органах мышей после интраназального заражения
Введенный мышам вирус Выделение вируса из органов, lg ЭИД50/0.2 мл
Легкие Носовые ходы Мозг
Лен 17 2.1 1.2 Не выделен
Лен/wt 5.5 3.6 Не выделен
А/17/Виктория/2011/89 2.1 1.3 Не выделен
A/WSN/33 6.3 4.8 5.3
Плацебо Не выделен Не выделен Не выделен
Обозначения: Лен17 - донор аттенуации А/Ленинград/134/17/57 (H2N2);
Лен/wt - вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

Обозначения: Лен17 - донор аттенуации А/Ленинград/134/17/57 (H2N2);

Лен/wt - вирус дикого типа А/Ленинград/134/57 (H2N2), предшественник донора аттенуации.

В ходе исследований установлено, что заявляемый вакцинный штамм живой гриппозной вакцины А/17/Виктория/2011/89 (H3N2) характеризуется сочетанием полезных признаков, необходимых вакцинному штамму: антигенной специфичностью эпидемического вируса А/Виктория/361/2011 (H3N2), структурой генома, оптимальной для реассортантных вакцинных штаммов, температурочувствительностью и холодоадаптированностью, что коррелирует с аттенуацией для человека, характерной для донора аттенуации. Инфекционная активность вакцинного штамма при репродукции в развивающихся куриных эмбрионах при 32°С в течение 48 часов - 8,8 lg ЭИД50/мл. Гемагглютинирующая активность - 1:1024. Штамм проявляет генетическую стабильность биологических признаков после 5 пассажей на куриных эмбрионах (при использовании больших заражающих доз). Штамм аттенуирован и безвреден для лабораторных животных. Морфология штамма полиморфная, типичная для вируса гриппа.

Таким образом, вакцинный штамм А/17/Виктория/2011/89 (H3N2) по биологическим свойствам соответствует требованиям, предъявляемым к вакцинным штаммам Фармакопейной статьей ФСП Р№ 003224/01-050210 на живую гриппозную вакцину для интраназального применения и действующему приказу Министерства здравоохранения РФ от 07.08.1998 №156/79 «О подготовке новых вакцинных, производственных и диагностических штаммов вируса гриппа и их внедрении в производство вакцин и диагностических препаратов».

В прилагаемом паспорте на штамм указаны требуемые для вакцинного штамма характеристики.

Штамм депонирован в Государственную коллекцию вирусов ГУ НИИ вирусологии им. Д.И. Ивановского РАМН. Штамму присвоен № депонента ГКВ № 2724.

ПАСПОРТ ВАКЦИННОГО ШТАММА

1 Название штамма А/17/Виктория/2011/89

2 ИЭМ№ 8995.

3 Серия (Лот №) Серия №1.

4 Сероподтип H3N2.

5 Метод подготовки Классическая реассортация в куриных эмбрионах.

6 Родительские вирусы.

6.1 Эпидемический штамм: А/Виктория/361/2011 (H3N2); CDC ID# 2012702646.

6.2 Донор аттенуации: А/Ленинград/134/17/57 (H2N2).

7 Пассажи в куриных Е7/Е1 (совместное заражение, два селективных пассажа, эмбрионах в процессе четыре клонирования и одно накопление) реассортации

8 Состав генома Гены РВ2, FBI, PA,NP, M и NS от донора аттенуации, НА и NA - от эпидемического вируса (формула генома 6:2).

9 Характеристика штамма до лиофильной сушки.

9.1 Оптимальные условия накопления 32°С, 48 часов.

9.2 Титр ГА 1:1024 с 1.0% куриными эритроцитами.

9.3 Титр вируса при оптимальной температуре 32°С 8.8 log10 ЭИД50/мл.

9.4 Взаимодействие с неспецифическими γ-ингибиторами сыворотки крови лошади и морской свинки: устойчив.

9.5 ts маркер: <1 lg ЭИД50/мл при 40°С (ts фенотип).

9.6 са маркер: 6.7 lg ЭИД50/мл при 26°С (са фенотип).

10 Характеристика штамма после лиофильной сушки

10.1 Дата лиофилизации: 16.04.2012 г.

10.2 Объем материала в ампуле: 0.5 мл.

10.3 Титр вируса при 32°С: 8.0 lg ЭИД50/мл.

10.4 Титр ГА - 1:512 с 1.0% куриными эритроцитами.

11 Антигенная специфичность

11.1 Гемагглютинин: идентичен эпидемическому вирусу А/Виктория/3 61/2011 (H3N2), что подтверждено в РТГА с гипериммунной крысиной сывороткой.

11.2 Нейраминидаза: идентична эпидемическому вирусу А/Виктория/3 61/2011 (H3N2), подтверждено секвенированием.

12 Токсикологическое: Не токсичен после внутрибрюшинного заражения исследование in vivo (острая мышей токсичность)

13 Контроль стерильности Стерилен (30.04.2012).

Штамм вируса гриппа А/17/Виктория/2011/89 (H3N2), депонированный в Государственной коллекции вирусов ФГБУ «Научно-исследовательский институт вирусологии им. Д.И. Ивановского» Минздравсоцразвития России под номером 2724, для получения живой гриппозной интраназальной эпидемической вакцины для взрослых и для детей.



 

Похожие патенты:

Изобретение относится к области медицины и касается способа диагностики гриппа С. Представленный способ включает выявление РНК вируса в мазках из носоглотки человека и животных путем проведения этапов обратной транскрипции и амплификации в одной пробирке методом полимеразной цепной реакции в режиме реального времени со специфичными зондом (5'-TGCTCCTGAAACCAGGACAG-3') и праймерами (5'-GAAATATTGATTGCTGAGACAGA-3', 5'-CCCTCCTGTTATTGCTGAAATTA-3').
Представленное изобретение относится к области медицинской микробиологии и касается способа обнаружения микроорганизма вида Vibrio parahaemolyticus. Способ включает посев исследуемого штамма на газон культуры, нанесение капли диагностического препарата фага в центр чашки, выдерживание при температуре 37°С в течение 20-24 часов и подтверждение его принадлежности к микроорганизмам вида V.
Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для идентификации вируса блютанга 6, 14 и 21 серотипов. Охарактеризованные праймеры комплементарны участкам вариабельного 2-го сегмента генома вируса блютанга нуклеотипа С (6, 14 и 21 серотипы) используются в ОТ-ПЦР с электрофоретической детекцией продуктов амплификации для идентификации вируса блютанга 6, 14 и 21 серотипов и имеют следующий состав (5'-3'): Прямой: GRAYATGRTGGATATWCCG Обратный: GGCTGCACRTCCAYYGARTC Представленное изобретение позволяет определить генетическую группу нуклеотипа C вируса блютанга в образцах исследуемого биологического материала с помощью ОТ-ПЦР в короткие сроки.
Изобретение относится к медицинской вирусологии и может быть использовано при производстве живой холодоадаптированной аттенуированной вакцины против гриппа. Холодоадаптированный штамм вируса гриппа В/Виктория/2/63/87 обладает уникальными мутациями в генах, кодирующих белки PB2, PB1, PA, NP, M1, NS1, и предназначен для получения холодоадаптированных реассортантных штаммов-кандидатов для получения живой гриппозной сезонной вакцины.
Изобретение относится к области ветеринарной вирусологии и биотехнологии. От племенной нетели выделен штамм вируса блютанга 14 серотипа, депонированный в коллекции микроорганизмов ГНУ ВНИИВВиМ Россельхозакадемии под №3032.

Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается вакцины против ящура типа А. Вакцина содержит авирулентный и очищенный антигенный материал из штамма вируса Aphtae epizooticae, сем.
Изобретение относится к медицинской вирусологии и микробиологии. Способ оценки противооспенной активности лечебно-профилактических препаратов включает введение в организм модельных животных контрольной и испытуемой групп по заданной схеме суспензии исследуемого противовирусного препарата.
Изобретение относится к области медицины. Способ предусматривает отделение подвижных сперматозоидов от спермоплазмы и сопутствующих клеток путем центрифугирования и последующей инкубации в специальных средах с целью забора супернатанта, содержащего «отмытые» сперматозоиды для проведения оплодотворения.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к области медицины и касается способа диагностики гриппа С. Представленный способ включает выявление РНК вируса в мазках из носоглотки человека и животных путем проведения этапов обратной транскрипции и амплификации в одной пробирке методом полимеразной цепной реакции в режиме реального времени со специфичными зондом (5'-TGCTCCTGAAACCAGGACAG-3') и праймерами (5'-GAAATATTGATTGCTGAGACAGA-3', 5'-CCCTCCTGTTATTGCTGAAATTA-3').

Изобретение относится к области биотехнологии и медицины и касается вакцины против гриппа, вызываемого известными штаммами вирусов гриппа А и В, а также возможными реассортантами.
Изобретение относится к медицинской вирусологии и может быть использовано при производстве живой холодоадаптированной аттенуированной вакцины против гриппа. Холодоадаптированный штамм вируса гриппа В/Виктория/2/63/87 обладает уникальными мутациями в генах, кодирующих белки PB2, PB1, PA, NP, M1, NS1, и предназначен для получения холодоадаптированных реассортантных штаммов-кандидатов для получения живой гриппозной сезонной вакцины.

Изобретение относится к области молекулярной биологии, вирусологии, генной инженерии, биотехнологии и ветеринарии. Предложена рекомбинантная вакцина, содержащая рекомбинантный вирус и фармацевтически приемлемые носитель, адъювант или эксципиент, где рекомбинантный вирус является инактивированным и содержится в вакцине в виде вирусного вектора, имеющего введенную экзогенную нуклеотидную последовательность, которая кодирует антиген заболевания, где инактивацию вируса проводят физическими или химическими методами, и вакцина является эффективной против, по меньшей мере, указанного заболевания, связанного с указанным антигеном.

Изобретение относится к области биотехнологии и касается рекомбинантных векторов, используемых для производства противогриппозных вакцин. Охарактеризованы рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа и способ ее использования.

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложен реассортантный вирус гриппа для производства вакцин.

Изобретение относится к области биотехнологии и вирусологии. Представлены выделенные штаммы вируса гриппа, которые способны инфицировать собачьих и вызывать респираторное заболевание в собачьих.

Изобретение относится к области медицинской биотехнологии и касается штаммов вируса гриппа. Представлен штамм вируса гриппа A/Гонконг/1/68/162/35 (H3N2), депонированный в Государственную коллекцию вирусов научно-исследовательского института вирусологии им.

Изобретение относится к области биотехнологии и касается рекомбинантных векторов, используемых для производства противогриппозных вакцин. Охарактеризованы рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа и способ ее использования.

Изобретение относится к области биотехнологии и касается рекомбинантных векторов, которые могут быть использованы для противогриппозных вакцин. Охарактеризованы рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа и способ ее использования в качестве компонента для создания вакцины против вируса гриппа А субтипа H1N1.

Изобретение относится к области медицины и может быть использовано для производства различных инактивированных вакцин против гриппа. Для этого проводят заражение куриных эмбрионов, сбор вируссодержащей аллантоисной жидкости (ВАЖ), очистку ВАЖ методом микрофильтрации. Очистку ВАЖ осуществляют с использованием полиэтиленгликоля с молекулярной массой 6000 в концентрации 1,5% с последующей микрофильтрацией на глубинных фильтрах с диаметром пор 1,0 мкм и 10,0 мкм. Далее очищенная ВАЖ концентрируется методом ультрафильтрации на мембранах с отсечкой молекулярного веса 100 килодальтон и полученный концентрат очищается в градиенте плотности сахарозы методом ультрацентрифугирования. Использование данного способа позволяет повысить качество очистки вирионов, а также увеличить количество вирусных антигенов, получаемых с одного куриного эмбриона. 1 табл., 1 ил., 6 пр.
Наверх