Способ прогнозирования риска развития пролапса гениталий у женщин

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для прогнозирования степени риска развития пролапса гениталий у женщин. Проводят отбор биоматериала для выделения ДНК. Генотипируют ДНК методом тетра-праймерной аллель-специфической полимеразной цепной реакции. Выявляют полиморфизм гена FBLN5 по сайтам rs12586948 и rs2018736. При наличии аллелей однонуклеотидных вариантов rs12586948-A и/или rs2018736-С прогнозируют высокую степень риска развития пролапса гениталий. При наличии аллелей однонуклеотидных вариантов rs12586948-G и/или rs2018736-A прогнозируют пониженную степень риска. Изобретение позволяет выявлять пациенток с высокой степенью риска развития пролапса гениталий для проведения своевременных и целенаправленных мероприятий по профилактике развития данной патологии. 1 ил., 3 табл., 3 пр.

 

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для прогнозирования повышенного риска развития пролапса гениталий.

Известно, что частота пролапса гениталий (ПГ) составляет 15-30%, увеличиваясь с возрастом до 50-60%. Существуют расовые отличия частоты заболевания, свидетельствующие о том, что ПГ более характерен для женщин европеоидного и латино-американского происхождения по сравнению с афроамериканками (Whitcomb EL, Rortveit G, Brown JS, Creasman JM, Thom DH, Van Den Eeden SK, Subak LL. Racial differences in pelvic organ prolapse. Obstet Gynecol. 2009 Dec; 114(6): 1271-7). Значимым фактором риска развития ПГ является наследственность, которая может обусловливать до 40% случаев формирования ПГ (Altman, D., Forsman, М., Falconer, С., and Lichtenstein, P. (2008). Genetic influence on stress urinary incontinence and pelvic organ prolapse. Eur. Urol. 54, 918-922).

В связи с этим чрезвычайно важно прогнозирование повышенного риска развития ПГ у женщин любого возраста.

Описан ряд способов решения этой задачи. Так, из патента RU 2341181 С1, Ящук А.Г. и др., от 20.12.2008 известен способ оценки риска формирования постгистерэктомического пролапса (ПГП) У женщины до операции гистерэктомии определяют возраст впервые возникшего ПГП; возраст менопаузы; длительность постменопаузального периода; паритет; наличие в анамнезе хронических бронхо-легочных заболеваний, связанных с хроническим кашлем; наличие в анамнезе ПГП у родственников первой степени родства; возраст на момент гистерэктомии; определяют наличие признаков дисплазии соединительной ткани, оценивая степени ее выраженности по шкале Смольновой Т.Ю.; наличие ПГП до гистерэктомии; уровень суточной экскреции оксипролина. Полученные анамнестические данные и результаты обследования подставляют в математические прогностические модели, по большему из полученных коэффициентов прогнозируют вероятность развития ПГП гениталий.

Недостатком данного способа является прогнозирование лишь предрасположенности к ПГП после гистерэктомии при наличии такового до операции, что не дает возможности прогнозировать риск развития заболевания в любом возрасте при отсутствии каких-либо симптомов патологии.

Близким аналогом является изобретение по патенту RU 2310849 С1, А.Г. Ящук и др., от 20.11.2007. Способ прогнозирования десценции тазового дна основан на выявлении полиморфизма гена интерстициального коллагена Со13АI. Выделяют геномную ДНК из лейкоцитов свежей или замороженной консервированной периферической венозной крови методом последовательной фенольно-хлороформной экстракции. С помощью полимеразной цепной реакции синтеза ДНК амплифицируют фрагменты локусов Alu и VNTR гена коллагена 3 типа. При выявлении генотипов Alu -/- с отсутствием инсерции и VNTR*2*2 аллеля, прогнозируют риск развития тазовой десценции у обследуемых.

Однако в данной работе не показана корреляция между генотипом и экспрессией белка; в качестве негенетических факторов риска, учтенных в логистическом регрессионном анализе, указаны следующие ковариаты: гипермобильность суставов, варикозное расширение вен нижних конечностей, костные нарушения, наследственная отягощенность. Между тем, хорошо известно, что наибольшей специфичностью относительно риска развития ПГ являются такие факторы, как возраст и повреждения мягких родовых путей во время родов. Кроме того, предложенный способ основан на выявлении полиморфных вариантов в генах, контролирующих процессы формирования коллагенового, но не эластического волокна в структурах соединительной ткани.

Задача изобретения - разработка способа выявления высокого риска развития ПГ путем поиска новых критериев патологии.

Способ прогнозирования степени риска развития ПГ у женщин, заключающийся в отборе биоматериала для выделения ДНК, проведении генотипирования ДНК методом тетра-праймерной аллель-специфической ПЦР реакции, характеризуется выявлением полиморфизма гена FBLN5 по сайтам rs12586948 и rs2018736, при этом высокую степень риска развития ПГ прогнозируют при наличии аллелей однонуклеотидных вариантов rs12586948-A и/или rs2018736-C, а пониженную степень риска - при наличии аллелей однонуклеотидных вариантов rs12586948-G и/или rs2018736-A.

Технический результат - выявление объективных и информативных критериев прогнозирования высокого риска развития ПГ у женщин любого возраста.

В основе патентуемого способа лежат следующие предпосылки.

Процессы, развитие которых вызывает ослабление поддерживающих структур тазового дна, до сих пор окончательно неизвестны, однако предполагается, что генетически обусловленные различия в строении соединительной ткани могут вносить свой вклад в развитие этого патологического процесса. Например, в полногеномном исследовании близких родственников с ПГ (124 пробанда, всего 209 женщин) показана ассоциация участка хромосомы 9q21 с наследственным пролапсом гениталий (Allen-Brady К. Norton PA, Famham JM, Teerlink С, Cannon-Albright LA. Significant linkage evidence for a predisposition gene for pelvic floor disorders on chromosome 9q21. Am J Hum Genet. 2009 May; 84(5):678-82). Наиболее выраженная ассоциация получена для находящегося в межгенном участке однонуклеотидного варианта rs 11139451, что не позволяет установить возможные механизмы и метаболические пути, на которые может влиять данный полиморфизм.

Известно, что одним из ключевых белков соединительной ткани является матриксный белок фибулин-5 (FBLN5). Мутации в гене FBLN5 обусловливают развитие синдрома вялой кожи и возрастную дегенерацию макулы (http://omim.org/entry/604580; Jones RP, Ridlev С, Jowitt ТА, Wang MC, Howard M, Bobola N, Wane Т, Bishop PN, Kieltv CM, Baldock C, Loterv AJ, Trumn D. Structural effects of fibulin 5 missense mutations associated with age-related macular degeneration and cutis laxa. Invest Ophthalmol Vis Sci. 2010 May; 51(5):2356-62). В экспериментальных исследованиях показана роль FBLN5 в аномальном эластогенезе, увеличении протеазной активности и ослаблении «поддержки» тазовых органов с возрастом (Drewes PG, Yanagisawa H, Starcher В, Hornstra IK, Csiszar K, Marinis SI, Keller P, Word RA. Pelvic organ prolapse in Fibulin-5 knockout mice: pregnancy changes in elastic fiber homeostasis in mouse vagina. Am J Pathol 2007; 170: 578-589). Таким образом, ген FBLN5 может рассматриваться как один из наиболее перспективных для изучения в качестве гена предрасположенности к ПГ.

Ген FBLN5 не имеет известных функциональных полиморфных вариантов, для которых была бы показана устойчивая ассоциация с экспрессией гена и заболеваниями соединительной ткани (Badger SA, Soong CV. O′Donnell ME, Sharif MA, Makar RR, Hughes AE. Common polymorphisms of Fibulin-5 and the risk of abdominal aortic aneurysm development. Vase Med. 2010 Apr; 15(2): 113-7; Brión M, Sanchez-Salorio M, Cortón M, de la Fuente M, Pazos B, Othman M, Swaroop A, Abecasis G, Sobrino B, Carracedo A: Spanish multi-centre group of AMD. Genetic association study of age-related macular degeneration in the Spanish population. Acta Ophthalmol. 2011 Feb; 89(1):e12-22. doi: 10.1111/j.1755-3768.2010.02040.X. Epub 2010 Nov 25).

В связи поставленной задачей была сопоставлена частота встречаемости минорных аллелей rs12586948-A и rs2018736-C у пациенток с ПГ и у здоровых женщин. Для ассоциативного исследования ПГ выбор сайтов для генотипирования был основан на использовании ресурса HaploView (version 4.2) для подбора таргетных SNP с целью покрытия всего гена. На фигуре 1 показана гаплотипическая структура гена FBLN5. Ген включает девять блоков сцепления, в каждом из которых было прогенотипировано по одному из таргетных SNP.

Методом тетра-праймерной аллель-специфической ПЦР реакции нами было определено распределение частот аллелей таргетных однонуклеотидных вариантов FBLN5 у пациенток с ПГ и у здоровых женщин. Группа с ПГ и здоровые женщины аналогичны по факторам риска (возраст, репродуктивный период или менопауза/постменопауза, количество родов естественным путем, повреждение родовых путей в процессе родов). Статистическая обработка данных основывалась на множественном регрессионном анализе с учетом в качестве ковариат факторов риска.

Все изученные варианты находились в состоянии равновесия по Харди-Вайнбергу. Минорные аллели rs12586948-A и rs2018736-C чаще встречались у женщин с ПГ по сравнению с контрольной группой (множественный регрессионный анализ - аддитивная модель: Р=0.01, OR=1.59, 95% ДИ: 1.11-2.28 и Р=0.03, OR=1.38, 95% ДИ: 1.03-87, соответственно (Таблица 2). Гаплотип АС при частоте встречаемости 18.46% характеризовался значимостью эффекта: Р=0.0071, OR=1.73, 95% ДИ: 1.16-2.58.

В протокол обследования включается генотипирование на предмет выявления полиморфных вариантов гена FNLN5 (rs12586948 и rs2018736), которое проводится в один этап на стандартном оборудовании для ПЦР-лаборатории. Для генотипирования образцы крови собирают в вакутейнеры, содержащие ЭДТА, и хранят при ~(20-80)°С до выделения ДНК. Для генотипирования ДНК выделяют из цельной крови с помощью наборов Diatom DNA Prep 200, основанных на использовании гуанидинтиоционата и Nucleus-сорбента (Isogene Lab.Ltd, Россия). Для проведения ПЦР реакции используют лиофилизированные готовые наборы Master Mix (Фирма Изоген), в которые добавляют 10 мкл ПЦР-растворителя (Фирма Изоген), 3 мкл праймеров (оптическая плотность 3-4 о.е.), 2 мкл деионизованной воды, 5 мкл исследуемой ДНК. Праймеры и условия ПЦР реакции описаны в таблице 3. Амплификацию проводят в амплификаторе Applied Biosystems 9700 (GeneAmp® PCR System 9700). Визуализацию результатов осуществляют в 2% агарозном геле с добавлением бромистого этидия.

В нижеследующих примерах приведены доказательства возможности реализации заявленного назначения и достижения указанного технического результата.

Пример 1. Пациентка из основной группы (образец №181).

Негенетические факторы риска (в основном отсутствуют):

- пременопаузальный период (49 лет),

- не занимается тяжелым физическим трудом,

- без вредных привычек,

- одни роды, вес ребенка менее 4 кг, без повреждения родовых путей.

В норме экспрессия фибулина 5 в тканях эпителия, эндотелия, фибробластах и экстрацеллюлярном матриксе составляет 6 баллов. Иммуногистохимическое исследование тканей влагалища пациентки показало сниженную экспрессию фибулина 5: эпителий - 4 балла, эндотелий - 4 балла, фибробласты - 4 балла, экстрацеллюлярный матрикс - 3 балла.

Данные иммуногистохимического исследования коррелируют с генотипическими данными: пациентка является носительницей гомозиготных минорных вариантов по обоим сайтам гена FBLN5 (rs12586948-A/A и rs2018736-C/C), ассоциированных по результатам исследования с наследственной предрасположенностью к ПГ.

Пример 2. Пациентка из основной группы (образец №95).

Негенетические факторы риска присутствуют частично:

- пременопаузальный период (51 год),

- не занимается тяжелым физическим трудом,

- без вредных привычек,

- трое родов, ребенок (дети) более 4 кг, без повреждения родовых путей.

Иммуногистохимическое исследование тканей влагалища показало сниженную экспрессию фибулина 5: эпителий - 4 балла, эндотелий - 6 балла, фибробласты - 4 балла, экстрацеллюлярный матрикс - 2 балла.

Пациентка является гетерозиготной носительницей минорных аллелей по обоим сайтам гена FBLN5 (rs12586948-G/A и rs2018736-A/C), ассоциированных по результатам исследования с наследственной предрасположенностью к ПГ.

Пример 3. Пациентка из контрольной группы (образец №267).

Негенетические факторы риска присутствуют:

- постменопаузальный период (71 год; более 10 лет постменопауза),

- не занимается тяжелым физическим трудом,

- без вредных привычек,

- двое родов с повреждением родовых путей. Повреждение родовых путей рассматривается как основной фактор риска развития ПГ (Dietz HP. Genetics of pelvic organ prolapse: comment. Int Urogynecol J. 2012 Apr; 23(4):509-10).

Пациентка является гомозиготной носительницей мажорных (протективных) аллелей по обоим сайтам гена FBLN5 (rs12586948-G/G и rs2018736-A/A), ассоциированных по результатам исследования со снижением риска формирования ПГ.

Таким образом, высокую степень риска развития ПГ возможно прогнозировать при выявлении минорных аллелей однонуклеотидных вариантов rs12586948-A и/или rs2018736-C.

Патентуемый способ позволяет выявить пациенток с высокой степенью риска развития ПГ для проведения своевременных и целенаправленных мероприятий по профилактике развития данной патологии.

Таблица 1
Список таргетных SNP
Блок сцепления № SNP на фигуре Идентификационный номер в db SNP (rs)
1 1 rs2430339
2 5 rs12586948
3 7 rs2284337
4 22 rs2498841
5 41 rs2018736
6 46 rs12589592
7 51 rs2284340
8 58 rs2245701
9 64 rs2474028
Таблица 2
Частоты генотипов и аллелей, ассоциированных с ПГ
Сайт Аллели и генотипы Контроль, n (%) ПГ, n (%)
rs12586948 G 428 (79.9) 298 (73.4)
А 108 (20.1) 108 (26.6)
GG 170 (63.4) 110 (54.2)
GA 88 (32.8) 78 (38.4)
АА 10 (3.7) 15 (7.4)
rs2018736 А 330 (61.8) 226 (53.8)
С 204 (38.2) 194 (46.2)
АА 103 (38.6) 62 (29.5)
АС 124 (46.4) 102 (48.6)
СС 40 (15.0) 46 (21.9)
Таблица 3
Праймеры и условия ПЦР реакции
Праймеры 5′-3′ Условия амплификации
SNP F (внешний прямой), Соотношение праймеров в реакционной смеси (в частях) Режимы Длины фрагментов (п.н.)
R (внешний обратный),
F (внутренний, в скобках указан аллельный вариант),
R (внутренний, в скобках указан аллельный вариант)
rs12586948 F atactccaccctggacaacg 0.8 94° - 1 мин, (94° - 30 сек, 63.8° - 25 сек, 72° - 25 сек) × 32 цикла, 72° - 5 мин 395
R tggttctgcccaagactagc 1.0
F(a) tactgagccagaatctgta 1.0 235
R(g) cctgtggattgtgttaagcc 0.8 198
rs2018736 F acgaccccagagtagcagaa 1.0 94° - 1 мин, (94° - 30 сек, 61° - 30 сек, 72° - 30 сек) × 32 цикла, 72° - 5 мин 542
R gactcctgagcagaggcatt 1.0
F(c) tgccctttctcagccac 1.0 193
R(a) gctggtgctcatagagggt 1.0 384

Способ прогнозирования степени риска развития пролапса гениталий у женщин, характеризующийся тем, что проводят отбор биоматериала для выделения ДНК, генотипируют ДНК методом тетра-праймерной аллель-специфической полимеразной цепной реакции, выявляют полиморфизм гена FBLN5 по сайтам rs12586948 и rs2018736, при этом высокую степень риска развития пролапса гениталий прогнозируют при наличии аллелей однонуклеотидных вариантов rs12586948-A и/или rs2018736-С, а пониженную степень риска - при наличии аллелей однонуклеотидных вариантов rs12586948-G и/или rs2018736-A.



 

Похожие патенты:

Изобретение относится к медицине, а именно к иммунотерапии, и может быть использовано для оценки эффективности лечения у пациента с раком. Для этого пациенту вводят иммуногенную композицию, которая содержит рекомбинантный вирусный вектор, экспрессирующий in vivo весь или часть MUC-1 антигена.

Изобретение относится к медицине, а именно к перинатологии и неонатологии, и описывает способ ранней диагностики вентрикуломегалии при церебральной ишемии тяжелой степени у новорожденных с внутриутробной цитомегаловирусно-герпетической инфекцией.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития плацентарной недостаточности с синдромом задержки роста плода 2-3-ей степени у беременных.

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано для оценки тяжести течения текущего депрессивного эпизода у больных рекуррентным депрессивным расстройством.
Изобретение относится к медицине, а именно к гематологии, к лабораторной диагностике и может быть использовано для дифференциальной диагностики анемии у детей. На гематологическом анализаторе определяют показатели гемограммы и индексы красной крови, такие как: гемоглобин (НВ) и гемоглобин ретикулоцитов (Ret-He), а в сыворотке крови определяют уровень растворимого рецептора трансферрина (p-ТФР), эритропоэтина сыворотки (ЭПО), сравнивают полученные показатели с референсными интервалами.
Изобретение относится к области медицины, а именно к акушерству, предназначено для прогнозирования патологии в родах, в частности дискоординации родовой деятельности (дистоции шейки матки).

Изобретение относится к области медицины, в частности к онкологии, и описывает способ диагностики стадий распространенного рака яичников, включающий исследование плазмы крови, где у пациентки определяют стадию заболеванию по международной гинекологической классификации (FIGO) и относят его к III или IV клинической стадии по уровню окислительной модификации белков (ОМБ) в плазме крови, причем III стадия определяется уровнем ОМБ от 4,638 до ∞, а IV стадия - уровнем ОМБ от 0 до 4,638.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности свободноягодника колючего, элеутерококка (Eleutherococcus senticocus (Rupr.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности сушеницы болотной (Filaginella uliginosa (L.) Opiz).

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности аралии высокой (Aralia elata (Miq.) Seem.).
Изобретение относится к медицине, а именно к педиатрии, неонатологии и пульмонологии, и может быть использовано для раннего прогнозирования исходов врожденной пневмонии у глубоконедоношенных новорожденных. Сущность изобретения состоит в том, что на 1-2 сутки жизни проводят определение содержания кателицидина LL 37 в разовой порции фарингеального аспирата. При уровне кателицидина LL 37, равном 10,2 нг/мл или более, прогнозируют благоприятный исход врожденной пневмонии у глубоконедоношенных новорожденных, а при его содержании менее 10,2 нг/мл - летальный исход. Способ позволяет с высокой точностью прогнозировать исходы врожденной пневмонии у глубоконедоношенных новорожденных, своевременно скорректировать и усилить назначенную терапию и тем самым улучшить исход заболевания, что приводит к уменьшению экономических затрат на лечение и предупреждает нарушения состояния здоровья ребенка в дальнейшем. 1 табл., 3 пр.
Изобретение относится к области медицины и предназначено для прогнозирования развития хронического травматического остеомиелита при переломах. Осуществляют исследование крови и, при выявлении генотипа А/А G-308A гена TNFa, прогнозируют развитие хронического травматического остеомиелита. Изобретение позволяет с большей точностью прогнозировать развитие хронического травматического остеомиелита на стадии доклинических проявлений и вносить необходимую коррекцию в лечение данной группы пациентов. 3 пр.
Изобретение относится к медицине, а именно к травматологии и ортопедии; может быть использовано для ранней диагностики синдрома жировой эмболии при переломах длинных трубчатых костей и костей таза и контроля эффективности проводимого лечения. Способ диагностики синдрома жировой эмболии заключается в исследовании сыворотки венозной крови, забранной у пациента в первые сутки посттравматического периода, и определении в ней концентрации белка S100B иммуноферментным методом. При превышении нормы белка S100B, составляющей 125 нг/л, диагностируется синдром жировой эмболии. Предложенный способ позволяет повысить точность ранней диагностики СЖЭ без необходимости выполнения спинальной пункции или пункции бедренной артерии, способных привести к серьезным осложнениям. 1 табл., 2 пр.
Изобретение относится к области медицины и предназначено для прогнозирования течения хронической сердечной недостаточности у пациентов с ишемической болезнью сердца. У пациентов определяют полиморфизм гена белка p53. При наличии аллеля Arg и генотипа Arg/Arg полиморфного локуса Arg72Pro экзона 4 прогнозируют неблагоприятное течение заболевания. Изобретение обеспечивает эффективное прогнозирование неблагоприятного течения хронической сердечной недостаточности у больных ишемической болезнью сердца, что позволяет выделить приоритетную группу больных для диспансерного наблюдения с организацией мероприятий, направленных на предотвращение у них преждевременной смертности. 5 табл., 2 пр.

Предложенная группа изобретений относится к области медицины, в частности онкологии и молекулярной биологии. Предложены способ и набор праймеров и зонда с последовательностями SEQ ID NO: 1, 2 и 3 для осуществления полимеразной цепной реакции в режиме реального времени для диагностики светлоклеточной почечноклеточной карциномы (СПК). Оценивают количественное содержание мРНК гена ACY1. При сниженном содержании мРНК в предположительно пораженной раком ткани человека по сравнению с количеством мРНК в здоровой ткани диагностируют СПК. Предложенная группа изобретений позволяет с высокой достоверностью диагностировать СПК, в том числе на ранней стадии опухолевого заболевания. 2 н. и 2 з.п. ф-лы, 1 ил., 5 табл., 6 пр.

Предложенная группа изобретений относится к области медицины, в частности онкологии и молекулярной биологии. Предложены способ и набор праймеров и зонда с последовательностями SEQ ID NO: 1, 2 и 3 для осуществления полимеразной цепной реакции в режиме реального времени для диагностики светлоклеточной почечноклеточной карциномы (СПК). Оценивают количественное содержание мРНК гена NETO2. При повышенном содержании мРНК в предположительно пораженной раком ткани человека по сравнению с количеством мРНК в здоровой ткани диагностируют СПК. Предложенная группа изобретений позволяет с высокой достоверностью диагностировать СПК, в том числе на ранней стадии опухолевого заболевания. 2 н. и 2 з.п. ф-лы, 1 ил., 5 табл., 6 пр.
Изобретение относится к медицине, а именно к перинатологии и неонатологии. Целью предлагаемого изобретения является ранняя диагностика вентрикуломегалии при церебральной ишемии средней степени тяжести, обусловленной внутриутробной цитомегаловирусно-герпетической инфекцией у новорожденных, где при отсутствии развития вентрикуломегалии на 5 сутки жизни в надосадочной части биологической жидкости носоглоточного аспирата сразу после рождения концентрация серомукоида составляет 0,136-0,166 единиц оптической плотности, а при развитии вентрикуломегалии на 5 сутки жизни в надосадочной части биологической жидкости носоглоточного аспирата сразу после рождения концентрация серомукоида равняется 0,167-0,196 единиц оптической плотности. 2 табл., 3 пр.
Изобретение относится к области медицины и предназначено для оценки генетической предрасположенности к развитию тромбоэмболии легочной артерии (ТЭЛА). При наличии клинических факторов риска развития ТЭЛА у пациента забирают 3 мл венозной крови и выполняют анализ полиморфизмов -174 G>C гена IL-6 и -308 G>A гена TNFальфа методом полимеразной цепной реакции. Результаты генотипирования оценивают путем присвоения определенного числа баллов: при выявлении генотипа GG гена IL-6 присваивают 3 балла, GC - 1 балл, CC - 0 баллов, при наличии генотипа GG гена TNFальфа присваивают 3 балла, GA - 1 балл, AA - 0 баллов, после чего баллы конкретного пациента суммируют. При числе баллов 4 и выше делают вывод о наличии индивидуальной предрасположенности к развитию ТЭЛА. Изобретение обеспечивает эффективную оценку генетической предрасположенности к развитию ТЭЛА. 2 табл., 2 пр.

Изобретение относится к биотехнологии и может быть использовано для анализа локализации и содержания белкового компонента в клетках млекопитающих с различным уровнем синтетических процессов. Предлагается способ выявления внутриклеточных белков с помощью флуоресцеин-5-изотиоционата (ФИТЦ) в клетках разных типов млекопитающих, которые характеризуются различным уровнем синтетических процессов, с применением метода конфокальной лазерной микроскопии. Клетки млекопитающих фиксируют параформальдегидом (ПФА), предотвращающим экстракцию белков на последующих стадиях окрашивания, пермеабилизуют детергентом, затем в течение 2 ч окрашивают ФИТЦ в концентрации 1 мкг/мл. Клетки заключают в Мовиол 4-88 с добавлением DABCO (1,4-диазобицикло [2.2.2] октан). Полученные препараты используют для анализа локализации и содержания белкового компонента клеток с помощью конфокальной микроскопии. Изобретение позволяет получить информацию и исследовать расположение белков внутри клеток и производить сравнительный анализ содержания белков в клетках с разным уровнем метаболизма. 7 ил., 7 пр.
Настоящая группа изобретений относится к медицине, а именно к кардиологии, и касается диагностики различных видов гипертрофии левого желудочка. Для этого определяют количество маркера некроза - сердечного тропонина Т, маркера сердечной функции - NT-proBNP и одного из маркера воспаления - GDF-15. По сравнению их количеств с эталонными значениями диагностируют физиологическую или патологическую гипертрофию левого желудочка. Кроме того, при наличии патологической гипертрофии определяют соотношения между маркером сердечной функции и воспалительным маркером, а также между маркером некроза и воспалительным маркером и, сравнивая эти соотношения с эталонными значениями, определяют, страдает ли субъект гипертрофической необструктивной кардиомиопатией, или гипертрофической обструктивной кариомиопатией, или гипертрофией при перегрузке давлением. 4 н. и 3 з.п. ф-лы, 3 табл., 3 пр.

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для прогнозирования степени риска развития пролапса гениталий у женщин. Проводят отбор биоматериала для выделения ДНК. Генотипируют ДНК методом тетра-праймерной аллель-специфической полимеразной цепной реакции. Выявляют полиморфизм гена FBLN5 по сайтам rs12586948 и rs2018736. При наличии аллелей однонуклеотидных вариантов rs12586948-A иили rs2018736-С прогнозируют высокую степень риска развития пролапса гениталий. При наличии аллелей однонуклеотидных вариантов rs12586948-G иили rs2018736-A прогнозируют пониженную степень риска. Изобретение позволяет выявлять пациенток с высокой степенью риска развития пролапса гениталий для проведения своевременных и целенаправленных мероприятий по профилактике развития данной патологии. 1 ил., 3 табл., 3 пр.

Наверх