Нелипидизированные варианты антигенов neisseria meningitidis orf2086



Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086
Нелипидизированные варианты антигенов neisseria meningitidis orf2086

 


Владельцы патента RU 2546873:

УАЙТ ЭлЭлСи (US)

Группа изобретений относится к области биохимии, в частности к имунногенной композиции, которая индуцирует перекрестные бактериальные антитела к ряду штаммов Neisseria meningitidis серотипа В. Иммуногенная композиция содержит в качестве активного компонента варианты нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086 и состоящего из аминокислотной последовательности, выбранной из группы SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, где полипептид включает делецию N-терминального Cys по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа. Также раскрыта плазмида, которая экспресирует нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086. Раскрыт способ продуцирования бактерицидных антител, специфических к ORF2086 подсемейства В серогруппы В Neisseria meningitidis у млекопитающих. Раскрыт способ получения нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086. Изобретение позволяет эффективно индуцировать перекрестные бактериальные антитела к Neisseria meningitidis серотипа В. 15 н. и 17 з.п. ф-лы, 8 ил., 14 табл., 13 пр.

 

Данная заявка ссылается на приоритет предварительной заявки США серийный №61/381,837, поданной 10 сентября 2010 года, которая включена в данный документ в качестве ссылки в полном объеме.

Область техники изобретения

Представленное изобретение касается нелипидизированных вариантов антигенов Neisseria meningitidis ORF2086 в иммуногенных композициях, как описано в данном документе. Представленное изобретение, кроме того, касается способов фиксирования конформации нелипидизированных вариантов антигенов Neisseria meningitidis ORF2086. Представленное изобретение дополнительно включает композиции и способы, относящиеся к улучшенной экспрессии нелипидизированных антигенов N. meningitidis ORF2086, по сравнению с соответствующим диким типом антигена.

Уровень техники изобретения

rLP2086 представляет собой рекомбинантный 28 - кДа липопротеин, который индуцирует перекрестные бактериальные антитела к ряду штаммов Neisseria meningitidis, включая штаммы Neisseria meningitidis серотипа В (MnB), или более точно, штаммы серогруппы В (MnB). Основываясь на гомологичности расшифрованной аминокислотной последовательности, были идентифицированы два разных подсемейства rLP2086, А и В. Данные два подсемейства были использованы в формуляции образцов MnB-rLP2086 вакцины, содержащих 20, 60,120 и 200 мкг/мл каждого в 10 мМ гистидина (рН 6,0), 150 мМ NaCl и 0,5 мг/мл алюминия с различными уровнями полисорбата 80 (PS-80). Нативный LP2086 является липопротеином. Fletcher et al. Infection & Immunity, vol. 72(4):2088-2100 (2004) продемонстрировали, что rLP2086 с аминотерминальным липидом был более иммуногенным, чем нелипидизированный варианты того же протеина у мышей. Дополнительные доклинические и клинические исследования продемонстрировали, что комбинирование данных двух липидизированный протеинов может обеспечить широкий охват всего fHBP семейства. Менингококковый менингит представляет собой тяжелое заболевание, которое может убивать детей и молодых взрослых в течение нескольких часов, несмотря на применение антибиотиков. Поэтому остается потребность в подходящих иммуногенных композициях менингококковой серогруппы В.

Краткое описание изобретения

Для удовлетворения этой и других потребностей в менингококковой вакцине, чтобы обеспечить весь диапазон применения нелипидизированных вариантов полипептидов N. meningitidis ORF2086, были исследованы дополнительные композиции. Первый аспект представленного изобретения предусматривает иммуногенную композицию, содержащую нелипидизированный протеин ORF2086, где протеин ORF2086 является В44, В02, В03, В22, В24, В09, А05, А04, А12 или А22 вариантом. В некоторых вариантах осуществления изобретения протеин ORF2086 является В44, В22, В09, А05, А12 или А22 вариантом.

Другой аспект представленного изобретения предусматривает иммуногенную композицию, содержащую нелипидизированный вариант протеина ORF2086 подсемейства В (полипептид P2086 подсемейства В). В некоторых вариантах осуществления, полипептид P2086 подсемейства В является В44, В02, В03, В22, В24 или В09 вариантом. В некоторых вариантах осуществления, иммуногенная композиция дополнительно содержит нелипидизированный вариант протеина ORF2086 подсемейства А (полипептид Р2086 подсемейство А). В некоторых вариантах осуществления полипептид Р2086 подсемейства А является А05, А04, А12 или А22 вариантом.

В некоторых вариантах осуществления иммуногенная композиция дополнительно содержит вспомогательное вещество. В некоторых вариантах осуществления вспомогательным веществом является алюминиевое вспомогательное вещество, сапонин, CpG нуклеотидная последовательность или какая-либо их комбинация. В некоторых вариантах осуществления алюминиевым вспомогательным веществом является AlPO4, Al(OH)3, Al2(SO4)3 или квасцы. В некоторых вариантах осуществления концентрация алюминия в иммуногенных композициях составляет между 0,125 мкг/мл и 0,5 мкг/мл. В некоторых вариантах осуществления концентрация алюминия в иммуногенных композициях составляет 0,25 мкг/мл. В предпочтительном варианте осуществления концентрация алюминия в иммуногенной композиции составляет между 0,125 мг/мл и 0,5 мг/мл. В некоторых предпочтительных вариантах осуществления концентрация алюминия в иммуногенной композиции составляет 0,25 мг/мл.

В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 1 мкг/мл и 250 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 10 мкг/мл и 100 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 10 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 100 мкг/мл. В некоторых вариантах осуществления сапонин представляет собой QS-21 Stimulon® (Agenus, Lexington, MA) или ISCOMATRIX® (CSL Limited, Parkville, Australia).

В некоторых вариантах осуществления иммуногенная композиция предоставляет возможность увеличить иммуногенный ответ на Neisseria meningitidis после введения многократных доз иммуногенной композиции субъекту. В некоторых вариантах осуществления иммуногенный ответ дается после введения субъекту двух доз. В некоторых вариантах осуществления иммуногенный ответ дается после введения субъекту трех доз.

Другой аспект изобретения предусматривает композицию, дающую повышенную иммуногенность нелипидизированного антигена Р2086, где композиция содержит сапонин и, по меньшей мере, один нелипидизированный антиген Р2086. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 1 мкг/мл и 250 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 10 мкг/мл и 100 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 10 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 100 мкг/мл. В некоторых вариантах осуществления сапонин представляет собой QS-21 или ISCOMATRIX.

В некоторых вариантах осуществления композиция дополнительно содержит алюминий. В некоторых вариантах осуществления алюминий присутствует в виде AlPO4, Al(OH)3, Al2(SO4)3 или квасцов. В некоторых вариантах осуществления концентрация алюминия в композиции составляет между 0,125 мкг/мл и 0,5 мкг/мл. В некоторых вариантах осуществления концентрация алюминия в композиции составляет 0,25 мкг/мл. В предпочтительном варианте осуществления концентрация алюминия в композиции составляет между 0,125 мг/мл и 0,5 мг/мл. В некоторых предпочтительных вариантах осуществления концентрация алюминия в композиции составляет 0,25 мг/мл.

В некоторых вариантах осуществления иммуногенная композиция предоставляет возможность увеличить иммуногенный ответ на Neisseria meningitidis после введения многократных доз иммуногенной композиции субъекту. В некоторых вариантах осуществления иммуногенный ответ дается после введения субъекту двух доз. В некоторых вариантах осуществления иммуногенный ответ дается после введения субъекту трех доз.

В некоторых вариантах осуществления нелипидизированный антиген Р2086 представляет собой полипептид Р2086 подсемейства В. В некоторых вариантах осуществления полипептид Р2086 подсемейства В является В44, В02, В03, В22, В24 или В09 вариантом. В некоторых вариантах осуществления нелипидизированный антиген Р2086 представляет собой полипептид Р2086 подсемейства А. В каком-нибудь варианте осуществления полипептид Р2086 подсемейства А является А05, А04, А12 или А22 вариантом.

В некоторых вариантах осуществления композиция содержит, по меньшей мере, два нелипидизированных антигена Р2086, где два нелипидизированных антигена Р2086 представляют собой, по меньшей мере, один нелипидизированный полипептид Р2086 подсемейства А и, по меньшей мере, один нелипидизированный полипептид Р2086 подсемейства В. В некоторых вариантах осуществления нелипидизированный полипептид Р2086 подсемейства А представляет собой вариант А05 и нелипидизированный полипептид Р2086 подсемейства В представляет собой вариант В44. В некоторых вариантах осуществления нелипидизированный полипептид Р2086 подсемейства А представляет собой вариант А05 и нелипидизированный полипептид Р2086 подсемейства В представляет собой вариант В22. В некоторых вариантах осуществления нелипидизированный полипептид Р2086 подсемейства А представляет собой вариант А05 и нелипидизированный полипептид Р2086 подсемейства В представляет собой вариант В09.

Другой аспект изобретения предусматривает способ приобретения иммунитета у субъекта к бактериям Neisseria meningitidis, в котором способ включает стадию введения субъекту иммуногенной композиции, содержащей нелипидизированный полипептид Р2086 подсемейства В. В некоторых вариантах осуществления полипептид Р2086 подсемейства В является В44, В02, В03, В22, В24 или В09 вариантом. В некоторых вариантах осуществления иммуногенная композиция дополнительно содержит полипептид Р2086 подсемейства А. В некоторых вариантах осуществления полипептид Р2086 подсемейства А является А05, А04, А12 или А22 вариантом.

В некоторых вариантах осуществления иммуногенная композиция дополнительно содержит вспомогательное вещество. В некоторых вариантах осуществления вспомогательное вещество является алюминиевым вспомогательным веществом, сапонином, CpG нуклеотидной последовательностью или какой-либо их комбинацией. В некоторых вариантах осуществления алюминиевым вспомогательным веществом является AlPO4, Al(OH)3, Al2(SO4)3 или квасцы. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет между 0,125 мкг/мл и 0,5 мкг/мл. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет 0,25 мкг/мл. В предпочтительном варианте осуществления концентрация алюминия в иммуногенной композиции составляет между 0,125 мг/мл и 0,5 мг/мл. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет 0,25 мг/мл.

В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 1 мкг/мл и 250 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет между 10 мкг/мл и 100 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 10 мкг/мл. В некоторых вариантах осуществления концентрация сапонина в иммуногенной композиции составляет 100 мкг/мл. В некоторых вариантах осуществления сапонин представляет собой QS-21 или ISCOMATRIX.

В некоторых вариантах осуществления иммуногенную композицию вводят субъекту в многократных дозах по схеме дозирования. В некоторых вариантах осуществления иммуногенную композицию вводят субъекту двумя дозами по схеме дозирования. В некоторых вариантах осуществления иммуногенную композицию вводят субъекту тремя дозами по схеме дозирования.

Другой аспект изобретения предусматривает способ продуцирования нелипидизированного варианта Р2086, который включает стадии (а) клонирования варианта ORF2086 нуклеиновой кислоты в векторе экспрессии, чтобы произвести вектор экспрессии ORF2086; (b) трансформирования бактерий с вектором экспрессии OFR2086; (с) индуктирования экспрессии варианта P2086 из вектора экспрессии ORF2086; и (d) выделения экспрессированного варианта протеина Р2086; где вектор экспрессии ORF2086 не включает контрольной последовательности липидизации. В некоторых вариантах осуществления бактерией является. В некоторых вариантах осуществления экспрессию индуцируют путем добавления IPTG.

В некоторых вариантах осуществления кодон, кодирующий N-терминальный Cys варианта Р2086, делетирован. В некоторых вариантах осуществления кодон, кодирующий N-терминальный Cys варианта Р2086, мутирован с образованием Ala, Gly или Val кодона. В некоторых вариантах осуществления, вариант Р2086 представляет собой А05, В01 или В44 вариант.В некоторых вариантах осуществления вариант Р2086 представляет собой В09 вариант.

В некоторых вариантах осуществления N-терминальный хвост является мутированным, чтобы присоединить Ser и Gly остатки для удлинения Gly/Ser стебля непосредственно ниже N-терминального Cys. В некоторых вариантах осуществления общее количество Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 7, по меньшей мере, 8, по меньшей мере, 9, по меньшей мере, 10, по меньшей мере, 11 или, по меньшей мере, 12.

В некоторых вариантах осуществления кодоны N-терминального хвоста варианта Р2086 оптимизируют путем точечного мутагенеза. В некоторых вариантах осуществления кодоны N-терминального хвоста варианта ORF2086 оптимизируют путем точечного мутагенеза таким образом, что кодон, кодирующий пятую аминокислоту варианта ORF2086, является 100% идентичным нуклеотидам 13-15 SEQ ID NO: 8 и кодон, кодирующий тринадцатую аминокислоту варианта ORF2086, является 100% идентичным нуклеотидам 37-39 SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 45 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 1-45 SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 42 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 4-45 SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 39 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 4-42 из SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта Р2086 содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 1-15 SEQ ID NO: 18. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта Р2086 содержит два аминокислотных замещения по сравнению с аминокислотами 1-15 SEQ ID NO: 18. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта Р2086 содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 2-15 SEQ ID NO: 18. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта Р2086 содержит два аминокислотных замещения по сравнению с аминокислотами 2-15 SEQ ID NO: 18. В некоторых вариантах осуществления аминокислотные замещения являются консервативными аминокислотными замещениями.

В одном варианте осуществления представленное изобретение касается стабильных составов антигенов Neisseria meningitis ORF2086 подсемейства В в иммуногенных композициях. Представленное изобретение, кроме того, касается способов сохранения конформации антигенов Neisseria meningitis ORF2086 Антигены и способов определения эффективности антигенов Neisseria meningitis rLP2086.

В одном аспекте изобретение касается композиции, которая включает выделенный нефункционализированный пировиноградной кислотой нелипидизированный полипептид ORF2086. В одном варианте осуществления композиция является иммуногенной. В другом варианте осуществления полипептид включает делецию N-терминального Cys по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа. В одном варианте осуществления полипептид включает аминокислотную последовательность, выбранную из группы, которая состоит из SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, где цистеин в положении 1 делетирован. В другом варианте осуществления полипептид включает аминокислотную последовательность, выбранную из группы, которая состоит из SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50 и SEQ ID NO: 55.

В еще другом варианте осуществления полипептид кодируется нуклеотидной последовательностью, которая является функционально связанной с экспрессирующей системой, где упомянутая экспрессирующая система является способной быть экспрессированной в бактериальной клетке. В одном варианте осуществления экспрессирующая система является экспрессирующей системой плазмиды. В одном варианте осуществления бактериальная клетка является Е. coli cell. В другом варианте осуществления нуклеотидная последовательность связана с регуляторной последовательностью, которая контролирует экспрессию упомянутой нуклеотидной последовательности.

В другом аспекте, изобретение касается композиции, которая включает нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086, который может быть получен по способу. Способ включает экспрессирование нуклеотидной последовательности, кодирующей полипептид, который содержит аминокислотную последовательность, выбранную с группы, состоящей из SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, где цистеин в положении 1 делетирован, где нуклеотидная последовательность функционально связана с экспрессирующей системой, которая способна быть экспрессированной в бактериальной клетке. В одном варианте осуществления бактериальная клетка является Е. coli.

В одном аспекте изобретение касается композиции, которая включает выделенный полипептид, который содержит аминокислотную последовательность, изложенную в SEQ ID NO: 49, и выделенный полипептид, который содержит аминокислотную последовательность, изложенную в SEQ ID NO: 44. В одном варианте осуществления композиции, описанные в данном документе, являются иммуногенными. В другом варианте осуществления композиции, описанные в данном документе, дополнительно включают полипептид ORF2086 подсемейства А из серогруппы В N. meningitidis. В другом варианте осуществления композиции, описанные в данном документе, вызывают бактерицидный иммунный ответ у млекопитающих к полипептиду ORF2086 подсемейства В из серогруппы В N. meningitidis.

В одном аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, изложенную в SEQ ID NO: 49. В другом аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID NO: 46. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID NO: 47. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID NO: 48. В одном аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, изложенную в SEQ ID NO: 50. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID NO: 45. В одном аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, изложенную в SEQ ID NO: 44.

В одном аспекте изобретение касается плазмиды, которая включает нуклеотидную последовательность, выбранную из группы, состоящую из SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 и SEQ ID NO: 45, где плазмида способна быть экспрессированной в бактериальной клетке. В одном варианте осуществления бактериальная клетка является Е. coli.

В одном аспекте изобретение касается способа индуцирования бактерицидных антител, специфических к ORF2086 подсемейства В серогруппы В N. meningitidis у млекопитающих. Способ включает введение млекопитающим эффективного количества выделенного полипептида, который включает аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 44 и SEQ ID NO: 49, или их комбинации.

В одном аспекте изобретение касается способа продуцирования полипептида. Способ включает экспрессирование в бактериальной клетке полипептида, который включает последовательность, имеющую большую, чем 90% идентичность к SEQ ID NO:21, упомянутую последовательность, содержащую, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 13-18 из SEQ ID NO: 21, аминокислот 21-34 из SEQ ID NO: 21 и аминокислот 70-80 из SEQ ID NO: 21, или их комбинации, где в последовательности отсутствует N-терминальный цистеин. Способ дополнительно включает очистку полипептида. В одном варианте осуществления последовательность включает, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 96-116 из SEQ ID NO: 21, аминокислот 158-170 из SEQ ID NO: 21, аминокислот 172-185 из SEQ ID NO: 21, аминокислот 187-199 из SEQ ID NO: 21, аминокислот 213-224 из SEQ ID NO: 21, аминокислот 226-237 из SEQ ID NO: 21, аминокислот 239-248 из SEQ ID NO: 21, или их комбинации. В одном варианте осуществления бактериальной клеткой является Е. coli.

В одном аспекте изобретение касается выделенного полипептида, продуцированного по способу, который включает способ, описанный в данном документе. В другом аспекте изобретение касается иммуногенной композиции, полученной по способу, который включает способ, описанный в данном документе.

В одном аспекте, изобретение касается иммуногенной композиции, которая включает полипептид ORF2086 подсемейства В из серогруппы В N. meningitidis, где полипептид представляет собой нефункционализированный пировиноградной кислотой нелипидизированный В44. В одном варианте осуществления композиция дополнительно включает второй полипептид ORF2086 подсемейства В из серогруппы В N. meningitidis, где второй полипептид представляет собой нефункционализированный пировиноградной кислотой нелипидизированный В09. В одном варианте осуществления композиция включает не более, чем 3 полипептида ORF2086 подсемейства В. В другом варианте осуществления композиция включает не более, чем 2 полипептида ORF2086 подсемейства В. В одном варианте осуществления композиция дополнительно включает полипептид ORF2086 подсемейства А. В другом варианте осуществления композиция включает полипептид А05 подсемейства А.

Короткое описание рисунков

Фигура 1: Вариантные Р2086 последовательности нуклеиновой кислоты.

Фигура 2: Вариантные Р2086 аминокислотные последовательности. Gly/Ser стебель в N-терминальном хвосте каждого варианта является подчеркнутым.

Фигура 3: Структура протеина ORF2086.

Фигура 4: Перемещения N-терминального Cys приводящие в результате к потере экспрессии в Е. coli.

Фигура 5: Влияние длины Gly/Ser стебля на экспрессию нелипидизированного варианта ORF2086. Последовательность связанного с вариантом протеина, обозначенного В01, изложена в SEQ ID NO: 35. Последовательность связанного с вариантом протеина, обозначенного В44, изложена в SEQ ID NO: 36. Последовательность связанного с вариантом протеина, обозначенного А05, изложена в SEQ ID NO: 37. Последовательность связанного с вариантом протеина, обозначенного А22, изложена в SEQ ID NO: 38. Последовательность связанного с вариантом протеина, обозначенного В22, изложена в SEQ ID NO: 39. Последовательность связанного с вариантом протеина, обозначенного А19, изложена в SEQ ID NO: 40.

Фигура 6: Высокие уровни экспрессии нелипидизированного В09 несмотря на А короткий Gly/Ser стебель. Левые две полосы демонстрировали экспрессию N-терминального Cys - делетированного варианта В09 до и после индукции. Третья и четвертая полосы демонстрируют экспрессию N-терминального Cys реального варианта В09 до и после индукции. Правая наибольшая полоса представляет собой стандарт молекулярной массы. Аминокислотная последовательность, показанная под изображением, изложена в SEQ ID NO: 41. Нуклеотидная последовательность, отображающая N-терминальный Cys-делетированный вариант А22, названный на фигуре как "А22_001", изложена в SEQ ID NO: 42, которая показана под SEQ ID NO: 41 на фигуре. Нуклеотидная последовательность, отображающая N-терминальный Cys-делетированный вариант В22, названный на фигуре как "В22_001", изложен в SEQ ID NO: 52. Нуклеотидная последовательность, отображающая N-терминальный Cys-делетированный вариант В09, названный на фигуре как "В09_004", изложен в SEQ ID NO: 53.

Фигура 7: Оптимизация кодона повышает экспрессию нелипидизированных вариантов В22 и А22. Левая панель демонстрирует экспрессию N-терминального Cys-делетированного варианта В22 до (полосы 1 и 3) и после (полосы 2 и 4) IPTG индукции. Правая панель демонстрирует экспрессию N-терминального Cys-делетированного варианта А22 до (полоса 7) и после (полоса 8) IPTG индукции.

Полосы 5 и 6 представляют собой стандарты молекулярной массы.

Фигура 8: Варианты Р2086 нуклеиновой и аминокислотной последовательностей.

Идентификаторы последовательности

SEQ ID NO: 1 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А04, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 2 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А05, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 3 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А12, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 4 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А12-2, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 5 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А22, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 6 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В02, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 7 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена ВОЗ, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 8 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В09, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 9 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В22, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 10 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В24, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 11 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В44, которая включает кодон, кодирующий N-терминальный Cys.

SEQ ID NO: 12 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 А04, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 13 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 А05, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 14 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 А12, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 15 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 А22, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 16 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В02, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 17 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 ВОЗ, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 18 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В09, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 19 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В22, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 20 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В24, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 21 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В44, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 22 представляет собой ДНК последовательность прямого праймера, показанную в примере 2.

SEQ ID NO: 23 представляет собой ДНК последовательность обратного праймера, показанную в примере 2.

SEQ ID NO: 24 представляет собой ДНК последовательность прямого праймера, показанную в примере 2, таблице 1.

SEQ ID NO: 25 представляет собой ДНК последовательность обратного праймера, показанную в примере 2, таблице 1.

SEQ ID NO: 26 представляет собой ДНК последовательность прямого праймера, показанную в примере 2, таблице 1.

SEQ ID NO: 27 представляет собой ДНК последовательность обратного праймера, показанную в примере 2, таблице 1.

SEQ ID NO: 28 представляет собой ДНК последовательность Gly/Ser стебля, показанную в примере 4.

SEQ ID NO: 29 представляет собой аминокислотную последовательность Gly/Ser стебля, показанную в примере 4, которая кодируется, например, SEQ IDNO: 28.

SEQ ID NO: 30 представляет собой ДНК последовательность Gly/Ser стебля, показанную в примере 4.

SEQ ID NO: 31 представляет собой аминокислотную последовательность Gly/Ser стебля, показанную в примере 4, которая кодируется, например, SEQ ID NO: 30.

SEQ ID NO: 32 представляет собой ДНК последовательность Gly/Ser стебля, показанную в примере 4.

SEQ ID NO: 33 представляет собой аминокислотную последовательность Gly/Ser стебля, которая кодируется, например, SEQ ID NO: 32 и SEQ ID NO: 34.

SEQ ID NO: 34 представляет собой ДНК последовательность Gly/Ser стебля, показанную в примере 4.

SEQ ID NO: 35 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 В01, показанную на фигуре 5.

SEQ ID NO: 36 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 В44, показанную на фигуре 5.

SEQ ID NO: 37 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 А05, показанную на фигуре 5.

SEQ ID NO: 38 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 А22, показанную на фигуре 5.

SEQ ID NO: 39 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 В22, показанную на фигуре 5.

SEQ ID NO: 40 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 А19, показанную на фигуре 5.

SEQ ID NO: 41 представляет собой аминокислотную последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086, показанную на фигуре 6.

SEQ ID NO: 42 представляет собой ДНК последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 А22, показанную на фигуре 6.

SEQ ID NO: 43 представляет собой кодон оптимизированную ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В44, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 11. Плазмида pDK087 включает SEQ ID NO: 43.

SEQ ID NO: 44 представляет собой аминокислотную последовательность нелипидизированного варианта N. meningitidis, серогруппы В, 2086 В44. SEQ ID NO: 44 является идентичной SEQ ID NO: 21, где N-терминальный цистеин в положении 1 SEQ ID NO: 21 делетирован. SEQ ID 44 кодируется, например, SEQ ID NO: 43.

SEQ ID NO: 45 представляет собой кодон оптимизированную ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В09, где кодон, кодирующий N-терминальный цистеин, делетирован, и где последовательность включает кодоны, кодирующие дополнительный Gly/Ser участок, по сравнению с SEQ ID NO: 8. Плазмида рЕВОбЗ включает SEQ ID NO: 45.

SEQ ID NO: 46 представляет собой кодон оптимизированную ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В09, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 8. Плазмида рЕВ064 включает SEQ ID NO: 46.

SEQ ID NO: 47 представляет собой кодон оптимизированную ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В09, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 8. Плазмида pEB 065 включает SEQ ID NO: 47.

SEQ ID NO: 48 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В09, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 8. Плазмида pLA134 включает SEQ ID NO: 48.

SEQ ID NO: 49 представляет собой аминокислотную последовательность нелипидизированного варианта N. meningitidis, серогруппы В, 2086 В09. SEQ ID NO: 49 является идентичной SEQ ID NO: 18, где N-терминальный цистеин в положении 1 SEQ ID NO: 18 делетирован. SEQ ID 49 кодируется, например, ДНК последовательностью, выбранной из группы, состоящей из SEQ ID NO: 46, SEQ ID NO: 47 и SEQ ID NO: 48.

SEQ ID NO: 50 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В09, где кодон, кодирующий N-терминальный цистеин, делетирован, и где последовательность включает кодоны, кодирующие дополнительный Gly/Ser участок, по сравнению с SEQ ID NO: 18. SEQ ID NO: 50 кодируется, например, SEQ ID NO: 45.

SEQ ID NO: 51 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена В44, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 11. Плазмида pLN056 включает SEQ ID NO: 51.

SEQ ID NO: 52 представляет собой ДНК последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 В22, показанную на фигуре 6.

SEQ ID NO: 53 представляет собой ДНК последовательность для N-конца N. meningitidis, серогруппы В, варианта 2086 В09, показанную на фигуре 6.

SEQ ID NO: 54 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 гена А05, где кодон, кодирующий N-терминальный цистеин, делетирован, по сравнению с SEQ ID NO: 2.

SEQ ID NO: 55 представляет собой аминокислотную последовательность нелипидизированного варианта N. meningitidis, серогруппы В, 2086 А05. SEQ ID NO: 55 является идентичной SEQ ID NO: 13, где N-терминальный цистеин в положении 1 SEQ ID NO: 13 делетирован. SEQ ID NO: 55 кодируется, например, SEQ ID NO: 54.

SEQ ID NO: 56 представляет собой аминокислотную последовательность серин-глициновой повторяющейся последовательности, показанную в примере 7.

SEQ ID NO: 57 представляет собой аминокислотнаяую последовательность нелипидизированныйого варианта N. meningitidis, серогруппы В, 2086 В01. SEQ ID NO: 57 является идентичной SEQ ID NO: 58, где N-терминальный цистеин в положении 1 SEQ ID NO: 58 делетирован.

SEQ ID NO: 58 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В01, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 59 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В15, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 60 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 B16, которая включает N-терминальный Cys в аминокислотном положении 1.

SEQ ID NO: 61 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 В22, в которой кодон N-терминального Cys в аминокислотном положении 1 из SEQ ID NO: 19 замещен на кодон глицина.

SEQ ID NO: 62 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 В22, в которой N-терминальный Cys в аминокислотном положении 1 из SEQ ID NO: 19 замещен на глицин.

SEQ ID NO: 63 представляет собой ДНК последовательность N. meningitidis, серогруппы В, варианта 2086 А22, в которой кодон N-терминального Cys в аминокислотном положении 1 из SEQ ID NO: 15 замещен на кодон глицина.

SEQ ID NO: 64 представляет собой аминокислотную последовательность N. meningitidis, серогруппы В, варианта 2086 А22, в которой N-терминальный Cys в аминокислотном положении 1 из SEQ ID NO: 15 замещен на глицин.

Подробное описание изобретения

Если не оговорено другое, все технические и научные термины, использованные в данном документе, имеют те же значения, что и, обычно, понимаются квалифицированным специалистом в данной области с уровня техники, к которому данное изобретение принадлежит. Несмотря на то, что способы и вещества подобные или эквивалентные тем, что описаны в данном документе, могут быть использованы на практике или при апробировании представленного изобретения, подходящие способы и материалы описываются ниже. Материалы, способы и примеры являются только иллюстративными, и не предназначены быть ограничивающими. Все публикации, патенты и другие документы, упомянутые в данном документе, включены как ссылки в полном объеме.

Известно, что в данном раскрытии, термины, такие как "заключает", "заключенный", "заключающий", "содержит", "содержащий" и аналогичные могут иметь значение, приписываемые им патентным законом США; например, они могут означать "включает", "включенный", "включающий" и тому подобные. Такие термины относятся к включению отдельных ингредиентов или набора ингредиентов без исключения каких-либо других ингредиентов. Термины, такие как "состоящий по существу из" и "состоит по существу из" имеют значение, приписываемое им патентным законом США, например, они позволяют включение дополнительных ингредиентов или стадий, которые не приуменьшают новые или основные характеристики изобретения, то есть, они исключают дополнительные не перечисленные ингредиенты или стадии, которые приуменьшают новые или основные характеристики изобретения, и они исключают ингредиенты или стадии с уровня техники, такие как документы с уровня техники, которые цитируются в данном документе или включены в виде ссылок в данный документ, в особенности, когда это является задачей данного документа, чтобы определить варианты осуществления, которые являются патентоспособными, например, новыми, неочевидными, изобретательными, по сравнению с известным уровнем техники, например, по сравнению с документами, цитируемыми в данном документе или включенными в виде ссылок в данный документ.И, термины "состоит из" и "состоящий из" имеют значение, приписываемые им патентным законом США; а именно, что данные термины являются закрытыми - завершенными. Соответственно, данные термины относятся к включению отдельного ингредиента или набора ингредиентов и исключению всех других ингредиентов.

Определения

Как использовано в данном документе, формы единственного числа включают множественные упоминания, если контекст ясно не предписывает другого. Таким образом, например, упоминание "способ" включает один или более способов, и/или стадии типа, которые описаны в данном документе, и/или, которые будут очевидными квалифицированному специалисту с уровня техники при чтении данного раскрытия и тому подобного.

Как использовано в данном документе, формы множественного числа включают упоминания в единственном числе, если контекст ясно не предписывает другого. Таким образом, например, упоминание "способы" включает один или более способов, и/или стадии типа, которые описаны в данном документе, и/или, которые будут очевидными квалифицированному специалисту с уровня техники при чтении данного раскрытия и тому подобного.

Как использовано в данном документе, "около" означает со статистически значимым диапазоном величину, такую как установленный диапазон концентрации, период времени, молекулярная масса, температура или рН. Такой диапазон может быть с порядком величины, как правило, с 20%, более типично еще с 10%, и даже более типично с 5% от данного значения или диапазоном. Приемлемое варьирование, осуществляемое термином "около" будет зависеть от особенности системы, которую исследуют, и может быть легко оценена квалифицированным специалистом в данной области. Всякий раз, когда в данной заявке упоминается диапазон, каждое целое число из группы различных чисел диапазона, также рассматривается, как вариант осуществления изобретения.

Термин "вспомогательное вещество" касается соединения или смеси, которая усиливает иммунной ответ к антигену, как далее описано и проиллюстрировано в данном документе. Неограничивающие примеры вспомогательных веществ, которые могут быть использованы в вакцине представленного изобретения, включают систему RIBI вспомогательного вещества (Ribi Inc., Hamilton, Mont.), квасцы, минеральные гели, такие как гель гидроксида алюминия, эмульсии масло-в-воде, эмульсии вода-в-масле, такие как, например, полные и неполные адъюванты Фрейнда, блок-сополимер (CytRx, Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.), AMPHIGEN® вспомогательное вещество, сапонин, Quil А или другие фракции сапонина, монофосфорилированный липид А и Avridine липид-аминное вспомогательное вещество.

"Антитело" представляет собой молекулу иммуноглобулина способную к специфическому связыванию с мишенью, такой как углевод, полинуклеотид, липид, полипептид, т.д., посредством, по меньшей мере, одного сайта распознавания антигена, расположенного в вариабельной области молекулы иммуноглобулина. Как использовано в данном документе, если другое не указано контекстом, термин предназначен для охватывания не только интактных поликлональных или моноклональных антител, но также сконструированных антител (например, химерных, гуманизированных и/или дериватизированных для изменения эффекторных функций, стабильности и других биологических активностей), и их фрагментов (таких как Fab, Fab', F(ab'2, Fv), антител одиночной цепи (ScFv) и домена, включая акульи и верблюжьи антитела), и гибридных протеинов, содержащих часть антитела, поливалентных антител, полиспецифических антител (например, биспецифические антитела при условии, что они демонстрируют требуемую биологическую активность) и фрагментов антитело, как описано в данном документе, и какой-либо другой модифицированной конфигурации молекулы иммуноглобулина, которая содержит сайт распознавания антигена. Антитело включает антитело какого-нибудь класса, такое как IgG, IgA или IgM (или их подкласс), и необходимо, что антитело не является каким-либо специфическим классом. В зависимости от аминокислотной последовательности константного домена его тяжелых цепей антитела, иммуноглобулины могут быть определены в различные классы. Существует пять основных классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, и некоторые из них могут быть дополнительно разделены на подклассы (изотипы), например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2 у людей. Константные домены тяжелой цепи, которые соответствуют различным классам иммуноглобулинов, называются альфа, дельта, эпсилон, гамма и мю, соответственно. Структуры субъединицы и трехмерные конфигурации различных классов иммуноглобулинов хорошо известны.

"Фрагменты антитела" включают только часть интактного антитела, в котором часть предпочтительно сохраняет, по меньшей мере, одну, предпочтительно большинство или все, из функций обычно связанных с той частью, которая присутствует в интактном антителе.

Термин "антиген", как правило, касается биологической молекулы, обычно протеина, пептида, полисахарида, липида или конъюгата, который содержит, по меньшей мере, один эпитоп, с которым родственное антитело может селективно связываться; или в некоторых примерах с иммуногенным веществом, которое может стимулировать продуцирование антител или ответов Т-клетки, или обоих, у животного, включая композиции, которые вводят инъекционно или поглощаются животными. Иммунной ответ может быть сгенерирован к целой молекуле, или к одной или более различным частям молекулы {например, эпитопу или гаптену). Термин может быть использован по отношению к индивидуальной молекуле или к гомогенной или гетерогенной популяции антигенных молекул. Антиген распознается антителами, рецепторами Т-клеток или другими элементами специфического гуморального и/или клеточного иммунитета. Термин "антиген" включает все родственные антигенные эпитопы. Эпитопы представленного антигена могут быть идентифицированы, используя какой-либо набор методик картирования эпитопа, хорошо известные с уровня техники. Смотри, например, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, N. J. Например, линейные эпитопы могут быть определены, например, путем одновременного синтезирования большого числа пептидов на твердых подложках, пептидов, соответствующих частям протеиновой молекулы, и взаимодействующих с антителами пептидов, в то время как пептиды, тем не менее, прикреплены к подложкам. Такие методики известны с уровня техники и описаны в, например, патенте США 4,708,871; Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81:3998-4002; Geysen et al. (1986) Molec. Immunol.23:709-715, все включены в данный документ в виде ссылок в их полном объеме. Подобным образом, конформационные эпитопы могут быть идентифицированы путем определения пространственной конформации аминокислоты, таким как, например, путем рентгеновской кристаллографии и 2-мерным ядерно-магнитным резонансом. Смотри, например, протоколы картирования эпитопа, как указано выше. Более того, для целей представленного изобретения, "антиген", кроме того, может быть использован для указания протеина, который включает модификации, такие как делеции, присоединения и замещения (как правило, консервативные в природе, но они могут быть неконсервативными), нативной последовательности, при условии, что протеин сохраняет способность к установлению иммунологического ответа. Данные модификации могут быть спланированы, как посредством сайт направленного мутагенеза, или посредством специфических синтетических методик, или посредством подхода генной инженерии, или могут быть случайными, такими как посредством мутаций хозяев, которые продуцируют антигены. Более того, антиген может быть выведен, получен или выделен из микроорганизма, например, бактерии, или может быть целым организмом. Подобным образом, олигонуклеотид или полинуклеотид, который экспрессирует антиген, такой как в применениях иммунизации нуклеиновой кислоты, также включен в определение. Синтетические антигены также являются включенными, например, в полиэпитопы, фланкирующие эпитопы, и другие рекомбинантные или синтетически произведенные антигены (Bergmann et al. (1993) Eur. J. Immunol. 23:2777 2781; Bergmann et al. (1996) J. Immunol. 157:3242 3249; Suhrbier, A. (1997) Immunol, и Cell Biol. 75:402 408; Gardner et al. (1998) 12th World AIDS Conference, Geneva, Switzerland, Jun. 28 - Jul. 3, 1998).

Термин "консервативные" аминокислотные замещения может быть сделано на основе сходства в полярности, заряде, растворимости, гидрофобности, гидрофильности и/или амфипатической природе включенных остатков. Например, неполярные (гидрофобные) аминокислоты включают аланин, лейцин, изолейцин, валин, пролин, триптофан и метионин; полярные/нейтральные аминокислоты включают глицин, серии, треонин, цистеин, тирозин, аспарагин и глутамин; положительно заряженные (основные) аминокислоты включают аргинин, лизин и гистидин; и отрицательно заряженные (кислые) аминокислоты включают аспарагиновую кислоту и глутаминовую кислоту. В некоторых вариантах осуществления, консервативная аминокислота меняет первичную последовательность полипептидов ORF2086, но не меняет функции молекулы. При генерировании данных мутантов, может быть рассмотрен индекс гидропатичности аминокислот. Важность индекса гидропатичности аминокислоты в представленной взаимодействующей биологической функции полипептида, как правило, понятна с уровня техники (Kyte & Doolittle, 1982, J. Mol. Biol., 157(1): 105-32). Известно, что определенные аминокислоты могут быть замещены на другие аминокислоты, имеющие подобный индекс или показатель гидропатичности, и все еще в результате давать полипептид с подобной биологической активностью. Каждая аминокислота определяется индексом гидропатичности на основе ее гидрофобности и характеристик заряда. Такие индексы представляют собой: изолейцин (+4,5); валин (+4,2); лейцин (+3,8); фенилаланин (+2,8); цистеин/цистин (+2,5); метионин (+1,9); аланин (+1,8); глицин (-0,4); треонин (-0,7); серии (-0,8); триптофан (-0,9); тирозин (-1,3); пролин (-1,6); гистидин (-3,2); глутамат (-3,5); глутамин (-3,5); аспартат (-3,5); аспарагин (-3,5); лизин (-3,9); и аргинин (-4,5).

Считается, что относительный характер гидропатичности аминокислотного остатка определяет вторичную и третичную структуру полученного в результате полипептида, который последовательно определяет взаимодействие полипептида с другими молекулами, такими как ферменты, субстраты, рецепторы, антитела, антигены, и тому подобные. С уровня техники известно, что аминокислота может быть замещена на другую аминокислоту, имеющую подобный индекс гидропатичности, и, тем не менее, при этом получают функционально эквивалентный полипептид. При таких изменениях замещение аминокислот, чьи индексы гидропатичности находятся в пределах +/-2, является предпочтительными, чьи индексы гидропатичности находятся в пределах +/-1 является особенно предпочтительными, и чьи индексы гидропатичности находятся в пределах +/-0,5 является еще более особенно предпочтительными.

Консервативные замещения аминокислот или включения также могут быть сделаны на основе гидрофильности. Как описано в патенте США №4,554,101, который в данный документ включен в качестве ссылки, наибольшее частное среднее значение гидрофильности полипептида, как обусловленное гидрофильностью ее соседних аминокислот, коррелирует с его иммуногенностью и антигенностью, то есть, с биологическим свойством полипептида. Патент США №4,554,101 показывает, что следующие значения гидрофильности определяются аминокислотными остатками: аргинином (+3,0); лизином (+3,0); аспартатом (+3,0±1); глутаматом (+3,0±1); серином (+0,3); аспарагином (+0,2); глутамином (+0,2); глицином (0); пролином (-0,5±1); треонином (-0,4); аланином (-0,5); гистидином (-0,5); цистеином (-1,0); метионином (-1,3); валином (-1,5); лейцином (-1,8); изолейцином (-1,8); тирозином (-2,3); фенилаланином (-2,5); триптофаном (-3,4). Имеется в виду, что аминокислота может быть замещена на другую, имеющую подобное значение гидрофильности, и, тем не менее, получают биологически эквивалентный и, в частности, иммунологически эквивалентный полипептид. В таких заменах, замещение аминокислот, чьи значения гидрофильности находятся в пределах ±2, является предпочтительным; чьи значения гидрофильности находятся в пределах ±1, является особенно предпочтительным; и чьи значения гидрофильности находятся в пределах ±0,5, является еще больше особенно предпочтительным. Иллюстративные замещения, которые охватывают различные вышеупомянутые характеристики в рассмотрении, хорошо известны квалифицированному специалисту с уровня техники, и включают, без ограничения: аргинин и лизин; глутамат и аспартат; серии и треонин; глутамин и аспарагин; и валин, лейцин и изолейцин.

Термин "эффективное иммуногенное количество", как использовано в данном документе, касается количества полипептида или композиции, содержащей полипептид, которое является эффективным в установлении иммунного ответа у позвоночного хозяина. Например, эффективное иммуногенное количество протеина rLP2086 данного изобретения представляет собой количество, которое является эффективным в установлении иммунного ответа у позвоночного хозяина. В частности " эффективная иммуногенная доза или количество" будет зависеть от возраста, массы и медицинского состояния организма-хозяина, а также способа введения. Подходящие дозы легко определяются квалифицированным специалистом в данной области с уровня техники.

Термин "Gly/Ser стебель", как использовано в данном документе, касается серий Gly и Ser остатков непосредственно в направлении N-терминального Cys остатка протеина, кодированного ORF2086. Может существовать от 5 до 12 Gly и Ser остатков в Gly/Ser стебле. Соответственно, Gly/Ser стебель состоит из аминокислот от 2 до между 7 и 13 протеина, кодированного ORF2086. Предпочтительно, Gly/Ser стебель состоит из аминокислот от 2 и аж до между 7 и 13 протеина, кодированного ORF2086. Gly/Ser стебли вариантов P2086 представленного изобретения показаны подчеркнутыми последовательностями на фигуре 2 (SEQ ID NO: 12-21). Как показано в данном документе, длина Gly/Ser стебля может оказывать влияние на стабильность или уровень экспрессии нелипидизированного варианта Р2086. В иллюстративном варианте осуществления, эффекты от влияния длины Gly/Ser стебля являются сравнимыми с теми, что от соответствующего варианта дикого типа.

Термин "иммуногенный" касается способности антигена или вакцины вызывать иммунной ответ, или гуморальный, или клеточно-опосредованный, или оба.

"Иммуногенное количество", или "иммунологически эффективное количество", или "доза", каждое из которых в данном документе используется взаимозаменяемо, как правило, касается количества антигена или иммуногенной композиции достаточного вызвать иммуногенный ответ, или клеточный (Т клетка) или гуморальный (В клетка или антитело) ответ, или оба, как измерено, используя стандартные методы анализа, известные квалифицированному специалисту в данной области с уровня техники.

Термин "иммуногенная композиция" касается какой-либо фармацевтической композиции, содержащей антиген, например микроорганизм, или его компонент, где композиция может быть использована, чтобы вызвать иммунный ответ у субъекта. Иммуногенные композиции представленного изобретения могут быть использованы для лечения человека восприимчивого к N. meningidis инфекции, посредством введения иммуногенных композиций, используя системный трансдермальный путь или через слизистую. Такие введения могут включать инъекционный путь введения: внутримышечный (в.м.), внутрибрюшинный (в.б.), интрадермальный (и.д.) или подкожный пути; применение с помощью пластыря или других устройств трансдермальной доставки; или посредством введения через слизистую оболочку, перорального/пищеварительного введения, введения через дыхательные или мочеполовые пути. В одном варианте осуществления иммуногенная композиция может быть использована в производстве вакцины или элиситации поликлональных или моноклональных антител, которые могли бы быть использованы для пассивной защиты или лечения субъекта.

Оптимальные количества компонентов для конкретной иммуногенной композиции могут быть установлены путем стандартных исследований, включающих наблюдение соответствующих иммунных ответов у субъектов. После первичной вакцинации, субъекты могут получить одну или несколько вспомогательных профилактических прививок, соответствующе разнесенных во времени.

Термин "выделенный" означает, что вещество является извлеченным из своей исходной окружающей среды (например, природной среды, если, если существует в природе, или из организма своего хозяина, если является рекомбинантно существующим, или взят из одной окружающей среды в отличающуюся окружающую среду). Например, "выделенный" протеин или пептид является в значительной степени свободным от клеточного материала или других контаминирующих протеинов из клетки или источника ткани, из которого протеин произведен, или в значительной степени свободным от химических предшественников или других химических веществ, в случае химически синтезированных, или, в противном случае, присутствующих в смеси как часть химической реакции. В представленном изобретении протеины могут быть выделены из бактериальных клеток или из продуктов распада клеток, таким образом, что они обеспечиваются в форме, подходящей для производства иммуногенной композиции. Термин "выделенный" или "выделение" может включать очищение или очистку, включая, например, способы очистки протеинов, как описано в данном документе. Выражение "в значительной степени свободный от клеточного материала" включает получение полипептида или протеина, в котором полипептид или протеин отделяют от клеточных компонентов клеток, из которых его выделяют или рекомбинантно продуцируют. Таким образом, протеин или пептид, который является в значительной степени свободным от клеточного материала, включает приготовления капсульного полисахарида, протеина или пептида, имеющего меньше, чем около 30%, 20%, 10%, 5%, 2,5% или 1%, (по сухому весу) контаминирующего протеина или полисахарида, или другого клеточного материала. Когда полипептид/протеин является рекомбинантно продуцированным, то он также, предпочтительно, является в значительной степени свободным от культуральной среды, то есть, культуральная среда представляет собой меньше, чем около 20%, 10% или 5% по объему препарата протеин. Когда полипептид или протеин получают путем химического синтеза, то он, предпочтительно, является в значительной степени свободным от химических предшественников или других химических веществ, то есть его отделяют от химических предшественников или других химических веществ, которые вовлечены в синтез протеина или полисахарида. Соответственно, такие препараты полипептида или протеина содержат, меньше, чем около 30%, 20%, 10%, 5% (по сухой массе) химических предшественников или соединений других, чем фрагмент интересующего полипептида/протеина или полисахарида

Термин "N-терминальный хвост", как использовано в данном документе касается N-терминальной части протеина, кодированного ORF2086, который присоединяет протеин к мембране клетки. N-терминальный хвост показан в нижней части структуры вид сбоку на фигуре 3. N-терминальный хвост, как правило, содержит N-терминальных 16 аминокислот протеина, кодированного ORF2086. В некоторых вариантах осуществления N-терминальный хвост представляет собой аминокислоты 1-16 какой-либо из SEQ ID No: 12-21. Термин "ORF2086", как использовано в данном документе, касается 2086 с открытой рамкой считывания от бактерий Neisseria species. Neisseria ORF2086, протеины, кодированные из них, фрагменты таких протеинов и иммуногенные композиции, содержащие такие протеины, известны с уровня техники и описаны, например, в WO2003/063766 и в опубликованных заявках на патент США U.S. No US 20060257413 и US 20090202593, каждая из которых включена в данный документ в виде ссылки в полном объеме.

Термин "Р2086", как правило, касается протеина, кодированного ORF2086. "Р" перед "2086" является сокращением от "протеин." Р2086 протеины изобретения могут быть липидизированными или нелипидизированными. "LP2086" и "Р2086", как правило, касаются липидизированных и нелипидизированных форм 2086 протеина, соответственно. Р2086 протеин изобретения может быть рекомбинантным. "rLP2086" и "rP2086", как правило, касаются липидизированными и нелипидизированными формами рекомбинантного 2086 протеина, соответственно. "2086" также известен как протеин связывающий фактор Н (fHBP) благодаря своей способности связываться с фактором Н.

Под термином "фармацевтически приемлемый носитель", как использовано в данном документе, подразумевают, что он включает какой-либо или все растворители, дисперсионные среды, покрытия, противобактериальные и противогрибковые агенты, изотонические агенты и агенты, понижающие абсорбцию, и тому подобное, совместимые с введением людям и другим позвоночным организмам. Как правило, фармацевтически приемлемым носителем является носитель, утвержденный нормативным агентством федерального, государственного управления, или другим нормативным агентством, или перечисленные в Фармакопее США или другой общепризнанной фармакопее для использования у животных, включая людей, а также млекопитающих, не относящихся к человеку. Термин "носитель" касается разбавителя, вспомогательного вещества, наполнителя или основы, с которыми фармацевтическую композицию вводят. Такие фармацевтические носители могут быть стерильными жидкостями, такими как вода и масло, включая нефтяного, животного, растительного или синтетического происхождения. Вода, солевые растворы и водные растворы декстрозы и глицерина могут быть использованы как жидкие носители, особенно для инъекционных растворов. Приемлемые фармацевтические наполнители включают крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рис, муку, мел, силикагель, стеарат натрия, моностеарат глицерина, тальк, хлорид натрия, сухое обезжиренное молоко, глицерин, пропиленгликоль, воду, этанол и тому подобное. Композиция, если необходимо, кроме того, может содержать небольшие количества увлажняющих, разрыхляющих, эмульгирующих агентов, или рН буферных агентов. Такие композиции могут приобретать форму растворов, суспензий, эмульсий, составов с замедленным высвобождением и тому подобное. Примеры подходящих фармацевтических носителей описаны в "Remington's Pharmaceutical Sciences" Е. W. Martin. Состав должен соответствовать способу введения. Соответствующий носитель будет очевидным для квалифицированного специалиста в данной области и будет зависеть, в значительной степени, от способа введения.

"Защитный" иммунный ответ касается способности иммуногенной композиции вызывать иммунный ответ, или гуморальный, или клеточно-опосредованный, которые служат для защиты субъекта от инфекции. Предусматривается, что нет необходимости защите быть абсолютной, то есть, нет необходимости полностью предотвращать или уничтожать инфекцию, если существует статистически значительное улучшение по сравнению с контрольной популяцией субъектов, например инфицированные животные, которым не вводили вакцину или иммуногенную композицию. Защита может быть ограничена до уменьшения серьезности или стремительности проявления симптомов инфекции. В основном, "защитный иммунный ответ" будет включать индуцирование возрастания уровней антител специфических для конкретного антигена, по меньшей мере, у 50% субъектов, включая некий уровень измеримых ответов функционального антитела на каждый антиген. В конкретных ситуациях "защитный иммунный ответ" мог включать индукцию двукратного повышения уровней антитела или четырехкратного повышения уровней антитела специфического для конкретного антигена, по меньшей мере, у 50% субъектов, включая некий уровень измеримых ответов функционального антитела на каждый антиген. В определенных вариантах осуществления опсонизирующие антитела коррелируют с защитным иммунным ответом. Таким образом, защитный иммунный ответ может быть проанализирован путем измерения процента снижения количества бактерий при анализе сывороточной бактериальной активности (SBA) или опсонофагоцитарном анализе, например таком, как описано ниже. Такие анализы также известны с уровня техники. Для менингококковых вакцин, например, SBA анализ представляет собой установленный суррогат для защиты. В некоторых вариантах осуществления, существует снижение количества бактерий, по меньшей мере, на 10%, 25%, 50%, 65%, 75%, 80%, 85%, 90%, 95% или более, по сравнению с количеством бактерий при отсутствии иммуногенной композиции.

Термины "протеин", "полипептид" и "пептид" касаются полимера из аминокислотных остатков и не ограничиваются минимальной длиной продукта. Таким образом, пептиды, олигопептиды, димеры, мультимеры, и тому подобные, включены в рамки определения. Определение охватывает, как протеины во всю длину, так и их фрагменты. Термины, кроме того, включают модификации, такие как делеции, присоединения и замещения (как правило, консервативные в природе, но которые могут быть неконсервативными), в нативной последовательности, предпочтительно такие, при которых протеин сохраняет способность вызывать иммунологический ответ у животных, когда им вводят протеин. Кроме того, включенными являются пост-экспрессионные модификации, например гликозилирование, ацетилирование, липидирование, фосфорилирование и тому подобное.

Термин "рекомбинантный", как использовано в данном документе, касается какого-либо протеина, полипептида или клетки, экспрессирующей интересующий ген, который продуцируется с использованием способов генной инженерии. Термин "рекомбинантный", как использовано по отношению к протеину или полипептиду, означает полипептид, продуцируемый путем экспрессии рекомбинантного полинуклеотида. Протеины представленного изобретения могут быть выделены из природного источника или получены с использованием способов генной инженерии. "Рекомбинантный", как использовано в данном документе, дополнительно описывает молекулу нуклеиновой кислоты, которая на основании своего происхождения или манипуляции, не связана со всем или частью полинуклеотида, с которым она связана в природе. Термин "рекомбинантный", как использовано по отношению к клетке-хозяину, означает клетку-хозяина, которая включает рекомбинантный полинуклеотид.

Термин "стабилизатор" касается соединения, которое связывается с антигеном и сохраняет эпитопы или иммунореактивность антигена в течение периода времени. Стабилизаторы известны с уровня техники. Примеры стабилизаторов включают многовалентные катионы, например, кальция или алюминия.

Термин "субъект" касается млекопитающего, птицы, рыбы, рептилии или какого-либо другого животного. Термин "субъект", кроме того, включает людей. Термин "субъект", кроме того, включает домашних животных-любимцев. Неограничивающие примеры домашних животных-любимцев включают: собак, котов, свинок, кроликов, крыс, мышей, песчанок, хомяков, морских свинок, хорьков, птиц, змей, ящериц, рыб, черепах и жаб. Термин "субъект", кроме того, включает домашних сельскохозяйственных животных. Неограничивающие примеры домашних сельскохозяйственных животных включают: альпаку, бизона, верблюда, крупный рогатый скот, оленя, свиней, лошадей, лам, мулов, ослов, овец, козлов, кроликов, северного оленя, яка, кур, гусей и индюков.

Термин "млекопитающие", как использовано в данном документе, касается какого-либо млекопитающего, такого как, например, люди, мыши, кролики, не человекообразные приматы. В предпочтительном варианте осуществления млекопитающим является человек.

Термины "вакцина" или "вакцинная композиция", которые используются взаимозаменяемо, касаются фармацевтических композиций, содержащих, по меньшей мере, одну иммуногенную композицию, которая индуцирует иммунный ответ у субъекта.

Общее описание

Представленное изобретение является результатом нового открытия, что конкретные составы и графики дозирования нелипидизированных вариантов Р2086 вызывают более высокие титры антитела с бактерицидными свойствами, чем предыдущие составы Р2086, как описано, например, в Fletcher et al., Infection & Immunity. Vol. 72(4):2088-2100 (2004). Альтернативно, представленное изобретение является результатом нового открытия, что конкретные составы и графики дозирования нелипидизированных вариантов Р2086 вызывают более высокие титры антитела с бактерицидными свойствами, чем коммерчески доступные составы липидизированных вариантов LP2086. Отмечено, однако, что коммерческие составы липидизированного LP2086 могут не быть в наличии в настоящее время. Более высокие скорости ответа (как определено по четырехкратному возрастанию или больше титров в SBA над базовой линией) наблюдались для вакцины, содержащей нелипидизированный вариант гР2086 по сравнению с вакциной с липидизированным rLP2086. Состав нелипидизированного варианта Р2086 вызывал антитела с бактерицидными свойствами против более широкого спектра штаммов, включая штаммы, как с аналогичными (>92% ID), так и с несходными (<92% ID) LP2086 последовательностями.

Представленное изобретение, кроме того, идентифицирует ранее неидентифицированные сложности экспрессирования нелипидизированных вариантов Р2086 и предусматривает способы преодоления данных сложностей, и новые композиции на их основе. В то время как плазмида конструирует кодирующие нелипидизированные варианты Р2086, предусматривавшие сильную экспрессию нелипидизированных вариантов, данные варианты были функционализированы пировиноградной кислотой по N-терминальному Cys. Функционализация пировиноградной кислотой предотвращает или снижает вероятность однородности в производстве или единообразия полипептидов. Кроме того, изобретатели обнаружили, что делеция N-терминального Cys из последовательностей нелипидизированного варианта Р2086 предотвращала функционализацию пировиноградной кислотой нелипидизированных вариантов Р2086. Попытки преодолеть функционализацию пировиноградной кислотой путем делеции кодона N-терминального Cys или отменяли экспрессию или в результате приводили к экспрессии нерастворимых вариантов. Альтернативно, отщепление N-терминального Cys от нелипидизированных вариантов Р2086 понижало экспрессию в некоторых вариантах. Неожиданно, однако, изобретатели обнаружили, что, по меньшей мере, не функционализированные пировиноградной кислотой, нелипидизированные варианты А05, В01, В09 и В44 могут быть экспрессированы, несмотря на делецию N-терминального Cys остатка. В основном, данные полипептиды могли бы быть экспрессированны без дополнительных модификаций других, чем делеция Cys, по сравнению с соответствующей нелипидизированной последовательностью дикого типа. Смотри, например, примеры 2 и 4. Более того, изобретатели обнаружили, что не функционализированные пировиноградной кислотой, нелипидизированные варианты неожиданно были иммуногенными, и они неожиданно вызывали антитела с бактерицидными свойствами.

Соответственно, представленное изобретение предусматривает два способа преодоления или уменьшения вероятности возникновения данных сложностей при экспрессировании нелипидизированных вариантов. Однако, дополнительные способы рассматриваются представленным изобретением. Первый способ заключался в варьировании длины Gly/Ser стебля в N-терминальном хвосте, непосредственно ниже N-терминального Cys. Второй способ представляет собой оптимизацию кодона в пределах N-терминального хвоста. Тем не менее, оптимизация дополнительных кодонов рассматривается представленным изобретением. Данные способы обеспечивают повышенную экспрессию растворимых нелипидизированных вариантов Р2086. Например, в одном варианте осуществления повышенную экспрессию растворимых нелипидизированных вариантов Р2086 сравнивают с экспрессией соответствующих нелипидизированных вариантов дикого типа.

Выделенные полипептиды

Изобретатели неожиданно обнаружили не функционализированные пировиноградной кислотой, нелипидизированные полипептиды ORF2086. Кроме, того, изобретатели обнаружили, что полипептиды неожиданно являются иммуногенными и способны вызывать бактерицидный иммунный ответ.

Как использовано в данном документе, термин "не функционализированный пировиноградной кислотой" касается полипептида, не имеющего в составе пирувата. Нелипидизированные полипептиды ORF2086, имеющие в составе пируват, как правило, демонстрировали сдвиг по массе +70, по сравнению с соответствующим полипептидом дикого типа. В одном варианте осуществления полипептид изобретения не демонстрирует сдвиг по массе +70 по сравнению с соответствующим нелипидизированным полипептидом дикого типа, при проведении измерения на масс-спектрометре. Смотри, например, пример 10.

В другом варианте осуществления выделенный, не функционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086 включает делецию N-терминального цистеинового остатка по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа. Термин "N-терминальный цистеин" касается цистеина (Cys) на N-конце или N-терминальном хвосте полипептида. Более конкретно, "N-терминальный цистеин", как использовано в данном документе, означает N-терминальный цистеин, на котором липопротеины LP2086 являются липидизированными трипальмитоил липидным хвостом, как известно в данной области с уровня техники. Например, когда ссылаются на какую-либо одну из SEQ ID No: 12-21 как на справочную последовательность, N-терминальный цистеин расположен в положении 1.

Термин "нелипидизированный полипептид ORF2086 дикого типа" или "нелипидизированный полипептид 2086 дикого типа", или "нелипидизированный полипептид дикого типа", как использовано в данном документе, касается полипептида ORF2086, имеющего аминокислотную последовательность, которая является идентичной аминокислотной последовательности соответствующего зрелого липидизированного полипептида ORF2086, обнаруженного в природе. Только разница между нелипидизированными и липидизированными молекулами состоит в том, что нелипидизированный полипептид ORF2086 дикого типа не является липидизированным трипальмитоил липидным хвостом на N-терминальном цистеине.

Как известно с уровня техники, нелипидизированная форма 2086 продуцируется протеином, в котором недостает исходной лидерной последовательности, или лидерной последовательностью, которая замещена частью последовательности, которая не специфицирует сайт для ацилирования жирной кислотой в клетке-хозяине. Смотри, например, документ WO 2003/063766, который включен в данный документ в виде ссылки в полном объеме.

Примеры нелипидизированного ORF2086 включают не только нелипидизированный полипептид ORF2086 дикого типа, который непосредственно описан, но также и полипептиды, имеющие аминокислотную последовательность, соответствующую какой-либо одной из SEQ ID No: 12-21, в которых N-терминальный Cys делетирован, и полипептиды, имеющие аминокислотную последовательность, соответствующую какой-либо одной из SEQ ID No: 12-21, в которых N-терминальный Cys замещен. Дополнительные примеры нелипидизированного полипептида ORF2086 включают аминокислотные последовательности, выбранные из SEQ ID No: 44, SEQ ID No: 49, SEQ ID No: 55, SEQ ID No: 57, SEQ ID No: 62 и SEQ ID No: 64.

Примеры нелипидизированных полипептидов ORF2086 дикого типа включают полипептиды, имеющие аминокислотную последовательность, соответствующую какой-либо одной из SEQ ID No: 12-21, показанной на фигуре 2, SEQ ID NO: 58, SEQ ID NO: 59 и SEQ ID NO: 60. Данные примеры нелипидизированных полипептидов ORF2086 дикого типа включают N-терминальный Cys.

Как использовано в данном документе, например, "нелипидизированный" полипептид В44 включает полипептид, который имеет аминокислотную последовательность, выбранную из SEQ ID No: 21, SEQ ID No: 21, в которой N-терминальный Cys в положении 1 делетирован, и SEQ ID No: 44. "Нелипидизированный дикого типа" полипептид В44 включает полипептид, который имеет аминокислотную последовательность SEQ ID No: 21. "Нефункционализированный пировиноградной кислотой, нелипидизированный" полипептид В44 включает, который имеет аминокислотную последовательность, выбранную из SEQ ID No: 21, в которой N-терминальный Cys в положении 1 делетирован, и SEQ ID No: 44.

Как другой пример, как использовано в данном документе, "нелипидизированный" полипептид В09 включает полипептид, который имеет аминокислотную последовательность, выбранную из SEQ ID No: 18, SEQ ID No: 18, в которой N-терминальный Cys в положении 1 делетирован, SEQ ID No: 49 и SEQ ID No: 50. "нелипидизированный дикого типа" полипептид В09 включает полипептид, который имеет аминокислотную последовательность SEQ ID No: 18. "Нефункционализированный пировиноградной кислотой, нелипидизированный" В09 включает полипептид, который имеет аминокислотную последовательность, выбранную из SEQ ID No: 18, в которой N-терминальный Cys в положении 1 делетирован, SEQ ID No: 49 и SEQ ID No: 50.

Как еще дополнительный пример, который использован в данном документе, "нелипидизированный" полипептид А05 включает полипептид, который имеет аминокислотную последовательность, выбранную из SEQ ID No: 13, SEQ ID No: 13, в которой N-терминальный Cys в положении 1 делетирован, и SEQ ID NO: 55. "Нелипидизированный дикого типа" А05 включает полипептид, который имеет аминокислотную последовательность SEQ ID NO: 13. "Нефункционализированный пировиноградной кислотой, нелипидизированный" А05 включает полипептид, который имеет аминокислотную последовательность, выбранную из SEQ ID NO: 13, в которой N-терминальный Cys в положении 1 делетирован, и SEQ ID NO: 55.

Термин "делеция" N-терминального Cys, как использовано в данном документе, включает мутацию, которая удаляет N-терминальный Cys, по сравнению с последовательностью нелипидизированного полипептида дикого типа. Например, "делеция" N-терминального Cys касается аминокислоты Cys от контрольной последовательности, например, от соответствующей последовательности дикого типа, таким образом, в результате получая убавление аминокислотного остатка по сравнению с контрольной последовательностью.

В другом варианте осуществления N-терминальный Cys замещен на аминокислоту, которая не является Cys остатком. Например, в иллюстративном варианте осуществления N-терминальный Cys в положении 1 из SEQ ID No: 12-21 включает С→G замещение в положении 1. Смотри, например, SEQ ID No: 62 по сравнению с SEQ ID No: 19 (В22 дикого типа), и SEQ ID No: 64 по сравнению с SEQ ID NO: 15 (А22 дикого типа). Иллюстративные аминокислоты для замещения N-терминального Cys включают какую-либо аминокислоту, за исключением Cys, предпочтительно полярную незаряженную аминокислоту, такую как, например, глицин. В предпочтительном варианте осуществления замещения осуществляют на неконсервативный остаток к Cys.

Изобретатели неожиданно обнаружили, что экспрессирующие нелипидизированные полипептиды ORF2086, имеющие делецию N-терминального Cys остатка, в результате давали не детектируемую функционализацию пировиноградной кислотой, когда измеряли с использованием масс-спектрометрии, по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа. Примеры не функционализированных пировиноградной кислотой, нелипидизированных полипептидов ORF2086 включают те, которые имеют аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID No: 12 (А04), SEQ ID No:13 (A05), SEQ ID No:14 (A12), SEQ ID No:15 (A22), SEQ ID No:16 (B02), SEQ ID No:17 (B03), SEQ ID No:18 (B09), SEQ ID No:19 (B22), SEQ ID No: 20 (B24), and SEQ ID No: 21 (B44), в которой цистеин в положении 1 делетирован. Дополнительные примеры выделенных, нефункционализированных пировиноградной кислотой, нелипидизированных полипептидов ORF2086 включают полипептиды, которые имеют аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID No: 44, SEQ ID No: 49, SEQ ID No: 50, and SEQ ID No: 55. Предпочтительно, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид 2086 включает, по меньшей мере, около 250, 255 или 260 последовательных аминокислот, и не более чем около 270, 269, 268, 267, 266, 265, 264, 263, 260, 259, 258, 257, 256 или 255 последовательных аминокислот.Для определения ряда какое-нибудь минимальное значение может быть сгруппировано с каким-нибудь максимальным значением. Более предпочтительно, полипептид имеет, по меньшей мере, 254 или 262 последовательных аминокислот.

В одном варианте осуществления выделенный, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086 кодируется нуклеотидной последовательностью, которая функционально связана с экспрессионной системой, где экспрессионная система способна быть экспрессированной в бактериальной клетке. В иллюстративном варианте осуществления нуклеотидная последовательность связана с регуляторной последовательностью, которая контролирует экспрессию нуклеотидной последовательности.

Подходящие экспрессионные системы, регуляторные последовательности, и бактериальные клетки известны с уровня техники. Например, какой нибудь вектор экспрессии плазмиды, например, PET™ (Novogen, Madison Wis.) или PMAL™ (New England Biolabs, Beverly, Mass.) может быть использован до тех пор, пока полипептид способен быть экспрессирован в бактериальной клетке. Предпочтительно, для клонирования и экспрессии рекомбинантных протеинов в Е. coli используют вектор PET™. В PET™ системе, клонированный ген может быть экспрессирован под контролем промотора фага Т7. Иллюстративные бактериальные клетки включают Pseudomonas fluorescens, и, предпочтительно, Е. coli.

В одном аспекте изобретение касается нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, который может быть получен по этому способу. Предпочтительно полипептид является выделенным. Кроме того, изобретение касается композиций, которые включают нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086, который может быть получен по этому способу. Композиция, предпочтительно, является иммуногенной композицией. Способ включает экспрессирование нуклеотидной последовательности, кодирующей полипептид, который имеет аминокислотную последовательность, выбранную из группы, которая состоит из SEQ ID No: 12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15, SEQ ID No:16, SEQ ID No:17, SEQ ID No:18, SEQ ID No:19, SEQ ID No: 20 и SEQ ID No: 21, в которых цистеин в положении 1 делетирован. Нуклеотидная последовательность функционально связана с экспрессионной системой, которая способна быть экспрессированной в бактериальной клетке. В одном варианте осуществления, способ включает экспрессирование нуклеотидной последовательности, кодирующей полипептид, который имеет аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID No: 44, SEQ ID No: 49, SEQ ID No: 50 и SEQ ID No: 55. В другом варианте осуществления нуклеотидную последовательность выбрают из группы, состоящей из SEQ ID No: 43, SEQ ID No: 51, SEQ ID No: 46, SEQ ID No: 47, SEQ ID No: 48, SEQ ID No: 45, SEQ ID No: 54. Предпочтительно, бактериальной клеткой является Е. coli.

В одном аспекте изобретение касается композиции, которая включает первый выделенный полипептид, который включает аминокислотную последовательность, представленную в SEQ ID NO: 49, и второй выделенный полипептид, который включает аминокислотную последовательность, представленную в SEQ ID NO: 44. В предпочтительном варианте осуществления полипептиды являются иммуногенными. В другом предпочтительном варианте осуществления, композиция дополнительно включает полипептид ORF2086 подсемейства А из серогруппы В N. meningitidis. Предпочтительно, полипептид ORF2086 подсемейства А является нефункционализированным пировиноградной кислотой, нелипидизированным полипептидом ORF2086 подсемейства А. В иллюстративном варианте осуществления, полипептидом ORF2086 подсемейства А является А05, примеры которого включают, например, SEQ ID NO: 13, в котором N-терминальный цистеин в положении 1 делетирован, и SEQ ID NO: 55.

В другом аспекте изобретение касается способа получения выделенного полипептида. Способ включает экспрессирование полипептида в бактериальной клетке, где полипептид содержит последовательность, имеющую больше чем 90% идентичности к SEQ ID No:21, упомянутая последовательность включает, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 13-18 из SEQ ID No. 21, аминокислот 21-34 из SEQ ID No: 21, и аминокислот 70-80 из SEQ ID No: 21, или их комбинации, где у полипептида отсутствует N-терминальный цистеин. Способ дополнительно включает очистку полипептида. Полипептид, полученный таким образом, включает нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086. Предпочтительно, полипептид является иммуногенным. В предпочтительном варианте осуществления бактериальной клеткой является Е. coli.

Примеры полипептидов, которые включают, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 13-18 из SEQ ID No: 21, аминокислот 21-34 из SEQ ID No: 21 и аминокислот 70-80 из SEQ ID No: 21, или их комбинации, включают SEQ ID No: 12 (А04), SEQ ID No: 13 (A05), SEQ ID No: 14 (A12), SEQ ID No: 15 (А22), SEQ ID No: 16 (B02), SEQ ID No: 17 (B03), SEQ ID No: 18 (B09), SEQ ID No: 19 (B22), SEQ ID No: 20 (B24) и SEQ ID No: 21 (B44). Предпочтительно, цистеин в положении 1 данных полипептидов делетирован. Кроме того, иллюстративные полипептиды включают SEQ ID No: 44, SEQ ID No: 49, SEQ ID No: 50, SEQ ID No: 55, SEQ ID No: 62 и SEQ ID No: 64.

В одном иллюстративном варианте осуществления, последовательность выделенного полипептида дополнительно включает, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 96-116 из SEQ ID No: 21, аминокислот 158-170 из SEQ ID No: 21, аминокислот 172-185 из SEQ ID No: 21, аминокислот 187-199 из SEQ ID No: 21, аминокислот 213-224 из SEQ ID No: 21, аминокислот 226-237 из SEQ ID No: 21, аминокислот 239-248 из SEQ ID No: 21, или их комбинации. Примеры полипептидов, которые включают, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 13-18 из SEQ ID No: 21, аминокислот 21-34 из SEQ ID No: 21 и аминокислот 70-80 из SEQ ID No: 21 или их комбинации, и дополнительно включающая, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 96-116 из SEQ ID No: 21, аминокислот 158-170 из SEQ ID No: 21, аминокислот 172-185 из SEQ ID No: 21, аминокислот 187-199 из SEQ ID No: 21, аминокислот 213-224 из SEQ ID No: 21, аминокислот 226-237 из SEQ ID No: 21, аминокислот 239-248 из SEQ ID No: 21, или их комбинации, включают SEQ ID No: 16 (В02), SEQ ID No: 17 (В03), SEQ ID No: 18 (B09), SEQ ID No: 19 (B22), SEQ ID No: 20 (B24) и SEQ ID No: 21 (B44). Предпочтительно, цистеин в положении 1 данных полипептидов делетирован. Кроме того, иллюстративные полипептиды включают полипептид, имеющий аминокислотную последовательность, выбранную из SEQ ID No: 44, SEQ ID No: 49, SEQ ID No: 50, и SEQ ID No: 55, и SEQ ID No: 62.

В одном аспекте изобретение касается выделенного полипептида, полученного по способу, описанному в данном документе. В одном варианте осуществления выделенный полипептид является нефункционализированным пировиноградной кислотой, нелипидизированным полипептидом. В другом аспекте изобретение касается иммуногенной композиции, полученной по способу, описанному в данном документе.

В одном аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, представленную в SEQ ID No: 18, в которой N-терминальный Cys в положении 1 делетирован, или SEQ ID No: 49. Иллюстративные нуклеотидные последовательности, которые кодируют SEQ ID No: 49, включают последовательности, выбранные из SEQ ID No: 46, SEQ ID No: 47 и SEQ ID No: 48. Предпочтительно, нуклеотидной последовательностью является SEQ ID No: 46. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID No: 46. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID No: 47. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID No: 48.

В одном аспекте изобретение касается плазмиды, включающей нуклеотидную последовательность, выбранную из SEQ ID No: 46, SEQ ID No: 47, SEQ ID No: 48 и SEQ ID No: 45, где плазмида способна быть экспрессированной в бактериальной клетке. Подходящие экспрессионные системы, регуляторные последовательности и бактериальные клетки известны с уровня техники, как описано выше. Предпочтительно, бактериальной клеткой является Е. coli.

В другом аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, представленную в SEQ ID No: 50. В иллюстративном варианте осуществления SEQ ID No: 50 кодируется SEQ ID No: 45.

В еще другом аспекте изобретение касается выделенного полипептида, который включает аминокислотную последовательность, представленную в SEQ ID No: 21, в которой N-терминальный Cys делетирован, или SEQ ID NO: 44. Иллюстративные нуклеотидные последовательности, которые кодируют SEQ ID No: 44, включают последовательности, выбранные из SEQ ID No: 43 и SEQ ID No: 51. Предпочтительно, нуклеотидной последовательностью является SEQ ID No: 43. В одном аспекте изобретение касается выделенной нуклеотидной последовательности, которая включает SEQ ID No: 43.

Иммуногенные композиции

В предпочтительном варианте осуществления композиции, описанные в данном документе, включающие выделенный, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086, являются иммуногенными. Иммуногенные композиции, которые включают протеин, кодированный нуклеотидной последовательностью из Neisseria meningitidis ORF2086 известны с уровня техники. Иллюстративные иммуногенные композиции включают те, которые описаны в WO2003/063766, и опубликованных заявках на патент США с номерами US 20060257413 и US 20090202593, которые включены в данный документ в виде ссылок в полном объеме. Такие иммуногенные композиции, как описаны в них, включают протеин, демонстрирующий бактерицидную активность, установленную как у протеина ORF2086, его иммуногенных частях, и/или его биологических эквивалентах. Протеин ORF2086 относится к протеину, кодированному 2086 с открытой рамкой считывания Neisseria species.

Протеин может быть рекомбинантным протеином или выделенным протеином из нативной Neisseria species. Например, Neisseria протеины ORF2086 могут быть выделенными из бактериальных штаммов, таких как те, что из Neisseria species, включая штаммы Neisseria meningitidis (серогруппы А, В, С, D, W-135, X, Y, Z и 29E), Neisseria gonorrhoeae, и Neisseria lactamica, а также иммуногенные части и/или биологические эквиваленты упомянутых протеинов.

Протеины ORF2086 включают 2086 протеины подсемейства А и протеины подсемейства В, их иммуногенные части и/или их биологические эквиваленты. Протеины 2086 подсемейства А и протеины 2086 подсемейства В известны с уровня техники, смотри, например, Fletcher et al., 2004, цитированная выше, и Murphy et al., J Infect Dis. 2009 Aug 1; 200(3):379-89. Кроме того, смотри документ WO2003/063766, который раскрывает SEQ ID No: от 260 до 278, как представляющие аминокислотные последовательности, связанные с протеинами 2086 подсемейства А. В дополнение, раскрытыми в WO2003/063766 являются SEQ ID No: от 279 до 299, как представляющие аминокислотные последовательности, связанные с протеинами 2086 подсемейства В. Заявка WO2003/063766 включена в данный документ в виде ссылки в полном объеме. Протеины ORF2086 или их эквиваленты, и т.д. могут быть липидизированными или нелипидизированными. Предпочтительно, Neisseria протеин ORF2086 является нелипидизированным. Альтернативно, иммуногенные композиции могут быть комбинациями липидизированных и нелипидизированных протеинов ORF2086.

В одном варианте осуществления иммуногенная композиция включает выделенный протеин, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину, кодированному нуклеотидной последовательностью из Neisseria ORF2086.

В одном варианте осуществления иммуногенная композиция включает выделенный протеин, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину подсемейства А, кодированному нуклеотидной последовательностью из Neisseria ORF2086. Предпочтительно, иммуногенная композиция включает выделенный протеин подсемейства А, кодированный нуклеотидной последовательностью из Neisseria ORF2086. В некоторых вариантах осуществления полипептидом ORF2086 подсемейства А является вариант А05, А04, А12 или А22.

В некоторых вариантах осуществления полипептидом ORF2086 подсемейства А является вариант А05, А12 или А22.

В другом варианте осуществления иммуногенная композиция включает выделенный протеин, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину подсемейства В, кодированного нуклеотидной последовательностью из Neisseria ORF2086. Предпочтительно, иммуногенная композиция включает выделенный протеин подсемейства В, кодированный нуклеотидной последовательностью из Neisseria ORF2086. В некоторых вариантах осуществления протеином ORF2086 подсемейство В является вариант В44, В02, В03, В22, В24 или В09.

В некоторых вариантах осуществления протеином ORF2086 подсемейства В является вариант В44, В22 или В09.

В предпочтительном варианте осуществления иммуногенная композиция включает выделенный, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину подсемейства В, кодированному нуклеотидной последовательностью из Neisseria ORF2086. Например, в некоторых вариантах осуществления протеин ORF2086 подсемейства В представляет собой последовательности, выбранные из В44, имеющего аминокислотную последовательность, как показано в SEQ ID No: 21; В02, имеющего аминокислотную последовательность, как показано в SEQ ID No: 16; В03, имеющего аминокислотную последовательность, как показано в SEQ ID No: 17; В22, имеющего аминокислотную последовательность, как показано в SEQ ID No: 19; В24, имеющего аминокислотную последовательность, как показано в SEQ ID No: 20; или варианта В09, имеющего аминокислотную последовательность, как показано в SEQ ID No: 18, в котором N-терминальный Cys делетирован, или их комбинации.

Более предпочтительно, иммуногенная композиция включает нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В09, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44, или их комбинации. В одном варианте осуществления композиция включает нефункционализированный пировиноградной кислотой, нелипидизированный вариант В09, имеющий аминокислотную последовательность, как показано в SEQ ID No: 18, в котором N-терминальный Cys делетирован, нефункционализированный пировиноградной кислотой, нелипидизированный В44, имеющий аминокислотную последовательность, как показано в SEQ ID No: 21, в котором N-терминальный Cys делетирован, или их комбинацию. В другом варианте осуществления иммуногенная композиция включает нефункционализированный пировиноградной кислотой, нелипидизированный В09, содержащий SEQ ID No: 49, нефункционализированный пировиноградной кислотой, нелипидизированный В44 содержащий SEQ ID No: 44, или их комбинацию.

В одном аспекте изобретение касается иммуногенной композиции, которая включает полипептид ORF2086 подсемейства В из серогруппы В N. meningitidis, где полипептид представляет собой нефункционализированный пировиноградной кислотой, нелипидизированный В44. В44 может содержать аминокислотную последовательность, как показано в SEQ ID No: 21, в которой N-терминальный Cys делетирован или SEQ ID No: 44. В одном варианте осуществления композиция дополнительно включает второй полипептид ORF2086 подсемейство В из серогруппы В N. meningitidis, где второй полипептид является нефункционализированным пировиноградной кислотой, нелипидизированным В09. В09 может содержать аминокислотную последовательность, как показано в SEQ ID NO: 18, где N-терминальный Cys делетирован, или SEQ ID NO: 49. В одном варианте осуществления иммуногенная композиция является вакциной.

В другом варианте осуществления композиция включает не больше, чем 3 полипептида ORF2086 подсемейства В. В дополнительном варианте осуществления композиция включает не больше, чем 2 полипептида ORF2086 подсемейства В.

В одном варианте осуществления композиция дополнительно включает один или больше полипептидов ORF2086 подсемейства А. В предпочтительном варианте осуществления композиция включает полипептид А05 подсемейства А.

В еще другом варианте осуществления иммуногенная композиция включает выделенный протеин, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину подсемейства А, кодированному нуклеотидной последовательностью из Neisseria ORF2086, и выделенный протеин, имеющий, по меньшей мере, 95% идентичность аминокислотной последовательности к протеину подсемейства В, кодированного нуклеотидной последовательностью из Neisseria ORF2086.

Предпочтительно, иммуногенная композиция включает выделенный протеин подсемейства А, кодированный нуклеотидной последовательностью из Neisseria ORF2086 и выделенный протеин подсемейства В, кодированный нуклеотидной последовательностью из Neisseria ORF2086. Более предпочтительно, иммуногенная композиция включает выделенный нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086 подсемейства А и выделенный нефункционализированный пировиноградной кислотой, нелипидизированный полипептид ORF2086 подсемейства В. В некоторых вариантах осуществления полипептид ORF2086 подсемейства А представляет собой вариант А05, А04, А12 или А22. В предпочтительном варианте осуществления полипептид ORF2086 подсемейства А является А05, имеющим аминокислотную последовательность, как показано в SEQ ID No: 13; А04, имеющим аминокислотную последовательность, как показано в SEQ ID No: 12; А12, имеющим аминокислотную последовательность, как показано в SEQ ID No: 14; или вариантом А22, имеющим аминокислотную последовательность, как показано в SEQ ID No: 15, где N-терминальный Cys делетирован, или какой-либо их комбинацией. В некоторых вариантах осуществления протеин ORF2086 подсемейства В является вариантом В44, В02, В03, В22, В24 или В09. В предпочтительном варианте осуществления протеин ORF2086 подсемейства В представляет собой В44, имеющий аминокислотную последовательность, как показано в SEQ ID No: 21; В02, имеющий аминокислотную последовательность, как показано в SEQ ID No: 16; В03, имеющий аминокислотную последовательность, как показано в SEQ ID No: 17; В22, имеющий аминокислотную последовательность, как показано в SEQ ID No: 19; В24, имеющий аминокислотную последовательность, как показано в SEQ ID No: 20; или вариант В09, имеющий аминокислотную последовательность, как показано в SEQ ID No: 18, где N-терминальный Cys делетирован, или их комбинацию.

В одном варианте осуществления иммуногенная композиция включает в соотношении 1:1 протеин подсемейства А и протеин подсемейства В.

В другом аспекте выделенные полипептиды и композиции, описанные в данном документе, вызывают бактерицидный иммунный ответ у млекопитающих на полипептид ORF2086 из серогруппы В N. meningitidis. Композиции имеют способность индуцировать бактерицидные противоменингококковые антитела после введения млекопитающим, и в предпочтительном варианте осуществления, могут индуцировать антитела, которые являются бактерицидными по отношению к штаммам из соответствующих подсемейств. Дополнительная информация о бактерицидных ответах представлена ниже. Смотри, например, примеры 6, 11, 12 и 13. Антитела с бактерицидными свойствами являются индикатором защиты у людей, и доклинические исследования служат, как идентификатор объекта, и какой-либо новый кандидат иммуногенной композиции должен вызывать данные функциональные антитела.

В иллюстративном варианте осуществления выделенный нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В09, содержащий SEQ ID No: 18, где N-терминальный Cys в положении 1 делетирован, или SEQ ID No: 49, и его иммуногенные композиции вызывают бактерицидные антитела к (например, которые могут связываться с) полипептиду ORF2086 из серогруппы В N. meningitidis, подсемейства А или, предпочтительно, подсемейства В. Предпочтительно, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В09 и его иммуногенные композиции, вызывают бактерицидные антитела к варианту А05 (SEQ ID NO: 13); варианту В44 (SEQ ID NO: 21); варианту B16 (SEQ ID NO: 60); варианту B24 (SEQ ID NO: 20); варианту B09 (SEQ ID NO: 18) или их комбинации. В иллюстративном варианте осуществления нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В09 и его иммуногенные композиции вызывает бактерицидные антитела к варианту В44 (SEQ ID NO: 21); варианту В16 (SEQ ID NO: 60); варианту B24 (SEQ ID NO: 20); варианту B09 (SEQ ID NO: 18) или их комбинации. Смотри, например, пример 11, пример 12 и пример 13.

В другом иллюстративном варианте осуществления выделенный, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44, имеющий SEQ ID No: 21, в которой N-терминальный Cys в положении 1 делетирован, или SEQ ID No: 44, и его иммуногенные композиции, вызывает бактерицидные антитела к (например, которые могут связываться с) полипептиду ORF2086 из серогруппы В N. meningitidis, подсемейства В. Предпочтительно, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44 и его иммуногенные композиции вызывают бактерицидные антитела к варианту В44 (SEQ ID No: 21); варианту В16 (SEQ ID No: 60); варианту B24 (SEQ ID No: 20); варианту B09 (SEQ ID No: 18), или их комбинации. Смотри, например, пример 11. Дополнительно, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44 и его иммуногенные композиции также могут вызывать бактерицидные антитела, которые связываются с вариантом В02 (SEQ ID No: 16). Смотри, например, пример 12 и пример 13. Более того, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44 и его иммуногенные композиции также могут вызывать бактерицидные антитела, которые связываются с вариантом В03 (SEQ ID No: 17) и вариантом В15 (SEQ ID No: 59). Смотри, например, пример 6.

В дополнительном иллюстративном варианте осуществления выделенный, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В22, содержащий SEQ ID NO: 19, где N-терминальный Cys в положении 1 делетирован, и его иммуногенные композиции вызывают бактерицидные антитела (например, которые могут связываться с) к полипептиду ORF2086 из серогруппы В N. meningitidis, подсемейства В. Предпочтительно, нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В22 вызывает бактерицидные антитела к варианту В44 (SEQ ID No: 21); варианту В16 (SEQ ID No: 60); варианту B24 (SEQ ID No: 20); варианту B09 (SEQ ID No: 18), или их комбинации. Смотри, например, пример 13.

В одном варианте осуществления выделенный нефункционализированный пировиноградной кислотой, нелипидизированный полипептид А05, имеющий SEQ ID No: 13, где N-терминальный Cys делетирован, или SEQ ID No: 55, и его иммуногенные композиции вызывают бактерицидные антитела (например, которые могут связываться с) к полипептиду ORF2086 из серогруппы В N. meningitidis, подсемейства А. Предпочтительно, нефункционализированный пировиноградной кислотой, нелипидизированный А05 и его иммуногенные композиции вызывает бактерицидные антитела к варианту А05 (SEQ ID No: 13), варианту А22 (SEQ ID No: 15), варианту A12 (SEQ ID No: 14), или их комбинации. Смотри, например, пример 6 и 13.

В одном аспекте изобретение касается способа вызывания бактерицидных антител специфических к серогруппе В N. meningitidis у млекопитающих. В иллюстративном варианте осуществления способ включает вызывание бактерицидных антител специфических к ORF2086 подсемейства В серогруппы В N. meningitidis, ORF2086 подсемейства А серогруппы В N. meningitidis, или их комбинации. Способ включает введение млекопитающему эффективного количества выделенного, нефункционализированного пировиноградной кислотой, нелипидизированного полипептида 2086 или его иммуногенной композиции, как описано выше.

В предпочтительном варианте осуществления способ включает вызывание бактерицидных антител специфических к ORF2086 подсемейства В серогруппы В N. meningitidis. Выделенный полипептид или иммуногенная композиция содержит нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44. В другом предпочтительном варианте осуществления композиция дополнительно содержит нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В09. В иллюстративном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID No: 49, SEQ ID No: 44, или их комбинацию. В другом иллюстративном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID No: 18, где N-терминальный Cys в положении 1 делетирован, SEQ ID NO: 21, где N-терминальный Cys в положении 1 делетирован, или их комбинацию. В еще другом иллюстративном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID NO: 19, где N-терминальный Cys в положении 1 делетирован.

В предпочтительном варианте осуществления способ включает вызывание бактерицидных антител специфических к ORF2086 подсемейства А серогруппы В N. meningitidis. Выделенный полипептид или иммуногенная композиция содержит нефункционализированный пировиноградной кислотой, нелипидизированный полипептид А05. В предпочтительном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID No: 13, где N-терминальный Cys в положении 1 делетирован. В другом предпочтительном варианте осуществления композиция дополнительно содержит нефункционализированный пировиноградной кислотой, нелипидизированный полипептид В44. Смотри, например, пример 6 и 13. В иллюстративном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID No: 55, SEQ ID No: 44, или их комбинацию. В предпочтительном варианте осуществления выделенный полипептид или иммуногенная композиция содержит SEQ ID No: 13, где N-терминальный Cys в положении 1 делетирован, SEQ ID No: 21, где N-терминальный Cys в положении 1 делетирован, или их комбинацию.

Иммуногенная композиция может содержать протеин, кодированный нуклеотидной последовательностью из Neisseria ORF2086, полинуклеотиды или их эквиваленты, как единственный активный иммуноген в иммуногенной композиции. Альтернативно, иммуногенная композиция может дополнительно содержать активные иммуногены, в том числе другие иммуногенные полипептиды Neisseria sp., или иммунологически активные протеины из одного или более других микробных патогенов (например, вируса, приона, бактерии или гриба, без ограничения), или капсульный полисахарид. Композиции могут содержать один или более необходимых протеинов, фрагментов или фармацевтических соединений, как требуется для выбранного показания.

Какой-либо мульти-антиген или многовалентная иммуногенная композиция рассматривается представленным изобретением. Например, иммуногенная композиция может включать комбинации двух или более протеинов ORF2086, комбинацию протеина ORF2086 с одним или более протеинами Por А, комбинацию протеина ORF2086 с meningococcus серогруппы А, С, Y и W135 полисахаридами и/или полисахаридными конъюгатами, комбинацию протеина ORF2086 с комбинациями meningococcus и pneumococcus, или комбинацию какого-либо из вышеупомянутых в форме, подходящей для необходимого введения, например, для доставки через слизистую. Квалифицированный специалист в данной области легко сможет сформулировать такие мульти-антигенные или многовалентные иммунологические композиции.

Представленное изобретение, кроме того, рассматривает мульти-иммунизационные схемы, по которым какую-либо композицию полезную против патогена могут комбинировать с этими или теми композициями представленного изобретения. Например, без ограничения, пациенту может быть введена иммуногенная композиция представленного изобретения и другая иммунологическая композиция для иммунизации против вируса папиломавируса человека (HPV), такая как HPV вакцина GARDASIL®, как часть мульти-иммунизационной схемы. Квалифицированный специалист в данной области легко сможет выбрать иммуногенные композиции для использования в сочетании с иммуногенными композициями представленного изобретения с целью развития и внедрения мульти-иммунизационных схем.

Полипептиды ORF2086, фрагменты и эквиваленты могут быть использованы как часть объединенной иммуногенной композиции; в которой один или более протеинов или полипептидов находятся в сочетании с носителем, для того чтобы произвести композицию, которая имеет иммуногенные свойства против нескольких серотипов, или серотипов N. meningitidis, особенно менингококковых серогрупп, особенно серогруппы В, и/или против некоторых заболеваний. Альтернативно, один из полипептидов ORF2086 может быть использован как протеиновый носитель для других иммуногенных полипептидов. Состав таких иммуногенных композиций хорошо известен квалифицированному специалисту в данной области с уровня техники.

Иммуногенные композиции изобретения предпочтительно включают фармацевтически приемлемый носитель. Подходящие фармацевтически приемлемые носители и/или разбавители включают какой-либо или все традиционные растворители, дисперсионные среды, наполнители, твердые носители, водные растворы, оболочки, противобактериальные и противогрибковые агенты, изотонические и замедляющие абсорбцию агенты, и тому подобные. Подходящие фармацевтически приемлемые носители включают, например, один или более из воды, солевого раствора, фосфатно-буферного солевого раствора, декстрозы, глицерина, этанола и т.д., а также их комбинаций.

Фармацевтически приемлемые носители могут дополнительно включать небольшие количества вспомогательных веществ, таких как увлажняющие или эмульгирующие агенты, консерванты или буферы, которые повышают срок хранения или эффективность антитела. Получение и использование фармацевтически приемлемых носителей хорошо известны с уровня техники. За исключением случаев, когда какая-либо традиционная среда или агент является несовместимым с активным ингредиентом, тогда рассматривается их использование в иммуногенных композициях представленного изобретения.

Иммуногенные композиции могут вводить парентерально, например, путем инъекции, или подкожно, или внутримышечно, а также перорально или интраназально. Способы внутримышечной иммунизации описаны Wolff et al. Biotechniques: 11 (4):474-85. (1991) и Sedegah et al. PNAS Vol.91, pp.9866-9870, (1994). При других способах введения используются, например, без ограничения, пероральные препараты, легочные препараты, суппозитории и трансдермальные аппликации. Пероральные препараты, например, включают такие обычно используемые наполнители, как, например, фармацевтической степени чистоты маннит, лактоза, крахмал, стеарат магния, сахарин натрия, целлюлоза, карбонат магния и тому подобное, без ограничений. Предпочтительно, иммуногенную композицию вводят внутримышечно.

Иммуногенные композиции представленного изобретения могут, кроме того, содержать один или более дополнительных "иммуномодуляторов", которые являются агентами, которые отклоняют или изменяют иммунную систему, таким образом, что наблюдается или положительная регуляция, или негативная модуляция гуморального и/или клеточно-опосредованного иммунитета. В одном конкретном варианте осуществления предпочтение отдается положительной регуляции гуморальных и/или клеточно-опосредованных ответвлений иммунной системы. Примеры определенных иммуномодуляторов включают, например, вспомогательное вещество или цитокин, или ISCOMATRIX (CSL Limited, Parkville, Australia), описанных в патенте США No. 5,254,339 среди других.

Неограничивающие примеры вспомогательных веществ, которые могут использоваться в вакцинах представленного изобретения, включают RIBI систему вспомогательных веществ (Ribi Inc., Hamilton, Mont.), квасцы, минеральные гели, такие как гель гидроксида алюминия, эмульсии масло-в-воде, эмульсии вода-в-масле, такие как, например, полный и неполный адъюванты Фрейнда, блок-сополимер (CytRx, Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.), вспомогательное вещество AMPHIGEN®, сапонин, Quil А или другие фракции сапонина, монофосфорильный липид А и Avridine липид-аминное вспомогательное вещество. Неограничивающие примеры эмульсий масло-в-воде, подходящие для вакцин изобретения, включают модифицированный SEAM62 и SEAM 1/2 препараты. Модифицированный SEAM62 представляет собой эмульсию масло-в-воде, содержащую 5% (об./об.) сквалена (Sigma), 1% (об./об.) SPAN® 85 детергента (ICI Surfactants), 0,7% (об./об.) полисорбата ® 80 детергента (ICI Surfactants), 2,5% (об./об.) этанола, 200 мкг/мл Quil А, 100 мкг/мл холестерина и 0,5% (об./об.) лецитина. Модифицированный SEAM 1/2 представляет собой эмульсию масло-в-воде, содержащую 5% (об./об.) сквалена, 1% (об./об.) SPAN® 85 детергента, 0,7% (об./об.) полисорбата 80 детергента, 2,5% (об./об.) этанола, 100 мкг/мл Quil А и 50 мкг/мл холестерина.

Другие "иммуномодуляторы", которые могут быть включены в вакцину, включают, например, один или более интерлейкинов, интерферонов, или других известных цитокинов или хемокинов. В одном варианте осуществления вспомогательное вещество может быть циклодекстриновым производным или полианионным полимером, таким как те, что описаны в патенте США с номерами 6,165,995 и 6,610,310, соответственно. Следует понимать, что использование иммуномодулятора и/или вспомогательного вещества будет зависеть от субъекта, которому будут вводить вакцину или иммуногенную композицию, пути инъекционного введения и количества инъекций, которые делаются.

В некоторых вариантах осуществления, вспомогательное вещество является сапонином. В некоторых вариантах осуществления концентрация сапонина составляет от 1 мкг/мл до 250 мкг/мл; от 5 мкг/мл до 150 мкг/мл; или от 10 мкг/мл до 100 мкг/мл. В некоторых вариантах осуществления концентрация сапонина составляет около 1 мкг/мл; около 5 мкг/мл; около 10 мкг/мл; около 20 мкг/мл; около 30 мкг/мл; около 40 мкг/мл; около 50 мкг/мл; около 60 мкг/мл; около 70 мкг/мл; около 80 мкг/мл; около 90 мкг/мл; около 100 мкг/мл; около 110 мкг/мл; около 120 мкг/мл; около 130 мкг/мл; около 140 мкг/мл; около 150 мкг/мл; около 160 мкг/мл; около 170 мкг/мл; около 180 мкг/мл; около 190 мкг/мл; около 200 мкг/мл; около 210 мкг/мл; около 220 мкг/мл; около 230 мкг/мл; около 240 мкг/мл или около 250 мкг/мл.

В конкретных предпочтительных вариантах осуществления протеины данного изобретения используются в иммуногенных композициях для перорального введения, которые включают мукозное вспомогательное вещество, и применяются для лечения или предупреждения N. meningitidis инфекции в человеческом организме. Мукозное вспомогательное вещество может быть холерным экзотоксином; однако, предпочтительно, мукозные вспомогательные вещества, которые могут быть использованы в соответствии с представленным изобретением, являются другими, чем холерный экзотоксин, и включают нетоксичные производные холерного голотоксина, в которых субъединица А является мутировавшей, химически модифицированный холерный экзотоксин, или родственные протеины, полученные путем модификации аминокислотной последовательности холерного экзотоксина. Для конкретного холерного экзотоксина, который может быть особенно подходящим для приготовления иммуногенных композиций данного изобретения, смотри мутантный холерный голотоксин Е29Н, как раскрыто в опубликованной международной заявке WO 00/18434, которая включена в данный документ в виде ссылки в полном объеме. Данные могут добавляться к или сочетаться с полипептидами данного изобретения. Такие же методики могут быть применены к другим молекулам с мукозным вспомогательным веществом или доставляющими свойствами, такими как термически лабильный токсин (LT) Escherichia coli.

Могут быть использованы другие соединения с мукозным вспомогательным веществом или доставляющей активностью, такие как желчь; поликатионы, такие как DEAE-декстран и полиорнитин; детергенты, такие как натрия додецилбензолсульфат; липид-сопряженные вещества; антибиотики, такие как стрептомицин; витамин А; и другие соединения, которые изменяют структурную и функциональную целостность поверхностей слизистой. Другие мукозо активные соединения включают производные микробных структур, такие как MDP; акридин и циметидин. STIMULON™ QS-21, MPL и IL-12, как описано выше, также могут быть использованы.

Иммуногенные композиции данного изобретения могут быть доставленными в форме ISCOMS (иммуностимулирующих комплексов), ISCOMS, содержащих СТВ, липосомы или инкапсулированными в соединениях, таких как акрилаты или поли(DL-лактид-со- гликозид), чтобы сформировать микросферы размером подходящим для адсорбции. Протеины данного изобретения, кроме того, могут быть введены в масляные эмульсии.

Количество (то есть, доза) иммуногенной композиции, которое вводят пациенту, может быть определено в соответствии со стандартными методиками, известными квалифицированному специалисту с уровня техники, принимая во внимание такие факторы, как специфический антиген, вспомогательное вещество (если присутствует), возраст, пол, вес, разновидность, состояние конкретного пациента и путь введения.

Например, доза для пациента - молодого человека - может содержать, по меньшей мере, 0,1 мкг, 1 мкг, 10 мкг или 50 мкг протеина ORF2086 Neisseria, и не больше, чем 80 мкг, 100 мкг, 150 мкг или 200 мкг протеин ORF2086 Neisseria. Какая-либо минимальная величина и какая-либо максимальная величина могут быть объединены для определения подходящего диапазона.

Вспомогательные вещества

Иммуногенные композиции, как описано в данном документе, также содержат, в конкретном варианте осуществления изобретения, одно или более вспомогательных веществ. Вспомогательное вещество представляет собой вещество, которое усиливает иммунный ответ, когда его вводят вместе с иммуногеном или антигеном. Показано, что некоторое количество цитокинов или лимфокинов имеет иммуномодулирующую активность и, таким образом, являются подходящими как вспомогательные вещества, в том числе, но не ограничиваясь этим, интерлейкины 1-α, 1-β, 2, 4, 5, 6, 7, 8, 10, 12 (смотри, например, патент США No 5,723,127), 13, 14, 15, 16, 17 и 18 (и его мутантные формы); интерфероны - α, β и γ; гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF) (смотри, например, патент США No 5,078,996 и АТСС номер доступа 39900); макрофагальный колониестимулирующий фактор (M-CSF); гранулоцитарный колониестимулирующий фактор (G-CSF); и факторы некроза опухолей а и 0.

Еще другие вспомогательные вещества, которые являются подходящими для иммуногенных композиций, описанные в данном документе, включают хемокины, в том числе без ограничения, MCP-1, MIP-1α, MIP-1β и хемокин, выделяемый Т-клетками при активации (RANTES); адгезивные молекулы, такие как селектин, например, L-селектин, Р-селектин и Е-селектин; молекулы подобные муцину, например, CD34, GlyCAM-1 и MadCAM-1; член интегринового семейства, такой как LFA-1, VLA-1, Мас-1 и р150.95; член иммуноглобулинового надсемейства, такой как РЕСАМ, ICAM, например, ICAM-1, ICAM-2 и ICAM-3, CD2 и LFA-3; ко-стимулирующие молекулы, такие как В7-1, В7-2, CD40 и CD40L; факторы роста, в том числе васкулярный фактор роста, фактор роста нервов, фактор роста фибробластов, эпидермальный фактор роста, PDGF, BL-1, и эндотелиальный фактор роста сосудов; рецепторные молекулы, включая Fas, TNF рецептор, Fit, Аро-1, р55, WSL-1, DR3, TRAMP, Аро-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, и DR6; и каспазу (ICE).

Другие иллюстративные вспомогательные вещества включают, но не ограничиваются этим, гидроксид алюминия; фосфат алюминия; STIMULON™ QS-21 (Aquila Biopharmaceuticals, Inc., Framingham, Mass.); MPL™ (3-О-дезацилированный монофосфорил-липид A; Corixa, Hamilton, Mont.), 529 (аминоалкил-глюкозаминфосфатное соединение, Corixa, Hamilton, Mont.), IL-12 (Genetics Institute, Cambridge, Mass.); GM-CSF (Immunex Corp., Seattle, Wash.); N-ацетил-мурамил-L-теронил-D-изоглутамин (thr-MDP); N-ацетил-нор-мурамил-L-аланил-D-изоглутамин (CGP 11637, называется нор-MDP); N-ацетилмурамил-L-аланил-D-изоглутаминил-L-аланил-2-(1'-2'-дипалмитоил-sn-глицеро-3-гидроксифосфорилоксиэтиламин) (CGP 19835A, называется MTP-PE); и холерный экзотоксин. В конкретных предпочтительных вариантах осуществления вспомогательным веществом является QS-21.

Дополнительные иллюстративные вспомогательные вещества включают нетоксические производные холерного экзотоксина, включая его субъединицу А, и/или конъюгаты или генетически сконструированные слияния полипептида N. meningitidis с холерным экзотоксином или его субъединицей В ("СТВ"), прохолерогеноидом, грибковыми полисахаридами, в том числе шизофилланом, мурамил-дипептидом, производными мурамил-дипептида ("MDP"), форболовыми эфирами, термически лабильным токсином Е. coli, блок-полимерами или сапонинами.

Фосфат алюминия использовали как вспомогательное вещество в 1 фазе клинических испытаний в концентрации 0,125 мг/дозу, намного меньше, чем предел в 0,85 мг/дозу, указанные в Кодексе федеральных правил США. Алюминийсодержащие вспомогательные вещества широко используются у людей, чтобы потенциировать иммунный ответ антигенов, при введении внутримышечно или подкожно. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет от 0,125 мкг/мл до 0,5 мкг/мл; от 0,20 мкг/мл до 0,40 мкг/мл; или от 0,20 мкг/мл до 0,30 мкг/мл. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет около 0,125 мкг/мл; около 0,15 мкг/мл; около 0,175 мкг/мл; около 0,20 мкг/мл; около 0,225 мкг/мл; около 0,25 мкг/мл; около 0,275 мкг/мл; около 0,30 мкг/мл; около 0,325 мкг/мл; около 0,35 мкг/мл; около 0,375 мкг/мл; около 0,40 мкг/мл; около 0,425 мкг/мл; около 0,45 мкг/мл; около 0,475 мкг/мл; или около 0,50 мкг/мл.

В предпочтительном варианте осуществления концентрация алюминия в иммуногенной композиции составляет от 0,125 мг/мл до 0,5 мг/мл; от 0,20 мг/мл до 0,40 мг/мл; или от 0,20 мг/мл до 0,30 мг/мл. В некоторых вариантах осуществления концентрация алюминия в иммуногенной композиции составляет около 0,125 мг/мл; около 0,15 мг/мл; около 0,175 мг/мл; около 0,20 мг/мл; около 0,225 мг/мл; около 0,25 мг/мл; около 0,275 мг/мл; около 0,30 мг/мл; около 0,325 мг/мл; около 0,35 мг/мл; около 0,375 мг/мл; около 0,40 мг/мл; около 0,425 мг/мл; около 0,45 мг/мл; около 0,475 мг/мл; или около 0,50 мг/мл.

Подходящие вспомогательные вещества, используемые для усиления иммунного ответа, дополнительно включают, без ограничения, MPL™ (3-О-дезацилированный монофосфорил-липид A, Corixa, Hamilton, MT), который описан в патенте США No 4,912,094. Кроме того, подходящими для использования, как вспомогательные вещества являются синтетические аналоги липида А или соединения аминоалкил-глюкозамина фосфата (AGP), или их производные, или аналоги, которые являются доступными от Corixa (Hamilton, МТ), и которые описаны в патенте США No. 6,113,918. Одним таким AGP является 2-[(R)-3-тетрадеканоилокситетрадеканоиламино]этил 2-дезокси-4-O-фосфоно-3-O-[(R)-3-тетрадеканоилокситетрадеканоил]-2-[(R)-3-тетрадеканоилокси-тетрадеканоил-амино]-b-D-глюкопиранозид, который также известен как 529 (раньше известен как RC529). Данное вспомогательное вещество 529 формулируют как водную форму (AF) или как стабильную эмульсию (SE).

Еще другие вспомогательные вещества включают мурамил-пептиды, такие как N-ацетил-мурамил-L-треонил-D-изоглутамин (thr-MDP), N-ацетил-нормурамил-L-аланин-2-(1'-2'-дипалмитоил-sn-глицеро-3-гидроксифосфорилокси)этиламин (МТР-РЕ); эмульсии масло-в-воде, такие как MF59 (патент США No. 6,299,884) (содержащие 5% сквалена, 0,5% полисорбата 80 и 0,5% Span 85 (необязательно содержащий различные количества МТР-РЕ) сформулированные в виде субмикронных частиц, используя микрофлюидайзер, такой как микрофлюидайзер Model 110Y (Microfluidics, Newton, MA)), и SAF (содержащий 10% сквалена, 0,4% полисорбата 80, 5% плюрониловый блок-сополимер L121, и thr-MDP, или микрофлюидизированный в субмикронную эмульсию или встряхивали, чтобы создать эмульсию с большим размером частиц); неполный адъювант Фрейнда (IFA); соли алюминия (квасцы), такие как гидроксид алюминия, фосфат алюминия, сульфат алюминия; Amphigen; Avridine; 1.121/сквален; D-лактид-полилактид/гликозид; плюрониловые полиолы; ослабленные Bordetella; сапонины, такие как Stimulon™ QS-21 (Antigenics, Framingham, MA.), описанный в патенте США No. 5,057,540, ISCOMATRIX (CSL Limited, Parkville, Australia), описанный в патенте США No. 5,254,339, и иммуностимулирующие комплексы (ISCOMATRIX); Mycobacterium tuberculosis; бактериальные липополисахариды; синтетические полинуклеотиды, такие как олигонуклеотиды, содержащие CpG мотив (например, патент США No. 6,207,646); IC-31 (Intercell AG, Vienna, Austria), описанный в Европейских патентах No. 1,296,713 и No. 1,326,634; коклюшный токсин (РТ) или его мутант, холерный экзотоксин или его мутант (например, патенты США No. 7,285,281, 7,332,174, 7,361,355 и 7,384,640); или термически лабильный токсин Е. coli (LT) или его мутант, а именно LT-K63, LT-R72 (например, патенты США No. 6,149,919, 7,115,730 и 7,291,588).

Способы продуцирования нелипидизированных антигенов Р2086

В одном аспекте изобретение касается способа продуцирования нефункционализированного пировиноградной кислотой, нелипидизированного ORF2086 полипептида. Способ включает экспрессирование нуклеотидной последовательности, кодирующей полипептид ORF2086, в которой N-терминальный цистеин делетирован, по сравнению с соответствующей последовательностью дикого типа, и в которой нуклеотидная последовательность является функционально связанной с экспрессионной системой, которая способна быть экспрессированной в бактериальной клетке. Иллюстративные полипептиды, полученные по способу, включают какой-либо полипептид, описанный в данном документе. Например, предпочтительно, полипептид имеет аминокислотную последовательность, изображенную в SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 21, в которой цистеин в положении 1 делетирован, по сравнению с соответствующий последовательностью дикого типа. Дополнительные иллюстративные полипептиды включают полипептид, имеющий аминокислотные последовательности, последовательности, выбранные из SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 62 и SEQ ID NO: 64. Способ дополнительно включает очистку полипептида.

В некоторых вариантах осуществления изобретение предусматривает способ получения растворимых, нелипидизированных антигенов Р2086, включающий стадии клонирования последовательности нуклеиновой кислоты варианта ORF2086 в векторе экспрессии Е. coli без липидизированной контрольной последовательности, преобразуя бактерии Е. coli вектором экспрессии ORF2086, включая экспрессию и выделение экспрессированного протеина Р2086. В некоторых вариантах осуществления экспрессия является включенной с IPTG.

В некоторых вариантах осуществления кодон для N-терминального Cys варианта ORF2086 делетирован. Примеры таких кодонов включают TGC. В некоторых вариантах осуществления кодон для N-терминального Cys варианта ORF2086 мутирован путем точечного мутагенеза для создания Ala, Gly или Val кодона. В некоторых вариантах осуществления Ser и Gly кодоны добавляют к N-терминальному хвосту варианта ORF2086, чтобы удлинить Gly/Ser стебель непосредственно ниже за N-терминальным Cys. В некоторых вариантах осуществления общее количество Gly и Ser остатков в пределах Gly/Ser стебля составляет, по меньшей мере, 7, 8, 9, 10, 11 или 12. В некоторых вариантах осуществления кодон для N-терминального Cys делетирован. В некоторых вариантах осуществления N-терминальные 7, 8, 9, 10, 11 или 12 остатки являются или Gly, или Ser.

В некоторых вариантах осуществления кодоны N-терминального хвоста нелипидизированного варианта ORF2086 оптимизируют путем точечного мутагенеза. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют для сопряжения N-терминального хвоста варианта В09. В некоторых вариантах осуществления кодоны N-терминального хвоста варианта ORF2086 оптимизируют путем точечного мутагенеза таим образом, что кодон, кодирующий пятую аминокислоту варианта ORF2086 является 100% идентичным к нуклеотидам 13-15 из SEQ ID NO: 8 и кодон, кодирующий тринадцатую аминокислоту варианта ORF2086 является 100% идентичным к нуклеотидам 37-39 из SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 45 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 1-45 из SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 42 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 4-45 из SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта ORF2086 оптимизируют таким образом, что 5' 39 нуклеиновые кислоты являются 100% идентичными нуклеиновым кислотам 4-42 из SEQ ID NO: 8. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта P2086 содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 1-15 из SEQ ID NO: 18. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта P2086 содержит два аминокислотных замещения по сравнению с аминокислотами 1-15 из SEQ ID NO: 18. В некоторых вариантах осуществления, N-терминальный хвост нелипидизированного варианта Р2086 содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 2-15 из SEQ ID NO: 18. В некоторых вариантах осуществления N-терминальный хвост нелипидизированного варианта Р2086 содержит два аминокислотных замещения по сравнению с аминокислотами 2-15 из SEQ ID NO: 18. В некоторых вариантах осуществления аминокислотные замещения являются консервативными аминокислотными замещениями.

В некоторых вариантах осуществления кодоны нелипидизированных вариантов оптимизировали для повышения экспрессии. Оптимизация кодона известна с уровня техники. Смотри, например, Sastalla et al, Applied and Environmental Microbiology, vol. 75(7): 2099-2110 (2009) и Coleman et al, Science, vol. 320: 1784 (2008). В некоторых вариантах осуществления оптимизация кодона включает типирование применяемого кодона аминокислотной последовательности с часто встречающимся кодоном выбранного организма-хозяина, в тоже время, включая и/или исключая конкретные ДНК последовательности. В некоторых вариантах осуществления оптимизация кодона дополнительно включает минимизацию соответствующей вторичной мРНК структуре, чтобы уменьшить помехи трансляции. В некоторых вариантах осуществления N-терминальный хвост был кодон-оптимизированным, для того чтобы включать какую-либо одну из SEQ ID NO: 28, 30, 32 и 34. В некоторых вариантах осуществления Gly/Ser стебель был кодон-оптимизированным, для того чтобы включать какую-либо одну из SEQ ID NO: 28, 30, 32 и 34.

Для того, чтобы данное изобретение могло быть понято лучше, представлены следующие примеры. Примеры представлены только с целью иллюстрации и не должны толковаться как ограничение объема изобретения.

Составы иммуногенной композиции

В конкретных вариантах осуществления иммуногенные композиции изобретения дополнительно содержат, по меньшей мере, одно из вспомогательных веществ, буфера, криопротектора, соли, двухвалентного катиона, неионного детергента, ингибитора окисления свободных радикалов, разбавителя или носителя.

Иммуногенные композиции изобретения могут дополнительно содержать один или больше консервантов в дополнение к некоторому количеству антигенов менингококкового протеина и капсульным полисахарид-протеиновым конъюгатам. FDA требует, чтобы биологические продукты во флаконах с многократной дозой (мульти-дозой) содержат консервант, только с некоторыми исключениями. Вакцинные продукты, содержащие консерванты, включают вакцины, содержащие бензетония хлорид (антракс), 2-феноксиэтанол (DTaP, HepA, Lyme, Polio (парентеральные)), фенол (пневмо, тифозный (парентеральный), вакцина) и тимеросал (DTaP, DT, Td, HepB, Hib, грипп, JE, менинго, пневмо, бешенство). Консерванты, одобренные для использования в инъекционных лекарственных средствах, включают, например, хлорбутанол, м-крезол, метилпарабен, пропилпарабен, 2-феноксиэтанол, бензетония хлорид, бензалконий хлорид, бензойную кислоту, бензиловый спирт, фенол, тимеросал и фенилмеркуронитрат.

Составы изобретения, кроме того, могут включать один или больше буфер, соль, двухвалентный катион, неионный детергент, кроипротектор, такой как сахар, и антиоксидант, такой как поглотитель свободных радикалов или хелатирующий агент, или какая-либо различная их комбинация. Выбор какого-либо одного компонента, например, комплексона, может определить, в любом случае, другой необходимый компонент (например, поглотитель). Конечная композиция, сформулированная для введения, должна быть стерильной и/или свободной от пирогенов. Квалифицированный специалист может эмпирически определить, какие комбинации этих или других компонентов будут оптимальными для включения в иммуногенные композиции изобретения, содержащие консервант, в зависимости от множества факторов, таких как особенности хранения и необходимые условия введения.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает один или более физиологически приемлемых буферов, выбранных из, но ограничивающийся этим, Трис (триметамина), фосфата, ацетата, бората, цитрата, глицина, гистидина и сукцината. В конкретных вариантах осуществления препарат является буферизированным с точностью до диапазона рН от около 6,0 до около 9,0, предпочтительно от около 6,4 до около 7,4.

В конкретных вариантах осуществления может быть необходимость регулировать рН иммуногенной композиции или препарата изобретения. рН препарата изобретения могут регулировать, используя стандартные методики из уровня техники. рН препарата могут регулировать так, чтобы он находился между 3,0 и 8,0. В конкретных вариантах осуществления рН препарата может составлять, или может регулироваться так, чтобы находился между 3,0 и 6,0, 4,0 и 6,0, или 5,0 и 8,0. В другом варианте осуществления рН препарата может составлять, или может регулироваться так, чтобы составлял около 3,0, около 3,5, около 4,0, около 4,5, около 5,0, около 5,5, около 5,8, около 6,0, около 6,5, около 7,0, около 7,5 или около 8,0. В конкретных вариантах осуществления рН может составлять, или может регулироваться так, чтобы находился в диапазоне от 4,5 до 7,5, или от 4,5 до 6,5, от 5,0 до 5,4, от 5,4 до 5,5, от 5,5 до 5,6, от 5,6 до 5,7, от 5,7 до 5,8, от 5,8 до 5,9, от 5,9 до 6,0, от 6,0 до 6,1, от 6,1 до 6,2, от 6,2 до 6,3, от 6,3 до 6,5, от 6,5 до 7,0, от 7,0 до 7,5 или от 7,5 до 8,0. В конкретном варианте осуществления рН препарата составляет около 5,8.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает один или больше двувалентных катионов, в том числе, но, не ограничиваясь этим, MgCl2, CaCl2 и MnCl2, в диапазоне концентраций от около 0,1 мМ до около 10 мМ, предпочтительным является, аж до около 5 мМ.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает одну или больше солей, в том числе, но не ограничиваясь этим, хлорид натрия, хлорид калия, сульфат натрия и сульфат калия, присутствуют с ионной силой, которая является физиологически приемлемой для субъекта при парентеральном введении, и включены с конечной концентрацией, чтобы получить конечный препарат с выбранной ионной силой или осмолярностью. Конечная ионная сила или осмолярность препарата будут определяться многочисленными компонентами (например, ионами с буферного(ых) соединения(ий) и других небуферных солей). Предпочтительная соль, NaCl, присутствует в диапазоне аж до около 250 мМ, с концентрациями солей, которые выбирают по совокупности других компонентов (например, сахаров), таким образом, что конечная общая осмолярность препарата является совместимой с парентеральным введением (например, внутримышечными или подкожными инъекциями) и будут способствовать долгосрочному периоду стабильности иммуногенных компонентов препарата иммуногенной композиции при различных диапазонах температур. Бессолевые препараты будут допускать повышенные диапазоны одного или больше из выбранных криопротекторов, чтобы сохранить необходимые конечные уровни осмолярности.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает один или больше криопротекторов, выбранных из, но, не ограничивающийся этим, дисахаридов (например, лактозы, мальтозы, сахарозы или трегалозы) и полигидрокси углеводородов (например, дульцита, глицерина, маннита и сорбита).

В конкретных вариантах осуществления осмолярность препарата находится в диапазоне от около 200 мОсм/л до около 800 мОсм/л, с предпочтительным диапазоном от около 250 мОсм/л до около 500 мОсм/л, или около 300 мОсм/л - около 400 мОсм/л. Бессолевые препараты могут содержать, например, от около 5% до около 25% сахарозы, и, предпочтительно, от около 7% до около 15%, или от около 10% до около 12% сахарозы. Альтернативно, бессолевой препарат могут содержать, например, от около 3% до около 12% сорбита, и, предпочтительно, от около 4% до 7%, или от около 5% до около 6% сорбита. Если добавляют соль, такую как хлорид натрия, тогда эффективный диапазон сахарозы или сорбита относительно понижается. Эти и другие такие рассуждения об осмоляльности и осмолярности хорошо известны квалифицированному специалисту с уровня техники.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает один или больше ингибиторов окисления свободных радикалов и/или хелатирующих агентов. Многообразие поглотителей свободных радикалов и комплексонов известно с уровня техники и применяют для препаратов и способов использования, описанных в данном документе. Примеры включают, но не ограничиваются этим, этанол, ЭДТА, комбинация ЭДТА/этанол, триэтаноламин, маннит, гистидин, глицерин, цитрат натрия, гексафосфат инозитола, триполифосфат, аскорбиновую кислоту/аскорбат, янтарную кислоту/сукцинат, яблочную кислоту/малеат, десферал, этилендиаминдигидроксифенилуксусную кислоту и диэтилентриаминпентауксусная кислота (ДТПА), и различные комбинации из двух или более указанных выше. В конкретных вариантах осуществления, по меньшей мере, один невосстанавливающий поглотитель свободных радикалов может быть добавлен в концентрации, которая эффективно повышает долговременную стабильность препарата. Один или более ингибиторов окисления свободных радикалов/комплексонов, кроме того, могут быть добавлены в различных комбинациях, таких как поглотитель и двухвалентный катион. Выбор комплексона будет определять, действительно ли добавление поглотителя необходимо.

В конкретных вариантах осуществления препарат изобретения, который является совместимым с парентеральным введением, включает один или больше неионных поверхностно-активных веществ, включая, но не ограничиваясь этим, сложные эфиры жирных кислот и полиоксиэтиленсорбитана, полисорбат-80 (Твин 80), полисорбат-60 (Твин 60), полисорбат-40 (Твин 40) и полисорбат-20 (Твин 20), полиоксиэтиленалкиловые эфиры, включая, но не ограничиваясь этим, Бридж 58, Бридж 35, а также другие, такие как Triton Х-100; Triton Х-114, NP40, Span 85 и плюрониловые серии неионных поверхностно-активных веществ (например, Pluronic 121), с предпочтительными компонентами полисорбат-80 в концентрации от около 0,001% до около 2% (предпочтительным будет вплоть до около 0,25%) или полисорбат-40 в концентрации от около 0,001% до 1% (предпочтительным будет вплоть до около 0,5%).

В конкретных вариантах осуществления препарат изобретения содержит один или больше дополнительных стабилизирующих агентов подходящих для парентерального введения, например, восстанавливающий агент, содержащий, по меньшей мере, одну тиольную (-SH) группу (например, цистеин, N-ацетилцистеин, восстановленный глутатион, тиогликолят натрия, тиосульфат, монотиоглицерин или их смесь). Альтернативно или необязательно, составы иммуногенной композиции изобретения, содержащие консерванты, кроме того, могут быть стабилизированы путем удаления кислорода из контейнеров для хранения, защиты препарата от света (например, путем использования контейнеров из янтарного стекла).

Составы иммуногенной композиции изобретения, содержащие консерванты, могут содержать один или больше фармацевтически приемлемых носителей или наполнителей, которые включают какой-либо наполнитель, который сам по себе не инициирует иммунный ответ. Подходящие наполнители включают, но не ограничиваются этим, макромолекулы, такие как протеины, сахариды, полимолочные кислоты, полигликолевые кислоты, полимерные аминокислоты, аминокислотные сополимеры, сахарозы (Paoletti et al, 2001, Vaccine, 19:2118), трегаллозу, лактозу и липидные агрегата (такие как масляные капли или липосомы). Такие носители хорошо известны квалифицированному специалисту с уровня техники. Фармацевтически приемлемые наполнители обсуждаются, например, в Gennaro, 2000, Remington: The Science and Practice of Pharmacy, 20th edition, ISBN:0683306472.

Композиции изобретения могут быть лиофилизированы или в форме водных составов, то есть растворов или суспензий. Жидкие препараты, преимущественно, могут вводить непосредственно из их упакованных форм, и, таким образом, являются идеальными для инъекции без необходимости восстановления в водной среде, как в другом случае, это требуется для лиофилизированных композиций изобретения.

Непосредственная доставка иммуногенных композиций представленного изобретения субъекту может быть выполнена путем парентерального введения (внутримышечно, внутрибрюшинно, внутрикожно, подкожно, внутривенно, или во внутрипоровое пространство ткани); или путем ректального, перорального, вагинального, местного, трансдермального, интрагазального, глазного, ушного, легочного или через другие слизистые оболочки введения. В предпочтительном варианте осуществления парентеральное введение осуществляют путем внутримышечной инъекции, например, в бедро или верхнюю часть руки субъекта. Инъекцию могут делать с помощью иголки (например, иголки для подкожной инъекции), но, альтернативно, могут использовать инъекцию без иголки. Обычная внутримышечная доза составляет 0,5 мл. Композиции изобретения могут быть приготовлены в различных формах, например, для инъекции или как жидкие растворы, или суспензии. В конкретных вариантах осуществления композиция может быть приготовлена как порошок или аэрозоль для легочного введения, например, в ингаляторе. В других вариантах осуществления композиция может быть приготовлена как суппозиторий или пессарий, или для назального, ушного или глазного введения, например, как аэрозоль, капли, гель или порошок.

Оптимальные количества компонентов для конкретной иммуногенной композиции могут быть установлены путем стандартных исследований, включающих наблюдение соответствующих иммунных ответов у субъектов. Следующую начальную вакцинацию субъекты могут получить одной или несколькими повторными иммунизациями, разнесенными в достаточном временном периоде.

Упаковка и дозированные формы

Иммуногенные композиции изобретение могут быть упакованы в виде единичной дозированной или многократной дозированной формы (например, 2 дозы, 4 дозы или больше). Для многократно дозированных форм, флаконы являются обычными, однако нет необходимости отдавать предпочтение большее, чем предварительно наполненным шприцам. Подходящие многократно дозированные форматы включают, но не ограничиваются этим: от 2 до 10 доз на контейнер при этом от 0,1 до 2 мл на дозу. В конкретных вариантах осуществления доза представляет собой 0,5 мл дозы. Смотри, например, международную заявку на патент WO2007/127668, которая включена в виде ссылки в данный документ.

Композиции может находиться в флаконах или других подходящих для хранения контейнеров, или может находиться в предварительно наполненных устройствах доставки, например, единичные или многокомпонентные шприцы, которые могут быть доставлены с или без иголок. Единичная, как правило, но в этом нет необходимости, содержит единичную дозу иммуногенной композиции изобретения, содержащую консервант, несмотря на то, что многократная доза, представляется предварительно наполненными шприцами. Подобным образом, флакон может содержать единичную дозу, но могут альтернативно содержать многократные дозы.

Объемы эффективной дозы могут быть установлены в обычном порядке, но обычная доза композиции для инъекции имеет объем 0,5 мл. В конкретных вариантах осуществления дозу формулируют для введения субъекту-человеку. В конкретных вариантах осуществления дозу формулируют для введения взрослому, подростку, молодому, ребенку или младенцу (то есть, не старше, чем годовалый ребенок) субъекту человеку и в предпочтительных вариантах осуществления может быть введена путем инъекции.

Жидкие иммуногенные композиции изобретения, кроме того, являются подходящими для восстановления других иммуногенных композиций, которые находятся в лиофилизированной форме. В случае, когда иммуногенная композиция является такой, чтобы быть использованной для таких приготовленных для немедленного приема восстановлений, изобретение предусматривает набор из двух или более флаконов, двух или более готовых наполненных шприцов, или один или более из каждого набора, с содержимым шприца, которое используется для восстановления содержимого другого флакона перед инъекцией, или наоборот.

Альтернативно, иммуногенные композиции представленного изобретения могут быть лиофилизированными и восстановленными, например, используя один из множества способов сушки при заморозке, хорошо известных с уровня техники, чтобы получить сухие, правильные, имеющие определенную форму (например, сферическую) частицы, такие как микропеллеты или микросферы, характеристики имеющихся частиц, такие как средние размеры диаметра, которые могут быть выбраны и проконтролированы с помощью варьирования точными способами, использованными, чтобы их получить. Иммуногенные композиции могут дополнительно содержать вспомогательное вещество, которое необязательно может быть получено с или содержаться в виде отдельных, сухих, правильной формы (например, сферической) частиц, таких как микропеллеты или микросферы. В таких вариантах осуществления представленное изобретение, кроме того, предусматривает набор иммуногенной композиции, содержащий первый компонент, который включает стабилизированную, сухую иммуногенную композицию, необязательно дополнительно содержащий один или больше консервантов изобретения, и второй компонент, содержащий стерильный, водный раствор для восстановления первого компонента. В конкретных вариантах осуществления водный раствор содержит один или больше консервантов, и может, необязательно, содержать, по меньшей мере, одно вспомогательное вещество (смотри, например, WO2009/109550 (включенный в данный документ в виде ссылки)).

В еще другом варианте осуществления контейнер для многократно дозированного формата выбирают из одной или больше групп, состоящих из, но неограничивающихся этим, общей лабораторной стеклянной посуды, колб, лабораторных стаканов, мерных цилиндров, ферментаторов, биореакторов, трубок, пипеток, сумок, банок, флаконов, крышек для флаконов (например, резиновых пробок, закручивающихся крышек), ампул, шприцов, двойных или многокамерных шприцов, заглушки для шприцов, плунжеры для шприцов, резиновых крышек, пластиковых крышек, стеклянных крышек, картриджей и однораховых перьев и тому подобное. Контейнеры представленного изобретения выполнены, без ограничения, из материалов производства и включают материалы, такие как стекло, металлы (например, сталь, нержавеющая сталь, алюминий, т.д.) и полимеры (например, термоплстмасса, эластомеры, термопластические эластомеры). В конкретном варианте осуществления контейнер формата представляет собой 5 мл стеклянный флакон Schott Туре 1 с бутиловой крышкой. Квалифицированный специалист оценит, что формат, представленный выше, не является единственно возможным полным списком, однако единственно служит руководством специалисту относительно выбора форматов, имеющихся в наличии, для представленного изобретения. Дополнительные форматы, рассматриваемые для использования в представленном изобретении, могут быть найдены в опубликованном каталоге от продавцов и производителей лабораторного оборудования, такого как United States Plastic Corp.(Lima, OH), VWR.

ПРИМЕРЫ

Пример 1: Экспериментальные методики

Сывороточный бактерицидный анализ

Макак-крабоедов (n=5/группа) иммунизировали внутримышечно протеинами rLP2086 или rP2086 (А+В), адсорбированными на AlPO4. Макаки-крабоеды являются представителями не человекообразных приматов. Животных вакцинировали на 0, 4 и 24 неделях, и определяли титры ORF2086-специфического IgG и функционального антитела на 0, 4, 6 и 26 неделе. Титры сывороточного ORF2086-специфического IgG определяли к rLP2086A и В.

Титры функциональных антител были исследованы с помощью сывороточного бактерициднного анализа (SBA) к штаммам Neisseria meningitides, экспрессирующим LP2086 с последовательностями либо гомологичными, либо гетерологичными к тем, которые содержатся в вакцине.

Сывороточные бактерицидные антитела у макак или кроликов, иммунизированных вакциной ORF2086, определяли с помощью СРК с человеческим дополнением. Иммунные сыворотки кролика или иммунные сыворотки макаки были инактивированны нагреванием для удаления внутренней комплементарной активности и последовательно серийно разбавляли 1:2 в фосфатно-солевом буфере (PBS) Дульбекко с Са2+и Mg2+(D-PBS) в 96-луночном микротитровальном планшете для тестирования на сывороточную бактерицидную активность по отношению к штаммам N. meningitidis. Бактерии, используемые в анализе, были выращены в GC средах, дополненных добавкой Келлогга (GCK) и контролировались по оптической плотности при 650 нм. Бактерии собирали для использования в анализе при заключительной OD650 0,50-0,55, разбавляли в D-PBS и 1000-3000 КОЕ были добавлены в анализируемой смеси с 20% комплементом человека.

Недетектируемую на бактерицидную активность сыворотку крови человека использовали в качестве экзогенного источника комплемента. Источники комплемента были проверены на пригодность по отношению к каждому конкретному анализируемому штамму. Источник комплемента был использован только тогда, когда число выживших бактерий в контролях без добавления иммунных сывороток составлял > 75%. Десять уникальных источников комплемента были необходимы для выполнения SBA, описанных в данном исследовании.

Через 30 минут инкубации при 37°C с 5% CO2, к реакционной смеси добавляли D-PBS и аликвоты переносили в планшеты для микрофильтрации, наполенные 50% GCK средами. Планшеты для микрофильтрации фильтровали, инкубировали на протяжении ночи при 37°C 5% CO2, и микроколонии подкрашивали и подсчитывали. Сывороточные бактерицидные тиры определяли как интерполированное обратное сывороточное разбавление, которое дает 50% снижение КОЕ по сравнению с КОЕ в контрольных лунках без иммунных сывороток. Титр SBA определяют как обратную величину интерполированному разбавлению, которое вызывает 50% уменьшение количества бактерий после 30 минутной инкубации при 37°C. Восприимчивость к уничтожению с помощью иммунных сывороток ORF2086 была установлена в случае существования 4-кратного и более увеличения титра SBA для иммунных сывороток ORF2086 по сравнению с соответствующими до-иммунными сыворотками. Сыворотки, которые были негативными по отношению к анализируемому штамму при начальном разбавлении, были предназначены титру с половиной предела обнаружения для анализа (например, 4).

Пример 2: Клонирование и экспрессия нелипидизированных вариантов ORF2086

Аминокислотная последовательность зрелого Р2086, соответствующая остаткам 27-286 из N. meningitidis штамма М98250771 (А05), первоначально была получена из PCR амплификации из геномной ДНК. Прямой праймер с последовательностью из TGCCATATGAGCAGCGGAAGCGGAAG (SEQ ID NO: 22), ренатурировал до 5' последовательности и включал Ndel сайт для клонирования. Обратный праймер, с последовательностью из CGGATCCCTACTGTTTGCCGGCGATGC (SEQ ID NO: 23), ренатурировал до 3' конца гена и включал терминирующий кодон TAG с последующей рестрикцией сайта BamHI. 799 bp амплифицированный фрагмент сначала клонировали до вспомогательного вектора PCR2.1 (Invitrogen, Carlesbac, CA). Данную плазмиду расщепляли с Ndel и BamHI, и лигировали в вектор экспрессии рЕТ9а (Novagen, Madison, WI), который расщепили с Ndel и BamHI. Полученный в результате вектор pLA100 (который включает SEQ ID NO: 54), экспрессирован зрелым Р2086 подсемейства А05 из штамма М98250771 без N-терминального цистеина (смотри SEQ ID NO: 13, где N-терминальный Cys в положении 1 делетирован или SEQ ID NO: 55), который должен присутствовать в липидизированном протеине. BLR(DE3) Е. coli штамм хозяина [F- ompT hsdSB(rB-mB-) gal dcm Δ(srl-recA)306::Tn10 (TetR) (DE3)] (Novagen) использовали, чтобы получить экспрессию fHBP.

Такие же стадии клонирования использовали, чтобы получить В02, В03, В09, В22, В24, В44, А04, А12 и А22 N-терминальный Cys-делетированные варианты. N-терминальные Cys-содержащие варианты также были получены с помощью таких же способов, используя прямые праймеры, которые также включали Cys кодон (например первый кодон из SEQ ID NO: 1-11). Основываясь на последовательностях, предусмотренных в данном документе, квалифицированный специалист будет способен создать прямой и обратный праймеры для каждого из данных вариантов. Например, следующие праймеры были использованы, чтобы амплифицировать нелипидизированный вариант В44, с последующим клонированием в рЕТ9а, используя Ndel и BIpI.

Таблица 1
N-терминальный Cys Праймер последовательности SEQ ID NO
Включенный - Fwd 5' TTTCTT cccgggAAGGAGatatacatatg TGCAGCAGCGGAGGCGGCGG 3' 24
Включенный - Rev 5' TTTCTTIgctcagca TTATTGC TTGGCGGCAAGACCGAT 3' 25
Делетированный - Fwd 5' TTTCTT cccgggAAGGAGatatacatatg AGCAGCGGAGGCGGCGG 3' 26
Делетированный - Rev 5' TTTCTT gctcagca TTATTGC TTGGCGGCAAGACCGAT 3' 27

Результаты

Конструкты нелипидизированной плазмиды были сильно экспрессированы, а варианты нелипидизированного протеина были функционализированы пировиноградной кислотой на N-терминальном Cys остатке. Смотри примеры 8 и 9, которые описывают, например, способ экспрессирования конструктов. Для того чтобы преодолеть данное пирувилирование, N-терминальный Cys кодон делетировали. Смотри, например, пример 10. Делеция N-терминального Cys, однако, аннулировала экспрессию вариантов А22 и В22. Смотри, например, фигуру 4. Варианты А05, В01 и В44, тем не менее, до сих пор были экспрессированы, несмотря на делецию N-терминального Cys остатка. Смотри, например, SEQ ID NO: 13 (А05), в которой N-терминальный Cys в положении 1 делетирован, SEQ ID NO: 35 (В01 N-конец), и SEQ ID NO: 21(B44), в которой N-терминальный Cys в положении 1 делетирован. Смотри, например, фигуру 5. Кроме того, экспрессия нелипидизированного варианта В09 не оказался под влиянием делеции N-терминального Cys остатка. Смотри, например, пример 4.

Пример 3: Влияние Gly/Ser стебля на экспрессию нелипидизированного варианта

Чтобы определить, почему варианты А05, В01 и В44 были экспрессированны в отсутствие N-терминального Cys, а варианты А22 и В22 не были, последовательности данных вариантов были выровненные. Варианты А05, В01 и В44 все обладают расширенными сериями 10 или 11 Gly и Ser остатков непосредственно следующими за N-терминальным Cys (то есть Gly/Ser стебель). Варианты А22 и В22, тем не менее, имели только Gly/Ser стебель, состоящий из 6 Gly и Ser остатков. Соответственно, Gly/Ser стебель вариантов А22 и В22 был увеличен путем введения дополнительных Gly и Ser остатков.

Варианты длинного Gly/Ser стебля были получены с помощью способов, описанных в примере 2 используя прямые праймеры, которые кодируют Gly/Ser стебель с или 10, или 11 Gly и Ser остатками.

N-терминальные Cys - делетированные с длинным Gly/Ser стеблем (10-11 Gly/Ser остатки) варианты А22 и В22 показали повышение экспрессии по сравнению с N-терминальными Cys - делетированными А22 и В22 с коротким Gly/Ser стеблем (6 Gly/Ser остатков) вариантами. Данные уровни экспрессии, однако, были все же снижены по сравнению с уровнями экспрессии вариантов А05, В01 и В44.

Пример 4: Оптимизация кодона

Экспрессия нелипидизированного варианта В09 не была подвержена делеции N-терминального Cys остатка (смотри SEQ ID NO: 18, где цистеин в положении 1 делетирован, или SEQ ID NO: 49). Смотри, например, фигуру 6. Определение последовательности варианта В09 продемонстрировало, что вариант В09 имеет Gly/Ser стебель, состоящий из 6 Gly и Ser остатков, подобных к Gly/Ser стеблю вариантов А22 и В22. Более того, N-терминальные хвосты вариантов В09 и А22 являются идентичными аминокислотному уровню. N-терминальные хвосты вариантов В09 и А22 (SEQ ID NO: 53 и 42, соответственно), однако, отличаются уровнем нуклеиновой кислоты на 2 нуклеиновых кислоты: нуклеиновые кислоты 15 и 39 из SEQ ID NO: 8. Смотри, например, фигуру 6. Первые 14 аминокислот N-терминального хвоста варианта В22 являются идентичными вариантам В09 и А22, и N-терминальный хвост варианта В22 отличается только на 15-тую аминокислоту. Нуклеиновые кислоты 1-42 варианта В22 являются идентичными нуклеиновым кислотам 1-42 варианта А22. Нуклеиновые кислоты 1-42 варианта В22 (смотри SEQ ID NO: 52) являются идентичными нуклеиновым кислотам 1-42 из В09 (смотри SEQ ID NO: 53), за исключением разниц в нуклеиновых кислотах 15 и 39, в случае, когда они оптимально выровнены. Соответственно, вариант В22 отличается от варианта В09 в аминокислотах 15 и 39 из SEQ ID NO: 8. Данное последнее предложение содержит топографическую ошибку и следует констатировать, что вариант В22 отличается от варианта В09 в нуклеиновых кислотах 15 и 39 из SEQ ID NO: 8.

Чтобы определить, случаи, когда разницы нуклеиновых кислот, находящихся под влиянием уровня экспрессии варианта В09 по сравнению с вариантами А22 и В22, варианты А22 и В22 были мутированы путем точечной мутации, чтобы включить нуклеиновые кислоты 15 и 39 в соответствующие кодоны для Gly5 и Gly13. Внедрение данных скрытых мутаций нуклеиновой кислоты значительно повышали экспрессию N-терминальных Cys - делетированных вариантов А22 и В22 до уровней подобных к N-терминальному Cys - делетированному варианту В09. Смотри, например, фигуру 7. Соответственно, оптимизация кодона, чтобы совместить вариант В09, может повысить экспрессию N-терминальных Cys - делетированных нелипидизированных вариантов Р2086.

Дополнительное исследование последовательностей нелипидизированного варианта предполагало дополнительные оптимизации кодона в Gly/Ser стебле, чтобы улучшить экспрессию. Соответственно, дополнительные нелипидизированные варианты были сконструированы, с помощью способа из примера 2, используя прямые праймеры, содержащие такой кодон, оптимизированный последовательностями. Прямые праймеры, использованные для создания оптимизированных Gly/Ser стеблей, включают какую-либо из следующих последовательностей:

Пример 5: Оптимизация препарата иммуногенной композиции

ISCOMATRIX сформулированные вакцины создают быстрый иммунный ответ, приводящий в результате к понижению количества доз, требуемых для достижения больше, чем 4-кратного уровня ответа, как измерено в сывороточном бактерицидном анализе. Группы из пяти макак-резус были иммунизированы различными препаратами бивалентной нелипидизированной вакцины rP2086. Вакцина включала не функционализированный пировиноградной кислотой, нелипидизированный вариант А05 (SEQ ID NO: 13, в которой N-терминальный Cys в положении 1 делетирован, или SEQ ID NO: 55, кодируемой SEQ ID NO:54) и не функционализированный пировиноградной кислотой, нелипидизированный вариант В44 (SEQ ID NO: 21, в которой N-терминальный Cys в положении 1 делетирован, или SEQ ID NO: 44, кодируемой SEQ ID NO: 51). Единицы вспомогательного вещества представляют собой следующие: AlPO4 составляет 250 мкг, ISCOMATRIX составляет от 10 до 100 мкг. Единицы вспомогательного вещества для AlPO4, показанные в таблицах 2-5 представлены как единицы- миллиграммы, и представлены, вследствие этого, как 0,25 (миллиграмм) в противоположность от 250 мкг.

График иммунизации составлял 0, 4 и 24 недели с забором крови на 0, 4, 6 и 26 неделях. Повышение титров SBA не происходило после дозы одного для какой-либо из групп. После второй дозы наблюдалось повышение титров SBA и число ответов, которое определено путем 4-кратного повышения титра SBA над базовой линией для препаратов, содержащих ISCOMATRIX вспомогательное вещество. Таблицы 2 и 3 предоставляют SBA GMT, наблюдаемые для fHBP штаммов подсемейства А и В, соответственно. SBA GMT для ISCOMATRIX препаратов составляли в 3-19 и 4 - 2 4 раза выше, чем те, что наблюдали для состава AlPO4 для штаммов подсемейства А и В, соответственно. Кроме того, повешенные титры наблюдались после третей дозы для ISCOMATRIX препаратов в 13-95 и 2-10 для штаммов fHBP подсемейства А и В, соответственно, по сравнению с препаратом AlPO4. Анализ уровней клеток-ответчиков, как определялось, обнаружил около четырех кратного или больше повышения титра SBA над базовой линией с подобной тенденцией (Таблицы 4 и 5).

Таблица 2:
Титры SBA (GMT), полученные к штамму MnB LP2086 подсемейства A для иммунной сыворотки от макак-резуса, иммунизированных различными препаратами бивалентной вакцины rP2086
Вспомогательное вещество Среднее геометрическое значение титра (GMT)
вакцина липидирование AlPO4 ISCOMATRIX® 0 неделя 4 неделя 6 неделя 26 неделя
0,25 - - - - +
- 10 - - + +++
А05/В44 - 0,25 10 - - + ++
- 100 - - ++ ++++
0,25 100 - - + +++
Пять обезьян на группу; График иммунизации: 0, 4, 24 недели; график забора крови 0, 4, 6 и 26 недель. SBA анализ штамма MnB М98 250771. "-"<8; "+" 8-32; "++" 33-128; "+++" 129-512; "++++">512
Таблица 3:
Титры SBA (GMT), полученные к штамму MnB LP2086 подсемейства В для иммунной сыворотки от макак-резуса, иммунизированных различными препаратами бивалентной вакцины eP2086
Вспомогательное вещество Среднее геометрическое значение титра (GMT)
вакцина липидирование AlPO4 ISCOMATRIX® 0 неделя 4 неделя 6 неделя 26 неделя
0,25 - - - + +++
- 10 - - +++ ++++
А05/В44 _ 0,25 10 _ +++ ++++
_ 100 - - +++ ++++
0,25 100 - - ++ ++++
Пять обезьян на группу; График иммунизации: 0, 4, 24 недели; график забора крови 0, 4, 6 и 26 недель. SBA анализ штамма MnB М98 250771. «-«<8;» +» 8-32; «++» 33-128; «+++» 129-512; «++++»>512
Таблица 4:
Количество макак-резус с ≥ 4 кратным повышением в SBA титре, используя MnB штамм LP2086 подсемейства А
Вспомогательное вещество No. клетки-респондера b
вакцина липидирование AlPO4 COMATRIX® 0 неделя 4 неделя 6 неделя 26 неделя
0,25 - 0 0 0 2
- 10 0 0 3 5
А05/В44 - 0,25 10 0 0 2 5
- 100 0 0 4 5
0.25 100 0 0 2 5
Таблица 5:
Количество макак-резус с ≥ 4 кратным повышением в SBA титре, используя MnB штамм LP2086 подсемейства B
Вспомогательное вещество No. клетки- респондера b
вакцина липидирование AlPO4 COMATRIX® 0 неделя 4 неделя 6 неделя 26 неделя
0,25 - 0 0 0 2
- 10 0 0 3 5
А05/В44 - 0,25 10 0 0 2 5
- 100 0 0 4 5

Пример 6: Иммунозащита, данная липидизированным и нелипидизированным вариантом

Рекомбинантно экспрессированный нелипидизированный вариант Р2086 (В44) индуцирует широкую защиту, как измерено путем SBA к штаммам, которые представляют собой отличные от последовательностей вариантов fHBP (от около 85% до около < 92% ID) LP2086. Данные уровни ответов получены для нелипидизированной вакцины, сформулированной с AlPO4. Смотри таблицу 6, которая показывает уровни ответов SBA к подсемейству В штамма fHBP MnB, созданные бивалентной fHBP вакциной. Нелипидизированная вакцина (представленная через а "-" в колонке "липидизация"), содержала 1 мкг на протеин не функционализированного пировиноградной кислотой, нелипидизированного варианта А05 (SEQ ID NO: 13, в которой N-терминальный Cys в положении 1 делетирован) и не функционализированного пировиноградной кислотой, нелипидизированного варианта В44 (SEQ ID NO: 21, в которой N-терминальный Cys в положении 1 делетирован).

Альтернативно, рекомбинантно экспрессированный нелипидизированный вариант Р2086 (В44) индуцирует больше иммунных ответов, как измерено с помощью титра SBA, чем липидизированный вариант (В01), к штаммам, несущим подобные (>92% ID) и отличные (<92% ID) LP2086 последовательности. Более высокие уровни ответа (как определено по четырехкратному повышению или больше титров SBA над базовой линией) наблюдались для вакцины, содержащей нелипидизированный rP2086 В44 по сравнению с липидизированной вакциной rLP2086 В01 (Таблица 6).

В соответствии с таблицей 6, нелипидизированный В44 является предпочтительным компонентом подсемейства В из fHBP в композиции для обеспечения широких границ действия к (например, вызывание бактерицидных антител к) множественных штаммов варианта LP2086.

Неожиданно изобретатили заметили, что чрезвычайно маловероятно, что штаммы варианта LP2086 В09 имеют положительные уровни SBA ответа по отношению к гетерологичным (не-В09) ORF2086 полипептидам. ВУ частности, изобретатели обнаружили, что LP2086 В09 является исключением в показателях анализа штамма, к которым А05/В44 иммуногенная композиция, описанная в в таблице 6, вызывала бактерицидные антитела. Вследствие этого, в предпочтительном варианте осуществления иммуногенная композиция изобретения включает полипептид В09, в частности в контексте композиции, содержащей более, чем один полипептид ORF2086 подсемейства В. В предпочтительном варианте осуществления иммуногенная композиция, которая включает нелипидизированный В44, кроме того, может включать нелипидизированный полипептид В09.

Таблица 6:
Уровни ответа SBA к подсемейству B штаммов fHBP MnB, созданные бивалентными вакцинами ми fHBP Иммунная сыворотка от макаки-резуса.
Вспомогательн ое вещество Вариант LP2086 анализа штамма вакцина липидирование % ID к подходящему подсемейству для компонента нелипидизированнок вакцины % клетки-респондеры PD3 26 неделя
В02 А05/В01 + 80
99,6
А05/В44 - 100
AlPO4 B03 А05/В01 + 50
0.25 мг 86,7
А05/В44 - 80
В09 А05/В01 + 0
86,3
A05/R44 - 0
В15 А05/В01 + 25
86,7
А05/В44 - 80
В16 А05/В01 + 0
87,1
А05/В44 - 50
В16 А05/В01 + 0
87,1
А05/В44 - 60
В24 А05/В01 + 0
87,1
A05/B44 - 60
В44 А05/В01 + 100
100
А05/В44 - 100
ISCOMATRIX® (10 мкг) А05 А05/В44 - 100 100
ISCOMATRIX® (100 мкг) А05 А05/В44 - 100 100
ISCOMATRIX® (10 мкг) А22 А05/В44 - 88,9 80
ISCOMATRIX® (100 мкг) А22 А05/В44 88,9 100
Пять обезьян в группе; График иммунизации: 0, 4, 24 недели; график забора крови 0, 4, 6 и 26 недели.

Пример 7: Оптимизация кодона вариантов В44 и В09

Хотя уровни экспрессии, достигнутые в предыдущих примерах, были соответствующими для многих применений, дальнейшая оптимизация была желательной, и конструкты экспрессии Е. coli, включающие дополнительную оптимизацию кодона посредством полной длины протеина, были получены и исследованы. Обнаружено, что одна такая улучшенная последовательность для экспрессии без-Cys В44 протеина представляет собой последовательность нуклеиновой кислоты, изображенной в SEQ ID NO: 43. Как показано в примере 9, конструкт экспрессии, содержащий SEQ ID NO: 43, показал повышенную экспрессию по сравнению с неоптимизированной последовательностью дикого типа.

Экспрессия N-терминального Cys делетированного протеина В09 была улучшена путем применения изменений кодона из выше оптимизированного конструкта В44 (SEQ ID NO: 43) до В09 (SEQ ID NO: 48). Для создания оптимизированных последовательностей В09, В44 оптимизированная ДНК последовательность (SEQ ID NO: 43) сначала выровняли до ДНК последовательности аллельного В09 (SEQ ID NO: 48). Полная нелипидизированная кодирующая последовательность В09 аллеля (SEQ ID NO: 48) была оптимизирована, чтобы отражать изменения кодона, видные в оптимизированном аллеле В44 (SEQ ID NO: 43), где аминокислоты между В44 (SEQ ID NO: 44) и В09 (SEQ ID NO: 49) были идентичными. Последовательности кодона в аллеле В09, соответствующие идентичным аминокислотам между аллелем В09 и аллелем В44, были изменены, чтобы отразить кодон, использованный в оптимизированной последовательности В44 (SEQ ID NO: 43). Последовательности кодона для аминокислоты, которая отличается между В09 (SEQ ID NO: 49) и В44 (SEQ ID NO: 44), были изменены в В09 ДНК последовательности.

Дополнительно, нелипидизированная аминокислотная последовательность В44 (SEQ ID NO: 44) содержит две последовательные серин-глицин повторяющиеся последовательности (S-G-G-G-G)(SEQ ID NO: 56) (смотри также аминокислоты от 2 до 6 из SEQ ID NO: 44) на ее N-конце, тогда как аллель В09 содержит только одно повторение серин-глицин на N-конце (смотри аминокислоты от 2 до 6 и аминокислоты от 7 до 11 из SEQ ID NO: 49). Два повторения серин-глицин на N-конце В44 (аминокислоты от 2 до 6 и аминокислоты от 7 до 11 из SEQ ID NO: 44), кроме того, имеют разные применения кодона (смотри нуклеотиды от 4 до 18 и нуклеотиды от 19 до 33 из SEQ ID NO: 43), и разные комбинации оптимизированного В44 повторения серин-глицин (например, или нуклетиды от 4 до 18 из SEQ ID NO: 43, или нуклеотиды от 19 до 33 из SEQ ID NO: 43, или их комбинации) были применены к В09 ДНК послеовательности (SEQ ID NO: 48, например, применены к нуклеотидам от 4 до 18 из SEQ ID NO: 48) с целью исследовать влияние на экспрессию рекомбинантного протеина.

Три различные интерпретации оптимизированного В09 были сконструированы: SEQ ID NO: 45 включает как повторения серин-глицин (GS1 и GS2) (нуклеиновые кислоты от 4 до 33 из SEQ ID NO: 43) от оптимизированного В44, SEQ ID NO: 46 содержит GS1 (нуклеиновые кислоты от 4 до 18 из SEQ ID NO: 43), так и SEQ ID NO: 47 содержит GS2 (нуклеиновые кислоты от 19 до 33 из SEQ ID NO: 43). ДНК для всех из выше оптимизированных последовательностей кодона были химически синтезированы, используя стандартные с уровня техники химические подходы. Получающаяся в результате ДНК была клонирована в соответствующие экспрессии вектора плазмиды и проанализированы на экспрессию в клетках-хозяевах Е. coli, как описано в примерах 8 и 9.

Пример 8: Способы экспрессирования варианта ORF2086, В09

Клетки штамма Е. coli К-12 (производные W3110(CGSC4474) дикого-типа, имеющие делеции в recA, fhuA и araA) были трансформированы плазмидой рЕВО63, которая включает SEQ ID NO: 45, рЕВ064, который включает SEQ ID NO: 46, плазмидой рЕВ065, которая включает SEQ ID NO: 47, или плазмидой pLA134, которая включает SEQ ID NO: 48. Предпочтительные модификации к штамму К-12 являются полезными для ферментационных целей, но не требуют экспрессии протеинов.

Клетки инокулировали в глюкозо-солевой определенной среде. После 8 часов инкубации при 37°C применяли линейное глюкозное обеспечение и продолжали инкубацию в течение дополнительных 3 часов. Изопропил β-D-1-тиогалактопиранозид (IPTG) добавляли к культуре до конечной концентрации 0,1 мМ с последующей инкубацией в течение 12 часов при 37°C. Клетки собирали путем центрифугирования при 16,000 х g в течение 10 минут и лизировали путем добавления Easy-Lyse™ набор для лизирования клеток от Lienco Technologies (St. Louis, МО) и буфера загрузки. Просветленные лизаты анализировали для экспрессии В09 путем кумасси окрашивания SDS-PAGE гелей и/или вестерн-блот анализа с количественным определением с помощью сканирующего денситометра. Результаты сканирующей денситометрии представлены ниже в таблице 7:

Таблица 7:
Данные экспрессии в Е. coli
Протеин Клетка-хозяин Плазмида Процент от общего клеточного протеина через 12 часов после IPTG индукции, как измерено с помощью SDS-PAGE, сканирующей денситометрии
В09 Е. coli К-12 рЕВО63 24%
SEQ ID NO: 45
В09 Е. coli К-12 рЕВ065 12%
SEQ ID NO: 47
В09 Е. coli K-12 pEB064 38%
SEQ ID NO: 46
В09 Е. coli K-12 pLA134 13%
SEQ ID NO: 48

Пример 9: Способы экспрессирования варианта ORF2086, В44

Клетки штамма Е. coli В (BLR(DE3), Novagen) были трансформированы плазмидой pLN056, которая включает SEQ ID NO: 51. Клетки штамма Е. coli К-12 (производные дикоготипа W3110) были трансформированы плазмидой pDK087, которая включает SEQ ID NO: 43. Клетки инокулировали в глюкозо-солевой определенной среде. После 8 часов инкубации при 37°C применяли линейное глюкозное обеспечение и продолжали инкубацию в течение дополнительных 3 часов. Изопропил β-D-1-тиогалактопиранозид (IPTG) добавляли к культуре до конечной концентрации 0,1 мМ с последующей инкубацией в течение 12 часов при 37°C. Клетки собирали путем центрифугирования при 16,000 х g в течение 10 минут и лизировали путем добавления Easy-Lyse™ набор для лизирования клеток от Lienco Technologies (St. Louis, МО) и буфера загрузки. Супернатанты анализировали для экспрессии В09 путем кумасси окрашивания SDS-PAGE гелей и/или вестерн-блот анализа с количественным определением с помощью сканирующего денситометра. Результаты сканирующей денситометрии представлены ниже в таблице 8:

Таблица 8:
Данные экспрессии в Е. coli
Протеин Клетка-хозяин Плазмида Процент от общего клеточного протеина через 12 часов после IPTG индукции, как измерено с помощью SDS-PAGE, сканирующей денситометрии.
В44 Е. coli В PLN056 1%
SEQ ID NO: 51
В44 Е. coli K-12 pDK087 17%
SEQ ID NO: 43

Пример 10: Функционализация пировиноградной кислотой

Представленный пример демонстрирует, что N-терминальный Cys остаток нелипидизированных протеинов ORF2086 может стать функционализированным пировиноградной кислотой, когда их экспрессировали в, например, Е. coli.

Накопления гетерологичного протеина во время продуцирования вариантов А05 (SEQ ID NO: 13) и В44 (SEQ ID NO: 21) были проконтролированы, используя высокоэффективную жидкостную хроматографию с обратной фазой (ОФ-ВЭЖХ). Данное разделение было на поверхности раздела фаз с помощью квадрупольного время-пролетного масс-спектрометра (QTOF-MS), чтобы обеспечить возможность создания контролирования вариантов родственных продуктов.

После осуществления экспрессирования в Е. coli В и/или K-12 клетках-хозяевах, продукты получали из этих ферментации, подверженных процедуре очистки, во время которой наблюдали модификацию продукта. Деконволюция масс-спектров характеризовала варианты, как демонстрирующие массовые сдвиги +70 Да, по сравнению с нативными продуктами 27640 и 27572 Да для А05 и В44, соответственно.

Данные, опубликованные в литературе, показали, что массовый сдвиг+70 Да раньше наблюдался у протеинов и приписывался функционализации пировиноградной кислотой амино-терминального остатка.

Присутствие и месторасположение пируватной группы было установлено, используя данные масс-спектрального фрагментирования (MS/MS). Данные показали, что модификация была амино-терминального цистеинового остатка, то есть, аминокислоты в положении 1, в соответствии с А05 и В44. Для А05, процент полипептидов, функционализированных пировиноградной кислотой, составляет около 30%, по сравнению с общим количеством А05 полипептидов (SEQ ID NO: 13). Для В44 процент полипептидов, функционализированных пировиноградной кислотой, составляет около 25%, по сравнению с общим количеством В44 полипептидов (SEQ ID NO: 21).

В случае вариантов А05 (SEQ ID NO: 13, в которой N-терминальный Cys в положении 1 делетирован или SEQ ID NO: 55) и В44 (SEQ ID NO: 21, в которой N-терминальный Cys в положении 1 делетирован или SEQ ID NO: 44), которые не содержат амино-терминальный цистеин, были очищены, не наблюдалось детектирование функционализации пировиноградной кислотой (+70 Да).

Пример 11: Иммуногенность В09 и В44, по отдельности и в комбинации

5-10 групп из макак-резус были иммунизированы вариантом В09 (SEQ ID NO: 49, кодируемая SEQ ID NO: 48) или B44 вариантом (SEQ ID NO: 44, кодируемая SEQ ID NO: 43), или A05, B09 и B44 (SEQ ID NO: 55, SEQ ID NO: 49, кодируемые SEQ ID NO: 48, и SEQ ID NO: 44, кодируемая SEQ ID NO: 43, соответственно) формулировали с 250 мкг AIP04 на дозу. Обезьян вакцинировали, путем внутримышечного введения на 0, 4 и 8 неделе 10 мкг каждого из нелипидизированных fHBP по отдельности или в комбинации, как перечислено в таблицах 9 и 10. Обе недели 0 и 12 образцы сыворотки были проанализированы в SBA к штаммам МпВ с вариантами fHBP или подсемейства А или подсемейства В. Клетки-респондеры были отмечены как животные с 4-х кратным повышением титра. Исследованный вариант В44 был оптимизированным конструктом (SEQ ID NO: 43) и обширные уровни ответов, которые наблюдались в предыдущих исследованиях (таблица выше), сохранялись для оптимизированного конструкта (таблица 9) вакцины В44 самостоятельно или в комбинации с В09. Вакцина В09, кроме того, самостоятельно (таблица 10) могла создавать явно перекрестные реактивные иммунные ответы (таблица 10).

Таблица 9:
Уровни ответа, полученные для нелипидизированных вакцин fHBP у макак-резус
Вакцина (10 мкг на протеин; % ≥ 4 X повышение к исследуемому варианту (PD3; 10 макак-резус в группе)
А05 (SEQ ID NO: 13) В44 (SEQ ID NO: 21) B16 (SEQ ID NO: 60) B24 (SEQ ID NO: 20) B09 (SEQ ID NO: 18)
В44 0 80 30 40 30
В44+В09+А05 60 80 40 50 30

Макаки-резус (n=10) были иммунизированы в.м. на 0, 4 и 8 неделе 10 мкг каждого из нелипидизированных fHBP по отдельности или в комбинации, как перечислено в колонке Вакцина в сочетании с 250 мкг AlPO4. Обе недели 0 и 10, когда образцы сыворотки анализировали в SBA к штаммам MnB, перечисленным в таблице. Клетки-респондеры были отмечены как животные с 4-х кратным повышением титра.

Таблица 9 показывает, например, что композиция, включающая комбинацию нефункционализированного пировиноградной кислотой, нелипидизированного В44, В09 и А05, показала более высокое перекрестное покрытие, чем композиция, включающая только В44. С точки зрения результатов, показанных в представленной заявке, включая в частности таблицу 6 т таблицу 9 вместе, композиции, включающие В44, В09 и А05 по отдельности или в комбинации, являются предпочтительными вариантами осуществления представленного изобретения. В частности, раскрыты композиции, включающие как В44, так и В09. Такая композиция предпочтительно дополнительно включает полипептид подсемейства А, такой как, в частности, А05.

Таблица 10:
Уровни ответа, полученные для нелипидизированных вакцин fHBP В09 у макак-резус
Вакцина (10 мкг на протеин) % ≥ 4 X повышение к исследуемому варианту (PD3; 5 макак-резус в группе)
А05 В44 В16 В24 В09
В09 40 60 40 60 60

Макаки-резус (n=5) были иммунизированы в.м. на 0, 4 и 8 неделе 10 мкг каждого из нелипидизированных fHBP по отдельности или в комбинации, как перечислено в колонке Вакцина в сочетании с 250 мкг AlPO4. Обе недели 0 и 10, когда образцы сыворотки анализировали в SBA к штаммам MnB, перечисленным в таблице. Клетки-респондеры были отмечены как животные с 4-х кратным повышением титра.

Пример 12: Иммунная защита, обусловленная конструктами липидизированных и нелипидизированных вариантов

Двадцать самок Ново-Зеландских белых кроликов, 2,5-3,5 кг, полученные из Charles River Canada, были предварительно скринингированы посредством полного клеточного ELISA и 10 животных было отобрано для данного исследования, на основе их низких фоновых титров к исследуемым штаммам, представляющим fHBP варианты В02 (SEQ ID NO: 16) и В44 (SEQ ID NO: 21) (таблица 11). Группа из трех животных была иммунизирована в.м. 100 мкг каждого протеина, сформулированного с 50 мкг ISCOMATRIX на 0,5 мл дозы на 0, 4 и 9 недели (таблица 12). Группу 1 вакцинировали нелипидизированным В44 (SEQ ID NO: 44). Контрольную группу включали тех, которых вакцинировали липидизированным В01, сформулированным с AlPO4 (250 мкг). У кроликов брали кровь на 0, 4, 9 и 10 неделе. Конкретные сыворотки с 10 недели были получены и проанализированы с помощью сывороточного бактерицидного анализа к множественной серогруппе В меннингококковых штаммов fHBP подсемейства В.

График иммунизации 0, 4, 9 недели; график забора крови 0, 4, 9, 10 недели

Сывороточный бактерицидный анализ (SBA): Основанный на микроколониях сывороточный бактерицидный анализ (SBA) по отношению к множественной серогруппе В менингококковых штаммов (Таблица 13) выполняли на конкретных сывороточных образцах. Человеческие сыворотки от доноров были квалифицированы как источник комплемента для исследованного штамма в анализе. Комплемент-опосредованные антитело-зависимые бактерицидные титры были интерполированы и экспрессированы, как реципрокный разбавления исследуемой сыворотки, которая уничтожила 50% менингококковых клеток в анализе. Ограничение детектирования анализа было при титре SBA=4. Титр SBA < 4 был определен номером 2. ≥ 4-х кратное повышение титров SBA в 10 недельных сыворотках по сравнению с титрами в ранее забранной крови было рассчитано и проведено сравнение.

Активность сывороточного бактерицидного антитела, как измерено в SBA, является иммунологическим заместителем защиты по отношению к менингококковому заболеванию. Способность иммунизации нелипидизированным rfHBP, чтобы вызвать бактерицидные антитела у кроликов определяли, используя SBA. SBA измеряют уровень антител в образце сыворотки путем подражания комплемент-опосредованному бактериальному лизису, который присутствует в природе. Образцы сыворотки кроликов с 10 недели были проанализированы методом SBA по отношению у штаммам с В44 fHBP или В02 fHBP. Как показано в таблице 13, через одну неделю после третей иммунизации (10 неделя), все образцы сыворотки показали бактерицидную активность по отношению к исследуемым штаммам. (Таблица 13). Нелипидизированный В44 (SEQ ID NO: 44) был более иммуногенным, чем нелипидизированный В01 Ново-Зеландских кроликов по отношению к этим штаммам. Нелипидизированный В44 (SEQ ID NO: 44), сформулированный со вспомогательным веществом ISCOMATRIX, дал титры сравнимые с липидизированными В01, сформулированными с фосфатом алюминия, по отношению к этим штаммам. Сыворотка с предшествующих заборов крови кролика не показывала, как правило, существование до этого бактерицидной активности по отношению к исследуемым штаммам.

Таблица 13:
Сывороточная бактерицидная активность к штаммам fHBP подсемейства В Ново-Зеландских белых кроликов, вакцинированных рекомбинантным нелипидизированным fHBP
Титры GMT SBA к исследуемому варианту
Подсемейство В вариант (состав) В44 (SEQ ID NO: 21) В02 (SEQ ID NO: 16)
Нелипидизированный В44 (SEQ ID NO: 44)(lscomatrix) 6675 7140
Нелипидизированный В01 (ISCOMATRIX) 625 1052
Липидизированный В01 (AlPO4) 10099 10558

Пример 13: Иммуногенность шести нелипидизированных протеинов фактора Н связывания у Ново-Зеландских белых кроликов.

Группу из 5 кроликов иммунизировали нелипидизированными вариантами fHBP, как описано в таблице 14. Вакцины вводили на 0, 4 и 9 неделях. Образцы сыворотки кролика собирали на 0 и 10 неделях анализировали методом SBA по отношению к штаммам с гомологическими и гетерологичными fHBP последовательностями. Таблица 14 показывает процент клеток-респондеров после третей иммунизации. Через одну неделю после третей иммунизации (10 неделя), все образцы сыворотки показали бактерицидную активность по отношению к гомологическим штаммам, а также другим исследуемым штаммам из того же fHBP подсемейства. Сыворотка с предшествующих заборов крови кроликов, как правило, не показывала существование до этого бактерицидной активности по отношению к исследуемым штаммам.

Изобретение, кроме того, предусматривает следующие варианты осуществления, как определено в пунктах ниже:

С1. Иммуногенную композицию, содержащую полипептид Р2086, в которой Р2086 является вариантом В44, В02, В03, В22, В24, В09, А05, А04, А12 или А22.

С2. Иммуногенную композицию, содержащую полипептид Р2086 подсемейства В, в которой полипептид Р2086 подсемейства В является вариантом В44, В02, В03, В22, В24 или В09.

С3. Иммуногенную композицию по пункту С2, которая дополнительно содержит полипептид Р2086 подсемейства А.

С4. Иммуногенную композицию по пункту С3, в которой полипептид Р2086 подсемейства А является вариантом А05, А04, А12 или А22.

С5. Иммуногенную композицию по какому-либо одному из пунктов С1-4, где композиция дополнительно содержит вспомогательное вещество.

С6. Иммуногенную композицию по пункту С5, в которой вспомогательное вещество выбирают из группы, состоящей из:

а) алюминиевого вспомогательного вещества; b)сапонина

c) CpG нуклеотидной последовательности; и

d) какой-либо комбинации из а), b) и с).

С7. Иммуногенную композицию в соответствии с пунктом С6, в которой алюминиевое вспомогательное вещество выбирают из группы, состоящей из AlPO4, Al(OH)3, Al2(SO4)3 и квасцов.

С8. Иммуногенную композицию в соответствии с пунктом С6 или С7, в которой концентрация алюминия составляет от 0,125 мкг/мл до 0,5 мкг/мл.

С9. Иммуногенную композицию в соответствии с пунктом С8, в которой концентрация алюминия составляет 0,25 мкг/мл.

С10. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С6-9, в которой концентрация сапонина составляет от 1 мкг/мл до 250 мкг/мл.

С11. Иммуногенную композицию в соответствии с пунктом С10 в которой концентрация сапонина составляет между 10 мкг/мл и 100 мкг/мл.

С12. Иммуногенную композицию в соответствии с пунктом C10, в которой концентрация сапонина составляет 10 мкг/мл.

С13. Иммуногенную композицию в соответствии с пунктом С10, в которой концентрация сапонина составляет 100 мкг/мл.

С14. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С6-13, в которой сапонин представляет собой QS-21 или ISCOMATRIX.

С15. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С1-14, где композиция дает возможность повышению иммуногенного ответа к бактериям Neisseria meningitidis после введения многократных доз субъекту.

С16. Иммуногенную композицию в соответствии с пунктом С15, в которой иммуногенный ответ к бактериям Neisseria meningitidis возникает после введения 2 доз субъекту.

С17. Иммуногенную композицию в соответствии с пунктом С15, в которой иммуногенный ответ к бактериям Neisseria meningitidis возникает после введения 3 доз субъекту.

С18. Композицию, дающую повышенную иммуногенность на нелипидизированный антиген Р2086, где композиция содержит сапонин и, по меньшей мере, один нелипидизированный антиген Р2086.

С19. Иммуногенную композицию в соответствии с пунктом С18, в которой концентрация сапонина составляет от 1 мкг/мл до 250 мкг/мл.

С20. Иммуногенную композицию в соответствии с пунктом С19, в которой концентрация сапонина составляет от 10 мкг/мл до 100 мкг/мл.

С21. Иммуногенную композицию в соответствии с пунктом С19, в которой концентрация сапонина составляет 10 мкг/мл.

С22. Иммуногенную композицию в соответствии с пунктом С19, в которой концентрация сапонина составляет 100 мкг/мл.

С23. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-22, в которой сапонин представляет собой QS-21 или ISCOMATRIX.

С24. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-23, которая дополнительно содержит алюминий.

С25. Иммуногенную композицию в соответствии с пунктом С24, в которой концентрация алюминия составляет от 0,125 мкг/мл до 0,5 мкг/мл.

С26. Иммуногенную композицию в соответствии с пунктом С25, в которой концентрация алюминия составляет 0,25 мкг/мл.

С27. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-26, где композиция дает иммуногенный ответ к бактериям Neisseria meningitidis после введения многократных доз субъекту.

С28. Иммуногенную композицию в соответствии с пунктом С27, в которой иммуногенный ответ к бактериям Neisseria meningitidis возникает после введения 2 доз субъекту.

С29. Иммуногенную композицию в соответствии с пунктом С27, в которой иммуногенный ответ к бактериям Neisseria meningitidis возникает после введения 3 доз субъекту.

СЗО. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-29, в которой нелипидизированный антиген Р2086 представляет собой нелипидизированный полипептид Р2086 подсемейства В.

С31. Иммуногенную композицию в соответствии с пунктом С30, в которой нелипидизированный полипептид Р2086 подсемейства В является вариантом В44, В02, В03, В22, В24 или В09.

С32. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-29, в которой нелипидизированный антиген Р2086 представляет собой нелипидизированный полипептид Р2086 подсемейства А.

СЗЗ. Иммуногенную композицию в соответствии с пунктом С32, в которой нелипидизированный полипептид Р2086 подсемейства А является вариантом А05, А04, А12 или А22.

С34. Иммуногенную композицию в соответствии с каким-либо одним из пунктов С18-33, где композиция содержит, по меньшей мере, два нелипидизированных антигена Р2086, где два нелипидизированных антигена Р2086 являются, по меньшей мере, одним нелипидизированным полипептидом Р2086 подсемейства А и, по меньшей мере, одним нелипидизированным полипептидом Р2086 подсемейства В.

С35. Иммуногенную композицию в соответствии с пунктом С34, в которой нелипидизированный полипептид Р2086 подсемейства А является вариантом А05 и нелипидизированный полипептид Р2086 подсемейства В является вариантом В44.

С36. Иммуногенную композицию в соответствии с пунктом С34, в которой нелипидизированный полипептид Р2086 подсемейства А является вариантом А05 и нелипидизированный полипептид Р2086 подсемейства В является вариантом В22.

С37. Иммуногенную композицию в соответствии с пунктом С34, в которой нелипидизированный полипептид Р2086 подсемейства А является вариантом А05 и нелипидизированный полипептид Р2086 подсемейства В является вариантом В09.

С38. Способ предоставления иммунитета субъекту к бактериям Neisseria meningitidis bacteria, по которому способ включает стадию введения субъекту иммуногенной композиции, содержащей полипептид Р2086 подсемейства В, в которой полипептид Р2086 подсемейство В является вариантом В44, В02, В03, В22, В24 или В09.

С39. Способ в соответствии с пунктом С38, в котором иммуногенная композиция дополнительно содержит полипептид Р2086 подсемейства А.

С40. Способ в соответствии с пунктом С39, в котором полипептид Р2086 подсемейства А является вариантом А05, А04, А12 или А22.

С41. Способ в соответствии с каким-либо одним из пунктов С38-40, в котором иммуногенная композиция дополнительно содержит вспомогательное вещество.

С42. Способ в соответствии с пунктом С41, в котором вспомогательное вещество выбирают из группы, состоящей из:

а) алюминиевого вспомогательного вещества; b)сапонина

c) CpG нуклеотидной последовательности; и

d) какой-либо комбинации из а), b) и с).

С43. Способ в соответствии с пунктом С42, в котором алюминиевое вспомогательное вещество выбирают из группы, состоящей из AlPO4, Al(OH)3, Al2(SO4)3 и квасцов.

С44. Способ в соответствии с пунктом С42 или 43, в котором концентрация алюминия составляет от 0,125 мкг/мл до 0,5 мкг/мл.

С45. Способ в соответствии с пунктом С44, в котором концентрация алюминия составляет 0,25 мкг/мл.

С46. Способ в соответствии с каким-либо одним из пунктов С42-45, в котором концентрация сапонина составляет от 1 мкг/мл до 250 мкг/мл.

С47. Способ в соответствии с пунктом С46, в котором концентрация сапонина составляет от 10 мкг/мл до 100 мкг/мл.

С48. Способ в соответствии с пунктом С47, в котором концентрация сапонина составляет 10 мкг/мл.

С49. Способ в соответствии с пунктом С48, в котором концентрация сапонина составляет 100 мкг/мл.

С50. Способ в соответствии с каким-либо одним из пунктов С42-49, в котором сапонина представляет собой QS-21 или ISCOMATRIX.

С51. Способ в соответствии с каким-либо одним из пунктов С38-50, в котором иммуногенную композицию вводят субъекту в виде многократных доз по графику дозирования.

С52. Способ в соответствии с пунктом С51, в котором иммуногенную композицию вводят субъекту в виде 2 доз по графику дозирования.

С53. Способ в соответствии с пунктом С51, в котором иммуногенную композицию вводят субъекту в виде 3 доз по графику дозирования.

С54. Способ получения нелипидизированного варианта полипептид P2086, котороый включает стадии, в соответствии с которыми:

a) проводят клонирование варианта ORF2086 последовательности нуклеиновой кислоты в векторе экспрессии Е. coli;

b) трансформируют бактерии с помощью вектора экспрессии ORF2086;

c) индуцируют экспрессию; и

d) выделяют экспрессированный протеин P2086;

где, вектор экспрессии ORF2086 не содержит липидизированную контрольную последовательность.

С55. Способ в соответствии с пунктом С54, в котором кодон, кодирующий N-терминальный Cys варианта ORF2086 делетирован.

С56. Способ в соответствии с пунктом С54, в котором кодон, кодирующий N-терминальный Cys варианта ORF2086 является мутированным, чтобы создать Ala, Gly или Val кодон.

С57. Способ в соответствии с пунктом С55 или 56, в котором вариант ORF2086 является вариантом А05, В01 или B44.

С58. Способ в соответствии с каким-либо одним из пунктов С54-57, в котором N-терминальный хвост является мутированным, чтобы добавить Ser и Gly остатки для удлинения Gly/Ser стебля непосредственно ниже N-терминального Cys.

С59. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 7.

С60. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 8.

С61. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 9.

С62. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 10.

С63. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 11.

С64. Способ в соответствии с пунктом С58, в котором общее число Gly и Ser остатков в Gly/Ser стебле составляет, по меньшей мере, 12.

С65. Способ в соответствии с каким-либо одним из пунктов С54-57, в котором кодоны N-терминального хвоста варианта ORF2086 оптимизированы путем точечного мутагенеза, таким образом, что кодон, кодирующий пятую аминокислоту варианта ORF2086, является 100% идентичным к нуклеотидам 13-15 из SEQ ID NO: 8 и кодон, кодирующий тринадцатую аминокислоту варианта ORF2086 является 100% идентичным к нуклеотидам 37-39 из SEQ ID NO: 8.

С66. Способ в соответствии с пунктом С65, в котором кодоны N-терминального хвоста варианта ORF2086 являются 100% идентичными к нуклеотидам 1-45 из SEQ ID NO: 8.

С67. Способ в соответствии с пунктом С65, в котором кодоны N-терминального хвоста варианта ORF2086 являются 100% идентичными к нуклеотидам 4-45 из SEQ ID NO: 8.

С68. Способ в соответствии с пунктом С65, в котором кодоны N-терминального хвоста варианта ORF2086 являются 100% идентичными к нуклеотидам 4-42 из SEQ ID NO: 8.

С69. Способ в соответствии с пунктом С65, в котором N-терминальный хвост протеина, кодированного вариантом ORF2086, содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 1-15 из SEQ ID NO: 18.

С70. Способ в соответствии с пунктом С65, в котором N-терминальный хвост протеина, кодированного вариантом ORF2086, содержит, по меньшей мере, одно аминокислотное замещение по сравнению с аминокислотами 2-15 из SEQ ID NO: 18.

С71. Способ в соответствии с пунктом С65, в котором N-терминальный хвост протеина, кодированного вариантом ORF2086, содержит два аминокислотных замещения по сравнению с аминокислотами 1-15 из SEQ ID NO: 18.

С72. Способ в соответствии с пунктом С65, в котором N-терминальный хвост протеина, кодированного вариантом ORF2086, содержит два аминокислотных замещения по сравнению с аминокислотами 2-15 из SEQ ID NO: 18.

С73. Способ в соответствии с каким-либо одним из пунктов С69-72, в котором аминокислотные замещения являются консервативными аминокислотными замещениями.

С74. Способ в соответствии с каким-либо одним из пунктов С65-73, в котором вариант ORF2086 является вариантом А22 или В22.

С75. Способ в соответствии с каким-либо одним из пунктов С55-74, где экспрессия индуцируется путем добавления IPTG.

С76. Способ в соответствии с каким-либо одним из пунктов С55-75, в котором бактерией является Е. coli.

1. Иммуногенная композиция, содержащая эффективное количество выделенного, нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, в которой полипептид характеризуется, по крайней мере, 95% идентичностью последовательности аминокислотной последовательности, выбранной из группы, которая состоит из SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, где полипептид включает делецию N-терминального Cys по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа.

2. Композиция по п. 1, в которой полипептид характеризируется аминокислотной последовательностью, выбранной из группы, которая состоит из SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, в которой цистеин в положении 1 делетирован.

3. Композиция по п. 1, в которой полипептид содержит аминокислотную последовательность, выбранную из группы, которая состоит из SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50 и SEQ ID NO: 55.

4. Композиция по п. 1, в которой полипептид кодирован нуклеотидной последовательностью, которая функционально связана с экспрессионной системой, где упомянутая экспрессионная система способна быть экспрессированной в бактериальной клетке.

5. Композиция по п. 4, в которой экспрессионная система представляет собой плазмидную экспрессионную систему.

6. Композиция по п. 4, в которой бактериальная клетка представляет собой клетку Е. coli.

7. Композиция по п. 4, в которой нуклеотидная последовательность связана с регуляторной последовательностью, которая контролирует экспрессию упомянутой нуклеотидной последовательности.

8. Иммуногенная композиция, которая содержит эффективное количество нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, в которой полипептид содержит замещение N-терминального Cys по сравнению с соответствующим нелипидизированным полипептидом ORF2086 дикого типа.

9. Иммуногенная композиция, которая содержит эффективное количество первого нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, где полипептид характеризуется, по крайней мере, 95% идентичностью последовательности аминокислотной последовательности, выбранной из группы, которая состоит из SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, в которой цистеин в положении 1 делетирован, и второго нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, где полипептид характеризуется, по крайней мере, 95% идентичностью последовательности аминокислотной последовательности, выбранной из группы, которая состоит из SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20 и SEQ ID NO: 21, в которой цистеин в положении 1 делетирован.

10. Иммуногенная композиция, которая содержит эффективное количество выделенного нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, который содержит аминокислотную последовательность, представленную в SEQ ID NO: 49, и выделенный полипептид, который содержит аминокислотную последовательность, представленную в SEQ ID NO: 44.

11. Композиция в соответствии с каким-либо одним из пп. 1-10, где композиция является иммуногенной.

12. Композиция по п. 10, которая дополнительно содержит полипептид ORF2086 подсемейства А из серогруппы В Neisseria meningitidis.

13. Композиция в соответствии с каким-либо одним из пп. 1-10, где композиция вызывает бактерицидный иммунный ответ у млекопитающих к полипептиду ORF2086 подсемейства В из серогруппы В Neisseria meningitidis.

14. Иммуногенная композиция, которая содержит эффективное количество выделенного нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, который содержит аминокислотную последовательность, представленную в SEQ ID NO: 49.

15. Иммуногенная композиция, которая содержит эффективное количество выделенной нуклеотидной последовательности, которая содержит SEQ ID NO: 46 и которая кодирует выделенный нефункционализированный пировиноградной кислотой, нелипидизированный ORF2086.

16. Иммуногенная композиция, которая содержит эффективное количество выделенной нуклеотидной последовательности, которая содержит SEQ ID NO: 47 и которая кодирует выделенный нефункционализированный пировиноградной кислотой, нелипидизированный ORF2086.

17. Иммуногенная композиция, которая содержит эффективное количество выделенной нуклеотидной последовательности, которая содержит SEQ ID NO: 48 и которая кодирует выделенный нефункционализированный пировиноградной кислотой, нелипидизированный ORF2086.

18. Иммуногенная композиция, которая содержит эффективное количество нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, который содержит аминокислотную последовательность, представленную в SEQ ID NO: 50.

19. Иммуногенная композиция, которая содержит эффективное количество выделенной нуклеотидной последовательности, которая содержит SEQ ID NO: 45 и которая кодирует выделенный нефункционализированный пировиноградной кислотой, нелипидизированный ORF2086.

20. Иммуногенная композиция, которая содержит эффективное количество выделенной нуклеотидной последовательности, которая содержит SEQ ID NO: 44 и которая кодирует выделенный нефункционализированный пировиноградной кислотой, нелипидизированный ORF2086.

21. Плазмида для экспрессии нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, которая содержит нуклеотидную последовательность, выбранную из группы, которая состоит из SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 и SEQ ID NO: 45, и в которой плазмида способна быть экспрессированной в бактериальной клетке.

22. Плазмида по п. 21, в которой бактериальной клеткой является Е. coli.

23. Способ продуцирования бактерицидных антител, специфических к ORF2086 подсемейства В серогруппы В Neisseria meningitidis у млекопитающих, который включает введение млекопитающему эффективного количества выделенного нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, содержащего аминокислотную последовательность, выбранную из группы, которая состоит из SEQ ID NO: 44 и SEQ ID NO: 49 или их комбинации.

24. Способ получения нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, который включает экспрессирование в бактериальной клетке полипептида, который содержит последовательность, имеющую больше чем 90% идентичность к SEQ ID NO:21, упомянутая последовательность, содержащая, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислоты 13-18 из SEQ ID NO: 21, аминокислоты 21-34 из SEQ ID NO: 21 и аминокислоты 70-80 из SEQ ID NO: 21 или их комбинации, где в последовательности отсутствует N-терминальный цистеин; и очистку полипептида.

25. Способ по п. 24, в котором последовательность дополнительно содержит, по меньшей мере, один домен выбранный из группы, состоящей из аминокислоты 96-116 из SEQ ID NO: 21, аминокислоты 158-170 из SEQ ID NO: 21, аминокислоты 172-185 из SEQ ID NO: 21, аминокислоты 187-199 из SEQ ID NO: 21, аминокислоты 213-224 из SEQ ID NO: 21, аминокислоты 226-237 из SEQ ID NO: 21, аминокислоты 239-248 из SEQ ID NO: 21 или их комбинации.

26. Способ по п. 24, в котором бактериальной клеткой является Е. coli.

27. Иммуногенная композиция, которая содержит эффективное количество выделенного нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086, полученного в соответствии со способом по п. 24.

28. Иммуногенная композиция, которая содержит эффективное количество выделенного нефункционализированного пировиноградной кислотой, нелипидизированного ORF2086, который содержит последовательность, имеющую больше чем 95% идентичность SEQ ID NO: 21, где упомянутая последовательность, содержащая, по меньшей мере, один домен, выбранный из группы, состоящей из аминокислот 13-18 из SEQ ID NO: 21, аминокислот 21-34 из SEQ ID NO: 21 и аминокислот 70-80 из SEQ ID NO: 21 или их комбинации, где в последовательности отсутствует N-терминальный цистеин.

29. Иммуногенная композиция, которая содержит эффективное количество выделенного нефункционализированного пировиноградной кислотой, нелипидизированного полипептида ORF2086 подсемейства В из серогруппы В Neisseria meningitidis, в которой полипептид является нефункционализированным пировиноградной кислотой, нелипидизированным В44, где полипептид включает делецию N-терминального Cys.

30. Композиция по п. 29, которая дополнительно содержит второй полипептид ORF2086 подсемейства В из серогруппы В Neisseria meningitidis, в которой второй полипептид является нефункционализированным пировиноградной кислотой, нелипидизированным В09.

31. Композиция по п. 29, где упомянутая композиция дополнительно содержит полипептид ORF2086 подсемейства А из серогруппы В Neisseria meningitidis.

32. Композиция по п. 29, где упомянутая композиция содержит полипептид А05 подсемейства А.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к химерным или гибридным белкам для индуцирования иммунного ответа против Р. gingivalis.

Изобретение относится к биохимии, в частности к моноклональному антителу человека, специфичному к альфа-токсину S. aureus.

Изобретение относится к области биохимии, в частности к выделенному полипептиду, который является биологической мишенью для ингибирования клетки-метанопродуцента, а также к выделенному полинуклеотиду, который кодирует этот полипептид.

Изобретение относится к области иммунологии, молекулярной биологии и генетической инженерии. Предложена иммуногенная композиция, содержащая смесь стафилококковых белков, и включающая стафилококковый белок, связывающий внеклеточный компонент, и стафилококковый транспортный белок, или стафилококковый белок, связывающий внеклеточный компонент, и стафилококковый регулятор вирулентности или токсин, или стафилококковый транспортный белок и стафилококковый регулятор вирулентности или токсин.
Изобретение относится к ветеринарии, в частности к ветеринарной микробиологии, и может быть использовано при производстве сыворотки для диагностики сибирской язвы.

Изобретение относится к новому токсину. .

Данное изобретение относится к медицине, биофармацевтики и может быть использовано для приготовления вакцин. Для этого иммуногенная композиция содержит: 1) антиген нейссериальный аутотранспортерный белок, представляющий собой NadA или Hsf; 2) антиген нейссериальный белок, участвующий в усвоении железа, представляющий собой Lipo28 или низкомолекулярный и высокомолекулярный TbpA и 3) препарат везикул наружной мембраны, включающий нейссериальный липополисахарид (LPS) иммунотипа L3; и где указанные антигены, в тех случаях, когда они присутствуют в везикуле наружной мембраны, позитивно отрегулированы рекомбинантным образом в указанной везикуле наружной мембраны.

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, конкретно к получению иммуногенов из Neisseria meningitides, и может быть использовано в медицине. .

Изобретение относится к полипептидам, содержащим последовательность -X-Y- или -Y-X-, в которой -X- представляет собой аминокислотную последовательность, определенную выше, а -Y- не является определенной выше последовательностью, т.е.

Изобретение относится к медицине, а именно к созданию иммуногенных композиций и вакцин для предупреждения или лечения инфекций, вызываемых грамотрицательными бактериями.

Изобретение относится к белкам с установленными аминокислотными последовательностями, представленными в перечне последовательностей, полученным из бактерии, преимущественно штаммов А и В, которые проявляют свойства антигена.

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии. .

Изобретение относится к биохимии и представляет собой набор для профилактики или лечения бактериального менингита, содержащий: (а) конъюгированный капсулярный сахарид, происходящий из N.
Наверх