Вакцинные композиции, содержащие вирус бычьей вирусной диареи 1в типа, и способы их получения и применения



Вакцинные композиции, содержащие вирус бычьей вирусной диареи 1в типа, и способы их получения и применения
Вакцинные композиции, содержащие вирус бычьей вирусной диареи 1в типа, и способы их получения и применения
Вакцинные композиции, содержащие вирус бычьей вирусной диареи 1в типа, и способы их получения и применения
Вакцинные композиции, содержащие вирус бычьей вирусной диареи 1в типа, и способы их получения и применения

 


Владельцы патента RU 2595873:

ЭЛИ ЛИЛЛИ ЭНД КОМПАНИ (US)

Группа изобретений относится к медицине, а именно к иммунологии и ветеринарии, и может быть использована для индуцирования иммунного ответа, специфического в отношении вируса бычьей вирусной диареи 1b типа (BVDV-1b) у млекопитающего. Иммуногенная композиция содержит модифицированный живой вирус бычьей вирусной диареи 1b типа (BVDV-1b) и приемлемый в ветеринарии носитель, где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани. Группа изобретений относится также к применению вышеуказанной композиции и способу предупреждения, лечения, ведения или облегчения одного или более симптомов заболевания, вызванного инфекцией вируса бычьей вирусной диареи, в частности предотвращения транспортной лихорадки у животного. Использование данной группы изобретений позволяет получить вакцину, содержащую модифицированный живой BVDV-1b, представляющую собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани, обеспечивающую индуцирование иммунного ответа. 10 н. и 20 з.п. ф-лы, 11 пр., 7 табл.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ПАТЕНТНЫЕ ЗАЯВКИ

Настоящая заявка родственна совместно поданной предварительной заявке на патент США, серийный номер 61/427404, озаглавленной «Композиции и способы идентификации и дифференциации вирусных компонентов поливалентных вакцин против транспортной лихорадки» (поданной одновременно с данной заявкой 27 декабря 2010 и полностью включенной в настоящую заявку посредством ссылки.).

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение в целом относится к области ветеринарии и вакцинам для животных. В частности, изобретение относится к иммуногенным композициям, способам получения указанных композиций и способам предотвращения, лечения, облегчения и/или ведения бактериальной или вирусной инфекции или ее симптомов, и в частности респираторных инфекций у сельскохозяйственных животных, включая многофакторные заболевания, такие как комплекс респираторных заболеваний коров (BRDC). В настоящей заявке раскрыты антигенные композиции и способы их применения для приготовления и введения профилактических и терапевтических препаратов для предупреждения, лечения и/или облегчения одного или более симптомов пестивирусной инфекции и, в частности, пестивирусов, которые вызывают или вовлечены в патогенез транспортной лихорадки, комплекса BRDC, а также бычьей вирусной диареи у предрасположенных или инфицированных животных.

УРОВЕНЬ ТЕХНИКИ

Комплекс респираторных заболеваний коров (BRDC) - это комплекс многофакторных заболеваний, который часто поражает телят на доращивании и откорме в рыночных каналах и на целевом пастбище или загоне. Основными этиологическими бактериальными агентами этого заболевания являются Mannheimia haemolytica, Pasteurella multocida, Histophilus somni (ранее Haemophilus somnus) и Mycoplasma bovis. Вирусы, которые вызывают транспортную лихорадку, включают бычий вирус герпеса 1 типа (BHV-1), вирус парагриппа 3 типа (PI-3), бычий респираторно-синцитиальный вирус (BRSV) и вирус бычьей вирусной диареи (BVDV).

ВИРУС БЫЧЬЕЙ ВИРУСНОЙ ДИАРЕИ (BVDV)

В настоящее время BVDV считается важным этиологическим агентом в комплексе респираторных заболеваний коров (BRDC) (как правило, называемым «транспортная лихорадка»). Это заболевание, поражающее скот всех возрастов (включая сосущих телят), характеризуется учащенным дыханием, кашлем, депрессией, потерей аппетита, выделениями из глаз и носа и повышенной температурой. При острой вспышке летальный исход может наступить в течение 24 часов после появления симптомов заболевания. При отсутствии противовирусной терапии лечение BVDV вызывает определенные проблемы, а смертность от пестивирусной инфекции является высокой. Кроме того, лечение бактериальных патогенов, вовлеченных в комплекс BRDC, также осложнено во многих случаях резистентностью бактерий к лекарственным средствам.

Вирусы бычьей вирусной диареи представляют собой разрозненную группу вирусов, которые могут быть классифицированы как фенотипически (см., например, Baker, 1995) (цитопатические или нецитопатические), так и генотипически (см., например, Ridpath et al., 1994; Vilcek et al., 2001; и Flores et al., 2002). Создание защитного иммунитета против BVDV у сельскохозяйственных животных вызывало затруднения по ряду причин. Как и в случае ряда других вирусных заболеваний, уровни сывороточных антител против BVDV не обязательно коррелируют с защитой от заболевания. Выработка защитного иммунитета у сосущих телят создает дополнительные препятствия, так как материнские антитела к BVDV могут истощать вводимый иммуноген и эффективно нейтрализовать вакцину.

В исследовании, выполненном Fulton et al. (2006), была проведена оценка 21743 телят, поступающих на откормочные площадки скота в США, по результатам которой определили, что 88 телят были хронически инфицированы (ХИ) BVDV. Из 88 хронически инфицированных телят 77,9% были инфицированы BVDV-1b; только 11,6% были инфицированы BVDV-1а и лишь 10,5% были инфицированы BVDV-2a. К сожалению, несмотря на то, что эти данные ясно показали, что BVDV-1b является преобладающим подтипом вируса у хронически инфицированного скота, поступающего на внутренние откормочные площадки, в настоящее время отсутствуют вакцины, которые имеют лицензию Министерства сельского хозяйства США и являются специфическими в отношении инфекции BVDV-1b.

Таким образом, на основании этой и других причин, присущих уровню техники, существует потребность в составах, содержащих вакцину против BVDV, которые вызывают интенсивный и многопрофильный иммунный ответ, и в частности в составах, которые вызывают иммунный ответ против BVDV 1b типа. В связи с возможностью больших экономических потерь в невакцинированных стадах существует потребность в экономически эффективных (предпочтительно для однократного введения) вакцинах, содержащих модифицированные живые вирусы BVDV-1b, которые индуцируют профилактический иммунный ответ в отношении инфекции BVDV в популяции сельскохозяйственных животных.

Далее поскольку современные поливалентные вакцины против многофакторных заболеваний, таких как комплекс BRDC и относящаяся к нему транспортная лихорадка, неэффективны в предотвращении инфицирования BVDV-1b, существует также потребность в усовершенствованных методах вакцинации для улучшения эффективности профилактики и контроля вспышки заболевания у сельскохозяйственных животных, восприимчивых к BVDV-1b.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В настоящем изобретении предложены новые и обеспечивающие преимущества композиции, а также способы их применения, которые предпочтительно улучшают доставку профилактических и/или терапевтических агентов животному, которое нуждается в этом. В настоящем изобретении предложены вакцинные композиции, которые обеспечивают преимущества по сравнению с обычными составами, и в частности обеспечивают способы предотвращения или контроля заболеваний, вызванных одним или несколькими пестивирусами и в частности заболеваний, вызванных различными типами BVDV, включая субгенотип 1b типа (т.е. BVDV-1b).

В общем и широком смысле настоящее изобретение включает композиции, способы получения указанных композиций и способы их применения для предотвращения, лечения и/или ведения вирусной, и/или бактериальной инфекции, патогенеза и заболевания. Иммуногенные композиции, раскрытые в настоящей заявке, а также способы их применения предпочтительно используют для предотвращения, лечения и/или облегчения одного или более симптомов транспортной лихорадки/комплекса BRDC у предрасположенных млекопитающих с использованием вакцинных композиций согласно настоящему изобретению и способов их применения, которые превосходит обычные средства предотвращения/лечения транспортной лихорадки, доступные в настоящее время в ветеринарии.

Согласно конкретным вариантам реализации в настоящем изобретении предложены иммуногенные композиции, содержащие модифицированные живые вирусы BVDV-1b, а также фармацевтические составы, содержащие указанные композиции, и способы получения указанных вакцин в различных профилактических и/или терапевтических режимах. Указанные композиции и способы предпочтительно применяют для предотвращения вирусных и многофакторных заболеваний у животных, таких как сельскохозяйственные животные, которые предрасположены к инфицированию BVDV.

Согласно другим вариантам реализации в настоящем изобретении предложены способы применения раскрытых вакцинных композиций для возбуждения вирус-специфичного иммунологического ответа у животного. В общем и широком смысле указанные способы в целом обеспечивают доставку выбранному животному одной или более иммуногенных композиций, раскрытых в настоящей заявке, в количестве(ах) и в течение времени, которое является достаточным для того чтобы вызвать вирус-специфичный иммунологический ответ у животного, в частности, BVDV-специфический иммунологический ответ. Согласно таким вариантам реализации настоящего изобретения животное предпочтительно является парнокопытным млекопитающим и более предпочтительно представителем семейства Bovidae.

В настоящем изобретении также предложен способ предотвращения или контролирования вспышки вирусной и/или бактериальной инфекции(й) (в частности пестивирусных инфекций, вызванных BVDV и родственными видами) в одной или более выбранных популяций млекопитающих. Указанный способ в целом обеспечивает доставку предрасположенному или находящемуся в группе риска представителю такой популяции эффективного количества одной или более раскрытых иммуногенных композиций или вакцинных композиций в течение времени, достаточного для задержки, уменьшения, снижения, ингибирования и/или предотвращения вспышки указанной инфекции в общей популяции. Примеры популяций млекопитающих включают, но не ограничиваются перечисленными: членов семейств Bovinae и Caprinae, и в частности представителей родов Bison, Bos, Bubalus, Copra, Oreamnos, Ovibos, Ovis, Syncerus и тому подобных родов. Согласно иллюстративным вариантам реализации настоящего изобретения указанные способы особенно желательны в лечении коммерческих сельскохозяйственных животных из родов Bison, Bos, Capra и Ovis, включая, но не ограничиваясь указанными. Bison bison, Bos taurus, Capra hircus и Ovis dries.

Согласно другому аспекту в настоящем изобретении предложен способ стимуляции иммунной системы животного для выработки защитного иммунного ответа против вирусной инфекции, в частности, Bovidae-вирулентной пестивирусной инфекции. Указанный способ в целом включает, по меньшей мере, введение животному, которое нуждается в этом, иммунологически и профилактически эффективного количества одной или более раскрытых вакцинных композиций в количестве и в течение времени, которое достаточно для стимуляции иммунной системы животного. В соответствии с принятым применением указанного способа в одном варианте реализации настоящего изобретения введение одной или более раскрытых иммунологически и профилактически активных вакцинных композиций предпочтительно индуцирует, по меньшей мере, выработку первого определяемого количества антител к пестивирусу в организме животного, и еще более предпочтительно индуцирует выработку, по меньшей мере, первого обнаруживаемого количества антител против BVDV-1b у животного. Согласно предпочтительным вариантам реализации настоящего изобретения введение композиции предпочтительно иммунизирует животное против первоначальной, последующей и/или рецидивирующей инфекции вирусом BVDV-1b, и в некоторых вариантах реализации настоящего изобретения также предпочтительно иммунизирует животное против первоначальной, последующей и/или рецидивирующей инфекции, вызванной одним или более генетически сходными или эпитопно-родственными вирусами, включая, например, один или более типов, штаммов и подтипов вируса BVDV (включая, но не ограничиваясь указанными, BVDV-1a, BVDV-2, а также другие генетически сходные пестивирусы).

Согласно другому варианту реализации в настоящем изобретении предложен способ получения защитного иммунного ответа против пестивирусов у животного. Указанный способ в целом обеспечивает доставку животному, которое нуждается в этом, иммунологически и профилактически эффективного количества одной или более раскрытых BVDV-1b-специфичных иммуногенных композиций в условиях и в течение времени, которое достаточно для получения такого защитного иммунного ответа против одного или более видов, подвидов или штаммов пестивирусов, предпочтительно против одного или более видов, штаммов, подтипов или серотипов BVDV.

В другом варианте в изобретении предложен способ, обеспечивающий доставку профилактической или терапевтической композиции в первую клетку организма млекопитающего. Указанный способ в целом обеспечивает доставку млекопитающему, которое нуждается в этом, профилактически или терапевтически эффективного количества одной или более BVDV-специфичных иммуногенных композиций, раскрытых в настоящей заявке, в условиях и в течение времени, которое является эффективным для того чтобы обеспечить доставку композиции по меньшей мере в первую клетку, ткань, орган или систему органов указанного млекопитающего.

В настоящем изобретении также предложен способ предотвращения, лечения и/или облегчения одного или более симптомов инфекции BVDV у млекопитающего. Указанный способ в целом обеспечивает доставку указанному млекопитающему, которое нуждается в этом, иммунологически и профилактически эффективного количества одной или более раскрытых BVDV-1b-специфичных иммуногенных композиций в условиях и в течение времени, которое достаточно для предотвращения, лечения и/или облегчения одного или более симптомов инфекции BVDV у млекопитающего.

В другом варианте в настоящем изобретении также предложены способы предотвращения, лечения и/или облегчения одного или более симптомов многофакторного заболевания, такого как комплекс BRDC, у млекопитающего, и в частности заболеваний, в патогенез которых, по меньшей мере, первый BVDV вовлечен в качестве причинного или способствующего развитию заболевания агента. Указанные способы в целом включают введение выбранному млекопитающему по меньшей мере первого иммунологически или профилактически эффективного количества по меньшей мере первой анти-BVDV-1b вакцинной композиции в условиях и в течение времени, которое достаточно для предотвращения, лечения и/или облегчения одного или более симптомов заболевания у млекопитающего.

Согласно другому варианту реализации в настоящем изобретении предложен способ предотвращения, лечения и/или облегчения одного или более симптомов транспортной лихорадки у представителя семейства Bovidae. Указанный способ в целом обеспечивает доставку полорогому жвачному животному по меньшей мере первого иммунологически или профилактически эффективного количества первой композиции, содержащей популяцию модифицированных живых вирусов BVDV-1b в условиях и в течение времени, которое достаточно для предотвращения, лечения и/или облегчения одного или более симптомов транспортной лихорадки у полорогого жвачного животного.

ИММУНОГЕННЫЕ КОМПОЗИЦИИ

Для того чтобы обеспечить более широкий спектр защиты против одного или более пестивирусов и, в частности, одного или более вирусных агентов, вовлеченных в патогенез комплекса BRDC и транспортной лихорадки у членов семейства Bovidae, авторы настоящего изобретения разработали безопасные и эффективные вакцинные составы, которые включают один или более BVDV-1b-специфичных антигенов. Были описаны как моновалентные, так и поливалентные вакцинные составы, включая составы, которые содержат, в случае моновалентных вакцин, один или несколько антигенов, эпитопов, или модифицированные живые вирусы, которые вызывают иммунный ответ, специфичный только против BVD V, или, в случае поливалентных вакцин, один или несколько антигенов, эпитопов, или модифицированные живые вирусы, которые вызывают специфический иммунный ответ не только против BVDV, но и против одного или более дополнительных патогенов.

Согласно иллюстративным вариантам реализации в настоящем изобретении была разработана моновалентная иммуногенная композиция, содержащая модифицированные живые BVDV-1b, для защиты сельскохозяйственных животных от инфицирования BVDV-1b. Дополнительно в настоящем изобретении предложены поливалентные иммуногенные композиции, специфичные для комплекса BRDC и связанных с ними транспортных лихорадок, включая иллюстративный шестифакторный (т.е. «гексавалентный») состав, содержащий модифицированные живые бычьи вирусы, который включает антигенные компоненты для специфичной индукции иммунного ответа против одного или более, предпочтительно двух или более, еще более предпочтительно трех или более из BHV-1, PI-3, BRSV, двух субгенотипов BVDV 1 типа (1а и 1b) и BVDV 2 типа у животного. В более предпочтительном варианте реализации настоящего изобретения состав вызывает иммунный ответ против каждого из указанных вирусов, как правило, с разными уровнями.

Согласно другим вариантам реализации в настоящем изобретении предложены вакцинные составы, содержащие вышеуказанные иммуногены, и способы их применения для предотвращения, лечения и/или облегчения одного или более симптомов пестивирусной инфекции у животного, и в частности BVDV-1b инфекции у сельскохозяйственных животных. В область изобретения дополнительно включены вакцинные составы и способы их применения для предотвращения, лечения и/или облегчения одного или более симптомов транспортной лихорадки, такой как комплекс BRDC, у полорогих жвачных животных и других родственных видов млекопитающих.

ВАКЦИННЫЕ СОСТАВЫ

В настоящем изобретении предложены иммуногенные составы и их вакцинные составы для применения в профилактике одной или более вирусных инфекций, а также композиции для применения в предотвращении или лечении одного или более комплексов многофакторных заболеваний у выбранного млекопитающего. В частности, в настоящем изобретении предложено применение одной или более из раскрытых иммуногенных композиций в производстве вакцинных препаратов для профилактики, предотвращения или лечения, и в частности для применения в производстве лекарственных средств, пригодных для использования в ветеринарии, для предотвращения, ведения, облегчения и/или лечения одного или более заболеваний, или одного или более симптомов таких заболеваний как BVDV у сельскохозяйственных животных.

Вакцины согласно настоящему изобретению могут быть введены любым путем, подходящим для выбранного млекопитающего, который доступен специалисту в данной области техники, предпочтительно путем внутримышечной или подкожной инъекции или посредством интраназального, перорального, кожного, чрескожного или внутрикожного введения. Предпочтительно вакцинацию вакцинами против BVDV-1b проводят подкожно или внутримышечно или интраназально, наиболее предпочтительно подкожно. Вакцины обычно вводят до отъема, при вынашивании, или в момент поступления на пастбище или откормочную площадку. В рамках продолжающейся вакцинации взрослого скота можно регулярно использовать одну или более ревакцинирующих доз указанных вакцин, в том числе, например, как часть схемы ежегодной повторной вакцинации/поддержания иммунитета.

Хотя фармацевтические составы и вакцины согласно настоящему изобретению могут быть приготовлены в любой подходящей лекарственной форме, которую можно применять в ветеринарии, в некоторых вариантах реализации настоящего изобретения предложены вакцины в форме готового к введению раствора или суспензии, концентрированного исходного раствора, пригодного для разбавления перед введением, или в восстанавливаемой форме, такой как лиофилизированный, сублимированный или замороженный препарат, как известно специалистам в ветеринарии.

Приготовление композиций, содержащих модифицированные живые пестивирусы, и приготовление композиции и вакцин согласно изобретению с другими иммуногенами (с или без одного или более адъювантов) является рутинным этапом на основании указаний, приведенных в настоящей заявке, и включают смешивание живых ослабленных пестивирусов с фармацевтически приемлемым носителем или разбавителем, возможно с другими иммуногенами и возможно со вспомогательным веществом.

Носители, разбавители или другие инертные или неактивные компоненты фармацевтических составов и вакцин могут содержать один или несколько стабилизаторов, консервантов и/или буферов, которые могут быть использованы в ветеринарии. Типичные стабилизаторы включают, но не ограничиваются указанными, SPGA, и один или более из перечисленных далее: углеводы (включая, но не ограничиваясь указанными, сорбит, маннит, крахмал, сахарозу, декстран, глутамат или глюкозу), белки (включая, но не ограничиваясь указанными, сухое молоко, сывороточный альбумин, казеин, или белки из других источников, например из растений или микроорганизмов), или т.п. Подходящие буферы включают, но не ограничиваются указанными, один или более фосфатов щелочных металлов. Типичные консерванты, которые можно использовать в составах раскрытых фармацевтических композиций и вакцин включают, но не ограничиваются перечисленными: тимеросал, мертиолат, гентамицин, неомицин, нистатин, амфотерицин В, тетрациклин, пенициллин, стрептомицин, полимиксин В, а также любую их комбинацию. Типичные разбавители включают, но не ограничиваются перечисленными: стерильную воду, один или более буферов на водной основе (например, буферный солевой раствор и тому подобное), один или более спиртов (включая полиол, например, глицерин или т.п.), а также любые их комбинации.

Если необходимо, то вакцинные композиции согласно настоящему изобретению возможно могут дополнительно включать один или несколько вспомогательных веществ. Неограничивающие примеры подходящих соединений и композиций, обладающих адъювантной активностью, включают гидроксид, фосфат или оксид алюминия, эмульсии типа масло-в-воде, вода-в-масле, вода-в-масле-в-воде на основе, например, минерального масла, включающего, но не ограничивающегося перечисленными: Drakeol®, Bayol® или Marcol®; растительное масло, например, включая, но не ограничиваясь указанными, хлопковое масло, арахисовое масло или кукурузное масло; витамин Е-ацетат; сапонины; рыбий жир, включая, но не ограничиваясь указанными, сквален или сквалан, или любые их комбинации.

BVDV-специфичные вакцинные составы согласно настоящему изобретению возможно могут также дополнительно содержать один или более других иммуногенов, специфичных для одного или более дополнительных вирусов и/или микроорганизмов, которые также являются потенциально патогенными для животного, которое иммунизируют. Например, для скота и относящегося к нему крупного рогатого скота дополнительные иммуногены, которые могут присутствовать в композиции, могут быть получены из одного или более видов вирусов, патогенных для крупного рогатого скота, включая, но не ограничиваясь указанными, ротавирусы, бычий респираторно-синцитиальный вирус, бычий вирус герпеса (включая 1 тип), бычьи коронавирусы, вирусы парагриппа (включая 3 тип), бычьи парамиксовирусы, или подобные вирусы, или согласно другому варианту иммуногены, которые получены из одного или более патогенных для крупного рогатого скота видов микроорганизмов, включая, но не ограничиваясь указанными, Pasteurella multocida, Mannheimia haemolytica (ранее Pasteurella haemolytica), Histophilus somni (ранее Haemophilus somnus), Mycoplasma bovis и т.п., или комбинацию любых из вышеуказанных.

В некоторых вариантах реализации настоящего изобретения, когда это применимо, для специалиста в данной области техники будет очевидно, что иммуногенные композиции и вакцины согласно настоящему изобретению могут включать введение однократной дозы животному, или в другом варианте могут включать введение многократных, и/или последовательных доз животному на протяжении периода времени. В другом варианте иммуногенные композиции согласно настоящему изобретению можно также вводить в комбинации с одним или более антивирусными или антибактериальными соединениями, либо по отдельности, либо в комбинации с введением одного или более различных специфичных в отношении микроорганизма иммуногенов или вакцинных составов.

Еще один важный аспект настоящего изобретения относится к способам применения раскрытых иммуногенных композиций для доставки одного или более терапевтических агентов для лечения или облегчения одного или более симптомов инфекции или заболевания у млекопитающего. Указанные способы в целом включают введение млекопитающему, которое нуждается в этом, одной или более раскрытых иммуногенных композиций в количестве и в течение времени, которое достаточно для лечения, облегчения или уменьшения степени тяжести, продолжительности или интенсивности указанного заболевания или инфекции у указанного млекопитающего.

Способы и композиции согласно настоящему изобретению можно применять для предотвращения, профилактики и/или вакцинации животного, у которого развилась, имеется подозрение на развитие или риск развития, или у которого была диагностирована одна или более инфекций и/или болезней либо до, либо во время, либо после установления диагноза или развития одного или нескольких клинических симптомов заболевания или появления одного или нескольких его симптомов.

СПОСОБЫ ВОЗБУЖДЕНИЯ ИММУННОГО ОТВЕТА

Настоящее изобретение также относится к способам возбуждения определяемого иммунного ответа против одного или более вирусных патогенов у предрасположенного животного. Согласно одному предпочтительному способу предложено введение животному, которое нуждается в этом, или потенциально нуждается в этом, на основании, например, известных факторов риска для данного заболевания или инфекции, количества вакцинной композиции, как раскрыто в настоящей заявке, которое достаточно, чтобы вызвать у животного определяемый иммунный ответ.

Согласно некоторым вариантам реализации настоящее изобретение относится к способам вакцинации субъекта против пестивирусной инфекции, такой как BVDV, или против многофакторного заболевания, такого как комплекс BRDC, в патогенез которого пестивирусная инфекция вовлечена или является его причиной. Указанные способы в целом включают введение животному, которое нуждается в этом, профилактически и/или терапевтически эффективного количества пестивирус-специфичной вакцинной композиции, и одного или более фармацевтически или ветеринарно приемлемых носителей, буферов, разбавителей, наполнителей и т.п., чтобы обеспечить определяемый иммунный ответ у животного против пестивирусной инфекции или заболевания, вызванного или усугубленного указанной пестивирусной инфекцией.

В связи с этим в настоящем изобретении предложены способы применения раскрытых иммуногенных композиций и вакцинных составов для профилактики, лечения, облегчения или ведения одного или более вирусных или бактериальных заболеваний или инфекций у животного, или одного или более ее симптомов.

В настоящем изобретении также предложено применение одной или более раскрытых иммуногенных композиций в производстве лекарственного средства для применения у животных или вакцины для профилактики или предотвращения заболевания, включая приготовление одной или более вакцин, подходящих для профилактического введения, для предотвращения или облегчения одного или более симптомов пестивирусной инфекции, включая, например, BVDV, у животного.

В настоящем изобретении также предложен способ, обеспечивающий доставку терапевтического или профилактического иммуногенного соединения в первую клетку млекопитающего, причем способ в целом обеспечивает доставку млекопитающему, которое нуждается в этом, эффективного количества иммуногенной в отношении BVDV композиции, как раскрыто в настоящей заявке, которая включает множество модифицированных живых вирусных частиц в качестве активного ингредиента, в течение времени, которое эффективно для обеспечения желаемого лечения и/или профилактики у иммунизированного или получившего лечение млекопитающего.

ТЕРАПЕВТИЧЕСКИЕ И ПРОФИЛАКТИЧЕСКИЕ НАБОРЫ

Наборы, которые включают одну или более раскрытых иммуногенных композиций или фармацевтических составов, включающих указанные композиции; и инструкции по применению набора в одной или более профилактических или терапевтических схем также представляют собой иллюстративные аспекты настоящего изобретения. Указанные наборы предпочтительно включают одну или более раскрытых иммуногенных композиций или вакцин, по отдельности или в комбинации с одним или более дополнительных терапевтических соединений, фармацевтических препаратов и т.п., и инструкции по применению компонентов для предотвращения или лечения заболевания у животного. Наборы согласно настоящему изобретению могут быть упакованы для коммерческого распространения, а также возможно могут дополнительно включать одно или более устройств для доставки (например, шприцы, флаконы, устройства для инъекций и т.п.) для введения композиции(й) выбранному животному.

Контейнер(ы) для таких наборов обычно могут включать по крайней мере один флакон, пробирку, колбу, бутылку, шприц или другой контейнер, в который помещают иммуногенную композицию(и) или вакцинный состав(ы) и предпочтительно распределяют на одну или более аликвот для введения животному. В тех случаях, когда желательно присутствие второй иммуногенной композиции или первого противовирусного или антибактериального соединения, набор может также содержать вторую иммуногенную композицию или первое противовирусное или антибактериальное соединение во втором отдельном контейнере, или в одном контейнере с разрывным или неразрывным барьером для изоляции двух компонентов до приготовления для введения. В другом варианте множество отдельных иммуногенных композиций и/или различные противовирусные или антибактериальные соединения могут быть получены в виде одного состава, и могут быть упакованы в один контейнер, флакон, колбу, шприц, катетер, канюлю, бутылку, пробирку, ампулу или другой подходящий контейнер. Набор может также включать в себя большой контейнер, например, в случае, который включает упомянутые выше контейнеры, вместе с другим оборудованием и тому подобным. Многократные дозы могут содержаться в подходящем сосуде внутри контейнера, при желании, предпочтительно вместе с любым подходящим устройством для взвешивания или измерения объема для того чтобы отмерять заранее выбранную дозу.

КОМПОЗИЦИИ ДЛЯ ПРИМЕНЕНИЯ В ПРИГОТОВЛЕНИИ ЛЕКАРСТВЕННЫХ СРЕДСТВ

Другой важный аспект настоящего изобретения относится к способам применения раскрытых иммуногенных композиций (а также содержащих их составов) в приготовлении лекарственных средств для предотвращения, лечения или облегчения заболевания или его симптомов у животного, такого как позвоночное млекопитающее. Применение раскрытых иммуногенных композиций также включено в способ лечения и/или профилактики одного или более заболеваний бактериального или вирусного происхождения.

Указанное применение в целом включает введение животному, которое нуждается в этом, одной или более из раскрытых иммуногенных композиций в количестве и в течение времени, которое достаточно для предотвращения, лечения или ведения одного или более заболеваний или его симптомов у пораженного животного. Композиции, содержащие один или более раскрытых иммуногенных составов, также включены в настоящее изобретение, и в частности композиции, дополнительно содержащие по меньшей мере первый фармацевтически приемлемый наполнитель для применения в лечении или профилактике одного или более заболеваний вирусного и/или бактериального происхождения.

Иммуногенные композиции согласно настоящему изобретению могут быть приготовлены в виде моновалентных (например, одновалентные) вакцин или в другом варианте в виде двухвалентных, трехвалентных или мультивалентных (т.е. поливалентных) вакцин. Например, моновалентная вакцина предпочтительно будет содержать одну иммуногенную композицию согласно настоящему изобретению (например, популяцию модифицированных живых вирусов BVDV-1b), которая способна вызывать специфический иммунный ответ против BVDV при введении в организм выбранного реципиента млекопитающего, в частности млекопитающих, предрасположенных к инфекции BVDV.

Аналогичным образом двухвалентная вакцинная композиция предпочтительно будет содержать по меньшей мере первую BVDV-1b-специфичную композицию и по меньшей мере второй вирусный или бактериальный специфичный иммуноген, каждый из которых способен вызывать специфический иммунный ответ у млекопитающего. Мультивалентные (включая трех- или поливалентные) вакцинные композиции предпочтительно будут содержать три или более вирусных или бактериальных специфичных иммуногенов, соответственно. В одном варианте реализации настоящего изобретения, проиллюстрированном в настоящей заявке, авторы настоящего изобретения разработали гексавалентный (шестифакторную), модифицированный, живой вакцинный состав, обладающий удивительными и неожиданными преимуществами, который содержит иммуногены, специфичные для BVDV-1b, BVDV 1a типа (BVDV-1a), BVDV 2 типа (BVDV-2), PI-3, бычьего респираторно-синцитиального вируса (BRSV) и BHV-1, возбудителя инфекционного ринотрахеита для контроля инфекций комплекса BRDC в популяциях млекопитающих, в частности домашних сельскохозяйственных животных.

ОПИСАНИЕ ИЛЛЮСТРАТИВНЫХ ВАРИАНТОВ

Иллюстративные варианты реализации настоящего изобретения описаны ниже. В целях ясности не все отличительные особенности фактической реализации описаны в настоящем описании изобретения. Следует понимать, что при разработке любого указанного фактического варианта для достижения конкретных целей разработчиков, таких как соблюдение связанных с системой и деловой активностью ограничений, должен быть принят ряд решений, специфических для реализации изобретения, которые будут варьировать в зависимости от конкретного варианта реализации. Кроме того, следует понимать, что такие усилия по разработке могут быть сложными и трудоемкими, но будут рутинным процессом для специалистов в данной области техники, для которых настоящее изобретение обеспечивает определенные преимущества.

«ТРАНСПОРТНАЯ ЛИХОРАДКА»

«Транспортная лихорадка» это термин, относящийся к острому, высоко заразному, септическому синдрому у скота и овец, который клинически характеризуется лихорадкой, острым воспалением дыхательных путей, выделениями из носа, анорексией, депрессией, фибринозной пневмонией и некрозом инфицированных тканей. Наиболее часто встречающаяся на откормочных площадках после отправки, транспортная лихорадка является основной причиной смерти среди молодняка скота и вызывает ежегодные потери в отрасли на сумму более чем в полмиллиарда долларов. Лишь в 1991 году транспортная лихорадка по оценкам обошлась скотоводческой промышленности США почти в 624 млн. $, в основном из-за расходов на лечение, производственные потери и смерть.

Патогенез транспортной лихорадки, как правило, считается связанным с неблагоприятными внешними воздействиями, предрасполагающими животное к исходной вирусной респираторной инфекции, которая, в свою очередь, создает благоприятные условия для распространения одной или более вторичных бактериальных инфекций.

КОМПЛЕКС РЕСПИРАТОРНЫХ ЗАБОЛЕВАНИЙ КОРОВ (КОМПЛЕКС BRDC)

Основным возбудителем транспортной лихорадки является многофакторное состояние, известное как респираторная инфекция крупного рогатого скота или комплекс респираторных заболеваний коров (комплекс BRDC). Комплекс BRDC, который является одной из основных причин экономических потерь в индустрии крупного рогатого скота, характеризуется сопутствующим последовательным или одновременным инфицированием вирусными и бактериальными патогенами. Вирусные патогенны, вовлеченные в комплекс BRDC, включают бычий вирус герпеса 1 (BHV-1), бычий PI-3, вирус бычьей вирусной диареи (BVDV) и бычий респираторно-синцитиальный вирус (BRSV).

После вирусной инфекции у пораженного животного развивается одна или более последующих бактериальных инфекций (например, Mannheimia [ранее Pasteurella] haemolytica, Pasteurella multocida, Histophilus somni [ранее Haemophilus somnus], Actinomyces pyogenes, а также различные Mycoplasma spp.), которые часто проявляются в виде острой пневмонии.

Наиболее частый и узнаваемый ранний клинический признак пневмонии это депрессия. Телята, демонстрирующие признаки депрессии, будут иметь висячие уши, расширенные головы, выгнутую спину и/или часто отделяются от другого скота. Поскольку здоровье телят постепенно ухудшается, они перестают питаться, у них увеличивается частота дыхания, а также развивается выраженная лихорадка (как правило, в диапазоне 104-108F).

ПЕСТИВИРУСЫ

Пестивирусы вызывают экономически важные заболевания у животных во всем мире. Род Pestivirus семейства Flaviviridae состоит из трех видов вирусов, содержащих одноцепочечную положительную смысловую РНК: вируса бычьей вирусной диареи (BVDV), вируса классической чумы свиней (КЧС), вируса пограничной болезни (BDV). Недавно была идентифицирована четвертая отдельная группа пестивирусов, которая генетически связана с BVDV и упоминается в литературе как вирус бычьей вирусной диареи 2 типа (BVDV-2) (см., например, Thiel et al., 1996; and Becher et al., 1995; каждая из которых полностью включена в настоящее описание посредством ссылки). Таким образом, в настоящее время в современной литературе исходный вид BVDV называют «BVDV-1», чтобы различать два вида.

ВИРУС БЫЧЬЕЙ ВИРУСНОЙ ДИАРЕИ (BVDV)

Типичным видом Pestivirus является BVDV 1 типа (BDVD-1), геном которого составляет приблизительно 12,5 тыс. п.о. в длину и содержит одну большую открытую рамку считывания (OPC) (Collett et al., 1988, которая полностью включена в настоящее описание посредством ссылки). OPC кодирует полипротеин массой примерно 450 кДа, который подвергается ко- и посттрансляционному процессингу протеазами хозяина и вируса. Расщепление стандартного полипротеина BVDV с N-конца приводит к образованию неструктурного белка р20 (NPRO), капсидного белка р14 (С); гликопротеинов оболочки gp48 (EO), GP25 (El), gp53 (E2); неструктурных белков Р125 (NS23), Р10 (NS4A), Р32 (NS4B), Р58 (NS5A) и Р75 (NS5B) (см., например, Tautz et al., 1997; Xu et al., 1997; Elbers et al., 1996; and Wiskerchen et al., 1991, каждая из работ включена в настоящее описание посредством ссылки). BVDV-1 существует в виде двух биотипов, цитопатического (обозначенного «ср») и нецитопатического («пер»), которые различаются по синтезу одного 80 кДа полипептида (неструктурного белка р80, NS3) в цитопатическом варианте (см., например, Gillespie et al., 1960, которая полностью включена в настоящее описание посредством ссылки).

На основании филогенетического анализа ряда изолятов BVDV было показано, что BVDV-1 содержит по меньшей мере 13 различных субгенотипов (обозначаемых от BVDV-1 а до BVDV-11), тогда как для BVDV-2 были выявлены два субгенотипа (BVDV-2а и BVDV-2b) (см., например, Pellerin et al., 1994; Ridpath et al., 1994, and Xue et al., 2010; каждая из которых полностью включена в настоящее описание посредством ссылки).

BVDV-1 и BVDV-2 являются причиной острых инфекций у скота (диарея, лихорадка, геморрагический синдром) и, если заражение происходит во время беременности, абортов, пороков развития плода и хронической инфекции телят. Хронически инфицированные животные представляют собой основной резервуар вируса и могут заболевать смертельной болезнью слизистых оболочек (MD).

BVDV тесно связан с вирусами, вызывающими пограничные болезни у овец и классическую чуму у свиней. Зараженный скот обычно демонстрирует генерализованную «болезнь слизистых оболочек», которая характеризуется повышенной температурой, диареей, кашлем и изъязвлениями слизистой оболочки желудочно-кишечного тракта (см., например, Olafson et at., 1946; and Ramsey et al., 1953; каждая из которых полностью включена в настоящее описание посредством ссылки).

Вирус БВД способен проникать через плаценту беременных самок скота и может привести к рождению хронически инфицированных телят, которые иммунологически толерантны к вирусу и являются персистентно виремичными в течение оставшейся части их жизни. Хронически инфицированный скот, который чрезвычайно предрасположен к инфицированию микроорганизмами, вызывающими воспаление легких или кишечные заболевания, обеспечивает необходимый резервуар вирусов для вспышек болезни слизистых оболочек у скота (см., например, Liess et al., 1974; Barber et al., 1985; Malmquist, 1968; and Ross et al., 1986; каждая из которых полностью включена в настоящее описание посредством ссылки).

BVDV распространяется в стаде фекально-оральным способом, и стратегии контроля вируса варьируют от строгих методов управления для простого уменьшения экономических потерь до разработки процедур исследования для выявления инфицированных животных, что, несмотря на эффективность, как правило, влечет за собой неприемлемый уровень затрат.

За последние тридцать лет почти сто пятьдесят вакцин против BVDV, содержащих как модифицированные живые вирусы (MLV), так и инактивированный ослабленный вирус или вирусные частицы, и обладающих разной степенью эффективности, были выпущены на рынок для скотоводства на промышленной основе, однако до сих пор поступают сообщения о ежегодных вспышках BVDV, несмотря на широкую доступность и использование коммерческих вакцинных составов. Современные подходы к ведению заболевания включают ежегодные повторные прививки вакциной для скота, также дополнительно принимают меры, чтобы убедиться в отсутствии телят, которые рождаются носителями хронической инфекции. Было разработано несколько различных методов испытаний для обнаружения BVDV и/или обнаружения BVDV-инфицированных животных, которые включают полимеразную цепную реакцию с обратной транскрипцией (ОТ-ПЦР), твердофазный иммуноферментный анализ (ELISA), стандартные методики выделения вирусов и различные иммуногистохимические анализы.

ТИПИЧНЫЕ ОПРЕДЕЛЕНИЯ

В настоящей заявке термины «примерно» и «приблизительно» являются взаимозаменяемыми, и, как правило, их следует понимать как относящиеся к диапазону чисел вокруг заданного числа, а также ко всем числам в указанном диапазоне чисел (например, «примерно от 5 до 15» означает «примерно от 5 до примерно 15», если не указано иное). Более того, следует понимать, что в настоящей заявке все численные диапазоны включают каждое целое значение в пределах диапазона. В настоящей заявке термин «антиген» или «иммуноген» означает вещество, которое вызывает специфический иммунный ответ у животного-хозяина. Антиген может представлять собой целый организм, уничтоженный, ослабленный или живой; субъединицу или часть организма; рекомбинантный вектор, содержащий вставку с иммуногенными свойствами;

часть или фрагмент ДНК, способный индуцировать иммунный ответ при представлении животному-хозяину; белок, полипептид, пептид, эпитоп, гаптен или любую их комбинацию. В другом варианте антиген или иммуноген может включать токсин или антитоксин. Антиген, как правило, включает любое иммуногенное вещество, т.е. любое вещество, которое вызывает иммунный ответ (например, образование молекул специфических антител) при введении в ткани восприимчивого животного, и вещество, которое способно специфически связываться с антителом, которое производится в ответ на введение антигена. Антиген может распознаваться иммунной системой, вызывая гуморальный иммунный ответ и/или возбуждая клеточный иммунный ответ, приводящий к активации В- и/или Т-лимфоцитов. Антиген может включать один эпитоп, или два или более эпитопов.

В настоящей заявке термин «антитело» относится к белку, который связывается с другими молекулами (антигены) с помощью вариабельных доменов VH и VL тяжелой и легкой цепи, соответственно. Термин «антитело» относится к любой молекуле иммуноглобулина, включая, например, но не ограничиваясь перечисленными: IgM, IgG, IgA, IgE, IgD, а также любой их подкласс или комбинацию. Термин «антитело» также означает функциональный фрагмент молекулы иммуноглобулина, включая, например, но не ограничиваясь перечисленными: фрагменты Fab, Fab', (Fab')2, Fv, Fd, ScFv и sdFv, если не указано иное.

В настоящей заявке термин «антигенный полипептид» или «иммуногенный полипептид» представляет собой полипептид, который при введении позвоночному животному реагирует с молекулами иммунной системой позвоночных, т.е. является антигенным и/или индуцирует иммунный ответ у позвоночного животного, т.е. является иммуногенным. Выделенные антигенные и иммуногенные полипептиды согласно настоящему изобретению в дополнение к тем, которые кодируются полинуклеотидами согласно настоящему изобретению, могут быть предложены в виде рекомбинантного белка, очищенной субъединицы, экспрессирующего белок вирусного вектора, или могут быть предложены в виде инактивированной вирусной вакцины, например, живой ослабленной вакцины, убитой нагреванием вирусной вакцины и т.д.

В настоящей заявке «модифицированная живая вакцина» представляет собой вакцину, содержащую вирус, который был изменен, как правило, путем перевивания в клетках культуры ткани, для ослабления его способности вызывать заболевание, но который сохраняет свою способность защищать от болезни или инфекции при последующем введении животному.

В настоящей заявке термин « вспомогательное вещество» означает композицию, содержащую одно или более веществ, которые усиливают иммуногенность и эффективность модифицированного живого вируса или его антигена, когда они присутствуют в вакцинной композиции, содержащей популяцию таких вирусов, или множество таких антигенов.

В настоящей заявке термин «инфекционная доза» вируса определяется как доза, заражающая 50% культуры ткани (TCID50), или количество, которое необходимо для инфицирования или уничтожения 50% культуры ткани восприимчивых клеток.

В настоящей заявке термин «носитель» включает любой растворитель(и), дисперсионную среду, оболочку(и), разбавитель(и), буфер(ы), изотонический агент(ы), раствор(ы), суспензию(и), коллоид(ы), инертный наполнитель(и) или т.п., или их комбинацию, которая фармацевтически приемлема для введения соответствующему животному. Применение одного или более средств доставки химических соединений в целом, и иммуногенов в частности, хорошо известно специалистам в области фармацевтики. За исключением тех случаев, когда обычная среда или агент не совместимы с активным ингредиентом, его использование в диагностических, профилактических и терапевтических композициях включено в область изобретения. Один или более дополнительных активных ингредиентов могут также быть включены или введены в комбинации с одной или более раскрытыми иммуногенными композициями и их вакцинными составами.

В настоящей заявке термины «иммунизировать» и «иммунизация» или аналогичные термины относятся к приданию способности вырабатывать определяемый или предпочтительно значительный иммунный ответ против конкретного антигенного эпитопа или иммуногена. Эти термины не обязательно подразумевают полный иммунитет, а то, что вырабатывается иммунный ответ, который существенно больше, чем в начальных условиях, например, когда иммуногенные композиции согласно изобретению не вводят, или когда вводят обычные вакцины. Например, считается, что млекопитающее иммунизировано против одного или более целевых иммуногенов, если клеточный и/или гуморальный иммунный ответ на целевой иммуноген(ы) развивается (предпочтительно значительный иммунный ответ) после введения вакцинных композиций, раскрытых в настоящей заявке.

В настоящей заявке термин «иммунный ответ» к композиции или вакцине обозначает развитие клеточного и/или антитело-опосредованного иммунного ответа у животного-хозяина. Как правило, иммунный ответ включает (но не ограничиваются указанными) один или более из следующих эффектов: (а) выработку антител, (б) выработку В-клеток, (в) выработку Т-хелперов и/или (г) выработку цитотоксических Т-клеток, которые специфично нацелены на данный антиген или гаптен.

В настоящей заявке термин «иммуногенный» также относится к веществу, например, аминокислотной последовательности, части аминокислотной последовательности в белке, полипептиду или пептиду, или модифицированному или ослабленному убитому или живому вирусу, который вызывает иммунный ответ у животного-хозяина. В настоящей заявке термин «иммуногенный белок», «иммуногенный пептид», или «иммуногенный полипептид» обозначает белки, пептиды и полипептиды, которые иммунологически активны с тем, чтобы после введения хозяину они были способны вызывать иммунный ответ гуморального и/или клеточного типа, направленный против белка. Термин «эпитоп» относится к сайту белка, который способен индуцировать иммунный ответ гуморального типа (В-клетки) и/или клеточного типа (Т-клетки).

В настоящей заявке термин «патоген» определяют как какой-либо инфекционный агент, включая, например, вирусы, прионы, простейших, паразитов, а также микроорганизмы, такие как бактерии, дрожжи, плесень, грибки и тому подобные организмы.

В настоящей заявке термин «индивидуум» (также взаимозаменяемо называемый «хозяин», «субъект», «реципиент», «пациент» и т.д.) относится к любому животному, которое может получать одну или более фармацевтических композиций или вакцинных композиций, раскрытых в настоящей заявке. Предпочтительно субъектом является позвоночное животное, которое предназначено для обозначения любого вида животных (предпочтительно, млекопитающих). В некоторых вариантах индивидуум предпочтительно представляет собой любое млекопитающее, включая, но не ограничиваясь указанными: приматов, кроме человека, полорогих, собак, коз, свинковых, врановых, Epines, лошадей, кошек, коз, кроликов, зайцев, волков, овец, свиней, Racines, лис, и тому подобное, включая сельскохозяйственных животных, зоологические виды, экзотические виды, а также животных-компаньонов, домашних животных и любое животное, получающее ветеринарную помощь.

Фразы «ветеринарно приемлемый» и «фармацевтически приемлемый» относятся к молекулярным частицам и композициям, которые не вызывают аллергической или сходной неблагоприятной реакции при введении в организм млекопитающего. В настоящей заявке термин «фармацевтически приемлемая соль» означает соль, которая сохраняет требуемую биологическую активность исходного соединения и не придает нежелательных токсикологических эффектов. Примеры таких солей включают, но не ограничиваются указанными, кислотно-аддитивные соли, образованные с неорганическими кислотами, например, соляной кислотой, бромистоводородной кислотой, серной кислотой, фосфорной кислотой, азотной кислотой, и т.п.; и соли, образованные органическими кислотами, такими как, например, уксусная кислота, щавелевая кислота, винная кислота, янтарная кислота, малеиновая кислота, фумаровая кислота, глюконовая кислота, лимонная кислота, яблочная кислота, аскорбиновая кислота, бензойная кислота, дубильные кислоты, памовая (эмбоновая) кислота, альгиновая кислота, нафтойная кислота, полиглутаминовая кислота, нафталинсульфоновые кислоты, нафталиндисульфоновые кислоты, полигалактуроновая кислота; соли с поливалентными катионами металлов, таких как цинк, кальций, висмут, барий, магний, алюминий, медь, кобальт, никель, кадмий и тому подобные металлы; соли, образованные с органическим катионом, образованным из N,N'-дибензилэтилендиамина или этилендиамина; и их комбинации.

В настоящей заявке термин «защитный иммунный ответ» или «терапевтический иммунный ответ» относится к ЦТЛ и/или ХТЛ ответу на антиген, который некоторым образом предотвращает или, по крайней мере, частично купирует заболевание или симптомы, нежелательные эффекты или их прогрессирование. Иммунный ответ может также включать иммунный ответ, развитие которого облегчали путем стимуляции Т-хелперов.

В настоящей заявке термин «вакцина» относится к композиции или составу, который содержит иммуногенную композицию согласно настоящему изобретению в форме, которая может быть введена позвоночному животному, предпочтительно животному, такому как млекопитающее. Как правило, вакцины согласно настоящему изобретению включают одну или более иммуногенных композиций (включая одну или более модифицированных живых вирусных частиц или их множество), раскрытых в настоящей заявке, приготовленных для введения животному, которое нуждается в этом. Такие композиции могут иметь любой подходящий состав, включая, но не ограничиваясь перечисленными: полученные в водном носителе, а также в замороженной, лиофилизированной, сублимированной или обезвоженной форме, которые затем повторно гидратируют или суспендируют в обычных фармацевтически приемлемых носителях (например, стерильный физиологический раствор или аналогичный водный буферный раствор) перед введением. В таких формах вакцинные композиции согласно настоящему изобретению могут быть приготовлены в виде обычных разовых или многодозных аликвот, которые могут быть легко использованы согласно одному или более способов или схем вакцинации, раскрытых в настоящей заявке, для предотвращения, ведения или лечения каким-либо иным образом одного или более состояний или одного или более симптомов вирусной и/или бактериальной инфекции у предрасположенного животного.

При введении животному-хозяину иммуногенные композиции и вакцины, содержащие их, способны вызывать иммунный ответ, предпочтительно иммунный ответ, специфичный в отношении введенного антигена(ов), в результате которого полученную иммунную реакцию можно легко обнаружить с помощью обычных анализов, известных специалистам в области иммунологии, включая, но не ограничиваясь указанными, анализы для обнаружения выработки специфических антител, цитокинов и/или активации цитотоксических Т-клеток, антигенпрезентирующих клеток, Т-клеток, дендритных клеток и/или других клеточных реакций в клетках и тканях вакцинированных животных. Вакцинные композиции согласно настоящему изобретению могут содержать или быть одновременно введены с одним или несколькими вспомогательными веществами, по отдельности или в комбинации с одним или более дополнительными антигенами или т.п.

Вакцины и иммуногенные композиции согласно настоящему изобретению вызывают иммунный ответ у животного после иммунизации. В настоящей заявке термин «иммунный ответ» относится к гуморальному иммунному ответу и/или клеточному иммунному ответу, который приводит к активации или пролиферации В- и/или Т-лимфоцитов. В некоторых случаях, однако, иммунные ответы могут иметь низкую интенсивность и обнаруживаются только при использовании по меньшей мере одного вещества в соответствии с изобретением, тогда как другие могут потребовать повторного введения, вспомогательного вещества, второго или дополнительного активного агента, либо одной или более их комбинаций. Термин «вспомогательное вещество» относится к агенту, который используется для стимуляции иммунной системы живого организма, так что одна или несколько функций иммунной системы усиливаются и направляются на иммуногенный агент.

В настоящей заявке термины «лечение», «лечить», «получивший лечение» или «лечащий» относятся к терапии или облегчению одного или более симптомов заболевания или снижению степени и тяжести заболевания или его симптомов как до, так и после того как заболевание поражает предрасположенное животное. При использовании в отношении инфекционного заболевания, например, термины относятся к лечению или схеме лечения, которая уменьшает тяжесть инфекции, или уменьшает, или облегчает, или задерживает развитие одного или более симптомов заболевания, вызванных инфекцией, а также повышает способность зараженного животного бороться с инфекцией, включая, например, снижение и/или устранение инфекции из организма субъекта, получившего лечение, или снижает или предотвращает ухудшение заболевания, или распространение на других животных, которые контактируют с пораженным животным.

Термин «иммуногенно эффективное количество» имеет свое обычное значение в этой области техники, т.е. количество иммуногена, которое способно вызывать иммунный ответ, который существенно связывает патогенные агенты, имеющие общие с иммуногеном отличительные иммунологические особенности. Данный термин может также включать терапевтически или профилактически эффективное количество, или и то, и другое.

В настоящей заявке термины «предотвращение», «предотвращать», «предотвращенный», «предотвращающий», «вакцинировать» и «вакцинация» относятся к профилактике или к частичному или полному ингибированию инфекции, или снижению или задержке начала одного или более заболеваний, или одного или более его симптомов у животного, которое может быть предрасположено к указанному заболеванию, но до сих пор не подвергалось воздействию или у которого указанное заболевание не было диагностировано. При использовании в отношении инфекционного заболевания, например, термины относятся к профилактическому введению одной или более иммуногенных композиций согласно изобретению, которое как правило, вызывает увеличение резистентн ости животного к заражению одним или более вирусных или бактериальных патогенов или, другими словами, снижает вероятность того, что субъект будет инфицирован патогеном(и), или, в случае инфицирования, приведет к задержке развития симптомов, уменьшению тяжести инфекции, или уменьшению симптомов заболевания, вызванного инфекцией, или любой их комбинации у инфицированного животного.

Любой из терминов «предотвращение» и «лечение» включают ведение конкретной инфекции, заболевания, состояния или его симптома у животного, а также любые полезные модификации статуса кандидата или течения заболевания или состояния или любого его симптома. Ведение заболевания может касаться некоторых или всех его симптомов или не оказывать фактического воздействия на основную инфекцию или любое заболевание или состояние, развившееся в результате этого.

В настоящей заявке термин «например» используют только в качестве примера, без намерения ограничить область изобретения, и не должен быть истолкован как относящийся только к тем элементам, которые конкретно перечислены в настоящем описании изобретения.

В соответствии с устоявшейся конвенцией по патентному праву в настоящей заявке, включая формулу изобретения, слова «а» и «an» означают «один или более».

ПРИМЕРЫ

Для демонстрации иллюстративных вариантов реализации настоящего изобретения в заявку включены следующие примеры. Специалисты должны принять во внимание, что методики, описанные в нижеследующих примерах, представляют собой методики, которые, как было обнаружено, хорошо функционировали при осуществлении изобретения, и таким образом могли рассматриваться в качестве основы предпочтительных способов его осуществления. Вместе с тем, в свете настоящего описания специалисты должны принять во внимание, что в конкретные описанные варианты реализации можно внести большое количество изменений и при этом получить сходный или аналогичный результат, не выходя за рамки настоящего изобретения.

ПРИМЕР 1 - ПОЛУЧЕНИЕ ОСЛАБЛЕННОГО ЖИВОГО ВИРУСА БЫЧЬЕЙ ВИРУСНОЙ ДИАРЕИ (BVDV)

Настоящий пример обеспечивает иллюстративный способ крупномасштабного получения ослабленного живого вируса (MLV) BVDV-1b.

МАТЕРИАЛЫ И СПОСОБЫ

ВИРУС И МИКРООРГАНИЗМЫ

Штамм TGAC BVDV-1B получили в лаборатории центра разработки ветеринарных биопрепаратов (CVB-L) службы инспекции здоровья животных и растений (APHIS) министерства сельского хозяйства США (USDA) (Эймс, штат Айова, США). Исходная культура (MS) впоследствии была названа "TVL-BVDV1b MS 04/27/2007 DW3-095", и, как отмечено в совместно рассматриваемой предварительной патентной заявке США №61/427404, поданной одновременно с настоящей заявкой, депонирована в условиях, обеспечивающих доступность культуры на время рассмотрения настоящей патентной заявки для лица, умолномоченного Комиссаром по патентам и товарным знакам, в соответствии с 37 C.F.R. §1,14 and 35 U.S.C. § 122. Указанный депозит доступен в соответствии с требованиями иностранных патентных законодательств в странах, где поданы эквиваленты рассматриваемой заявки или дальнейших заявок на ее основе. Тем не менее, следует понимать, что доступность депозита не дает разрешения на практическую реализацию рассматриваемого изобретения в нарушение патентных прав, преследуемую органами государственной власти. Депонированная исследуемая культура хранится в общедоступном виде в соответствии с положениями Будапештского договора о депонировании микроорганизмов, т.е. хранится с соблюдением всех мероприятий, необходимых для сохранения ее жизнеспособности и чистоты, в течение, по меньшей мере, пяти лет после последнего запроса образца депозита, и в любом случае в течение, по меньшей мере, 30 (тридцати) лет после даты депонирования, или в течение периода действия любого патента, в котором может быть опубликовано описание депонированной культуры. Депозитор признает, что задержка замены депозита приведет к неспособности депозитария предоставить запрашиваемый образец из-за состояния депозита. Все ограничения общедоступности депонированной исследуемой культуры будут окончательно сняты после выдачи патента, описывающего ее. Депозит вируса TVL BVDV1b MS 04/27/2007 DW3-095 был введен в постоянную коллекцию патентного депозитария Американской лаборатории типовых культур, расположенной по адресу 10801 University Blvd., Manassas, VA, 20110-2209, USA, 21 декабря 2010 года согласно условиям Будапештского договора, после чего депозитарий присвоил ему номер АТСС РТА-11553.

Выполнили оценку идентичности исходной культуры вируса (MSV) с использованием полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР), положительно идентифицировавшую исходную культуру вируса как BVDV-1b. Протокол ПЦР-дифференциации вируса бычьей вирусной диареи разработан в работе Ridpath and Bolin, 1998 (полностью включенной в настоящее описание посредством экспресс-ссылки). Положительную идентификацию выполнили с использованием иммунофлюоресцентного анализа (РИФ) (McNulty et at, 1984). Репликация этих вирусов в клетках почки КРС Texas Vet Lab Bovine Kidney (TVL-BK) позволила получить легко распознаваемые цитопатологические изменения.

ЧАСТОТА ИДЕНТИФИКАЦИИ МИКРООРГАНИЗМОВ

Перед инокуляцией клеток TVL-BK продуктивным исходным вирусом клетки микроскопически визуализировали с целью подтверждения того, что морфология клеток соответствует ранее описанной. Перед сбором каждой партии продуктивного вируса выполняли наблюдение клеток TVL-BK с целью подтверждения проявления типичных цитопатологических эффектов (СРЕ), связанных с вирусом.

ВИРУЛЕНТНОСТЬ, ПОДДЕРЖАНИЕ И ДИАПАЗОН КУЛЬТУР ИЛИ СУБКУЛЬТУР

Стабильность вирулентности, активности и антигенных свойств BVDV-1b, используемого в настоящей вакцине, обеспечивали путем хранения в лиофилизированном или замороженном состоянии, а также ограничений количества пересевов или субкультур. Диапазон: Продуктивный вирус=MSV+10 (эффективный последовательный пересев), однако может представлять собой любой пересев между 5 и 10. Продуктивная культура клеток=MCS+20 (эффективный последовательный пересев), однако также может представлять собой любой пересев менее 20.

СОСТАВ И РЕАКЦИЯ СРЕДЫ, ИСПОЛЬЗУЕМОЙ В ИСХОДНОЙ И ПРОДУКТИВНОЙ КУЛЬТУРЕ

Состав и реакция среды, используемой в исходной и продуктивной культуре, являлись следующими: Инокулят рабочего вируса (MSV+1 - MSV+8) и инокулят продуктивного вируса (являвшийся обычно, но не исключительно MSV+9), размножали в клетках TVL-ВК, при условии, что количество пересевов клеток TVL-BK для размножения вируса не превышало 20 пересевов от MCS. Ростовой средой (как для рабочих, так и для продуктивных препаратов клеток) являлась среда Игла, модифицированная по Дульбекко (DMEM).

Полученный MSV можно было хранить в лиофилизированном виде, в среде для криоконсервации в жидком азоте или в среде для криоконсервации при температуре от -70 до -85°С. MCS можно было хранить в среде для криоконсервации (в жидком азоте) или в среде для криоконсервации при температуре от -70 до -85°С.

СПОСОБЫ ПОЛУЧЕНИЯ СУСПЕНЗИЙ ДЛЯ ПОСЕВА И ИНОКУЛЯЦИИ

Криопробирки, содержавшие замороженные клетки TVL-BK, быстро размораживали. Культуральные колбы заполняли средой до рекомендованной емкости и асептически переносили суспендированные клетки из Криопробирки к культуральную колбу. Культуральные сосуды также засевали расщепляющимися активно размножающимися культурами в соотношении от 1:3 до 1:6 (см2:см2). TVL-BK в колбах или роллер-флаконах, предназначенных для субкультивирования, высвобождали с культуральной поверхности путем асептического удаления ростовой среды и добавления IX раствора трипсин-ЭДТА. После инкубирования (5 мин, при 35-39°С) монослой диспергировался. Трипсин инактивировали путем добавления диспергированных клеток в культуральный сосуд с ростовой средой. Замороженные аликвоты вируса быстро размораживали или ресуспендировали в среде, если исходный вирус был лиофилизирован. Клетки TVL-BK (+20 или менее) инокулировали вирусом. Вирус, реплицированный в колбах или роллер-флаконах, предназначеных для субкультивирования, собирали после соответствующего инкубационного периода и/или проявления СРЕ. Затем вирусные суспензии хранили при температуре от 6 до -80°С или немедленно использовали для инокуляции других культуральных сосудов.

Для инокуляции сред для исходных и продуктивных культур использовали стандартные методики культивирования клеток. Клетки TVL-BK инокулировали во время 20 или меньшего пересева. Замороженный инокулят продуктивного вируса, обычно представлявший собой MSV+9, быстро размораживали. Объем вирусного инокулята находился в диапазоне от 1 до 25 мл на 1600 см2 площади культуры, что позволяло достичь множественности заражения от 0,01 до 1,0 вирусов на клетку. Минимальный титр инокулята составлял: 105,0 TCID50 (доз, инфицирующих тканевую культуру) на мл для BVDV-1b. Инокулированные культуры инкубировали при 37±2°С и 5±1% СО2 в течение 2-4 суток.

СБОР ПРОДУКТА

В день сбора продукта культуры исследовали на вирусспецифические СРВ и стерильность. Типичное минимальное время инкубирования составляло 2 суток после инокуляции BVDV-1b. Типичное максимальное время инкубирования составляло 4 суток после инокуляции BVDV-1b. Вирусные суспензии асептически собирали из продуктивных сосудов. Образцы собирали для определения TCID50 продукта. Собранный материал хранили при температуре от 6 до -80°С. Собранный материал мог храниться при температурах выше нуля до одного месяца, а в замороженном виде - до шести месяцев перед получением конечного продукта.

Собранные жидкости, обладавшие нетипичными СРВ или признаками загрязненности, выбрасывали. Только собранные жидкости, обладавшие типичными СРВ и не Содержавшие загрязнений, подходили для дальнейшего использования. Минимально приемлемый титр собранного вируса составлял 106 TCID50/мл.

Чистоту собранных жидкостей подтверждали следующим образом: 2-мл образца собранной жидкости асептически добавляли к 38 мл SCDB и инкубировали при 35-39°С наряду с отрицательным (только среда) и положительным контролями в течение 46-50 часов. Отсутствие макроскопического роста в культурах, а также в отрицательном контроле позволило установить, что собранные жидкости были чистыми и подходили для дальнейшего использования. Собранные жидкости, чистота которых не подтверждалась, выбрасывали.

ТИПИЧНЫЙ СОСТАВ ЖИВОГО ОСЛАБЛБННОГО ВИРУСА БЫЧЬЕЙ ВИРУСНОЙ ДИАРБИ

Все операции выполняли асептически. Во время сборки серии или субсерии вакцины добавляли подходящие антибиотики, например, неомицин и нистатин (микостатин) в количестве 15 мкг и 15 единиц/дозу, соответственно. Собранные жидкости по мере необходимости разбавляли DMEM с целью регулирования концентрации и стабилизировали добавлением раствора сахарозы, отфильтрованного через 0,2-мкм фильтр, получая конечную концентрацию сахарозы 20±1%.

Собранные вирусные жидкости необязательно концентрировали путем стерильной ультрафильтрации, используя фильтр с 10-кДа отсечкой по молекулярной массе. Степень концентрирования обычно не превышала 50-кратной.

Каждую партию собранных вирусных жидкостей анализировали с целью определения TCID50. Вкратце, для инокуляции клеток TVL-BK в 96-луночном планшете использовали десятикратные разведения (от 10-1 до 10-8) собранного материала. Планшеты инкубировали при 37±2°Си5±1% С02 в течение 96±6 часов. После инкубирования планшеты считывали при 100-кратном увеличении и исследовали на СРЕ. Титры определяли по способу Спирмена-Карбера с поправкой по Finney (1978).

Предварительно стерилизованные конечные контейнеры асептически заполняли. Конечные контейнеры частично закупоривали стерильной пробкой с внутренним уплотнением. Флаконы с конечным продуктом переносили в лиофилизатор и высушивали. Время цикла сушки колебалось от 24 до 72 часов при максимальной температуре продукта 22°С. Содержание влаги в высушенном конечном продукте обычно не превышало 5%, а минимальное количество антигенного материала на дозу в конечном контейнере предпочтительно составляло приблизительно 8×103 TCID50 на дозу.

ПРИМЕР 2 - ИССЛЕДОВАНИЕ МОНОВАЛЕНТНОЙ ВАКЦИНЫ BVDV-1B ПУТЕМ КОНТРОЛЬНОГО ЗАРАЖЕНИЯ ТЕЛЯТ

Настоящий пример демонстрирует эффективность моновалентной вакцины BVDV-1b для профилактики инфекции у вакцинированных животных.

МАТЕРИАЛЫ И МЕТОДЫ

ЖИВОТНЫЕ

Здоровых четырех-пятимесячных телок смешанной породы приобрели из коммерческих источников, идентифицировали по случайно выбранным номерам ушных бирок и подвергли серологическому скринингу на чувствительность к вирусу бычьей вирусной диареи. Все телята получили одну дозу кристаллической свободной кислоты цефтиофура (Excede®, Pfizer Animal Health, Нью-Йорк, штат Нью-Йорк, США) по прибытии. У телят был свободный доступ к воде, сену и гранулированному кормовому рациону.

ВАКЦИНА

Ослабленную живую вирусную вакцину BVDV-1b получали, как описано выше. Вкратце, исходную культуру BVDV-1b размножали в клетках линии TVL-BK (20-й пересев), собирали во время 10-го пересева, стабилизировали в соответствии с планом производства, разливали в бутыли и лиофилизировали. Концентрация BVDV составляла 8×103 TCID50 на дозу согласно способу Спирмена-Карбера (см., например, Finney, 1978). В качестве разбавителя для регидратации вакцины использовали стерильную воду.

ВАКЦИНАЦИЯ И ЗАРАЖЕНИЕ ТЕЛЯТ

Девятнадцать (19) BVDV-отрицательных телят объединили в проходе для сортировки. Каждого теленка поместили в одну из двух групп (вакцинированных или невакцинированных контрольных животных), используя схему рандомизации при подборе согласованных групп (Таблица 1), предоставленную CVB-Biometrics (Эймс, штат Айова, США).

ТАБЛИЦА 1
ТАБЛИЦА РАНДОМИЗАЦИИ СОГЛАСОВАННЫХ ПАР
Подопытный субъект Группа Теленок
1 А 53
2 Б 12
3 А 54
4 Б 2
5 А 50
6 А 74
7 Б 32
8 А 77
9 Б 3
10 А 67
11 Б 22
12 А 72
13 Б 71
14 Б 1
15 А 69
16 Б 58
17 А 39
18 А 65
19 Б 68
Группа А = вакцинированные; Группа Б = невакцинированные контрольные животные

Десять серологически отрицательных телят вакцинировали одной дозой вакцины BVDV-1b. Каждое вакцинированное животное получало 2-мл дозу продукта путем подкожной инъекции в левую сторону шеи в день 0. Остальные телята не получали вирусных вакцин. После вакцинации две группы телят содержали в отдельных, но эквивалентных фермах в течение двух суток до заражения.

Образцы крови собирали в день прибытия и тестировали на титр BVDV. Образцы крови также собирали в день вакцинации и день заражения. Титры антител BVDV-1b определяли при постоянной концентрации вируса и уменьшающихся концентрациях нейтрализующей сыворотки (Schefers et al., 2008). За два дня до заражения как вакцинированную, так и невакцинированную контрольную группы объединили с целью клинического обследования перед заражением. Через 14 (четырнадцать) дней после вакцинации вакцинированных и контрольных телят заражали вирулентным изолятом BVDV-1b, полученным из легких теленка, умершего в загоне. Вирус высевали in vitro на клетки TVL-BK, используя DMEM, содержащую 10% сыворотку лошади. Дозу для заражения 8×107 TCID50 в 4 мл вводили каждому теленку по 2 мл в каждый носовой канал во время вдоха.

Ректальные температуры ежедневно записывали для каждого теленка в течение двух дней до заражения, в день заражения и в течение 14 дней после заражения.

Количество лейкоцитов (WBC) определяли для каждого теленка в течение двух дней до заражения, в день заражения и в течение 14 дней после заражения. Образцы собирали в пробирки Vacutainer® с ЭДТА, подсчет выполняли, используя дифференциальный счетчик лейкоцитов Drew Scientific (Уотербери, штат Коннектикут, США) Hemavet 950™.

У каждого теленка собирали назальные мазки и лейкоцитарную массу за два дня до заражения, в день заражения и в течение 14 дней после заражения с целью выделения BVDV. Назальные мазки собирали с помощью тампон-зондов для культивирования BBL Culture Swabs с жидкой средой Стюарта (Becton, Dickinson and Company, Спаркс, штат Мэриленд, США). Среду из образцов стерильно фильтровали и использовали для инокуляции 80%-конфлюентной культуры клеток TVL-BK. Лейкоцитарную массу собирали из вакуумных пробирок с ЭДТА и использовали для инокуляции 80%-конфлюентной культуры клеток TVL-BK. Лейкоцитарную массу удаляли после инкубирования в течение часа. Культуры инкубировали в течение от 4-5 дней в 5±2% CO2 при температуре 37±3°С. Супернатанты из всех образцов культуры анализировали на присутствие BVDV-1b с помощью ОТ-ПЦР, используя BVDV-1b-специфический набор праймеров (BVDV-1b (первый)), разработанный авторами настоящего изобретения, с подходящим зондом для обнаружения:

BVDV-1b (первый):

Прямой праймер: 5'-CACCCTATCAGGCTGTATTCATAGC-3' (SEQ ID NO:1);

Обратный праймер: 5'-TGCCCACAGCACATCTTAACC-3' (SEQ ID NO:2); и

Зонд для обнаружения BVDV-1b: 5'-TCACCTGGACGACCC-3' (SEQ ID NO:3).

BVDV-1b (второй):

Второй прямой праймер: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:19);

Второй обратный праймер: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:20); и

Второй зонд для обнаружения BVDV-1b: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:21).

Хотя BVDV-1b (первый) обеспечивает приемлемые результаты, BVDV-1b (второй) демонстрирует лучшие результаты.

Все клинические наблюдения выполняли независимо, у наблюдателей отсутствовала информация о групповой принадлежности, поскольку как вакцинированную, так и невакцинированную контрольную группу объединили, и единственным отличительным признаком являлся номер ушной бирки. На протяжении всего исследования до получения клинических оценок у наблюдателей отсутствовала информация о статусе вакцинации отдельных подопытных животных.

СТАТИСТИЧЕСКИЙ АНАЛИЗ

Лейкопения: Среднее количество лейкоцитов до заражения рассчитывали для каждого животного путем усреднения количества лейкоцитов с -2 по 0 день. Для каждого дня после заражения с 1 по 14 день рассчитывали ежедневное соотношение количества лейкоцитов по сравнению со средним уровнем до заражения (количество лейкоцитов в виде доли от их количества до заражения). Это соотношение анализировали с целью определения развития лейкопении у отдельных животных по 25% снижению количества по сравнению с исходным уровнем. Предотвращаемую фракцию вычисляли, как описано в работе Tanner and Morgan (1993), с целью определения предотвращения развития лейкопении за счет вакцинации в данном исследовании.

Выделение из назальных мазков: Информация о выделении вируса из назальных мазков основана на доле вакцинированных животных, у которых был выделен BVDV, по сравнению с долей контрольных животных, у которых был выделен BVDV после заражения. Предотвращаемую фракцию для выделения BVDV-1b рассчитывали, как описано в работе Tanner and Morgan (1993).

Виремия Информация о выделении вируса из лейкоцитарной массы образцов крови анализировали на основе доли вакцинированных животных, у которых был выделен BVDV-1, по сравнению с долей контрольных животных, у которых был выделен BVDV после заражения. Предотвращаемую фракцию рассчитывали, как описано в работе Tanner and Morgan (1993).

Титры антител: Сравнение титров, приведенных к порядковой шкале, по группам анализировали с помощью U-критерия Манна-Уитни.

Ректальная температура: Для каждого животного определяли среднюю ректальную температуру до заражения. Это среднее значение использовали в качестве ковариаты в повторном дисперсионном анализе (ANOVA), включавшем эффекты Группы, Дня и взаимодействие Группа* День.

Все статистические анализы проводили с использованием SAS Learning Edition v2.0 for Microsoft Windows® (SAS Institute, Inc, Кэри, штат Северная Каролина, США).

РЕЗУЛЬТАТЫ

Лейкопению обнаружили у одного из десяти вакцинированных животных и восьми из девяти контрольных животных, что позволило получить значение предотвращаемой фракции 87%. Необработанные данные о количестве лейкоцитов записаны в Таблице 2.

ТАБЛИЦА 2
КОЛИЧЕСТВО ЛЕЙКОЦИТОВ
ВАКЦИНИРОВАННЫЕ ЖИВОТНЫЕ
Вакцинированные животные День -2 День -1 День 0 День 1 День 2 День 3 День 4 День 5 День 6
39 10,62 9,24 8,56 6,42 7,60 8,66 8,48 9,58 8,20
50 6,30 5,94 5,00 4,68 6,58 5,78 6,22 9,40 8,04
53 7,66 7,10 6,90 7,14 7,00 8,10 8,14 8,62 8,18
54 4,62 4,00 4,38 4,98 5,14 5,96 5,54 6,52 7,08
65 6,08 4,56 5,26 4,90 5,06 4,52 4,14 5,68 6,04
67 8,40 9,08 8,62 7,80 9,10 8,40 8,68 9,06 9,96
69 7,20 6,76 6,78 7,22 7,94 7,52 7,42 7,20 6,76
72 7,22 6,98 6,52 5,94 5,94 5,94 6,22 7,10 5,86
74 8,02 7,32 7,46 7,96 11,00 8,10 8,26 7,08 7,26
77 7,22 5,90 5,10 4,72 4,76 4,86 6,22 6,12 7,02
ТАБЛИЦА 2 (ПРОДОЛЖЕНИЕ)
ВАКЦИНИРОВАННЫЕ ЖИВОТНЫЕ
Вакцинированные животные День 7 День 8 День 9 День 10 День 11 День12 День 13 День 14
39 8,30 10,62 6,72 10,76 15,38 11,42 9,38 11,62
50 8,88 6,30 6,54 6,44 6,22 5,92 7,24 6,04
53 9,06 7,66 8,74 10,06 11,14 9,66 10,70 10,58
54 6,94 4,62 5,40 5,72 7,62 8,46 8,02 9,26
65 5,00 6,08 4,78 5,30 6,08 9,80 8,14 7,28
67 8,56 8,40 9,60 9,60 9,54 11,24 11,38 9,38
69 6,40 7,20 7,10 8,98 9,96 12,74 11,54 10,14
72 6,08 7,22 5,64 7,24 7,22 7,76 7,12 12,94
74 6,16 8,02 8,06 7,44 8,46 9,62 9,78 9,96
77 6,44 7,22 5,94 6,00 7,92 8,04 9,78 8,42
ТАБЛИЦА 2 (ПРОДОЛЖЕНИЕ)
КОНТРОЛЬНЫЕ ЖИВОТНЫЕ
Контрольные животные День -2 День -1 День 0 День 1 День 2 День 3 День 4 День 5 День 6
1 11,62 10,90 11,78 12,28 11,14 7,66 8,70 7,76 9,40
2 10,40 9,68 9,68 10,60 10,22 8,12 8,84 7,70 7,96
3 8,10 7,68 8,28 9,82 7,80 10,26 5,90 5,02 5,52
12 6,76 7,08 6,98 7.78 8,42 7,52 5,60 4,64 4,98
22 10,22 8,82 8,16 9,84 9,42 6,28 5,40 5,28 5,48
32 10,40 11,32 9,54 8,72 8,84 7,82 5,96 5,68 7,18
58 6,40 6,00 6,52 6,64 7,22 5,24 2,58 2,56 3,70
68 8,72 8,30 7,06 8,52 8,28 6,18 5,38 4,08 3,93
71 5,94 6,28 6,90 6,22 7,92 5,90 8,06 6,08 6,54
ТАБЛИЦА 2 (ПРОДОЛЖЕНИЕ)
КОНТРОЛЬНЫЕ ЖИВОТНЫЕ
Контрольные животные День 7 День 8 День 9 День 10 День 11 День 12 День 13 День 14
1 8,60 11,62 9,00 8,70 7,66 4,64 6,54 5,92
2 9,12 10,40 11,96 10,10 9,50 9,56 9,20 9,86
3 6,94 8,10 10,62 3,68 3,64 4,58 4,02 5,00
12 4,00 6,76 4,56 5,80 6,42 7,22 8,04 7,96
22 5,82 10,22 9,42 7,10 7,44 7,94 8,36 8,58
32 8,04 10,40 8,12 16,52 6,28 7,20 8,38 8,94
58 4,60 6,40 5,08 9,60 4,48 7,30 6,74 6,08
68 5,10 8,72 5,00 7,18 5,08 5,90 5,80 5,48
71 9,94 5,94 9,20 6,80 7,18 6,56 7,00 6,68

Ежедневное соотношение количества лейкоцитов от среднего количества до заражения для каждого отдельного теленка показано в Таблице 3.

ТАБЛИЦА 3
КОЛИЧЕСТВО ЛЕЙКОЦИТОВ - ПРОЦЕНТ ОТ СРЕДНЕГО ЗНАЧЕНИЯ ДО ЗАРАЖЕНИЯ
ВАКЦИНИРОВАННЫЕ ЖИВОТНЫЕ
Вакцинированные животные День 1 День 2 День 3 День 4 День 5 День 6 День 7 День 8
39 -0,322 -0,198 -0,086 -0,105 0,011 -0,134 -0,124 0,121
50 -0,186 0,145 0,006 0,082 0,636 0,399 0,545 0,096
53 -0,011 -0,030 0,122 0,127 0,194 0,133 0,255 0,061
54 0,149 0,186 0,375 0,278 0,505 0,634 0,602 0,066
65 -0,075 -0,045 -0,147 -0,219 0,072 0,140 -0,057 0,147
67 -0,103 0,046 -0,034 -0,002 0,041 0,145 -0,016 -0,034
69 0,044 0,149 0,088 0,073 0,041 -0,022 -0,074 0,041
72 -0,140 -0,140 -0,140 -0,099 0,028 -0,152 -0,120 0,045
74 0,047 0,447 0,066 0,087 -0,068 -0,045 -0,189 0,055
77 -0,223 -0,216 -0,200 0,024 0,008 0,156 0,060 0,189
ТАБЛИЦА 3 (ПРОДОЛЖЕНИЕ)
ВАКЦИНИРОВАННЫЕ ЖИВОТНЫЕ
Вакцинированные животные День 9 День 10 День 11 День 12 День 13 День 14 Лейкопения
39 -0291 0,136 0,624 0,205 -0,010 0,227 +
50 0,138 0,121 0,082 0,030 0,260 0,051 -
53 0,211 0,393 0,543 0,338 0,482 0,465 -
54 0,246 0,320 0,758 0,952 0,851 1,137 -
65 -0,098 0,000 0,147 0,849 0,536 0,374 -
67 0,103 0,103 0,097 0,292 0,308 0,078 -
69 0,027 0,299 0,441 0,843 0,669 0,467 -
72 -0,183 0,048 0,045 0,124 0,031 0,874 -
74 0,061 -0,021 0,113 0,266 0,287 0,311 -
77 -0,022 -0,012 0,304 0,324 0,610 0,386 -
ТАБЛИЦА 3 (продолжение)
КОНТРОЛЬНЫЕ ЖИВОТНЫЕ
Контрольные животные День 1 День 2 День 3 День 4 День 5 День 6 День 7 День 8
1 0,074 -0,026 -0,330 -0,239 -0,321 -0,178 -0,248 0,016
2 0,069 0,030 -0,181 -0,109 -0,224 -0,198 -0,081 0048
3 0,224 -0,027 0,279 -0,264 -0,374 -0,312 -0,135 0,010
12 0,121 0,213 0,084 -0,193 -0,331 -0,282 -0,424 -0,026
22 0,085 0,039 -0,307 -0,404 -0,418 -0,396 -0,358 0,127
32 -0,163 -0,152 -0,250 -0,428 -0,455 -0,311 -0,228 -0,002
58 0,053 0,145 -0,169 -0,591 -0,594 -0,413 -0,271 0,015
68 0,061 0,032 -0,230 -0,330 -0,492 -0,512 -0,365 0,086
71 -0,024 0,243 -0,074 0,265 -0,046 0,026 0,560 -0,068
ТАБЛИЦА 3 (продолжение)
КОНТРОЛЬНЫЕ ЖИВОТНЫЕ
Контрольные животные День 9 День 10 День 11 День 12 День 13 День 14 Лейкопения
1 -0,213 -0,239 -0,330 -0,594 -0,428 -0,482 +
2 0,206 0,018 -0,042 -0,036 -0,073 -0,006 -
3 0,324 -0,541 -0,546 -0,429 -0,499 -0,377 +
12 -0,343 -0,164 -0,075 0,040 0,159 0,147 +
22 0,039 -0,217 -0,179 -0,124 -0,078 -0,054 +
32 -0,221 0,585 -0,397 -0,309 -0,196 -0,142 +
58 -0,195 0,522 -0,290 0,158 0,069 -0,036 +
68 -0,377 -0,105 -0,367 -0,265 -0,277 -0,317 +
71 0,444 0,067 0,127 0,029 0,098 0,048 -

BVDV-1b был выделен из носовых секретов одного из десяти вакцинированных и восьми из девяти контрольных животных, что позволило получить предотвращаемую фракцию 90%. Указанные данные представлены в Таблице 4.

Таблица 4
Выделение BVDV-1B из назальных мазков
Вакцинированные животные
Вакцинированные животные День 0 День 1 День2 День3 День 4 День 5 День 6 День7 День 8
39 - - - - - - - - -
50 - - - - - - - - -
53 - - - - - - - - -
54 - - - - - - - - -
65 - - - - - - - - -
67 - - - - - - - - -
69 - - - - - - - - -
72 - - - - - - - - -
74 - - - - - - - - -
77 - - - - - - - - -
Таблица 4 (продолжение)
Вакцинированные животные
Вакцинированные животные День 9 День 10 День 11 День 12 День 13 День 14 Выводы
39 - - - - - - -
50 - - - - - - -
53 - - - - - - -
54 - - - - - - -
65 - - - - - - -
67 - + - - - - +
69 - - - - - - -
72 - - - - - -
74 - - - - - - -
77 - - - - - - -
Таблица 4 (продолжение)
Контрольные животные
Контрольные животные День 0 День 1 День 2 День 3 День 4 День 5 День 6 День 7 День 8
1 - - - - - - + - +
2 - - - - - - - - -
3 - - - - + - + - -
12 - - - - - + + - +
22 - - - - - - - - +
32 - - - - + - + - +
58 - - - - - - + - +
68 - - - - - - - - +
71 - - - - + - - - +
Таблица 4 (продолжение)
Контрольные животные
Контрольные животные День 9 День 10 День 11 День 12 День 13 День 14 Выводы
1 - - - - - - +
2 - - + - - - +
3 - + + + + + +
12 + - - - + - +
22 + - - - + - +
32 - - + - + - +
58 + + + + + - +
68 + + + + + - +
71 - + - - - - +
+ означает положительный результат; - обозначает отрицательный результат.

BVDV-1b был выщелен из лейкоцитарной массы двух вакцинированных телят и всех девяти контрольных телят, что позволило получить предотвращаемую фракцию 80%. Указанные данные представлены в Таблице 5.

Таблица 5
Выделение BVDV-1B из лейкоцитарной массы
Вакцинированные животные
Вакцинированные животные День 0 День 1 День 2 День 3 День 4 День 5 День 6 День 7 День 8
39 - - - - - - - - -
50 - - - - - - - -
53 - - - - - - - - -
54 - - - - - - - - -
65 - - - - - - - - -
67 - - - - - - - - -
69 - - - - - - - - -
72 - - - - - - - - -
74 - - - - - - - - +
77 - - - - - - - - -
Таблица 5 (продолжение)
Вакцинированные животные
Вакцинированные животные День 9 День 10 День 11 День 12 День 13 День 14 Выводы
39 - - - - - - -
50 - - - - - - -
53 - - - - - - -
54 - - - - - - -
65 - - - - - - -
67 - - - - - - +
69 - - - - - - -
72 - - - - - - -
74 - - - - - - +
77 - - - - - - -
Таблица 5 (продолжение)
Контрольные животные
Контрольные животные День 0 День 1 День 2 День 3 День 4 День 5 День 6 День 7 День 8
1 - - - + - + + + -
2 - - - - - + + + +
3 - - - - + + + + -
12 - - - - - + + + +
22 - - - - + + + + +
32 - - - - + + + - +
58 - - - + + + + + +
68 - - - - - + + + +
71 - - - - + + + + +
Таблица 5 (продолжение)
Контрольные животные
Контрольные животные День 9 День 10 День 11 День 12 День 13 День 14 Выводы
1 + - - - - - +
2 + + - - - - +
3 + + - - - - +
12 + + + - - - +
22 - + - - - - +
32 - + - - - - +
58 + + - - - - +
68 + + + - - - +
71 - + - - - - +

Вакцинация вызывала статистически значимое (Р<0,05) увеличение титров нейтрализующих антител к BVDV-1b. Вакцина не вызывала значительного увеличения титров нейтрализующих антител к BVDV-1a BVDV-2. Отдельные титры нейтрализующих антител представлены в Таблице 6.

Таблица 6
Титры сывороточных нейтрализующих антител
Типы 1a 1b 1b 2 2
Вакцинированное животное Перед вакцинированием Перед заражением Перед вакцинированием Перед заражением Перед вакцинированием Перед заражением
39 <2 <2 <2 16 <2 <2
50 <2 4 <2 16 <2 <2
53 <2 <2 <2 <2 <2 8
54 <2 <2 <2 8 <2 <2
65 <2 <2 <2 <2 4 2
67 <2 <2 <2 16 4 <2
69 <2 <2 <2 64 <2 <2
72 <2 <2 <2 128 <2 2
74 <2 8 <2 256 <2 <2
Таблица 6 (продолжение)
Типы 1a 1b 1b 2 2
Контрольные животные Перед вакцинированием Перед заражение м Перед вакцинированием Перед заражением Перед вакцинированием Перед заражением
1 <2 <2 <2 <2 <2 <2
2 <2 <2 <2 <2 <2 <2
3 <2 <2 <2 <2 <2 <2
12 <2 <2 <2 <2 <2 <2
22 <2 <2 <2 <2 <2 <2
32 <2 <2 <2 <2 <2 <2
58 <2 <2 <2 <2 <2 <2
68 <2 <2 <2 <2 <2 <2
71 <2 <2 <2 <2 <2 <2

Анализ данных о ректальной температуре не выявил статистически значимого действия вакцинации. Данные о ректальной температуре приведены в Таблице 7.

Таблица 7
Ректальные температуры
Вакцинированные животные
Вакцинированные животные День -2 День -1 День 0 День 1 День 2 День 3 День 4 День 5 День 6
39 103,1 100,8 102,0 99,5 100,4 100,7 101,2 101,7 102,2
50 102,5 101,3 101,6 99,6 100,6 100,6 101,5 101,0 102,6
53 103,1 101,2 102,1 99,4 101,4 101,0 101,8 100,4 102,3
54 102,1 101,7 102,1 100,3 101,4 101,4 101,2 101,5 101,0
65 102,7 102,8 104,3 101,1 100,9 102,4 101,5 101,4 101,4
67 102,8 101,3 102,0 101,4 100,5 101,3 101,1 101,2 101,5
69 101,2 100,6 101,1 99,3 100,9 101,8 1015 101,4 101,6
72 102,6 102,4 102,3 101,3 101,4 100,4 101,9 101,7 102,0
74 103,4 102,2 102,5 100,4 101,6 101,2 101,8 101,4 103,5
77 101,5 101,1 101,7 100,2 100,4 101,4 101,6 102,0 102,0
Таблица 7 (продолжение)
Вакцинированные животные
Вакцинированные животные День 7 День 8 День 9 День 10 День 11 День12 День 13 День 14
39 101,3 101,3 101,1 101,0 102,1 101,0 101,7 101,1
50 102,4 102,0 102,0 101,3 102,0 102,5 101,2 101,2
53 101,4 101,2 100,4 100,2 101,3 101,7 101,3 100,9
54 102,0 101,0 101,4 101,0 101,2 101,2 101,0 100,4
65 102,8 101,7 101,2 101,4 101,7 103,7 102,5 101,4
67 101,6 101,9 101,2 100,5 101,2 101,2 101,0 101,3
69 101,3 101,3 103,3 99,8 101,1 101,1 101,4 99,7
72 102,4 102,0 102,0 102,0 102,7 101,3 102,2 102,2
74 103,0 100,8 101,6 100,3 101,0 100,4 101,0 100,1
77 102,0 101,0 101,0 100,5 100,4 101,2 101,8 101,0
Таблица 7 (продолжение)
Контрольные животные
Контрольные животные День -2 День -1 День 0 День 1 День 2 День 3 День 4 День 5 День 6
1 101,3 101,0 101,5 100,7 100,3 101,9 101,6 101,4 100,2
2 101,0 100,7 102,0 100,2 101,0 101,1 101,9 103,8 101,3
3 101,4 101,5 101,4 101,1 101,0 101,4 101,6 101,8 101,7
12 100,4 100,1 101,4 98,6 100,9 101,0 100,8 100,0 103,2
22 101,9 99,9 100,9 99,2 100,2 99,5 100,3 100,5 101,2
32 102,1 102,0 101,3 100,2 99,5 100,4 100,1 100,2 100,7
58 102,4 101,5 101,9 99,4 101,0 100,7 102,2 101,3 102,6
68 102,1 100,3 102,2 100,4 101,2 101,4 100,5 101,3 101,4
71 101,3 100,2 101,3 100,2 101,2 101,3 101,1 101,2 101,5
Таблица 7 (продолжение)
Контрольные животные
Контрольные животные День 7 День 8 День 9 День 10 День 11 День 12 День 13 День 14
1 102,2 103,3 100,7 101,2 101,3 100,6 101,5 101,2
2 100,4 102,1 102,2 100,2 100,5 101,5 100,9 100,2
3 101,4 103,9 102,2 102,5 101,2 101,6 101,6 100,3
12 101,7 103,0 100,6 100,2 100,6 100,6 100,3 99,2
22 100,7 103,2 101,0 100,5 100,8 100,6 100,5 99,8
32 102,3 100,7 99,7 99,5 100,5 101,6 99,3 100,2
58 101,5 101,3 101,9 102,4 101,2 101,9 99,5 99,5
68 101,8 101,0 100,7 100,9 101,0 101,4 101,6 101,8
71 101,0 102,8 100,5 100,8 100,7 101,4 99,3 99,4

Клинических признаков инфекции BVDV не наблюдалось ни у одного из телят в ходе данного исследования.

Вакцинация здоровых четырех-пятимесячных телок смешанной породы одной дозой вакцины BVBV-1b (ослабленный живой вирус) привела к получению скорректированной оценки эффективности вакцины, составившей 87% против лейкопении, 90% против выделения BVDV-1b из носового секрета и 80% против виремии. Серологический анализ также выявил антигенный ответ у вакцинированных телят.

ПРИМЕР 3 - ОЦЕНКА ОБРАТНОГО ПЕРЕСЕВА BVDV-1B

В настоящих примерах выполнена оценка стабильности исходной культуры TVL-BVDV-1b с целью гарантии ее невозвращения к вирулентному состоянию при введении животным.

Одну ампулу вируса размораживали и использовали для инокуляции TVL-BK клеток, получая TVL-BVDV-1b+1 (5×107 TCID50/мл). Этот вирус использовали для интраназального заражения первого набора из десяти молочных телят, лишенных молозива, в количестве 1×106 TCID50 на теленка. Телят в наборах 2-5 интраназально заражали объединенными носовыми секретами предыдущего набора телят.

Набор 1 состоял из десяти телят, причем количество телят в наборах со второго по пятый составляло от двух до пяти телят в зависимости от количества телят из первого набора из 10 телят, выделявших вирус. Каждого теленка содержали в отдельном загоне, и первичными результатами исследования являлось отсутствие клинических признаков бычьей вирусной диареи у телят и генетическая стабильность исходной культуры в течение, по меньшей мере, пяти последовательных пересевов in vivo.

Статистические единицы исключали из исследования, если они обладали титром BVDV-1a, BVDV-1b или BVDV-2≥2 во время скрининга согласно определению при постоянной концентрации вируса и уменьшающихся концентрациях нейтрализующей сыворотки.

Образцы крови для серологических исследований собирали у телят в процессе скрининга в день прививки (день 0) и в конце исследования. Носовой секрет собирали у каждого отдельного теленка в первом наборе в дни 2-8 после прививки. Аликвоты носового секрета каждого отдельного теленка в каждый из указанных дней анализировали на выделение вируса и хранили в замороженном виде. Определяли день с наибольшим количеством отдельных телят, выделявших BVDV-1b (т.е. день максимального выделения), и все образцы носового секрета, полученные в указанный день, объединяли и использовали для заражения телят во втором наборе. В этот заранее определенный день максимального выделения собирали носовой секрет у телят в последующих группах. Затем указанные образцы анализировали на выделение вируса и хранили в замороженном виде до подтверждения присутствия вируса, объединения образцов и использования их для заражения следующего набора телят или до прекращения дальнейшего выделения вируса.

Телят идентифицировали по номеру ушной бирки и переводили на заменитель молока на шесть-восемь недель, используя общие технологические приемы хозяйствования и ухода, стандартные для селекционной работы.

Выходные переменные включали клинические признаки BVDV, выделение вируса из образцов носового секрета и генетическую стабильность вируса через пять последовательных пересевов in vivo. Всех телят обследовали на клинические признаки инфекции BVDV, а последнюю группу, участвовавшую в обратном пересеве, наблюдали в течение 21 дня после введения восстановленного вируса. Все клинические признаки записывали и выполняли анализ аналогично анализу этиологии клинического заболевания.

У телят собирали образцы носовых выделений; отдельные аликвоты каждого образца поддерживали для выделения и анализа вируса. Образцы подвергали стерильной фильтрации через 0,2-мкм фильтр. Затем каждую лунку 12-луночного планшета, содержащего TVL-MDBK (~80% конфлюентности) инокулировали образцом. Одну лунку на планшет оставляли неинокулированной и использовали в качестве отрицательного контроля. Одну лунку на планшет инокулировали разведением исходной культуры и использовали в качестве положительного контроля. Планшеты инкубировали при 3-7% СО2 при температуре 35-39°С в течение 5-7 дней. Образцы субкультивировали на вторичном планшете в течение дополнительных 5-7 дней. Затем среду из лунок, демонстрировавших типичную для BVDV-1b цитопатическую морфологию, дополнительно подвергали ПЦР-анализу с целью определения идентичности инфекционного агента.

Генетическую стабильность исходной культуры анализировали путем сравнения максимального пересева BVDV, выделенного из организма теленка, с исходной культурой. Отсутствие выделения из всех десяти телят в 1 наборе настоящего исследования, или выделение вируса, который не ревертировал к вирулентному состоянию (о чем свидетельствовало отсутствие отличительных клинических признаков бычьей вирусной диареи) являлось показателем успешного изучения обратного пересева и генетической стабильности исходной культуры.

Пример 4 - получение шестивалентной вакцины BRDC (ослабленный живой вирус)

В настоящем Примере описано получение поливалентной (6-валентной) вакцины BRDC, включающей исходную культуру BVDV-1b, описанную выше.

Материалы и методы

Используемые микроорганизмы

BHV-1: Изолят Cooper (Колорадо) бычьего вируса герпеса был выделен в 1956 году из легких полорогих, страдавших заболеванием верхних дыхательных путей (York et al., 1957). Данный исходный штамм вируса идентифицирован как TVL-BHV (Cooper) РО, August 5,1997 DW-1-21-W.

BVDV-1a: Штамм Singer BVDV-1a получили из APHIS. Данный исходный штамм идентифицирован как TVL-BVD (Singer) РО, Dec 1998 DW4-29.

BVDV-1b: Штамм TGAC BVDV-1b получили из APHIS. Данный исходный штамм идентифицирован как TVL-BVDV 1b MS 04/27/2007 DW3-095.

BVDV-2: Штамм 125 BVDV-2 получили из APHIS. Данный исходный штамм идентифицирован как TVL-BVDV 2 Strain 125 РО 11/01/01 DW3-90.

PI3: Штамм Reisinger SF4 вируса бычьего парагриппа 3 типа (PI3) получили из APHIS.

Данный исходный штамм идентифицирован как TVL-PI3 (Reisinger SF-4PO, 2 April 2001 (SM-83).

BRSV: Штамм N375 бычьего респираторно-синцитиального вируса (BRSV) получили из APHIS. Данный исходный штамм идентифицирован как TVL-BRSV Р0 July 20, 2001 DW3-87.

Протокол

Перед инокуляцией клеток TVL-BK продуктивным исходным вирусом клетки микроскопически визуализировали с целью подтверждения того, что морфология клеток соответствует ранее описанной. Перед сбором каждой партии продуктивного вируса выполняли наблюдение клеток TVL-BK с целью подтверждения проявления типичных цитопатологических эффектов (СРЕ), связанных с вирусом.

Стабильность вирулентности, активности и антигенных свойств BHV-1, BVDV-1a, BVDV-1b, BVDV-2, PI3 и BRSV, используемого в настоящей вакцине, обеспечивали путем хранения в лиофилизированном или замороженном состоянии, а также ограничений количества пересевов или субкультур.

Продуктивный вирус = MSV+10 (эффективный последовательный пересев), однако мог представлять собой любой пересев между 5 и 10. Продуктивная культура клеток = MCS+20 (эффективный последовательный пересев), однако также могла представлять собой любой пересев менее 20.

Инокулят рабочего вируса (MSV+1 - MSV+8) и инокулят продуктивного вируса (являвшийся обычно, но не исключительно MSV+9), обычно размножали в клетках TVL-BK, при условии, что количество пересевов клеток TVL-BK для размножения вируса не превышало приблизительно 20 пересевов от MCS.

Ростовой средой для рабочих и продуктивных препаратов клеток являлась DMEM, содержащая 5-10% сыворотки лошади. Исходную культуру вируса получали и хранили, как описано выше.

Культуральные сосуды засевали расщепляющимися активно размножающимися культурами в соотношении от 1:3 до 1:6 (см2: см2). TVL-BK в колбах или роллер-флаконах (предназначенных для субкультивирования) высвобождали с культуральной поверхности путем асептического удаления ростовой среды и добавления IX раствора трипсин-ЭДТА, как описано в Примере 1. После инкубирования в течение приблизительно 5 мин при 35-39°С монослой диспергировался. Трипсин инактивировали путем добавления диспергированных клеток в культуральный сосуд с ростовой средой. Замороженные аликвоты вируса быстро размораживали или суспендировали в среде, если исходный вирус был лиофилизирован. Клетки TVL-BK (+20 или менее) инокулировали вирусом.

Вирус, реплицированный в колбах или роллер-флаконах, предназначеных для субкультивирования, собирали после соответствующего инкубационного периода и/или проявления СРВ. Затем вирусные суспензии могли храниться при температуре от 6 до -80°С или немедленно использоваться для инокуляции других культуральных сосудов. Для инокуляции сред для исходных и продуктивных культур использовали стандартные методики культивирования клеток. Клетки TVL-BK инокулировали во время 20 или меньшего пересева. Замороженный инокулят продуктивного вируса, обычно представлявший собой MSV+9, быстро размораживали. Объем вирусного инокулята обычно находился в диапазоне от 1 до 25 мл на 1600 см2 площади культуры, что позволяло достичь множественности заражения от 0,01 до 1 вируса на клетку.

Минимальные титры инокулята составляли: 105,5 TCID50 на мл для BHV, 105,0 TCID50 на мл для BVDV-1a, 105,0 TCID50 на мл для BVDV-1b, 105,0 TCID50 на мл для BVDV-2, 106,0 TCID50 на мл для вируса PI3 и 104,5 TCID50 на мл для BRSV. Инокулированные культуры инкубировали при 37±2°С и 5±1% СО2. BHV и PI3 инкубировали в течение 2-4 дней, BVDV-1a, BVDV-1b и BVDV-2 - в течение 4-6 дней, а BRSV - в течение 5-8 дней.

Сбор продукта

В день сбора продукта культуру исследовали на вирусспецифические СРЕ и стерильность. Минимальное время инкубирования составляло 2 дня после инокуляции BHV или PI3, 4 дня после инокуляции BVDV-1a, -1b или BVDV-2 и 5 дней после инокуляции BRSV. Максимальное время инкубирования составляло 4 дня после инокуляции BHV или PI3, 6 дня после инокуляции BVDV-1a, -1b или BVDV-2 и 8 дней после инокуляции BRSV.

Вирусные суспензии асептически собирали из продуктивных сосудов. Образцы собирали для определения TCID50 продукта. Собранный материал хранили при температуре от 6 до -80°С. Собранный материал мог храниться при температурах выше нуля до одного месяца, а в замороженном виде - до шести месяцев перед получением конечного продукта.

Все операции выполняли асептически, используя стандартные методики. Во время сборки серии или субсерии вакцины добавляли неомицин и нистатин (Mycostatin®, Bristol-Myers Squibb, Нью-Йорк, штат Нью-Йорк, США) в количестве 15 мкг и 15 единиц/дозу, соответственно.

Собранные жидкости разбавляли DMEM и стабилизировали добавлением раствора сахарозы, отфильтрованного через 0,2-мкм фильтр, получая конечную концентрацию сахарозы 10±1%.

Собранные вирусные жидкости можно было концентрировать путем стерильной ультрафильтрации, используя фильтр с 10 - кДа отсечкой по молекулярной массе.

Степень концентрирования обычно не превышала 50-кратной.

Партии собранных вирусных жидкостей анализировали с целью определения TCID50 (например, способом Спирмена-Карбера).

Пример 5 - Исследования эффективности шестивалентной вакцины brdc (ослабленный живой вирус)

В Примерах с 5 по 10 продемонстрирована эффективность шестивалентной ослабленной живой вакцины BRDC при профилактике заболевания, вызванного каждым из вирусов, содержащихся в ней. В настоящем первом примере показана эффективность вакцины при профилактике заболевания, вызванного BVDV-1b.

Материалы

Шестивалентную вакцину (ослабленный живой вирус) получали в соответствии со способом получения, описанным выше. Вкратце, BHV-1 (штамм Cooper), BVDV-1a (штамм Singer), BVDV-1b (штамм TGAC), BVDV-2 (125), PI3 (Reisinger SF-4) и BRSV (N375) размножали в клетках линии TVL-BK (20-й пересев). Отдельные фракции собирали при 10-м пересеве и смешивали вместе, получая шестивалентный продукт.

Наряду с каждой серией по проверке эффективности были выполнены плацебо за счет удаления компонентов. Например, плацебо с удалением BVDV содержал те же собранные партии BRSV, BHV и PI3, что и соответствующие серии для проверки эффективности. Компонент BVDV заменяли на культуральную среду для поддержания эквивалентного объема между сериями для проверки эффективности и плацебо с удалением BVDV. Аналогичные плацебо за счет удаления компонентов были составлены для каждого компонента шестивалентной MLV-вакцины.

Экспериментальные способы

Для каждого исследования были приобретены, рандомизированы и помечены ушными бирками коммерческие телята приблизительно 3-4-месячного возраста, находящиеся на нагуле и откорме. Указанных телят дегельминтизировали и вакцинировали против пастереллеза, микоплазмоза и эмфизематозного карбункула. Телят в вакцинированной и контрольной группах содержали в отдельных, несмежных, но эквивалентных загонах до момента за два дня до заражения (день -2), после чего их объединили в одном загоне. Всех телят заражали в день 0 вирулентным изолятом исследуемого вируса. Например, вирулентный BVDV-1b (полученный из легких теленка, умершего в загоне в Poky Feeders [Скотт-Сити, штат Канзас, США]) пересевали in vitro на TVL-BK клетках, используя DMEM с добавлением 10% сыворотки лошади. Дозу для заражения, приблизительно составлявшую 8×107 TCID50 в 4 мл вводили каждому теленку по 2 мл в каждый носовой канал во время вдоха. У телят был свободный доступ к воде, свиноройному сену и гранулированному кормовому рациону, содержавшему кокцидиостат, но не содержавшему антибиотика.

Рандомизация

Для распределения телят по двум экспериментальным группам (вакцинированных или контрольных, вакцинированных плацебо) использовали схему согласованной рандомизации с помощью таблицы рандомизации, предоставленной CVB-Biometrics (см. Таблицу 1.) Последовательность из трех телят, входящих на взгон, рандомизировали на две экспериментальные группы в соотношении 2:1. Ушные бирки, случайно выбранные из лотка во время начального отбора крови для серологической оценки, идентифицировали телят. Две указанные группы телят перед заражением содержали в отдельных, но эквивалентных загонах. Телят объединяли в одном загоне за два дня до заражения (день -2).

Обеспечение анонимности данных

У персонала отсутствовала информация о принадлежности к контрольной или вакцинированной группам. Все полевые и лабораторные сотрудники, за исключением архивариуса, не имели указанной информации в ходе исследования.

Результат

Выбранным первичным результатом являлась лейкопения после заражения. Лейкопению определяли как 25% снижение по сравнению с исходным количеством лейкоцитов. Другие результаты, также подтверждающие эффективность вакцины, включали выделение носового секрета, виремию, лихорадку, продукцию антител и клинические признаки вирусной инфекции.

Критерий оценки

Отдельные показания количества лейкоцитов (WBC) преобразовывали в процент от среднего значения до заражения и измеряли по шкале непрерывного интервала. Указанные преобразованные процентные количества лейкоцитов определяли ежедневно в течение 14 дней после заражения и использовали в качестве основного критерия для оценки. Обнаружение лейкопении служило основным критерием для определения устойчивости (неподверженности) или восприимчивости (подверженности) к заражению. Подверженную и неподверженную группы сравнивали с целью определения того, предотвращала ли вакцинация лейкопению после заражения вирусом. Клинические признаки респираторного заболевания и обнаружение вируса из образцов носового секрета/лейкоцитарной массы служило вторичным критерием для определения восприимчивости к заражению. Продолжительность лейкопении и продолжительность выделения секрета (количество дней, в которые у отдельного теленка обнаруживали вирус) анализировали с целью определения смягчающего действия вакцинации на указанные параметры. Все отдельные ежедневные показания ректальной температуры анализировали, используя среднюю температуру перед заражением (исходный уровень) в качестве ковариаты. Статистические единицы исключали из исследования, если они обладали вирусным титром>2 во время начала исследования.

Инструментарий и способы отбора проб

Образцы крови собирали у телят непосредственно перед вакцинацией (с -28 по -21 день) в серии для определения эффективности или в группе, вакцинированной соответствующим плацебо, полученным за счет удаления компонента. Образцы крови также собирали непосредственно перед заражением (день 0) и повторно через 14 дней после заражения (день 14). Образцы крови для дифференциального подсчета лейкоцитов и выделения вируса собирали с -2 дня по, как минимум, 14 день. Образцы собирали в вакуумные пробирки Vacutainer® (Becton-Dickinson and Co., Франклин Лейке, штат Нью-Джерси, США) с ЭДТА, подсчет выполняли, используя дифференциальный счетчик лейкоцитов Drew Scientific, Hemavet 950. Назальные мазки для выделения вируса собирали с -2 дня по, как минимум, 14 день.

Наблюдение и сбор данных

Отбор назальных образцов и образцов крови и осмотр телят на клинические признаки вирусной инфекции осуществляли со 2 по 14 день. Ректальную температуру у каждого теленка определяли с -2 по 14 день.

Количество лейкоцитов анализировали с целью определения снижения их количества после заражения. Среднее количество до заражения рассчитывали для каждого животного путем усреднения WBC с -2 по 0 день. Для каждого дня после заражения с 1 по 14 день или дольше, по усмотрению экспериментаторов, рассчитывали ежедневное соотношение количества WBC по сравнению со средним уровнем до заражения (количество WBC в виде доли от их количества до заражения). Если соотношение снижалось на 25%, у особи диагностировали лейкопению. Назальные мазки собирали у каждого теленка в день заражения и в течение 14 последующих дней после заражения путем взятия мазка из обеих ноздрей с помощью тампон-зондов BBL Culture Swabs с жидкой средой Стюарта. В день сбора образцы подвергали стерильной фильтрации через 0,2-мкм фильтр. Затем каждую лунку 12-луночного планшета, содержащего TVL-MDBK (~80% конфлюентности), инокулировали образцом. Одну лунку на планшет оставляли неинокулированной и использовали в качестве отрицательного контроля. Одну лунку на планшет инокулировали разведением вируса, использованного для заражения, и использовали в качестве положительного контроля. Планшеты инкубировали при 3-7% CO2 при температуре 35-39°С в течение 2-4 дней. Среду из каждой лунки собирали и хранили при температуре от -18°С до -22°С. Среду из всех лунок анализировали с помощью ОТ-ПЦР (Ridpath and Bolin 1998) с целью определения наличия конкретного вируса в культуре. У особей, культуры образцов которых были положительны по вирусу, диагностировали "выделение".

Лейкоцитарную массу из образцов крови использовали для инокуляции каждой лунки 12-луночного планшета, содержавшего TVL-MDBK (~80% конфлюентности). Одну лунку на планшет оставляли неинокулированной и использовали в качестве отрицательного контроля. Одну лунку на планшет инокулировали разведением вируса, использованного для заражения, и использовали в качестве положительного контроля. Планшеты инкубировали при 3-7% СО2 при температуре 35-39°С в течение 2-4 дней. Среду из каждой лунки собирали и хранили при температуре от -18°С до -22°С. Среду из всех лунок анализировали с помощью ОТ-ПЦР (Ridpath and Bolin 1998) с целью определения наличия вируса в культуре. У особей, культуры образцов которых были положительны по конкретному вирусу, диагностировали "виремию".

Ежедневную ректальную температуру каждого животного регистрировали с -2 по 14 день ('за 2 дня до заражения, в день заражения и через 14 дней после заражения) исследования. Среднее значение до заражения рассчитывали для каждого животного путем усреднения значений температуры с -2 по 0 день. Ежедневные значения температуры анализировали, используя исходный уровень в качестве ковариаты.

Титры антител к BVDV-1b: В случае эффективности BVDV-1b определяли титры сывороточных нейтрализующих антител против BVDV-1b при постоянной концентрации вируса и уменьшающихся концентрациях нейтрализующей сыворотки для каждого животного в день первичной вакцинации (день -21), в день заражения (день 0) и при завершении исследования. Титры антител определяли, используя модификацию методики титрования нейтрализующих антител против вируса бычьей вирусной диареи 1 типа Special Outline А-17, Titration of Bovine Viral Diarrhea Virus Type 1 Neutralizing Antibody. В указанном модифицированном анализе использовали цитопатический изолят BVDV-1b в качестве индикаторного вируса вместо изолята BVDV-1a. Животных, у которых развивался титр антител ≥8, считали сероконвертированными в BVDV-1b.

Оценивали различия в продолжительности лейкопении, выделения и виремии между вакцинированной и контрольной группами (долю смягчения). Ректальную температуру анализировали, используя среднюю температуру перед заражением (исходный уровень) в качестве ковариаты. Выбранный доверительный интервал составил 95%.

Лейкопения: Анализ данных о лейкопении был основан на соотношении вакцинированных животных, у которых развилась лейкопения, по сравнению с соотношением плацебо-вакцинированных контрольных животных, у которых развилась лейкопения после заражения вирусом. Указанный показатель оценивали путем определения предотвращаемой фракции, как описано Tanner and Morgan (1993).

Выделение и виремия: Данные, полученные при анализах выделения и виремии, были основаны на соотношении вакцинированных животных, выделявших вирус или страдавших виремией, по сравнению с соотношением плацебо-вакцинированных контрольных животных, выделявших вирус или страдавших виремией после заражения вирусом. Указанные показатели оценивали путем определения предотвращаемой фракции, как описано Tanner and Morgan (1993).

Оценивали медианное различие продолжительности лейкопении между двумя группами и рассчитывали долю смягчения согласно Fergen (2004). Оценивали медианное различие продолжительности выделения и медианное различие продолжительности виремии между двумя группами и рассчитывали долю смягчения согласно Fergen (2004).

Клинические наблюдения Анализ ректальной температуры в дни 1-14 выполняли путем дисперсионного анализа повторных измерений (ANOVA), включавшего эффекты Группы, Дня и взаимодействие Группа* День при использовании исходного уровня в качестве ковариаты. При достоверности взаимодействия Группа* День (р<0,5) вакцинированную группу сравнивали с контрольной группой, используя простой эффект Группы для каждого момента времени. Указанные сравнения простого эффекта получили на основе взаимодействия Группа* День.

Статистический анализ: Сравнение титров антител по группам анализировали с помощью U-критерия Манна-Уитни. Все статистические анализы проводили с использованием SAS Learning Edition v2.0 for Microsoft Windows®, как описано выше.

Пример 5А - Исследования эффективности шестивалентной вакцины BRDC

Результаты данного исследования демонстрируют, что ослабленная живая вакцина против вируса бычьей вирусной диареи типа 1b (BVDV1b), бычьего ринотрахеита-вирусной диареи-парагриппа-3 - респираторно-синцитиального вируса являлась антигенной и эффективной в качестве средства профилактики заболевания, вызванного BVDV1b. Двадцати одному BVDV-серонегативному теленку вводили дозу вакцины. Десять серонегативных контрольных телят вакцинировали дозой плацебо-вакцины, соответствующей продукту. Всех телят интраназально заражали BVDV1b. Вакцинация привела к повышению титра антител к BVDV1b и либо предотвращала, либо смягчала виремию, выделение вируса с носовым секретом, лихорадку, клинические симптомы заболевания и лейкопению, вызванные BVDV1b. Соответственно, для BVDV1b-фракции данной вакцины установили минимальные количество BVDV1b-TCID50, равное 2×103 на дозу. Указанная вакцина содержала BHV-1, PI3, BRSV, два субгенотипа BVDV 1 типа (1a и 1b) и BVDV 2 типа.

Вакцинация, заражение и отбор образцов: Тридцать (31) BVDV-отрицательных телят объединили в проходе для сортировки. Каждого теленка направляли с помощью закрывающихся ворот по мере прогона стада случайным образом по три теленка за один раз через проход в одну из двух групп (Группа А - вакцинированные или Группа В -плацебо-вакцинированные контрольные животные) с помощью схемы рандомизации при подборе согласованных групп.

Двадцать одного теленка вакцинировали дозой ослабленной живой вирусной вакцины против бычьего ринотрахеита - вирусной диареи - парагриппа 3 - респираторно-синцитиального вируса. Каждое вакцинированное животное получало 2-мл дозу продукта путем подкожной инъекции в левую сторону шеи в день 0. Десять телят вакцинировали плацебо-вакциной соответствующего продукта (с удалением BVDV). За два дня до заражения как вакцинированную, так и контрольную группу объединяли с целью клинического обследования до заражения и регистрации исходных показаний температуры тела и WBC. Вакцинированных и контрольных телят заражали через 21 день после вакцинации вирулентным изолятом BVDV1b, полученным из легких теленка, умершего в загоне. Вирус пересевали in vitro на клетки TVL-BK, используя среду Игла, модифицированную по Дульбекко, содержащую 10% сыворотку лошади. Дозу для заражения 4×107 TCID50 в 4 мл вводили каждому теленку по 2 мл в каждый носовой канал во время вдоха.

Пробы крови для определения титра антител собирали до вакцинации, в день заражения (21 день после вакцинации) и через 14 дней после заражения. Титры антител к вирусу диареи КРС определяли при постоянной концентрации вируса и уменьшающихся концентрациях нейтрализующей сыворотки.

Назальные мазки для выделения вируса собирали у телят из обеих ноздрей с помощью тампон-зондов BBL Culture Swab® с жидкой средой Стюарта в день заражения и в течение 14 суток после заражения.

Образцы крови для выделения вируса из лейкоцитарной массы собирали у каждого теленка путем венепункции в вакуумные пробирки с ЭДТА в день заражения и в течение 14 дней после заражения.

Ректальную температуру регистрировали ежедневно у каждого теленка в течение двух дней до заражения, в день заражения и в течение 14 дней после заражения.

Выполняли и записывали клинические обследования каждого теленка. У наблюдателей отсутствовала информация о групповой принадлежности, поскольку как вакцинированную, так и контрольную группу объединили, и единственным отличительным признаком являлся номер ушной бирки. На протяжении всего исследования у наблюдателей отсутствовала информация о статусе вакцинации отдельных подопытных животных. У персонала лаборатории отсутствовала информация о статусе вакцинации телят.

Образцы крови для определения дифференциального количества лейкоцитов собирали в течение двух дней до заражения, в день заражения и в течение 14 дней после заражения. Образцы собирали в вакуумные пробирки с ЭДТА и осуществляли подсчет, используя дифференциальный счетчик лейкоцитов Drew Scientific, Hemavet 950.

Обнаружение BVDV; Для обнаружения BVDV1b в собранных образцах использовали методику ПЦР с культивированием в клетках. Вкратце, назальные образцы наносили на клетки TVL-BK в культуре путем стерильной фильтрации (0,2 мкм). Лейкоцитарную массу наносили непосредственно на клетки TVL-BK в культуре за 45-75 минут до смыва клеток. Культуры инкубировали в течение 4 дней на 37°С±2°С и 5±1% СО2. Супернатант всех образцов культур по отдельности анализировали на наличие/отсутствие BVDV1b, используя общепринятую методологию ОТ-ПЦР и следующий набор праймеров/зондов:

Прямой праймер: CACCCTATCAGGCTGTATTCATAGC (SEQ ID NO:1)

Обратный праймер: TGCCCACAGCACATCTTAACC (SEQ ID NO:2)

TaqMan MGB-зонд: TCACCTGGACGACCC (SEQ ID NO:3)

Указанный способ разработали на основе Differentiation of types 1a, 1b and 2 bovine viral diarrhea virus (BVDV) by PCR, Julia F. Ridpath and Steven R. Bolin, Molecular and Cellular probes. Journal of Virological Methods, 130 (2005) 145-148). Указанный способ также был основан на протоколе генотипирования вируса диареи КРС номер BPPR02010,01 Центра ветеринарных биопрепаратов и Национальной ветеринарной службы США (Center for Veterinary Biologies and National Veterinary Services Laboratories Test Protocol -Genotyping Bovine Viral Diarrhea Virus, Number BPPR02010,01). Оба указанных способа дифференциации генотипов и субгенотипов BVDV используют генетические различия, существующие в 5'-нетранслируемой области (UTR) генома. Указанный набор праймеров/зондов был специально разработан для амплификации раздела 5'-UTR, в котором с помощью высокоспецифичного зонда можно обнаружить уникальную последовательность BVDV1b. Специфичность набора праймеров/зондов подтверждали в рамках организации; показано отсутствие перекрестной реакционноспособности с BHV, PI3, BRSV, BVDV1a или BVDV2. Количественную ОТ-ПЦР выполняли, используя анализ на основе Taqman®, на Applied Biosystems 7500.

Статистический анализ: Титры антител: Сравнение титров, приведенных к порядковой шкале, по группам анализировали с помощью U-критерия Манна-Уитни.

Виремия: Информация о выделении вируса из лейкоцитарной массы образцов крови анализировали на основе доли вакцинированных животных, у которых был выделен BVDV1b, по сравнению с долей контрольных животных, у которых был выделен BVDV1b после заражения. Предотвращаемую фракцию для виремии BVDV1b рассчитывали, как описано в работе Tanner and Morgan (1993).

Выделение из назальных мазков: Информация о выделении вируса из назальных мазков основана на доле вакцинированных животных, у которых был выделен BVDV1b, по сравнению с долей контрольных животных, у которых был выделен BVDV1b после заражения. Предотвращаемую фракцию для выделения BVDV1b рассчитывали, как описано в работе Tanner and Morgan (1993).

Ректальная температура; Для каждого животного определяли среднюю ректальную температуру до заражения. Это среднее значение использовали в качестве ковариаты в повторном дисперсионном анализе (ANOVA), включавшем эффекты Группы, Дня и взаимодействие Группа* День.

Клинические признаки заболевания: Каждый наблюдатель независимо от других ежедневно регистрировал клинические признаки заболевания. Любой теленок, у которого проявлялись признаки, по меньшей мере, в один из дней обследования после заражения, считался «пострадавшим». Предотвращаемую фракцию для клинических признаков рассчитывали, как описано в работе Tanner and Morgan (1993).

Лейкопения: Среднее количество лейкоцитов до заражения рассчитывали для каждого животного путем усреднения количества лейкоцитов с -2 по 0 день. Для каждого дня после заражения с 1 по 14 день рассчитывали ежедневное соотношение количества лейкоцитов по сравнению со средним уровнем до заражения (количество лейкоцитов в виде доли от их количества до заражения). Это соотношение анализировали с целью определения развития лейкопении у отдельных животных по 40% снижению количества по сравнению с исходным уровнем. Предотвращаемую фракцию вычисляли, как описано в работе Tanner and Morgan (1993), с целью определения предотвращения развития лейкопении за счет вакцинации в данном исследовании.

Все статистические анализы выполняли с помощью SPSS версии 16 для Windows.

РЕЗУЛЬТАТЫ

Титры сывороточных нейтрализующих антител: Все телята в настоящем исследовании характеризовались титром нейтрализующих антител против BVDV (BVDV1a, BVDV1b и BVDV2) до вакцинации, составлявшим<1:2. На день заражения (21 день) средний титр BVDV1b у вакцинированной группы составлял 1:83, что значительно (р≤0,05) превышало данный показатель у контрольной группы<1:2. Титры антител BVDV1b повысились через 14 дней после заражения как у контрольных, так и у вакцинированных телят, что указывало на заражение телят BVDV1b.

Выделение BVDV1b из лейкоцитарной массы; Все десять контрольных телят в настоящем исследовании на этапе после заражения характеризовались виремией. В то же время, семь контрольных телят характеризовались виремией в критический период, когда обычно наблюдается виремия после заражения BVDV. Три контрольных теленка (1, 14, 30) характеризовались виремией в день заражения. Эти же три теленка вместе с теленком 26 характеризовались виремией на следующий день после заражения. Это наблюдение вместе с данными серологических исследований, выделения из назальных мазков и ректальной температуры показывают, что указанные телята были естественным образом инфицированы в конце этапа вакцинации, у них развилась виремия и началось выделение вируса в начале этапа заражения. У одного из этих четырех телят (теленок 30) развилась виремия и выделение вируса в течение типичного периода виремии/выделения после заражения. Ни один из 21 вакцинированного теленка не характеризовался виремией в течение периода после заражения. Предотвращаемую фракцию рассчитывали, используя соотношение 3/10 контрольных животных с естественной защитой и 21/21 вакцинированных животных, защищенных от вируса. Это позволило получить значение предотвращаемой фракции 1,0.

Выделение BVDV1b из назальных мазков. Все десять контрольных телят в настоящем исследовании на этапе после заражения выделяли BVDV1b. В то же время, семь контрольных телят выделяли вирус в критический период, когда обычно наблюдается выделение вируса после заражения BVDV. Два контрольных теленка (26 и 30) выделяли вирус в день заражения. Три контрольных теленка (1, 14 и 30) выделяли вирус на следующий день после заражения. Это наблюдение вместе с данными серологических исследований, выделения из лейкоцитарной массы и ректальной температуры показывают, что указанные телята были естественным образом инфицированы в конце этапа вакцинации, у них развилась виремия и началось выделение вируса в начале этапа заражения. У одного из этих четырех телят (теленок 30) развилась виремия и выделение вируса в течение типичного периода виремии/выделения после заражения. Только 1 из 21 вакцинированных телят выделял BVDV1b в течение периода после заражения. Предотвращаемую фракцию рассчитывали, используя соотношение 3/10 контрольных животных с естественной защитой и 20/21 вакцинированных животных, защищенных от вируса. Это позволило получить значение предотвращаемой фракции 0,93.

Ректальные температуры; Анализ данных показал значимость взаимодействия Группа* День (р=0,034). Посуточный анализ показал, что температура в контрольной группе достоверно (р<0,05) превышала температуру в вакцинированной группе в дни 1, 4, 7 и 8 после заражения. На 12 день ректальная температура у контрольной группы упала и была достоверно (р<0,05) ниже, чем у вакцинированной группы.

Клинические признаки BVDV1b: Восемь из десяти (8/10 пострадавших) телят в контрольной группе демонстрировали клинические признаки, которые могли бы быть обусловлены инфекцией BVDV1b. Клинические признаки включали диарею, обильное количество прозрачных выделений из носа, учащенное дыхание и выделения из глаз. Ни у одного (0/21 пострадавших) из телят в вакцинированной группе не было выявлено любого из этих клинических признаков на этапе исследования после заражения. Предотвращаемую фракцию рассчитывали, используя соотношение 2/10 контрольных животных с естественной защитой и 21/21 вакцинированных животных, защищенных от вируса. Это позволило получить значение предотвращаемой фракции 1,0. Ни у одного из телят не наблюдалось никаких неблагоприятных поствакцинальных реакций.

Лейкопения: Лейкопению обнаружили у четырех из 21 вакцинированных животных и пяти из десяти контрольных животных, что позволило получить значение предотвращаемой фракции 62%.

ВЫВОДЫ

Вышеприведенные результаты демонстрируют антигенность и эффективность BVDV1b-фракции ослабленной живой вакцины против бычьего ринотрахеита-вирусной диареи-парагриппа-3-респираторно-синцитиального вируса в качестве средства профилактики заболевания, вызываемого BVDV1b.

Об антигенности и эффективности BVDV1b-фракции указанного комбинированного продукта свидетельствует следующее:

1) значительное увеличение титра антител к BVDV1b в вакцинированной группе по сравнению с контрольной группой. У всех телят в вакцинированной группе развились титры BVDV1b≥1:8 после введения одной 2-мл дозы, соответствующей требованиям, определенным в 9CFR 113,311 (с) (5).

2) исследования по выделению вируса выявили, что введение одной дозы привело к значительному снижению виремии и носового выделения, вызванного заражением BVDV1b.

3) вакцинированные телята демонстрировали значительно ослабленную лихорадку по сравнению с контрольными телятами и не проявляли клинических признаков заболевания.

4) Вакцинация также снизила вероятность развития лейкопении, вызванной BVDV1b.

На данное исследование незначительно влиял тот факт, что, по меньшей мере, три теленка контрольной группы инфицировались BVDV1b незадолго до заражения. В связи с тем, что все контрольные телята, в том числе инфицированные, по-прежнему являлись серонегативными во время заражения, был сделан вывод, что естественный контакт с инфекцией произошел в конце этапа вакцинации. В вакцинированной группе клинические признаки естественного контакта с инфекцией отсутствовали, вероятно, вследствие их содержания отдельно от контрольной группы до момента, соответствующего 2 дню до заражения. Естественный контакт с инфекцией является неотъемлемой возможностью при проведении исследований, связанных с искусственным заражением, в типичном окружении телят, находящихся на нагуле/откорме. Согласно Tanner and Morgan, оценка эффективности вакцины, в соответствии с определением предотвращаемой фракции рассматривает связь между наблюдаемой защитой и эффективностью вакцины по отношению к нескольким уровням естественного иммунитета.

Результаты настоящего исследования являются статистически значимыми и клинически важными, тем самым демонстрируя эффективность BVDV1b-фракции, содержащейся в указанной вакцине.

Пример 6 - Описание эффективности BRSV

Этот пример показывает, что фракция бычьего респираторно-синцитиального вируса (BRSV) в гексавалентной МЖВ вакцине способствует профилактике заболеваний, вызванных BRSV.

Материалы и Методы

Плацебо, не содержащее BRSV, получили и использовали параллельно с эффективными последовательными пассажами по способу, аналогичному описанному в примере 5, для BVDV1b. Это плацебо, не содержащее BRSV, содержит вирусы BVDV-1a, BVDV-1b, BVDV-2, BHV и PI3, полученные в результате тех же пассажей, что и вирусы в эффективной вакцине, в которых BRSV заменен культуральной средой для поддержания эквивалентного объема образцов, полученных путем последовательных пассажей эффективной смесью вирусов и плацебо, не содержащего BRSV. Стерильный разбавитель использовали для регидратации и шестивалентной МЖВ вакцины, и плацебо, не содержащего BRSV, как описано здесь.

Экспериментальные ПРОЦЕДУРЫ

Использовали коммерческих телят стокеров/фидеров в возрасте около 3-4 месяцев из относительно однородной популяции, имеющих примерно одинаковое происхождение, тип, вес и возраст. Телят дегельминтизировали и вакцинировали против пастереллеза, микоплазмоза, и эмфизематозного карбункула. При проведении эксперимента использовали равное количество телят в опытной и контрольной группах;

две группы телят содержали в отдельных несмежных, но эквивалентных помещениях перед заражением, и смешивали в одном помещении за два дня до заражения (день -2). Телята имели свободный доступ к воде, сену из бермудской травы и комбикорму, содержащему кокцидиостатик, но не антибиотик.

Рандомизация

Для разделения телят на группы лечения (вакцинация или вакцинированный плацебо контроль) использовали спаренную схему рандомизации с использованием таблиц для рандомизации CVB-Biometrics, в которых последовательность из трех телят, входящих на взгон для скота, рандомизируется на две группы в соотношении 2: 1. Ушные бирки, случайно извлекаемые из ведра во время первичного взятия крови для серологических анализов, идентифицировали телят.

Обеспечение анонимности данных

Весь персонал проводил исследование вслепую (за исключением регистратора), и не имел знаний о том, какие животные вакцинированы, а какие нет.

Результаты

Первичным результатом является предотвращение назального выделение вируса BRSV после заражения, которое определяли по наличию или отсутствию BRSV в назальных мазках, отбираемых ежедневно из ноздрей всех телят в течение эксперимента. Другие вторичные результаты могут включать ослабление одного или нескольких клинических признаков инфекции BRSV, снижение лихорадки и/или сокращение продолжительности выделения вируса телятами, выделяющими BRSV. Выделение BRSV животными из вакцинированной и контрольной групп определяли ежедневно в течение 14 дней после заражения, причем обнаружение BRSV выступало в качестве первичного критерия для определения устойчивости (незараженные) или восприимчивости (зараженные) к заражению. Зараженные и незараженные группы сравнивали, чтобы определить, предотвращает ли вакцинация выделение BRSV после контрольного заражения BRSV. Клинические признаки респираторного заболевания служили вторичным критерием для определения чувствительности или устойчивости к заражению. Продолжительность выделения (количество дней, в течение которых BRSV обнаруживали у отдельного теленка) анализировали, чтобы определить, оказывает ли вакцинация смягчающее влияние на этот параметр. Ректальную температуру каждого отдельного животного, измеренную ежедневно, анализировали против ковариантов средней температуры до заражения (базовый уровень). Экспериментальные точки исключали, если в момент начала исследования наблюдали титр нейтрализующих антител к BRSV>2.

Выборочная Совокупность и Метод

Образцы крови отбирали у телят непосредственно перед вакцинацией (с дня -28 до -21-го дня) у вакцинированных эффективной вакциной или плацебо, не содержащим BRSV, а затем снова немедленно перед заражением (день 0), и на 14 день после заражения (день 14).

Наблюдение и Сбор Данных

Назальные мазки отбирали у каждого теленка в день заражения и в течение 14 суток после заражения путем свабирования обеих ноздрей тампоном BBL Culture Swab® с жидкой средой Стюарта. Среду из образцов анализировали на присутствие BRSV с использованием ПЦР в реальном времени с использованием набора праймеров/зондов, специфичных для обнаружения BRSV.

Прямой праймер: 5'-GCAATGCTGCAGGACTAGGTATAAT-3' (SEQ ID NO:4);

Обратный праймер: 5'-ACACTGTAATTGATGACCCCATTCT-3' (SEQ ID NO:5);

Зонд на BRSV TaqMan® MGB: 5'-AAGACTTGTATGATGCTGCCAA-3' (SEQ ID NO:6). Данные о длительности анализировали, чтобы продемонстрировать, что вакцинация оказывала смягчающее действие на продолжительность времени, в течение которого BRSV обнаруживали в назальных образцах.

Клинические наблюдения: ректальную температуру каждого животного измеряли каждый день и записывали с дня -2 до 14-го дня (2 дня до заражения, в день заражения и 14 дней после заражения), при этом высчитывали среднее значение температуры для каждого животного до заражения, на основе усреднения значений, полученных в промежуток времени со дня -2 до дня 0. Температуру в каждый день затем анализировали с помощью базовой линии в качестве коварианты.

Титр сывороточных нейтрализующих антител определяли нейтрализующим анализом с постоянной концентрацией вируса и уменьшающейся концентрацией сыворотки у каждого животного в день вакцинации, 0 день и 14 день исследования (Schefers et al., 2008).

Клинические признаки BRSV у телят ранее были описаны в работе Baker (1986). Клинические признаки включают, но не ограничиваются, назальные и слезные выделения, повышенную частоту дыхания, повышение ректальной температуры, легкую депрессию, снижение потребления корма, повышенное слюноотделение и одышку. Клинические признаки инфекции BRSV менее очевидны в традиционных моделях заражения, потому что вирус, используемый, для заражения был ослаблен размножением in vitro, и единственным важным параметром в оценке этих моделей является выделение вируса (Wren, 2001). Следовательно, клинические признаки записывали за два дня до заражения, в день заражения и в течение четырнадцати дней после заражения. Наблюдение клинических признаков BRSV принимали во внимание при анализе данных, но не рассматривали в качестве первичного результата, потому что эти признаки могут свидетельствовать о многих заболеваниях дыхательных путей, обычно встречающихся у крупного рогатого скота.

Оценивали долю вакцинированных животных и вакцинированных плацебо контрольных животных, которых классифицировали как зараженных и не зараженных (доля предотвращения), как и разницу в продолжительности выделения вируса между вакцинированной и контрольной группами (доля смягчения).

Эффективность фракции вируса BRSV в гексавалентной МЖВ вакцине может легко быть оценена путем определения доли предотвращения, как описано в работе Tanner and Morgan (1993). Этот анализ основан на доле вакцинированных животных, которые устойчивы к заражению BRSV по сравнению с контрольными животными, вакцинированными плацебо, которые также являются устойчивыми.

Статистический анализ: различие медиан длительности выделения вируса между двумя группами может быть оценено, и долю ослабления рассчитывали в соответствии с методом Fergen (2004). Групповое сравнение титров антител выполняли с помощью U-критерия Манна-Уитни. Все статистические анализы проводили с использованием программного обеспечения SAS Learning Edition 2.0 для Microsoft Windows®, как описано выше.

Пример 6А - Исследование эффективности BRSV

Результаты этого исследования показывают, что модифицированный живой бычий респираторно-синцитиальный вирус (BRSV) в составе вакцины из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса, является антигенным и эффективным, способствуя предотвращению выделения бычьего респираторно-синцитиального вируса у телят стокеров/фидеров. Одну дозу вакцины вводили двадцати двум BRSV серонегативным телятам. Одиннадцать серо-негативных контрольных телят вакцинировали одной дозой продукта, соответствующего плацебо вакцине. Все телята были заражены BRSV интраназально. Вакцинация привела к повышению титра антител к BRSV и предотвращала выделение BRSV после заражения. Следовательно, минимальная BRSV-TCID50 в 7×102 на дозу была определена для доли BRSV в этой вакцине.

МАТЕРИАЛЫ И МЕТОДЫ

Вакцинация и заражение телят: тридцать три (33) BRSV- отрицательных телят смешали для сортировки. Каждого теленка отделяли воротами, после случайного разделения, по три теленка за один раз, пропускаемых через дорожку в одну из двух групп (Группа А - вакцинированные или Группа В - вакцинированные плацебо контрольные животные) с использованием спаренной схемы рандомизации, предоставляемой CVB-Biometrics.

Двадцать два из серологически отрицательных телят вакцинировали одной дозой МЖВ вакцины бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса. Каждую вакцинацию проводили 2 мл дозой продукта путем подкожной инъекции в левую сторону шеи в день 0. Одиннадцать телят вакцинировали продуктом, соответствующим вакцине плацебо (не содержащей BRSV). Собирали назальные мазки, отбирали кровь и анализировали для серологического подтверждения восприимчивости к BRSV с использованием нейтрализующего анализа с постоянной концентрацией вируса и уменьшающейся концентрацией сыворотки. За два дня до заражения и вакцинированную, и контрольную группы смешивали для клинических наблюдений до заражения. Вакцинированных и контрольных телят заражали через 32 дня после вакцинации 4 мл (2 мл в каждую ноздрю) TVL-BRSV, изолят N375. Используемый для заражения вирус титровали непосредственно перед заражением (TCID50 составила 106,6/мл) и повторно сразу после заражения (TCID60 106,2/мл). Используемый для заражения вирус хранили замороженным в течение процесса заражения.

Образцы крови собирали в день вакцинации, в день заражения и через 14 дней после заражения. Титр антител к бычьему респираторно-синцитиальному вирусу определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки.

Назальные мазки собирали в день вакцинации, в день заражения и в течение 14 суток после заражения.

Ректальную температуру измеряли и записывали для каждого теленка каждый день в период за два дня до заражения, в день заражения и в течение 14 суток после заражения. Делали клинические наблюдения. Наблюдатели действовали вслепую, так как вакцинированная и контрольная группы были объединены, и единственным отличительным признаком являлось число на ушной бирке. На протяжении всего исследования наблюдатели не получали информации о статусе вакцинирования индивидуального исследуемого животного. Персонал лаборатории не имел информации о статусе вакцинации телят.

Определение BRSV: назальные мазки отбирали у телят путем свабирования обеих ноздрей тампоном BBL Culture Swab®, смоченным жидкой средой Стюарта. Визуальное наблюдение специфичного для BRSV цитопатического эффекта и улучшенный метод ПЦР с культуры тканей использовали для обнаружения BRSV в собранных образцах. Кратко, образцы подвергали стерильной фильтрации (0,2 мкм) и добавляли к культуре клеток TVL-BK. Культуры инкубировали в течение 5 дней при температуре 37°С±2°С и с содержанием CO2 5±1%. Культуры проверяли на наличие специфического для BRSV цитопатического эффекта и результаты записывали. Супернатант из всех образцов культур (как при наличии, так и при отсутствии цитопатического эффекта) индивидуально анализировали на присутствие/отсутствие BRSV с помощью набора праймеров/зондов, описанных в работе М. Boxus et.al. (Real Time RT-PCR for the detection and quantitation of bovine respiratory syncytial virus, М. Boxus, C. Letellier, P. Kerkhofs, Journal of Virological Methods, 125 (2005) 125-130). Специфичность набора праймеров/зондов была подтверждена исследователями, проводящими эксперимент, и они не демонстрировали перекрестную реакцию с BHV, PI3, BVDV1a, BVDV1b или BVDV2. Количественный ПЦР анализ в реальном времени (RT qPCR) проводили с помощью анализа, основанного на Taqman® на приборе Applied Biosystems 7500. Все образцы, в которых наблюдали специфичный для BRSV цитопатический эффект, по результатам ПЦР-анализа были также положительными. Было 10 образцов, которые были отрицательными по специфичному для BRSV цитопатическому эффекту и положительными на BRSV по результатам ПЦР-анализа. Это согласуется с проведенными исследованиями о том, что ПЦР-анализ более чувствителен, чем анализы, основанные на наблюдении специфичного для BRSV цитопатического эффекта. Образцы, которые были отрицательными на BRSV после первичного культивирования, пересевали, и супернатант из смеси для культивирования анализировали на присутствие/отсутствие BRSV в соответствии с тем же методом.

Статистический анализ: эффективность наличия BRSV в этой вакцине преимущественно основывалась на доле вакцинированных животных, которые выделяли BRSV в сравнении с долей контрольных животных, выделявших BRSV после заражения. Долю предотвращения рассчитывали, как описано в работе Tanner and Morgan (1993). Оценивали количество дней после заражения, в течение которых BRSV выделяли из отдельных телят в ходе исследования. Группы сравнивали для определения того, была ли продолжительность изоляции BRSV (выделения) значительно снижена в группе вакцинированных животных по сравнению с контрольной группой после заражения BRSV.

Групповое сравнение ординально масштабированных данных о титре выполняли с использованием U-критерия Манна- Уитни. Ректальную температуру анализировали с использованием среднего значения температуры до заражения в качестве коварианты. Анализ температуры с 1 по 14 день после заражения проводили путем дисперсионного анализа повторных измерений (ANOVA). Весь статистический анализ проводили с использованием программного обеспечения SAS для Windows.

РЕЗУЛЬТАТЫ

Титр нейтрализующих антител в сыворотке: все телята в этом исследовании до вакцинации имели титр сывороточных нейтрализующих антител <1:2. После вакцинации титр сывороточных нейтрализующих антител был достоверно (р<0,05) больше в группе вакцинированных животных по сравнению с таковым в контрольной группе. Двадцать один из 22 вакцинированных телят продемонстрировали увеличение титра антител к BRSV после вакцинации, в то время как все одиннадцать животных контрольной группы, вакцинированные плацебо, оставались серонегативными в течение всего периода вакцинации перед заражением. Средний титр антител в вакцинированной группе составил 8,5 а средний титр в контрольной группе составил <2.

Выделение BRSV: Все одиннадцать контрольных телят в данном исследовании выделяли BRSV в течение этого исследования после фазы заражения. Только 3 из 22 вакцинированных животных выделяли BRSV в это время. Результат для группы предотвращения составил 0,8636. Наблюдали также значимое различие (р<0,05) в продолжительности выделения. Контрольная группа выделяла BRSV в среднем в течение 6,00 дней, а вакцинированные животные выделяли вирус лишь в течение 0,227 дней. Разница составляет 5,773 дней.

Ректальная температура: анализ ректальной температуры после заражения, с использованием средней температуры перед заражением в качестве коварианты, не выявил никаких статистически значимых различий между группами. Дальнейший анализ этих данных не проводили.

Клинические признаки BRSV: У каждого животного оценивали клинические признаки респираторного заболевания в течение двух последовательных дней перед заражением, в день заражения и в течение четырнадцати дней подряд после заражения. Клинических признаков, которые могли быть однозначно связаны с инфекцией BRSV, не наблюдали. Однако чрезмерные выделения из носа были зафиксированы как клинический признак для 7 из 11 контрольных телят, в тот же период времени активно выделяющих BRSV. Клинические признаки не были зафиксированы у вакцинированной группы в ходе исследования. Никаких неблагоприятных поствакцинальных реакций не наблюдали ни у одного из телят.

ВЫВОДЫ

Вышеизложенные результаты демонстрируют эффективность добавления фракции BRSV в МЖВ вакцину бычий ринотрахеит-Вирус Диареи-Парагриппз-респираторно-синцитиальный вирус, в предотвращении выделения BRSV телятами стокерами/фидерами.

О эффективности и антигенности фракции BRSV этого комбинированного продукта свидетельствует следующее:

1) Анализ выделения вируса (BRSV) выявил, что введение одной дозы вакцины обеспечивает 86% (19/22) защиту вакцинированных телят по сравнению с 100% (11/11) восприимчивостью в контроле (Доля предотвращения=0,8636).

2) значительное снижение продолжительности выделения вируса животными из вакцинированной группы по сравнению с контрольной группой. Телята из контрольной группы выделяли BRSV на 5,773 дней дольше, чем вакцинированные.

3) значительное увеличение титра антител к BRSV в вакцинированной группе по сравнению с контрольной группой.

Пример 7 - Описание эффективности IBR (HBV-1)

Этот пример показывает, что фракция вируса вируса бычьего герпеса 1 типа (BHV-1) в гексавалентной МЖВ вакцине способствует предотвращению бычьего инфекционного ринотрахеита (IBR).

Материалы и Методы

Шестивалентную вакцину из модифицированных живых вирусов получали как описано выше. Коротко, вирусы BHV1 (штамм Cooper), BVDV1a (штамм Singer), BVDV1b (штамм TGAC), BVDV2 (125), PI3 (Reisinger SF-4), и BRSV (N375) размножали в культуре клеток TVL-BK (20-ый пассаж). Отдельные фракции собирали на 10-м пассаже и смешивали вместе в конечный продукт из шести частей. Плацебо, не содержащее BHV-1, производили параллельно с эффективной вакциной. Не содержащее BHV-1 плацебо содержало те же штаммы BVDV-1a, BVDV-1b, BVDV-2, PI3 и BRSV, собранные вместе с вирусами, использованными для создания эффективной вакцины. BHV-1 заменяли на среду для культивирования, для поддержания эквивалентного объема между эффективной вакциной и не содержащим BHV-1 плацебо. Стерильный разбавитель использовали для регидратации как вакцины, так и не содержащего BHV-1 плацебо.

Коммерческих телят стокеров/фидеров примерно 3-4 месячного возраста, рандомизированных как описано выше, дегельминтизировали и вакцинировали от пастереллеза, микоплазмоза и эмфизематозного карбункула. Все телята имели свободный доступ к воде, сену из бермудской травы и комбикорму, содержащему кокцидиостатик, но не антибиотик. Доступность сена впоследствии могла быть ограничена, после того как телята переходили на корм.

В данном одноуровневом исследовании использовали около двадцати или более вакцинированных и десять или более контрольных телят. Две группы телят содержали перед заражением в отдельных, но эквивалентных помещениях. Затем телят смешивали в одном помещении за два дня до заражения (день -2).

Рандомизация

Для разделения телят на 2 группы лечения (вакцинированные и вакцинированные плацебо контрольные животные) может быть использована спаренная схема рандомизации. Например, трех телят, последовательно входящих на взгон для скота, рандомизировали на две группы лечения в соотношении 2:1. Ушные бирки, случайно извлекаемые из ведра при начальном взятии крови для серологических анализов, использовали для идентификации телят.

Обеспечение анонимности данных

Персонал не имел информации о том, какие животные являются вакцинированными, а какие контрольными, и весь персонал, полевой и лабораторный, проводил исследование вслепую (за исключением регистратора) в течение всего исследования.

Результаты

Первичным результатом данного исследования является разница в назальных поражениях, связанных с IBR. Его определяли как наличие или отсутствие назальных поражений. Другие клинические признаки IBR, включая продолжительность и тяжесть назальных поражений, выделение BHV-1 из ноздрей и температуру тела, считали вторичными результатами.

Баллы за назальные поражения выставляли в виде ординальных категорий. Продолжительность и степень тяжести видимых поражений слизистой оболочки носа, характерные для IBR, служили в качестве критериев оценки. Клинические признаки респираторного заболевания и выделение вируса в слизистой оболочке носа также могут быть использованы в качестве критерия для определения устойчивости (незараженные) или восприимчивости (зараженные) к заражению. Ежедневно измеряемую ректальную температуру каждого животного обычно анализируют с использованием средней температуры до заражения (базовый уровень) в качестве коварианты. Экспериментальные объекты исключали из исследования, если они имели титр сывороточных нейтрализующих антител к BHV-1>2 в момент начала исследования. Образцы крови отбирали у телят непосредственно перед вакцинацией (со дня -28 до -21-го дня) у животных из групп вакцинирования эффективной вакциной или не содержащим BHV-1 плацебо. Образцы крови также отбирали непосредственно перед заражением (день 0) и снова через 14 дней после заражения (день 14).

Выборочная совокупность, Сбор Данных и Клинические Наблюдения

Отбирали назальные образцы, и телят осматривали на наличие поражений в видимой слизистой оболочке носа и клинические признаки IBR со дня 0 по день 14. Ректальную температуру измеряли у каждого теленка с -2 дня по 14 день.

Конечные переменные включали видимые поражения слизистой оболочки носа, соответствующие IBR, ректальную температуру, выделение вируса, титр антител и клинические признаки IBR.

Явные назальные поражения при IBR описаны Rosner (1968). Типичные наблюдаемые поражения включают воспаление и отек носовых ходов с кровоизлияниями и фибронекротическим экссудатом на выстилающей слизистой оболочке. Rosner сообщил, что некротический экссудат в носовых проходах иногда настолько сильно выражен, что он образует псевдомембранозный экссудат, который отделен от подлежащей ткани. Rosner также описал, что обнаружение таких патологических изменений дает высокую степень уверенности в том, что предположительный диагноз IBR. В соответствии с установленными критериями, возможно устанавливать баллы за степень выраженности назальных поражений в соответствии с установленными критериями, а также можно анализировать их продолжительность, чтобы продемонстрировать, оказали ли вакцинация смягчающее влияние на продолжительность периода, в течение которого поражений не наблюдали.

Ректальную температуру, выделение вируса, титр антител и статистические методы оценивали и выполняли как описано в предыдущих примерах. Клинические признаки IBR описаны в работе Rosner (1968) и включают, но не ограничиваются, состояния с учащенным дыханием, анорексию, лихорадку, кашель, выделения из носа и потерю веса. Клинические признаки записывали два дня до заражения, в день заражения и в течение четырнадцати дней после заражения. Наблюдение клинических признаков IBR могли быть приняты во внимание в ходе анализа данных, но не рассматривались как основной результат, потому что эти признаки могли также быть признаками многих других дыхательных заболеваний, обычно встречающихся у крупного рогатого скота.

Статистический анализ: Групповое сравнение титра антител проводили с использованием U-критерия Манна-Уитни. Весь статистический анализ проводили с использованием программного обеспечения SAS Learning Edition v2.0 для MS-Windows® как описано выше.

Пример 7а - Исследование эффективности IBR (HBV-1)

Результаты данного исследования показывают, что фракция модифицированного живого вируса бычьего герпеса 1 типа (BHV-1) в вакцине из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса является антигенной и эффективной в профилактике инфекционного бычьего ринотрахеита (IBR). Две дозы вакцины вводили двадцати двум BHV-1 серонегативным телятам. Двенадцать серонегативных контрольных телят вакцинировали двумя дозами продукта, соответствующего плацебо вакцине. Все телята были заражены BHV-1 интраназально. Вакцинация привела к увеличению титра антител к BHV-1 и снижению как продолжительности, так и тяжести назальных поражений, связанных с IBR. Вакцинация также снизила продолжительность выделения вируса и лихорадки, которая обычно возникает после заражения BHV у телят. Следовательно, минимальная BHV-1 TCID50 в 5×103 на дозу была определена для фракции BHV-1 этой вакцины.

МАТЕРИАЛЫ И МЕТОДЫ

Вакцинация и заражение телят: тридцать четыре BHV-1 отрицательных телят смешали для сортировки. Каждого теленка отделяли воротами, после случайного разделения, по три теленка за один раз, через дорожку в одну из двух групп (Группа А -вакцинированные или Группа В - вакцинированные плацебо контрольные животные) с использованием спаренной схемы рандомизации, предоставляемой CVB-Biometrics. Двадцать два из серологически отрицательных телят вакцинировали одной дозой МЖВ вакцины бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса. Каждую вакцинацию проводили 2 мл дозой продукта путем подкожной инъекции в левую сторону шеи в день 0. Двенадцать телят вакцинировали продуктом, соответствующим вакцине плацебо (не содержащей BHV-1). Для определения выделения вируса BHV-1 отбирали назальные мазки и кровь у всех телят для серологического подтверждения восприимчивости к BHV-1. На 13-й день вакцинированные и контрольные телят получали вторую 2 мл дозу эффективной вакцины и плацебо-вакцины подкожно в правую сторону шеи. Через два дня до заражения и вакцинированную, и контрольную группы смешивали, чтобы провести клиническое наблюдение до заражения и получить базовые показания температуры тела. Вакцинированных и контрольных телят заразили через 15 дней после второй вакцинации 4 мл (2 мл в каждую ноздрю) вируса для заражения BHV-1, предоставленного USDA-APHIS-CVB, штамм Coopers, номер партии 05-08, дата производства 26 октября, 2005. Титр вируса для заражения был определен CVB и составлял 108,2 TCID50/2 мл. Вирус для заражения оттитровали непосредственно перед заражением и определили равным TCID50 108,0/4 мл, и сразу же после заражения и определили равным 107,4 TCID50/4 мл. Вирус для заражения хранили замороженным в течение процесса заражения.

Образцы крови собирали в день вакцинации, в день заражения и через 14 дней после заражения. Титр антител к бычьему вирусу герпеса определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки. Назальные мазки собирали в день вакцинации, в день заражения и в течение 14 дней подряд после заражения.

Ректальную температуру измеряли и записывали для каждого теленка каждый день в период за два дня до заражения, в день заражения и в течение 14 дней подряд после заражения.

Делали клинические наблюдения и выставляли баллы назальных поражений. Явные назальные поражения при BHV описаны в работе S.F. Rosner в JAVMA, Том 153, №12, декабрь 1968, с.1631-1638. Типичные наблюдаемые поражения включают воспаление и отек носовых ходов с кровоизлияниями и фибронекротический экссудатом на выстилающей слизистой оболочке. Rosner сообщил, что некротический экссудат в носовых проходах иногда настолько сильно выражен, что он образует псевдомембранозный экссудат, который отделен от подлежащей ткани. Rosner также описал, что обнаружение таких патологических изменений дает высокую степень уверенности в том, что предположительный диагноз IBR.

Баллы за назальные поражения выставляли в соответствии с критериями, перечисленными ниже:

Баллы Описание
0. Отсутствие поражений, характерных для вирусного заболевания IBR
1. Наличие поражений, характерных для заболевания IBR, не превышает 10% от видимой носовой слизистой оболочки.
2. Наличие поражений, характерных для заболевания IBR, затрагивает 11-25% видимой носовой слизистой оболочки.
3. Наличие поражений, характерных для заболевания IBR, затрагивает 26-50% видимой носовой слизистой оболочки.
4. Наличие поражений, характерных для заболевания IBR, затрагивает более 50% видимой носовой слизистой оболочки.

1. Наличие поражений, характерных для заболевания IBR, не превышает 10% от видимой носовой слизистой оболочки.

2. Наличие поражений, характерных для заболевания IBR, затрагивает 11-25% видимой носовой слизистой оболочки.

3. Наличие поражений, характерных для заболевания IBR, затрагивает 26-50% видимой носовой слизистой оболочки.

4. Наличие поражений, характерных для заболевания IBR, затрагивает более 50% видимой носовой слизистой оболочки.

Наблюдатели действовали вслепую, так как вакцинированная и контрольная группы были объединены и единственным отличительным признаком являлось число на ушной бирке. На протяжении всего исследования наблюдатели не получали информации о статусе вакцинирования индивидуального исследуемого животного. Персонал лаборатории не имел информации о статусе вакцинации телят.

Определение BHV-1: Назальные мазки отбирали у каждого теленка путем свабирования обеих ноздрей тампоном BBL Culture Swab® с жидкой средой Стюарта. Визуальное наблюдение специфичного для BHV-1 цитопатического эффекта и улучшенный метод ПЦР с культуры тканей использовали для обнаружения BHV-1 в собранных образцах. Кратко, образцы подвергали стерильной фильтрации (0,2 мкм) и добавляли к культуре клеток TVL-BK. Культуры инкубировали в течение 4 дней при температуре 37°С±2°С и с содержанием СО2 5±1%. Культуры проверяли на наличие специфического для BHV-1 цитопатического эффекта и результаты записывали. Супернатант из всех образцов культур (как при наличии, так и при отсутствии цитопатического эффекта) индивидуально анализировали на присутствие/отсутствие BHV-1 с использованием обычного метода количественной ПЦР в реальном времени и следующих зонда/набора праймеров:

Прямой праймер: CCATGTTAGCGCTCTGGAACC (SEQ ID NO:16)

Обратный праймер: CGTCTTTACGGTCGACGACTCC (SEQ ID NO: 17)

Зонд TaqMan MGB: ACGGACGTGCGCGAA (SEQ ID NO:18)

Специфичность зонда/набора праймеров была подтверждена исследователями, проводящими эксперимент, и они не демонстрировали перекрестную реакцию с PI3, BRSV, BVDV1a, BVDV1b или BVDV2. Анализы RT qPCR проводили с помощью анализа, основанного на Taqman® на приборе Applied Biosystems 7500. Все образцы, в которых наблюдали специфичный для BHV-1 цитопатический эффект по результатам ПЦР-анализа были также положительными. Было 8 образцов, которые были отрицательными по специфичному для BHV-1 цитопатическому эффекту и положительными на BHV-1 по результатам ПЦР-анализа. Это согласуется с проведенными исследованиями о том, что ПЦР-анализ более чувствителен, чем анализы, основанные на наблюдении специфичного для BHV-1 цитопатического эффекта. Образцы, которые были отрицательными на BHV-1 после первичного культивирования, пересевали и повторно исследовали на наличие цитопатического эффекта. Супернатант из смеси для культивирования анализировали на присутствие/отсутствие BHV-1 в соответствии с тем же методом.

Назальные поражения: первичными результатами исследования были различия в назальных поражениях, связанных с BHV-1. Долю предотвращения рассчитывали, как описано у Tanner and Morgan (1993), на основе наличия или отсутствия поражений у отдельного теленка. Оценочную условную долю смягчения тяжести поражений у зараженных телят определяли в соответствии с B.J. Fergen, Estimating an Intervention Effect on Outcome Severity, USDA, CVB. Продолжительность поражений (количество дней от первого до последнего дня, в течение которых поражения наблюдали) определяли для каждого пораженного теленка, и оценивали разность в продолжительности поражения в обеих группах.

Температура тела: Вторичным результатом исследования было различие в температуре тела между вакцинированными телятами и контрольной группой. Анализ ректальной температуры в течение дней 1-14 проводили с использованием дисперсионного анализа повторных измерений (ANOVA), включая значения Группы, Дня и взаимодействия Группа*День, и используя базовую линию температуры в качестве коварианты. Поскольку взаимодействие Группа*День было значимым (р<0,5), вакцинированную группу сравнивали с контрольной через простой эффект Группы для каждой временной точки. Эти простое сравнение эффекта было получено из взаимодействия Группа*День Выделение вируса: Другим вторичным результатом исследования была разница в выделении вируса после заражения BHV между вакцинированными и контрольными телятами. Долю предотвращения рассчитывали, как описано у Tanner and Morgan (1993), на основе выделения и идентификации BHV из назальных образцов отдельного теленка. Продолжительность выделения (количество дней с первого до последнего дня, в течение которых BHV-1 был обнаружен) определяли для каждого зараженного теленка, а разницу в продолжительности выделения животными обеих групп оценивали. Весь статистический анализ проводили с использованием программного обеспечения SPSS 17 версия для Windows.

РЕЗУЛЬТАТЫ

Титр нейтрализующих сывороточных антител: Все телята в этом исследовании имели до вакцинации титр нейтрализующих сывороточных антител к BHV-1<1:2. Все 12 телят в контрольной группе оставались серонегативными в день заражения (титр антител<1:2). Двадцать один из 22 телят в группе вакцинации были сероконвертированными с титром>1:2 в день заражения (медиана титра в группе 1:4). На 14 день после контрольного заражения все телята были сероконвертированными к BHV-1 (средний титр вакцинированных>256, медиана титра контрольных животных 128).

Назальные поражения: Назальные поражения наблюдали у всех 12 контрольных телят (100%) и у 20 из 22 вакцинированных телят (91%). Доля предотвращения для наблюдаемых назальных поражений составила 9%. Доля смягчения тяжести поражений у телят составила 90% (95% ДИ: 72%, 100%). Поражения среди заболевших контрольных животных были более серьезными, чем среди вакцинированных зараженных животных. Медиана времени, в течение которого наблюдали назальные поражения, составила 6 дней для вакцинированных и 10,5 дней для контрольных телят. Рассчитанная разница в продолжительности между двумя группами составила 4,5 дней.

Ректальная температура: анализ ректальной температуры после заражения, с использованием средней температуры перед заражением в качестве коварианты, выявил статистически значимое различие (р<0.05) в температуре между группами в течение нескольких дней. Анализ показал, что температура телят в контрольной группе была значительно (р<0.05) выше, в сравнение с базовой линией, по сравнению с животными из вакцинированной группы в течение дней с 3 по 9 и на 11 день после заражения.

Выделение BHV-1: Все контрольные и вакцинированные телята выделяли BHV-1 во время этого исследования после фазы заражения. Медиана продолжительности выделения BHV-1 телятами вакцинированной группы составила 6 дней и 10,5 дней для контрольных животных. Изменение в продолжительности выделения составило 4,5 дней. Все образцы, продемонстрировавшие специфичный для BHV цитопатический эффект, были подтверждены с помощью ПЦР. Тем не менее, было 8 образцов, в которых цитопатический эффект еще не наблюдали, но у которых был слабый положительный ПЦР сигнал. Эти 8 образцов не были включены как положительные в данный анализ.

Клинические признаки BHV-1: У каждого животного оценивали клинические признаки респираторного заболевания в течение двух последовательных дней перед заражением, в день заражения и в течение четырнадцати дней подряд после заражения. Клинические признаки, которые могут относиться к инфекции BHV-1 наблюдали и записывали. Никаких неблагоприятных поствакцинальных реакций не наблюдали ни у одного из телят.

ВЫВОДЫ

Вышеизложенные результаты демонстрируют эффективность добавления фракции BHV-1 в МЖВ вакцину ринотрахеит-вирус диареи-парагрипп3-респираторно-синцитиальный вирус в сокращении болезней, связанных с BHV-1 у телят стокеров/фидеров. Эффективность и антигенность фракции BHV-1 в этом продукте подтверждается следующим:

1) снижением тяжести и продолжительности назальных поражений в группе вакцинированных животных по сравнению с контрольной группой.

2) снижением лихорадки в вакцинированной группе по сравнению с контрольной группой.

3) Сероконвертацией к BHV-1 в вакцинированной группе по сравнению с контрольной группой.

Пример 8 - Описание эффективности PI3

Этот пример показывает, что фракция вируса бычьего парагриппа (PI3) в гексавалентной МЖВ вакцине способствует профилактике заболеваний, вызванных PI3.

Материалы и Методы

Шестивалентную вакцину из модифицированных живых вирусов получали как описано выше. Плацебо, не содержащее PI3, содержало те же штаммы BHV-1, BVDV-1a, BVDV-1b, BVDV-2, и BRSV, собранные вместе с вирусами, использованными для создания эффективной вакцины. PI3 заменяли на среду для культивирования, для поддержания эквивалентного объема между эффективной вакциной и не содержащим PI3 плацебо. Стерильный разбавитель использовали для регидратации как вакцины, так и не содержащего PI3 плацебо.

Использовали коммерческих телят стокеров/фидеров в возрасте около 3-4 месяцев? Рандомизированных как описано выше, затем животных дегельминтизировали и вакцинировали против пастереллеза, микоплазмоза, и эмфизематозного карбункула. Телята имели свободный доступ к воде, сену из бермудской травы и комбикорму, содержащему кокцидиостатик, но не антибиотик. Доступность сена впоследствии могла быть ограничена, после того как телята переходили на корм.

В данном одноуровневом исследовании использовали около двадцати или более вакцинированных и десять или более контрольных телят. Две группы телят содержали перед заражением в отдельных, но эквивалентных помещениях. Затем телят смешивали в одном помещении, за два дня до заражения (день -2).

Рандомизация

Для разделения телят на 2 группы лечения (вакцинированные и вакцинированные плацебо контрольные животные) может быть использована спаренная схема рандомизации. Например, трех телят, последовательно входящих на взгон для скота, рандомизировали на две группы лечения в соотношении 2: 1. Ушные бирки, случайно извлекаемые из ведра при начальном взятии крови для серологических анализов, использовали для идентификации телят.

Обеспечение анонимности данных

Персонал не имел информации о том, какие животные являются вакцинированными, а какие контрольными, и весь персонал, рабочий и лабораторный, проводил исследование вслепую (за исключением регистратора) в течение всего исследования.

Результаты

Первичным результатом данного исследования является предотвращение назального выделения вируса PI3 после заражения. Его определяли по наличию или отсутствию PI3 в назальных образцах, собираемых ежедневно у всех телят на протяжении всего исследования. Другие ожидаемые вторичные результаты включают ослабление клинических признаков инфекции PI3, смягчение лихорадки и сокращение продолжительности выделения телятами вируса PI3. Экспериментальных животных исключали из исследования, если они имели титр антител к PI3>2 в момент начала исследования.

Выборочная совокупность, Сбор Данных и Клинические Наблюдения

Образцы крови отбирали у телят непосредственно перед вакцинацией (дни с -28 по -21) эффективной вакциной или плацебо-вакциной, не содержащей PI3. Образцы крови также отбирали непосредственно перед заражением (день 0) и через 14 дней после заражения. Образцы крови для дифференциального подсчета лейкоцитов отбирали начиная со дня -2 до по меньшей мере 14 дня. Все образцы собрали в пробирки EDTA Vacutainer®, и подсчет проводили с использованием прибора для дифференциального подсчета лейкоцитов Drew Scientific, Hemavet 950. Назальные мазки отбирали для выделения вируса со дня -2 до по меньшей мере 14 дня.

Выделение PI3 животными из вакцинированной и контрольной групп определяли ежедневно в течение 14 дней после заражения. Обнаружение PI3 служило основным критерием для определения устойчивости (незараженные) или восприимчивости (зараженные) к заражению. Группы зараженных и незараженных сравнивали, чтобы определить, предотвращает ли вакцинация выделение PI3 после заражения вирусом PI3. Клинические признаки респираторного заболевания служили вторичным критерием для определения восприимчивости или устойчивости к заражению. Анализировали продолжительность выделения (количество дней, в течение которых PI3 обнаруживали у отдельного теленка), чтобы определить, оказывает ли вакцинация смягчающее влияние на этот параметр. Ежедневно измеряемую ректальную температуру каждого животного анализировали с использованием средней температуры до заражения (базовый уровень) в качестве коварианты.

Определение PI3: Назальные мазки отбирали у каждого теленка в день заражения и в течение 14 суток после заражения путем свабирования обеих ноздрей тампоном BBL Culture Swab с жидкой средой Стюарта. Среду из образцов анализировали на присутствие PI3 с помощью ПЦР в реальном времени с использованием специфических для PI3 зондов/набора праймеров, описанных здесь.

Длительность выделения: Продолжительность выделения определяли как количество дней, в течение которых PI3 обнаруживали в назальных мазках каждого отдельного теленка. Собранные данные о продолжительности анализировали, чтобы определить, оказывает ли вакцинация смягчающее действие на продолжительность периода времени, в течение которого PI3 обнаруживали в образцах назальных мазков.

Ректальная температура: ректальную температуру каждого животного измеряли каждый день и записывали со дня -2 до 14-го дня (2 дня до заражения, в день заражения и 14 дней после заражения). Высчитывали среднее значение температуры для каждого животного до заражения, на основе усреднения значений, полученных в промежуток времени со дня -2 до дня 0. Температуру в каждый день затем анализировали, используя базовую линию в качестве коварианты.

Титр антител: Титр сывороточных нейтрализующих антител определяли с помощью нейтрализующего анализа с постоянной концентрацией вируса и уменьшающейся концентрацией сыворотки для каждого животного в день вакцинации, 0 день и 14 день исследования.

Клинические признаки: Клинические признаки PI3 описаны в работе Bryson et al. (1989). Клинические признаки включают, но не ограничиваются ими, слабость, учащенное дыхание, лихорадку, кашель, посторонние и/или резкие звуки в легких. Клинические признаки записывали за два дня до заражения, в день заражения и в течение четырнадцати дней после заражения. Наблюдение клинических признаков PI3 принимали во внимание при анализе данных, но не рассматривали в качестве первичного результата из-за того, что эти признаки могут свидетельствовать о многих заболеваниях дыхательных путей, встречающихся у крупного рогатого скота.

Пример 8а - Исследование Эффективности PI3

Результаты данного исследования показывают, что фракция модифицированного живого вируса бычьего парагриппа (PI3) в вакцине из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса является антигенной и эффективной в предотвращении выделения вируса бычьего парагриппа3 телятами стокерами/фидерами. Две дозы вакцины вводили двадцати PI3 серонегативным телятам. Десять серонегативных контрольных телят вакцинировали двумя дозами продукта, соответствующего плацебо вакцине. Все телята были заражены PI3 интраназально. Вакцинация привела к увеличению титра антител к PI3 и предотвращению выделения вируса после заражения. Следовательно, минимальная PI3 TCID50 в 6×104 на дозу была определена для фракции PI3 этой вакцины.

МАТЕРИАЛЫ И МЕТОДЫ

Вакцинация и заражение телят: тридцать (30) PI3 отрицательных телят смешали для сортировки. Каждого теленка отделяли воротами, после случайного разделения, по три теленка за один раз, через дорожку в одну из двух групп (Группа А - вакцинированные или Группа В - вакцинированные плацебо контрольные животные) с использованием спаренной схемы рандомизации, предоставляемой CVB-Biometrics.

Двадцать телят вакцинировали одной дозой МЖВ вакцины бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса. Каждую вакцинацию проводили 2 мл дозой продукта путем подкожной инъекции в левую сторону шеи в день 0.

Десять телят вакцинировали продуктом, соответствующим вакцине плацебо (не содержащей PI3). Для определения выделения вируса PI3 отбирали назальные мазки, и кровь отбирали у всех телят для серологического подтверждения восприимчивости к PI3. На 25-й день вакцинированные и контрольные телята получали вторую 2 мл дозу эффективной вакцины и плацебо-вакцины подкожно в правую сторону шеи. За два дня до заражения и вакцинированную, и контрольную группы смешивали, чтобы провести клиническое наблюдение до заражения и получить базовые показания температуры тела. Вакцинированных и контрольных телят заразили через 15 дней после второй вакцинации 4 мл (2 мл в каждую ноздрю) вируса для заражения PI3, предоставленного USDA-APHIS-CVB, штамм Reisinger, номер партии 05-07, дата производства 26 июля, 2005. Титр вируса для заражения был определен CVB и составлял 108,2 TCID50/2 мл. Вирус для заражения оттитровали непосредственно перед заражением и определили равным TCID50 108,3/4 мл, и сразу же после заражения и определили равным 108,2 TCID50/4 мл. Вирус для заражения хранили замороженным в течение процесса заражения.

Образцы крови собирали в день вакцинации, через 6 дней после вакцинации, в день заражения и через 14 дней после заражения. Титр антител к вирусу бычьего парагриппа определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки.

Назальные мазки собирали в день вакцинации, в день заражения и в течение 10 дней подряд после заражения.

Ректальную температуру измеряли и записывали для каждого теленка каждый день в период за два дня до заражения, в день заражения и в течение 14 дней подряд после заражения.

Проводили клинические наблюдения. Персонал не имел информации о том, какие животные являются вакцинированными, единственным отличительным признаком был номер на ушной бирке. Все наблюдатели не имели информации о статусе вакцинации любого из подопытных животных в течение всего исследования. Персонал в лаборатории не имел информации о статусе вакцинации телят.

Определение PI3: Назальные мазки отбирали у каждого теленка путем свабирования обеих ноздрей тампоном BBL Culture Swab® с жидкой средой Стюарта. Визуальное наблюдение специфичного для PI3 цитопатического эффекта и улучшенный метод ПЦР с культуры тканей использовали для обнаружения PI3 в собранных образцах. Кратко, образцы подвергали стерильной фильтрации (0,2 мкм) и добавляли к культуре клеток TVL-BK. Культуры инкубировали в течение 4 дней при температуре 37°С±2°С и с содержанием СО; 5±1%. Культуры проверяли на наличие специфического для PI3 цитопатического эффекта и результаты записывали. Супернатант из всех образцов культур (как при наличии, так и при отсутствии цитопатического эффекта) индивидуально анализировали на присутствие / отсутствие PI3 с использованием обычного метода количественной ПЦР в реальном времени и следующего зондов/набора праймеров:

Прямой праймер: GGAGACCAAGACCAAGGAGATG (SEQ ID NO:13)

Обратный праймер: CGTCTGCCCATGCATAAGG (SEQ ID NO:14)

Зонд TaqMan MGB: ACCTCGGTCATCCATAG (SEQ ID NO:15)

Этот метод был разработан на основе работы А. Hu et.al. (Development of a real-time RT-PCR assay for detection and quantitation ofparainfluenza virus 3. А. Hu, M. Colella, P. Zhao, F. Li, J.S. Tarn, R. Rappaport, S.M. Cheng. Journal ofVirological Methods, 130 (2005) 145-148). Специфичность зонда/набора праймеров была подтверждена исследователями, проводящими эксперимент, и они не демонстрировали перекрестную реакцию с BHV, BRSV, BVDV1a, BVDV1b или BVDV2. Анализы RT qPCR проводили с помощью анализа, основанного на Taqman® на приборе Applied Biosystems 7500. Все образцы, в которых наблюдали специфичный для PI3 цитопатический эффект, по результатам ПНР-анализа были также положительными. Было 17 образцов, которые были отрицательными по специфичному для PI3 цитопатическому эффекту и положительными на PI3 по результатам ПНР-анализа. Это согласуется с проведенными исследованиями о том, что ПЦР-анализ более чувствителен, чем анализы, основанные на наблюдении специфичного для PI3 цитопатического эффекта. Образцы, которые были отрицательными на PI3 после первичного культивирования, пересевали и повторно исследовали на наличие цитопатического эффекта. Супернатант из смеси для культивирования анализировали на присутствие/отсутствие PI3 в соответствии с тем же методом.

Статистический анализ: Оценка эффективности фракции PI3 в данной вакцине преимущественно основывалась на доле вакцинированных телят, которые выделяли PI3, в сравнении с долей контрольных телят, которые выделяли PI3 после заражения. Долю предотвращения рассчитывали, как описано в работе Tanner and Morgan (1993). Групповое сравнение ординально масштабированных данных о титре выполняли с использованием U-критерия Манна - Уитни. Ректальные температуры анализировали с использованием среднего значения температуры до заражения в качестве коварианты. Анализ температуры в течение с 1 по 14 день после заражения проводили путем дисперсионного анализа повторных измерений (ANOVA). Весь статистический анализ проводили с использованием программного обеспечения SAS для Windows.

РЕЗУЛЬТАТЫ

Титр нейтрализующих сывороточных антител: Все телята в этом исследовании имели до вакцинации титр нейтрализующих сывороточных антител к PI3<1:2. Ни один из вакцинированных телят не продемонстрировал анамнестический иммунный ответ на введение вакцины. В день заражения животные в вакцинированной группе имели среднее значение титра антител к PI3 1:16, что достоверно (р:<0,5) больше, чем в контрольной группе 1:3. Один теленок в контрольной группе, теленок 7, продемонстрировала титр 1:16 в контрольной группе в течение исследования. Этот теленок также продемонстрировал анамнестический ответ на заражение и имел титр антител 1: 128 через шесть дней после заражения. Остальные девять контрольных телят были серонегативными в день заражения и не продемонстрировали анамнестического ответа на заражение.

Выделение PI3: Все десять контрольных телят выделяли PI3 во время этого исследования после фазы заражения. Только 4 из 20 вакцинированных телят выделяли PI3 в это же время. Это означает, что доля предотвращения составляет 0,80. Все образцы, продемонстрировавшие специфичный для PI3 цитопатический эффект, были подтверждены с помощью ПЦР. Тем не менее, было 17 образцов, в которых цитопатический эффект еще не наблюдали, но у которых был слабый положительный ПЦР сигнал. Эти 17 образцов были включены как положительные в данный анализ.

Ректальная температура: анализ ректальной температуры после заражения, с использованием средней температуры перед заражением в качестве коварианты, не выявил статистически значимого различия между группами. Дальнейший анализ этих данных не проводили.

Клинические признаки Р1З; У каждого животного оценивали клинические признаки респираторного заболевания в течение двух последовательных дней перед заражением, в день заражения и в течение четырнадцати последовательных дней после заражения. Клинических признаков, которые могут быть однозначно отнесены к инфекции PI3, не наблюдали. Никаких неблагоприятных поствакцинальных реакций не наблюдали ни у одного из телят.

ВЫВОДЫ

Вышеизложенные результаты демонстрируют эффективность добавления фракции PI3 в МЖВ вакцину ринотрахеит-вирус диареи-парагрипп3-респираторно-синцитиальный вирус, в предотвращении выделения PI3 телятами стокерами/фидерами. Об эффективности и антигенности фракции PI3 этого комбинированного продукта свидетельствует следующее:

1) Исследования выделения вируса (PI3) показали, что введение двух доз вакцины обеспечивает 80% (16/20) защиту вакцинированных телят по сравнению с 100% (10/10) восприимчивостью в контроле (Доля предотвращения=0,80).

2) значительное увеличение титра антител к PI3 в вакцинированной группе по сравнению с контрольной группой.

Пример 9 - Описание Эффективности BVDV-2

Этот пример показывает, что фракция вируса бычьей диареи 2 типа (BVDV-2) в гексавалентной МЖВ вакцине способствует профилактике заболеваний, вызванных BVDV-2.

Материалы и Методы

Шестивалентную вакцину из модифицированных живых вирусов получали как описано выше. Плацебо, не содержащее BVDV-2 производили параллельно с эффективной вакциной. Не содержащее BVDV-2 плацебо содержало те же штаммы BHV-1, BVDV-1a, BVDV-1b, PI3 и BRSV, собранные вместе с вирусами, использованными для создания эффективной вакцины. BVDV-2 заменяли на среду для культивирования, для поддержания эквивалентного объема между эффективной вакциной и не содержащим BVDV-2 плацебо. Стерильный разбавитель использовали для регидратации как вакцины, так и не содержащего BVDV-2 плацебо. Коммерческих телят стокеров/фидеров примерно 3-4 месячного возраста, рандомизированных как описано выше, дегельминтизировали и вакцинировали от пастереллеза, микоплазмоза и эмфизематозного карбункула. Все телята имели свободный доступ к воде, сену из бермудской травы и комбикорму, содержащему кокцидиостатик, но не антибиотик. Доступность сена впоследствии могла быть ограничена, после того как телята переходили на корм. В данном одноуровневом исследовании использовали около двадцати или более вакцинированных и десять или более контрольных телят. Две группы телят содержали перед заражением в отдельных, но эквивалентных помещениях. Затем телят смешивали в одном помещении, за два дня до заражения (день -2).

Рандомизация, обеспечение анонимности данных и результаты.

Рандомизацию, обеспечение анонимности данных и результаты проводили также, как описано в Примере 10.

Выборочная совокупность, Сбор Данных и Клинические Наблюдения

Образцы крови отбирали непосредственно перед вакцинацией (дни с -28 по -21) у телят, вакцинированных эффективной вакциной или плацебо-вакциной, не содержащей BVDV-2. Образцы крови отбирали также непосредственно в день заражения (день 0) и через 14 дней после заражения (День 14).

Образцы крови для дифференциального подсчета лейкоцитов отбирали начиная со дня -2 до по меньшей мере 14 дня. Все образцы собрали в пробирки EDTA Vacutainer®, и подсчет проводили с использованием прибора для дифференциального подсчета лейкоцитов Drew Scientific, Hemavet 950. Назальные мазки отбирали для выделения вируса со дня -2 до по меньшей мере 14 дня.

Конечные переменные включали лейкопению, гипертермию, назальное выделение вируса, вирусемию, образование нейтрализующих антител и клинические признаки. Первичным результатом является предотвращение индуцированной BVDV-2 лейкопении у телят из вакцинированной группы по сравнению с контрольной группой после заражения BVDV-2.

Лейкопения: данные о дифференциальном подсчете лейкоцитов анализировали, чтобы определить, было ли снижение уровня лейкоцитов после заражения. Среднее значение до заражения вычисляли для каждого животного путем усреднения количества лейкоцитов в дни с -2 по 0. Отношение количества лейкоцитов в конкретный день к среднему значению до заражения вычисляли (доля лейкоцитов от уровня до заражения) в течение каждого дня после заражения с 1 по 14 день или дольше, по усмотрению наблюдателей. Если доля у конкретного индивидуума уменьшалась на 25%, то его состояние классифицировали как лейкопения.

Выделение: Назальные мазки отбирали у каждого теленка в день заражения и в течение 14 суток после заражения путем свабирования обеих ноздрей тампоном BBL Culture Swab® с жидкой средой Стюарта. В день сбора образцы подвергали стерильной фильтрации через 0,2 мкм фильтр. Затем образец инокулировали в каждую лунку 12-луночного планшета, содержащую TVL-MDBK (~80% монослой). В одну лунку из планшета образец не инокулировали, и оставляли в качестве отрицательного контроля. Одну лунку планшета инокулировали разбавлением вируса, использованного для заражения, она служила положительным контролем. Планшеты инкубировали при 3-7% CO2 при температуре 35-39°С в течение от 2 до 4 дней. Среду из каждой лунки собирали и хранили при температуре от -18 до -22°С. Среду из лунок, которые демонстрировали типичную для BVDV-1a цитопатическую морфологию, дополнительно обрабатывали для определения конкретного инфекционного агента. Животных, которые показали положительный результат на культуре, классифицировали как «выделяющих».

Вирусемия: Лейкоцитарные пленки из образцов крови использовали для инокуляции в каждую лунку 12-луночного планшета, содержащего TVL-MDBK (~80% монослой). В одну лунку из планшета образец не инокулировали, и оставляли в качестве отрицательного контроля. Одну лунку планшета инокулировали разбавлением вируса, использованного для заражения, она служила положительным контролем.. Планшеты инкубировали при 3-7% С02 при температуре 35-39°С в течение от 2 до 4 дней. Среду из каждой лунки собирали и хранили при температуре от -18 до -22°С. Среду из лунок, которые демонстрировали типичную для BVDV-2 цитопатическую морфологию, дополнительно обрабатывали для определения конкретного инфекционного агента. Животных, которые показали положительный результат на культуре, классифицировали как животные «с вирусемией».

Титр антител: Титр сывороточных нейтрализующих антител к BVDV-2 определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки у каждого животного в день начала вакцинации (день -21), день заражения (день 0) и в конце исследования. Титр антител определяли в соответствии с протоколом Special Outline A-17, титрование нейтрализующих антител к вирусу бычьей вирусной диареи типа 2 (of Bovine Viral Diarrhea Virus Type 2 Neutralizing Antibody). Животных, которые развивали титр антител ≥8, считали сероконвертированными к BVDV-2.

Клинические признаки: Клинические признаки BVDV-2 могут включать, но не ограничиваются, лихорадку, лейкопению, диспноэ, выделения из носа и жидкий стул. Все соответствующие клинические признаки инфекции BVDV записывали в течение двух дней до заражения, в день заражения и в течение 14 дней после заражения. Наблюдение клинических признаков BVDV-2 принимали во внимание при анализе данных, но не рассматривали в качестве основного результата, так как эти признаки могут свидетельствовать о других заболеваниях, часто встречающихся в этом классе крупного рогатого скота.

Пример 9А - Исследование эффективности BVDV-2

Результаты данного исследования показывают, что фракция модифицированного живого вируса бычьей диареи (BVDV2) в вакцине из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиальный вируса является антигенной и эффективной в предотвращении заболевания, вызываемого BVDV2. Одну дозы вакцины вводили двадцати BVDV-серонегативным телятам. Десять серонегативных контрольных телят вакцинировали одной дозой продукта, соответствующего плацебо вакцине. Все телята были заражены BVDV (штамм 1373) интраназально. Вакцинация привела к увеличению титра антител к BVDV2 (от среднего <2 до <24), уменьшению смертности после заражения (умерли 7/10 контрольных животных и 0/20 вакцинированных животных). Следовательно, минимальная BVDV-2 TCID50 в 3×103 на дозу была определена для фракции BVDV-2 этой вакцины.

Пример 10 - Описание эффективности BVDV-1A

Этот пример показывает, что фракция вируса бычьей диареи типа la (BVDV-1a) в гексавалентной МЖВ вакцине способствует профилактике заболеваний, вызванных BVDV-1a.

Материалы и Методы

Шестивалентную вакцину из модифицированных живых вирусов получали как описано выше.

Плацебо, не содержащее BVDV-1a производили параллельно с эффективной вакциной. Не содержащее BVDV-1a плацебо содержало те же штаммы BHV-1, BVDV-1b, BVDV-2, PI3 и BRSV, собранные вместе с вирусами, использованными для создания эффективной вакцины. BVDV-1a заменяли на среду для культивирования, для поддержания эквивалентного объема между эффективной вакциной и не содержащим BVDV-1a плацебо. Стерильный разбавитель использовали для регидратации как вакцины, так и не содержащего BVDV-1a плацебо.

Коммерческих телят стокеров/фидеров примерно 3-4 месячного возраста, рандомизированных, как описано выше, дегельминтизировали и вакцинировали от пастереллеза, микоплазмоза и эмфизематозного карбункула. Все телята имели свободный доступ к воде, сену из бермудской травы и комбикорму, содержащему кокцидиостатик, но не антибиотик. Доступность сена впоследствии могла быть ограничена, после того как телята переходили на корм.

В данном одноуровневом исследовании использовали около двадцати или более вакцинированных и десять или более контрольных телят. Две группы телят содержали перед заражением в отдельных, но эквивалентных помещениях. Затем телят смешивали в одном помещении, за два дня до заражения (день -2).

Рандомизация

Для разделения телят на группы лечения (вакцинация или вакцинированный плацебо контроль) использовали спаренную схему рандомизации с использованием таблиц для рандомизации CVB-Biometrics, в которых трех телят, последовательно входящих на взгон для скота, рандомизировали на две группы в соотношении 2:1. Ушные бирки, случайно извлекаемые из ведра во время первичного взятия крови для серологических анализов, идентифицировали телят.

Обеспечение анонимности данных

Персонал не имел информации о том, какие животные являются вакцинированными, а какие контрольными, и весь персонал, полевой и лабораторный, проводил исследование вслепую (за исключением регистратора) в течение всего исследования.

Результат

Первичным результатом является лейкопения после заражения. Лейкопения определяется как 25%-ное снижение количества лейкоцитов по сравнению с исходным. Другие результаты, которые в большей степени подтверждают эффективность вакцины, включают назальное выделение, вирусемию, гипертермию, продукцию антител и клинические признаки BVDV.

Экспериментальные точки исключали из исследования, если в момент начала исследования наблюдали титр антител к BVDV-1>2

Выборочная совокупность, Сбор Данных и Клинические Наблюдения

Образцы крови отбирали непосредственно перед вакцинацией (дни с -28 по -21) у телят, вакцинированных эффективной вакциной или плацебо-вакциной, не содержащей BVDV. Образцы крови отбирали также непосредственно в день заражения (день 0) и через 14 дней после заражения (День 14).

Образцы крови для дифференциального подсчета лейкоцитов отбирали начиная со дня -2 до по меньшей мере 14 дня. Все образцы собрали в пробирки EDTA Vacutainer®, и подсчет проводили с использованием прибора для дифференциального подсчета лейкоцитов Drew Scientific, Hemavet 950. Назальные мазки отбирали для выделения вируса со дня -2 до по меньшей мере 14 дня.

Конечные переменные включали лейкопению, лихорадку, назальное выделение вируса, вирусемию, образование нейтрализующих антител и клинические признаки. Первичным результатом является предотвращение индуцированной BVDV-2 лейкопении у телят из вакцинированной группы по сравнению с контрольной группой после заражения BVDV-1а.

Лейкопения, Выделение вируса и Вирусемия: данные дифференциального подсчета лейкоцитов анализировали, как описано в примере 9; назальные мазки отбирали у каждого теленка в день заражения и в течение 14 суток после заражения путем свабирования обеих ноздрей тампоном с BBL Culture Swab® с жидкой средой Стюарта для определения выделения вируса также, как описано в примере 9. Лейкоцитарные пленки из образцов крови использовали для инокуляции каждой лунки 12-луночного планшета, содержащего TVL-MDBK (~80% монослой) и анализировали, как описано в примере 9.

Титр антител: Титр сывороточных нейтрализующих антител к BVDV-1a определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки у каждого животного в день начала вакцинации (день -21), день заражения (день 0) и в конце исследования. Титр антител определяли в соответствии с протоколом Special Outline A-17, титрование нейтрализующих антител к вирусу бычьей вирусной диареи типа 1a (of Bovine Viral Diarrhea Virus Type la Neutralizing Antibody). Животных, которые развивали титр антител ≥8, считали сероконвертированными к BVDV-1a.

Клинические признаки: Клинические признаки BVDV-1a могут включать, но не ограничиваются, лихорадку, лейкопению, диспноэ, выделения из носа и жидкий стул. Все соответствующие клинические признаки инфекции BVDV записывали два дня до заражения, в день заражения и в течение 14 дней после заражения. Наблюдение клинических признаков BVDV-1a принимали во внимание при анализе данных, но не рассматривали в качестве основного результата, так как эти признаки могут свидетельствовать о других заболеваниях, часто встречающихся в этом классе крупного рогатого скота.

пример 10А - исследование эффективности BVDV-1A

Результаты данного исследования показывают, что фракция модифицированного живого вируса бычьей диареи (BVDV1a) в вакцине из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиальный вируса является антигенной и эффективной в предотвращении инфекции, вызываемой BVDV1a. Одну дозу вакцины вводили двадцати BVDV-серонегативным телятам. Десять серонегативных контрольных телят вакцинировали одной дозой продукта, соответствующего плацебо вакцине. Все телята были заражены BVDV1a интраназально. Вакцинация привела к увеличению титра антител к BVDV1a, а также предотвращению или уменьшению вызываемых вирусом вирусемии, назального выделения, лихорадки, лимфопении и лейкопении. Следовательно, минимальная BVDV-1a TCID50 в 5×103 на дозу была определена для фракции BVDV1a этой вакцины.

МАТЕРИАЛЫ И МЕТОДЫ

Вакцинация, Заражение и Сбор образцов: тридцать (30) BVDV отрицательных телят смешали для сортировки. Каждого теленка отделяли воротами, после случайного разделения, по три теленка за один раз, через дорожку в одну из двух групп (Группа А - вакцинированные или Группа В - вакцинированные плацебо контрольные животные) с использованием спаренной схемы рандомизации, предоставляемой CVB-Biometrics. Двадцать телят вакцинировали одной дозой МЖВ вакцины ринотрахеита крупного рогатого скота-вируса диареи-парагриппа3-респираторно-синцитиального вируса. Каждую вакцинацию проводили 2 мл дозой продукта путем подкожной инъекции в левую сторону шеи в день 0.

Десять телят вакцинировали продуктом, соответствующим вакцине плацебо (не содержащей BVDV). За два дня до заражения и вакцинированную, и контрольную группы смешивали, чтобы провести клиническое наблюдение до заражения и получить базовые показания температуры тела и дифференциального подсчета лейкоцитов. Для определения выделения вируса BVDV отбирали назальные мазки, и кровь отбирали у всех телят для серологического подтверждения восприимчивости к BVDV. Вакцинированных и контрольных телят заразили через 21 день после вакцинации вирулентным изолятом BVDV1a, полученным из легких мертвого теленка с фермы Ruff Farms, Hanston, штат Канзас. Вирус культивировали in vitro на культуре клеток TVL-BK с использованием среды Игла, модифицированной Дульбекком, с 10% лошадиной сывороткой. Вирус для заражения оттитровали непосредственно перед заражением и определили равным TCID50 107,8/4 мл, и сразу же после заражения и определили равным 108,3 TCID50/4 мл. Два мл вируса для заражения вводили в каждый носовой проход во время вдоха. Вирус для заражения хранили замороженным в течение процесса заражения.

Образцы крови для определения титра антител собирали перед вакцинацией, в день заражения (21 день после вакцинации) и через 14 суток после заражения. Титр антител к вирусу бычьей диареи определяли нейтрализующим анализом с постоянной концентрацией вируса и убывающей концентрацией сыворотки. Назальные мазки для выделения вируса были собраны из телят, путем сваббирования обеих ноздрей тампоном BBL Culture Swab® с жидкой средой Стюарта в день заражения и в течение 14 суток после заражения.

Образцы крови для выделения вируса из лейкоцитарной пленки собирали у каждого теленка путем прокалывания вены в вакуумные пробирки с ЭДТА в день заражения и в течение 14 суток после заражения.

Ректальные температуры записывали каждый день для каждого теленка в течение двух последовательных дней перед заражением, в день заражения и в течение 14 суток после заражения.

Для каждого теленка выполняли и записывали клинические наблюдения. Наблюдатели действовали вслепую, так как вакцинированная и контрольная группы смешивались, и единственным отличительным признаком являлся номер на ушной бирке. На протяжении всего исследования наблюдатели не имели информации о статусе вакцинации индивидуального подопытного животного. Персонал лаборатории не имел информации о статусе вакцинации телят.

Пробы крови для дифференциального подсчета лейкоцитов собрали в течение двух последовательных дней перед заражением, в день заражения, и в течение 14 последовательных дней после заражения. Образцы собирали в вакуумные пробирки с ЭДТА, подсчет проводили с использованием счетчика для дифференциального подсчета лейкоцитов Drew Scientific, Hemavet 950.

Определение BVDV: Визуальное наблюдение специфичного для BVDV1a цитопатического эффекта и улучшенный метод ПЦР с культуры тканей использовали для обнаружения BVDV1a в собранных образцах. Кратко, назальные образцы подвергали стерильной фильтрации (0,2 мкм) и добавляли к культуре клеток TVL-BK. Лейкоцитарные пленки помещали прямо на культуру клеток TVL-BK на 45-75 минут перед тем, как промыть клетки. Культуры инкубировали в течение 4 дней при температуре 37°С±2°С и с содержанием CO2 5±1%. Культуры проверяли на наличие специфического для BVDV цитопатического эффекта, и супернатант из всех образцов культур индивидуально анализировали на присутствие/отсутствие BVDV1a с использованием обычного метода количественной ПЦР в реальном времени и следующего набора праймеров/зондов:

Прямой праймер: GGTCGCCCAGGTAAAAGCA (SEQ ID NO:7)

Обратный праймер: GCCTCTGCAGCACCCTATCA (SEQ ID NO:8)

Зонд TaqMan MGB: AACCGACTGTTACGAATAC (SEQ ID NO:9)

Этот метод был разработан на основе (Differentiation of types 1a, 1b and 2 bovine viral diarrhea virus (BVDV) by PCR, Julia F. Ridpath and Steven R. Bolin, Molecular and Cellular probes. Journal of Virological Methods, 130 (2005) 145-148). Этот метод также основан на протоколе испытаний Center for Veterinary Biologies и National Veterinary Services Laboratories - генотипирование вируса бычьей вирусной диареи (Genotyping Bovine Viral Diarrhea Virus) номер BPPR02010.01. Оба этих метода дифференциации генотипов и субгенотипов BVDV используют генетические различия, которые присутствуют в 5'-нетранслируемой области (НТО) генома. Эти зонд/набор праймеров были специально разработаны для амплификации части 5'НТО, в которой последовательности BVDV1a однозначно могут быть обнаружены с помощью высоко специфического зонда. Специфичность зонда/набора праймеров была подтверждена исследователями, выполнявшими анализ, и они не демонстрировали перекрестную реакцию с BHV, PL, BRSV, BVDV1b или BVDV2. Количественный ПЦР анализ в реальном времени проводили с использованием анализа, основанного на Taqman® на приборе Applied Biosystems 7500

Статистический анализ: Титр антител: Групповое сравнение ординально масштабированных данных о титре выполняли с использованием U-критерия Манна-Уитни.

Назальное выделение: Данные о выделении вируса из назальных мазков анализировали на основе доли вакцинированных животных, из которых был выделен BVDV1a, по сравнению с долей контрольных животных, из которых BVDV1a был выделен после заражения. Долю предотвращения рассчитывали на основе наблюдения цитопатического эффекта и определения с помощью ПЦР независимо. Долю предотвращения для выделения BVDV1a рассчитывали, как описано в работе Tanner and Morgan (1993).

Вирусемия: Данные о выделение вируса из лейкоцитарных пленок образцов крови проанализировали на основе доли вакцинированных животных, из которых был выделен BVDV1a, по сравнению с долей контрольных животных, из которых BVDV1a был выделен после заражения. Долю предотвращения рассчитывали на основе наблюдения цитопатического эффекта и определения с помощью ПЦР независимо. Долю предотвращения для вирусемии BVDV1a рассчитывали, как описано в работе Tanner and Morgan (1993).

Ректальная температура: Среднее значение ректальной температуры определяли для каждого животного. Это среднее значение использовали в качестве коварианты в дисперсионном анализе повторных измерений (ANOVA), который включал значения Группы, Дня и взаимодействия Группа*День.

Клинические признаки заболевания: Клинические признаки заболевания записывали ежедневно независимо каждым наблюдателем.

Лимфопения: Среднее значение до заражения вычисляли для каждого животного путем усреднения количества лимфоцитов в дни с -2 по 0. Отношение количества лимфоцитов в конкретный день к среднему значению до заражения вычисляли (доля лимфоцитов от уровня до заражения) в течение каждого дня после заражения с 1 по 14 день. Эти данные анализировали, чтобы определить, развилась ли у конкретного животного лимфопения, которая определяется уменьшением количества лимфоцитов на 25% от базового уровня. Долю предотвращения рассчитывали, как описано в работе Tanner and Morgan (1993), чтобы определить, предотвращала ли вакцинация развитие лимфопении в этом исследовании.

Лейкопения: Среднее значение до заражения вычисляли для каждого животного путем усреднения количества лейкоцитов в дни с -2 по 0. Отношение количества лейкоцитов в конкретный день к среднему значению до заражения вычисляли (доля лейкоцитов от уровня до заражения) в течение каждого дня после заражения с 1 по 14 день. Эти данные анализировали, чтобы определить, развилась ли у конкретного животного лейкопения, которая определяется уменьшением количества лейкоцитов на 25% от базового уровня.

Долю предотвращения рассчитывали, как описано в работе Tanner and Morgan (1993), чтобы определить, предотвращала ли вакцинация развитие лейкопении в этом исследовании.

Все статистические анализы проводили с использованием программного обеспечения SPSS version 16 для Windows.

РЕЗУЛЬТАТЫ

Титр сывороточных нейтрализующих антител: все телята в этом исследовании до вакцинации имели титр сывороточных нейтрализующих антител к BVDV<1:2. Ко дню заражения (День 21) средний титр сывороточных нейтрализующих антител к BVDV1a в группе вакцинированных животных составил 1:21, что было достоверно (р<0,05) больше в сравнении с таковым в контрольной группе<1:2. Титр антител к BVDV1a возрос за 14 дней после заражения у животных из контрольной и вакцинированной групп, что свидетельствует о том, что телята были заражены BVDV1a.

Выделение BVDV1a из Назальных Мазков; На основе наблюдения специфичного для BVDV цитопатического эффекта, все десять телят из контрольной группы выделяли BVDV1a в ходе данного исследования после заражения. Только 3 из 20 вакцинированных животных выделяли BVDV1a после заражения. Долю предотвращения рассчитывали исходя из соотношения 0/10 естественно защищенных животных к 17/20 защищенных вакциной животным. Это означает, что доля предотвращения равна 0.85.

Выделение BVDV1a из лейкоцитарных пленок. На основе наблюдения специфичного для BVDV цитопатического эффекта, шесть из десяти контрольных телят в настоящем исследовании находились в состоянии вирусемии в ходе данного исследования после заражения. Ни один из 20 вакцинированных телят не был в состоянии вирусемии после заражения. Долю предотвращения рассчитывали исходя из соотношения 4/10 естественно защищенных животных к 20/20 защищенных вакциной животным. Это означает, что доля предотвращения равна 1.0.

На основе определения BVDV1a с помощью улучшенного метода ПЦР с культуры ткани, семь из десяти контрольных животных в этом исследовании были в состоянии вирусемии в ходе данного исследования после заражения. Два из 20 вакцинированных телят были в состоянии вирусемии после заражения. Долю предотвращения рассчитывали исходя из соотношения 3/10 естественно защищенных животных к 18/20 защищенных вакциной животным. Это означает, что доля предотвращения равна 0.86.

Ректальная температура: Анализ ректальной температуры после заражения с использованием средней температуры до заражения в качестве коварианты показал значимый (р<0,05) эффект между группами и между группами в конкретные дни. Анализ показал, что температура в контрольной группе была достоверно выше, чем у вакцинированной группы, в дни 6, 8 и 14 и приближалась к достоверному различию в дни 5 и 11.

Клинические признаки BVDV1a: Один теленок в контрольной группе продемонстрировал клинические признаки, которые могут быть отнесены к инфекции BVDV1a. Клиническим признаком, наблюдавшимся у теленка 21, было обильное количество слизисто-гнойных выделений из носа. Ни один из телят в вакцинированной группе не продемонстрировал каких-либо клинических признаков инфекции во время этапа исследования после заражения BVDV1a. Никаких неблагоприятных поствакцинальных реакций не наблюдалось ни у одного из телят.

Лимфопения: Лимфопения была обнаружена у двух из 20 вакцинированных и у пяти из десяти подопытных животных, что означает долю предотвращения 80%. Данные о среднесуточной доле показывают типичный ответ контрольных телят на заражение BVDV (лимфопения с последующим возобновлением симптомов). Вакцинированные телята не отвечали подобным образом.

Лейкопения: Лейкопению обнаружили у пяти из 20 вакцинированных и четырех из десяти контрольных животных, что означает, что доля предотвращения составляет 37%. Данные о ежедневных средних долях представлены графически на Фиг.3.

ВЫВОДЫ

Вышеизложенные результаты демонстрируют эффективность добавления фракции BVDV1a в МЖВ вакцину ринотрахеит-вирус диареи-парагрипп3-респираторно-синцитиальный вирус для предотвращения инфекции, вызываемой BVDV1a.

О эффективности и антигенности фракции BVDV1a этого комбинированного продукта свидетельствует следующее:

1) значительное увеличение титра антител к BVDV1a в вакцинированной группе по сравнению с контрольной группой. У девятнадцати из 20 телят в вакцинированной группе титр антител к BVDV1a составил ≥1:8 после введения 2 мл одной дозы вакцины, отвечающей требованиям, определенным в 9CFR 113,311 (с) (5).

2) исследования по выделению вируса выявили, что введение одной дозы вакцины снижает индуцированные BVDV1a назальные выделения и вирусемию у телят после заражения.

3) вакцинированные телята продемонстрировали значительно меньшую температуру по сравнению с контрольными телятами.

4) Вакцинация также снизила индуцированные BVDV1a лимфопению и лейкопению у телят после заражения.

Результаты исследования являются статистически значимыми и клинически значимыми, таким образом, демонстрируя эффективность фракции BVDV1a, содержащейся в вакцине из модифицированных живых вирусов бычьего ринотрахеита-вируса диареи-парагриппа3-респираторно-синцитиального вируса.

ПРИМЕР 11 - Протокол анализа эффективности вакцин против транспортной ЛИХОРАДКИ

В совместно поданной предварительной заявке на патент США номер 61/427404, озаглавленной "Compositions and Methods for Identifying and Differentiating Viral Components of Multivalent Shipping Fever Vaccines" ("Композиции и способы для идентификации и дифференциации вирусных компонентов мультивалентных вакцин против транспортной лихорадки"), (поданной одновременно с данной заявкой 27 декабря 2010 года, и специально включенной здесь в полном объеме путем точного указания), авторы настоящего изобретения сообщили о разработке модифицированного генетического анализа, полезного для получения прямой количественной оценки вируса (т.е. "специфической активности") каждого отдельного вирусного компонента поливалентной вакцины. Изобретение заменяет обычные FA/IFA анализы (такие как описанные в текущем SAM 101 анализе) количественным ПЦР анализом в реальном времени, для определения наличия или отсутствия конкретных видов вирусов, типов или подтипов в отдельных исследуемых лунках (т.е. разведениях).

Испытание специфической активности отдельных компонентов поливалентной вакцины, такой как шестивалентная МЖВ вакцина, описанной здесь, может быть выполнено более объективно путем замены визуального наблюдения цитопатического эффекта в отдельных лунках на RT-qPCR/qPCR анализ. Например, наблюдение цитопатического эффекта при титровании вируса может быть весьма субъективным, в зависимости от условий анализа, и часто считается источником различий в титре МЖВ вакцины. При увеличении объективности анализа, однако, воспроизводимость между лабораториями также должна увеличиваться.

Испытание специфической активности PI3 может проводиться с использованием модифицированного метода анализа Supplemental Assay Method for the Titration of Parainfluenza 3 Vims Vaccines (Дополнительный метод анализа титрования вируса парагриппа3 в вакцинах) (MVSAM102.01). Испытание специфической активности BRSV можно проводить с использованием модифицированного метода анализа Supplemental Assay Method for Titration of Bovine Respiratory Syncytial Virus in Vaccines (дополнительный метод анализа титрования бычьего респираторно-синцитиального вируса в вакцинах) (MVSAM0129.01). Эти анализы модифицированы заменой анализа отдельных лунок для визуального наблюдения цитопатического эффекта на количественный ПЦР анализ в реальном времени. Титрование фракции BHV проводили с использованием модифицированного метода Supplemental Assay Method for the Titration of Infectious Bovine Rhinotracheitis Virus in Vaccines (дополнительный метод анализа титрования вируса инфекционного ринотрахеита крупного рогатого скота в вакцинах) (MVSAM0105.01). В этом анализе 96-луночный формат можно использовать вместо стандартного 6-луночного планшета для того, чтобы стандартизировать анализы для исследования поливалентных вакцин. Важно отметить, что этот протокол включает замену анализа отдельных лунок для визуального наблюдения цитопатического эффекта и подсчет бляшек BHV количественным ПЦР анализом отдельных лунок, чтобы обеспечить более точный и надежный анализ.

Настоящий пример демонстрирует использование методов количественной (в реальном времени), полимеразной цепной реакции (кПЦР), изложенных в одновременно поданной на рассмотрение изобретателями предварительной заявке на патент США №61/427404, для успешного определения специфической активности каждого из шести отдельных вирусных компонентов шестивалентной МЖВ вакцины, описанно и здесь. Изобретатели показали, что анализ является особенно подходящим по сравнению с существующими методиками определения отдельных специфических активностей генетически родственных штаммов в поливалентных образцах. При использовании шестивалентной МЖВ вакцины против респираторных инфекций крупного рогатого скота в качестве модели, анализ продемонстрировал эффективное количественное определение специфической активности трех родственных субгенотипов BVDV-1a, BVDV-1b, и BVDV-2, содержащихся в ней.

Материалы и Методы

Культуры клеток

Все культуры получали с использованием обычных методов и материалов, как описано у Freshney (1987). Линию клеток почки быка TVL, которая демонстрирует типичную морфологию эпителиальных клеток в культуре, использовали для всех анализов на культуре клеток.

Специфичность зондов/набора праймеров

РНК экстрагировали из вирусной жидкости из каждого из следующих вирусных инокулятов, утвержденных Департаментом сельского хозяйства США (USDA): BVDV-1a (штамм Singer), BVDV-1b (штамм TGAC), BVDV-2 (125), PI3 (Reisinger SF-4), и BRSV (N375) (процесс экстракции не выполняли для BHV-1 [штамм Cooper], так как это ДНК вирус). Экстракцию выполняли с использованием RNAqueous ®-4PCR (Ambion; Austin, TX, USA).

Каждый из образцов вирусной РНК использовали в качестве матрицы (образца) в отдельных количественных ПЦР с каждым из шести наборов праймеров/зондов с использованием химического анализа TaqMan® one-step RT-PCR. ДНК вируса (BHV-1) также использовали в качестве матрицы (образца) в отдельных реакциях количественной ПНР с каждым из шести наборов праймеров/зондов, описанных выше. Анализ наборов праймеров/зондов BRSV против всех шести вирусных фракций шестивалентной вакцины указывает, что нет никакой перекрестной реактивности для каждого из наборов праймеров/зондов с любой из других вирусных фракций.

кПЦР анализ

кПЦР анализ проводили на приборе Applied Biosystems 7500 Real-Time PCR System.

Олигонуклеотидные праймеры и меченые молекулярные зонды

Следующие изготовленные на заказ зонды TaqMan® и вирус-специфические пары прямых и обратных праймеров были изготовлены Applied Biosystems (Foster City, CA, USA).

BVDV-1b (первый):

Прямой праймер: 5'-CACCCTATCAGGCTGTATTCATAGC-3' (SEQ ID NO:1);

Обратный праймер: 5'-TGCCCACAGCACATCTTAACC-3' (SEQ ID NO:2); и

Зонд TaqMan® MGB для BVDV-1b: 5'-TCACCTGGACGACCC-3' (SEQ ID NO:3).

BVDV-1b (второй):

Второй прямой праймер: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:19);

Второй обратный праймер: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:20); и

Второй зонд для определения BVDV-1b: 5'-GTCGTCCAGGTGAAAACGGT-3' (SEQ ID NO:21).

BRSV:

Прямой праймер: 5'-GCAATGCTGCAGGACTAGGTATAAT-3' (SEQ ID NO:4);

Обратный праймер: 5'-ACACTGTAATTGATGACCCCATTCT-3' (SEQ ID NO:5); и

Зонд TaqMan® MGB BRSV: 5'-AAGACTTGTATGATGCTGCCAA-3' (SEQ ID NO:6).

BVDV-1a:

Прямой праймер: 5'-GGTCGCCCAGGTAAAAGCA-3' (SEQ ID NO:7);

Обратный праймер: 5'-GCCTCTGCAGCACCCTATCA-3' (SEQ ID NO:8); и

Зонд TaqMan® MGB для BVDV-1a: 5'-AACCGACTGTTACGAATAC-3' (SEQ ID NO:9).

BVDV-2:

Прямой праймер: 5'-GCTAGCCATGCCCTTAGTAGGAC-3' (SEQ ID NO:10);

Обратный праймер: 5'-GACGAGTCCCCTGTACTCAGG-3' (SEQ ID NO: 11); и

Зонд TaqMan® MGB для BVDV-2: 5'-CAGTGAGTCCATTGGATGG-3' (SEQ ID NO:12).

PI3:

Прямой праймер: 5'-GGAGACCAAGACCAAGGAGATG-3' (SEQ ID NO:13);

Обратный праймер: 5'-CGTCTGCCCATGCATAAGG-3' (SEQ ID NO:14); и

Зонд TaqMan® MGB для PI3: 5'-ACCTCGGTCATCCATAG-3' (SEQ ID NO:15).

BHV-1:

Прямой праймер: 5'-CCATGTTAGCGCTCTGGAACC-3' (SEQ ID NO:16);

Обратный праймер: 5'-CGTCTTTACGGTCGACGACTCC-3' (SEQ ID NO:17); и

Зонд TaqMan® MGB для BHV-1: 5'-ACGGACGTGCGCGAA-3' (SEQ ID NO:18).

Анализ специфической эффективности моновалентных вакцин

Протоколы для каждого из следующих анализов используют методику сравнения порогового цикла (СТ) Applied Biosystems 7500 для определения, содержит ли индивидуальная лунка планшета для титрования большее количество вируса, чем эквивалентная контрольная лунка. Большинство вирусных образцов содержат некоторые нежизнеспособные вирусные частицы, которые могут быть обнаружены с помощью ПЦР, таким образом, давая потенциально ложные положительные результаты. Эту проблему решают с помощью контрольного планшета без клеток. Образец разбавляют в контрольном планшете так же, как в планшете для анализа, но без клеток, чтобы исключить возможность репликации вируса. Контрольный планшет используют для получения значения базового уровня или фона СТ для каждой из лунок в каждом анализе. Если лунка опытного планшета имеет более высокое значение СТ, чем соответствующая лунка фона, значит вирусная репликация произошла, и лунка считается положительной. Если значение СТ не определено для лунки или значение СТ эквивалентно фоновому значению СТ, то лунка считается отрицательной.

Исследование специфической эффективности мультивалентных вакцин

Экспериментальную эффективную шестивалентную вакцину из модифицированных живых вирусов IBR/BVDV-1a, -1b, -2/PI3/RSV получали как описано здесь. Коротко, вирусы BHV-1 (штамм Cooper), BVDV-1a (штамм Singer), BVDV-1b (штамм TGAC), BVDV-2 (125), PI3 (Reisinger SF-4) и BRSV (N375) размножали в культуре клеток TVL-BK (20-й пассаж). Отдельные фракции собирали на десятом пассаже и смешивали вместе в конечный продукт из шести частей. Может быть проведено испытание специфической эффективности каждой из 6-ти фракций вакцины, как описано здесь, с добавлением подходящего количества нейтрализующей сыворотки. TCID50 каждого вирусного компонента определяли на основе цитопатического эффекта/FA/IFA и результаты сравнивали с полученными на основе RT-qPCR/qPCR.

Испытание Специфической активности BVDV-1A, -1В И -2

Моновалентные образцы BVDV-1a, BVDV-1b и BVDV-2 могут быть оттитрованы отдельно в соответствии с анализом Supplemental Assay Method for the Titration of Bovine Viral Diarrhea Virus in Vaccine (Дополнительный метод анализа титрования вируса бычьей вирусной диареи в вакцине) (SAM 101). Кратко, анализ проводили в двух повторностях с одним планшетом, используемым для расчета титра на основе цитопатического эффекта и/или FA/IFA, как описано. Другой планшет использовали для определения титра на основе количественной ПЦР в реальном времени. Контрольный планшет без клеток, как описано выше, использовали для каждого из вирусов.

Испытание Специфической активности PI3

Испытание специфической эффективности PI3 проводили в двух повторностях с одним планшетом, используемым для расчета титра на основе цитопатического эффекта. Другой планшет использовали для определения титра на основе сравнительных значений СТ PI3, определенных с помощью количественной ПЦР в реальном времени. Как описано выше, контрольный планшет без клеток также включали в анализ.

Исследование Специфической активности BRSV

Испытание специфической эффективности BRSV проводили в двух повторностях с одним из планшетов, используемым для расчета титра на основе цитопатического эффекта, как описано выше, а остальные планшеты использовали для определения титра на основе сравнительных значений СТ BRSV, определенных с помощью количественной ПЦР в реальном времени. Как описано выше, контрольный планшет без клеток также включали в анализ.

Исследование Специфической активности BHV

Испытание специфической активности BHV проводили в 96-луночном формате, заменяя количественный ПЦР анализ отдельных лунок обычным визуальным наблюдением и подсчетом бляшек. Анализ проводили в двух повторностях, один из планшетов использовали для расчета титра на основе наличия или отсутствия цитопатического эффекта в отдельной лунке (разведении), а оставшийся планшет использовали для расчета титра на основе сравнительных значений СТ BHV, определенных с помощью количественной ПЦР. Как описано выше, контрольный планшет без клеток также включали в анализ.

Ссылки

Следующие документы полностью включены в настоящую заявку посредством ссылки в той степени, в которой они описывают методики исследования или другую информацию, дополняющую примеры, описанные в настоящей заявке:

United States Patent No.4,415,732 to Caruthers et al.

United States Patent No.4,458,066 to Caruthers et al.

United States Patent No.4,683,195 to Mullis et al.

United States Patent No.4,683,202 to Mullis et al.

United States Patent No.4,725,677 to Roster et al.

United States Patent No.4,973,679 to Caruthers et al.

United States Patent No.4,980,460 to Moiko et al.

United States Patent No.5,614,388 to Picone et al.

Agrawal et al., Nucl. Acids Res., 18:5419-5423, 1990

Baker, J.C., "The clinical manifestations of bovine viral diarrhea infection," Vet. din. N. Am. Food Anim. Pract., 11:425-445, 1995.

Baker, J.C., Werdin, R.E., Ames, Т.K., Markham, R.J., and Larson, V.L., "Study on the etiologic role of bovine respiratory syncytial virus in pneumonia of dairy calves," J. Am. Vet. Med. Assoc., 189(1):66-70, 1986.

Barber, D.M., Nettleton, P.P., and Herring, J.A., "Disease in a dairy herd associated with the introduction and spread of bovine diarrhoea virus," Vet. Rec., 117(18):459-464,1985.

Beaucage and lyer. Tetrahedron, 48:2223-2311, 1992.

Becher, P., Konig, M., Paton, D.J., and Thiel, H.J., "Further characterization of border disease virus isolates: evidence for the presence of more than three species within the genus pestivims," Virology, 209(1):200-206, 1995.

Collett, M.S., R. Larson, S.K. Belzer, and E. Retzel, "Proteins encoded by bovine viral diarrhea virus: the gehomic organization of a pestivirus," Virology, 165(1):200-208,1988.

Elbers, K., N. Tautz, P. Becher, D. Stoll, T. Rumenapf, and H.J. Thiel, "Processing in the pestivirus E2-NS2 region: identification of proteins p7 and E2p7," J. Virol., 70(6):4131-4135,1996.

Fergen, B.J., "Estimating an Intervention Effect on Outcome Severity," USDA Center for Veterinary Biologies, Ames, IA, USA; Personal communication, 2004.

Finney, D.J., "Statistical method in biological assay," 3rd Ed., Charles Griffin and Company Ltd., London, 1978.

Flores, E.F., Ridpath, J.F., Weiblen, R. et al., "Phylogenetic analysis of Brazilian bovine viral diarrhea virus type 2 (BVDB-2) isolates: evidence of subgenotype within BVDV-2," Virus Res., 87:51-60, 2002.

Freshney, R.I., "Culture of Animal Cells, A Manual of Basic Technique," Second Edition, Dept of Medical Oncology, University of Glasgow, Alan R. Liss, Inc., Publisher, New York, NY, USA, 1987.

Fulton, R.W., Hessmand, B, Johnson, B.J. et al. "Evaluation of diagnostic test used for detection of bovine viral diarrhea vims and prevalence of subtypes 1a, 1b and 2a in persistently infected cattle entering a feedlot," J. Am. Vet. Med. Assoc., 228(4):578-584, 2006.

Gillespie, J.H., J.A. Baker, and K. McEntee, "A cytopathogenic strain of virus diarrhea virus," Cornell Vet., 50:73-79, 1960.

Hermann, M.A., Brechtbuhl, K., and Stauber, N., "Rapid characterization of new pestivirus strains by direct sequencing of PCR-amplified cDNA from the 5' non-coding region," Arch. Virol., 139:217-229, 1994.

Hollands al., Proc. Natl. Acad. Sci. USA, 88:7276-7280,1991.

Liess, В., H.R. Frey, H. Kittsteiner, F. Baumann, and W. Neumann, "Bovine mucosal disease, an immunobiological explainable late stage of BVD-MD virus infection with criteria of a 'slow virus infection,'" Dtsch. Tieraerzti. Wschr., 81(2);481-487, 1974.

Malmquist, W.A., "Bovine viral diarrhea mucosal disease: etiology, pathogenesis, and applied immunity,'" J. Am. Vet. Med. Assoc., 152:763-768, 1968.

McNulty M.S., Allan G.M., "Application of immunofluorescence in veterinary viral diagnosis," In: Recent advances in virus diagnosis, McNulty MS, McFerran JB (Eds.), pp.15-26. Martinus Nijhoff, The Hague, Netherlands, 1984.

Olafson, P., A.D., MacCallum, and F.H. Fox, "An apparently new transmissible disease of cattle," Cornell Vet., 36:205-213, 1946.

Ozaki et al., Nucl. Acids Res., 20:5205-5214, 1992.

Paton, D.J., "Pestivirus diversity," J: Comp. Pathol., 112(3):215-236, 1995.

Pellerin, С., J. van den Hurk, J. Lecomte, and P. Tussen, "Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities," Virology, 203(2):260-268, 1994.

Ramsey, F.K., and W.H. Chivers, "Mucosal disease of cattle," North Am. Vet., 34:629-633, 1953.

Ranheim, T, Mathis, P.K., Joelsson, D.B. et al., "Development and application of a quantitative RT-PCR potency assay for a pentavalent rotavirus vaccine (Rota Teq®)," J. Virol. Meth, 131:193-201, 2006.

Ridpath, J.F., and Bolin, S.R., "Differentiation of types 1a, 1b, and 2 bovine virus diarrhea virus by PCR," Molec. Cell. Probes, 12:101-106, 1998.

Ridpath, J.F., S.R. Bolin, and E.J. Dubovi, "Segregation of bovine viral diarrhea virus into genotypes," Virology, 205(1):66-74, 1994.

Ridpath, J.F., Bolin, S.R., and Dubovi, E.J., "Segregation of bovine viral diarrhea virus into genotypes," Virology, 205:66-74, 1994.

Ross, C.E., Dubovi, E.J., and Donis, R.O., "Herd problems of abortions and malformed calves attributed to bovine viral diarrhea," J. Am. Vet. Med. Assoc., 188(6):618-619, 1986.

Sambrook et al., Molecular cloning: a laboratory manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA, 1989.

Sambrook and Russell, Molecular cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA, 2001.

Schalk, J.A.C., de Vries, C.G.J.C.A., and Jongen, P.M.J.M., "Potency estimation of measles, mumps and rubella trivalent vaccines with quantitative PCR infectivity assay," Biologicals, 33(2):71-79, 2005.

Schalk, J.A.C., Elzen, C.V.D., Ovelgonne, H, et al., "Estimation of the number of infectious measles viruses in live virus vaccines using quantitative real-time PCR," J. Virol. Meth, 117:179-187,2004.

Schefers, J., Munoz-Zanzi, C., Collins, J.E., Goyal, S.M., and Ames, T.R., "Serological evaluation ofprecolostral serum samples to detect Bovine viral diarrhea virus infections in large commercial dairy herds," J. Vet. Diagn. Invest., 20:625-628, 2008.

Tanner, J.E., and A.P. Morgan, "Design and analysis of veterinary vaccine efficacy trials," Vet. Microbiol., 37(3-4):221-230, 1993.

Tautz, N., Elbers, K., Stoll, D., Meyers, G., and Thiel, H.J., "Serine protease of pesti viruses: determination of cleavage sites," J. Virol., 71(7):5415-5422, 1997.

Thiel et al., "The pestiviruses," In Virology, Fields et al., (eds. (Lippincott-Raven, Philadelphia, PA, USA), pp.1059-1073, 1996.

Vilcek, S, Paton, D.J., Durkovic, B, et al. "Bovine viral diarrhea virus genotype 1 can be separated into at least eleven genetic groups." Arch Virol., 146:99-115, 2001.

Wang, F, Puddy, A.C., Mathis, B.C., et al., "Using QPCR to assign infectious potencies to adenovirus based vaccines and vectors for gene therapy: toward a universal method for the facile quantitation of virus and vector potency," Vaccine, 23:4500-4508, 2005.

Wiskerchen, M., and M.S. Collett, "Pestivirus gene expression: protein p80 of bovine viral diarrhea virus is a proteinase involved in polyprotein processing," Virology, 184(1):341-350, 1991.

Wren, G., "New Thinking on BRSV: Research into BRSV and vaccines reveals new information about how the virus behaves and how it may interact with killed vaccines," Bovine Veterinarian, (February) pp.16-19, 2001.

Xu, J., E. Mendez, P.R. Caron, C. Lin, M.A. Murcko, M.S. Collett, and C.M. Rice, "Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites, cofactor requirements, and molecular model of an enzyme essential for pestivirus replication," J. Virol., 71(7):5312-5322, 1997.

Xue, W., D. Maffick, L. Smith, J. Umbaugh, and E. Trigo, "Vaccination with a modified-live bovine viral diarrhea virus (BVDV) type 1a vaccine completely protected calves against challenge with BVDV type 1b strains,", Vaccine, 29(1):70-76, Dec. 10, 2010, [epub ahead of print Oct. 27, 2010].

Все композиции и способы, раскрытые и включенные в формулу настоящей заявки, могут быть выполнены и осуществлены без излишних экспериментов согласно настоящему описанию изобретения. Выше приведены конкретные примеры композиций и способов данного изобретения, однако для специалистов в данной области должно быть очевидно, что в композиции, способы и последовательность этапов способов, описанных в настоящей заявке, могут быть внесены изменения, не выходящие за пределы принципов, сущности и объема изобретения. В частности, для специалистов в данной области должно быть очевидно, что определенные агенты, которые являются химически и физиологически родственными могут быть заменены на агенты, описанные в настоящей заявке, при этом будут достигнуты аналогичные или сходные результаты. Все указанные сходные замены и модификации являются очевидными для специалиста в данной области техники и рассматриваются как находящиеся в пределах сущности, объема и принципов изобретения, как определено следующей ниже формулой изобретения. Соответственно, исключительные права, на которые испрашивается патент, таковы, как описано ниже в формуле изобретения.

1. Иммуногенная композиция, содержащая модифицированный живой вирус бычьей вирусной диареи 1b типа (BVDV-1b) и приемлемый в ветеринарии носитель, где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

2. Иммуногенная композиция по п. 1, отличающаяся тем, что модифицированный живой вирус бычьей вирусной диареи является цитопатическим вирусом BVDV-1b.

3. Иммуногенная композиция по п. 1, дополнительно содержащая один или более: модифицированный живой вирус парагриппа 3 типа (PI3), модифицированный живой бычий респираторно-синцитиальный вирус (BRSV), модифицированный живой бычий вирус герпеса (BHV-1), модифицированный живой вирус бычьей вирусной диареи 1а типа (BVDV-1a) или модифицированный живой вирус бычьей вирусной диареи 2 типа (BVDV-2).

4. Иммуногенная композиция по п. 1, дополнительно содержащая иммунологически эффективное количество по меньшей мере одного дополнительного антигена; где по меньшей мере один дополнительный антиген является специфическим для организма, выбранного из группы, состоящей из Actinobacillus, Actinomyces, Bacillus, Bordetella, Brachyspira, Campylobacter, Clostridium, Ehrlichia, Erysipelothrix, Escherichia, Histophilus, Leptospira, Listeria, Mannheimia, Moraxella, Mycobacterium, Mycoplasma, Pasteurella, Salmonella и Streptococcus.

5. Иммуногенная композиция по п. 4, отличающаяся тем, что по меньшей мере один дополнительный антиген является инактивированным микробным патогеном.

6. Иммуногенная композиция по п. 5, отличающаяся тем, что инактивированный микробный патоген выбран из группы, состоящей из Actinobacillus, Actinomyces, Bacillus, Bordetella, Brachyspira, Campylobacter, Clostridium, Ehrlichia, Erysipelothrix, Escherichia, Histophilus, Leptospira, Listeria, Mannheimia, Moraxella, Mycobacterium, Mycoplasma, Pasteurella, Salmonella и Streptococcus или любой их комбинации.

7. Применение иммуногенной композиции по любому из пп. 1-6 для получения лекарственного средства для индуцирования иммунного ответа, специфического в отношении вируса бычьей вирусной диареи 1b типа (BVDV-1b) у млекопитающего.

8. Применение по п. 7, отличающееся тем, что лекарственное средство предназначено для профилактического введения млекопитающему.

9. Применение композиции, содержащей модифицированный живой вирус BVDV-1b и приемлемый в ветеринарии носитель для получения лекарственного средства для предотвращения транспортной лихорадки у млекопитающего; где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани; и где лекарственное средство включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу.

10. Применение по п. 9, отличающееся тем, что млекопитающее относится к полорогим жвачным животным.

11. Применение композиции, содержащей модифицированный живой вирус BVDV-1b и фармацевтически приемлемый носитель для получения лекарственного средства для предупреждения, лечения, ведения или облегчения одного или более симптомов заболевания, вызванного вирусом бычьей вирусной диареи, где лекарственное средство включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу и где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

12. Применение по п. 11, отличающееся тем, что композиция дополнительно содержит иммуноген, полученный из одного или более из: ротавируса крупного рогатого скота, BRSV, BHV-1, бычьего коронавируса, PI3, бычьего парамиксовируса, вируса ящура, вируса бычьего инфекционного ринотрахеита, BVDV-1a, BVDV-2, Mannheimia haemolytica типа A1, Mannheimia haemolytica типа A6, Pasteurella multocida, Histophilus somni и Mycoplasma bovis.

13. Применение по п. 11, отличающееся тем, что млекопитающее относится к полорогим жвачным животным.

14. Применение композиции, содержащей модифицированный живой вирус BVDV-1b и фармацевтически приемлемый носитель для получения лекарственного средства для защиты млекопитающего от заболевания, вызванного BVDV-1b; где лекарственное средство включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу и где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

15. Применение по п. 14, где лекарственное средство получают для совместного введения с вирусом бычьего инфекционного ринотрахеита, бычьим респираторно-синцитиальным вирусом или вирусом парагриппа 3 или их комбинацией.

16. Применение по п. 14, где заболевание представляет собой транспортную лихорадку, комплекс респираторных заболеваний коров или бычью вирусную диарею.

17. Способ индуцирования иммунного ответа, специфического в отношении вируса бычьей вирусной диареи 1b типа (BVDV-1b) у млекопитающего, включающий введение млекопитающему иммуногенной композиции по п. 1, где композиция включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу.

18. Способ по п. 17, при котором композиция вводится млекопитающему профилактически.

19. Способ предотвращения транспортной лихорадки у животного, включающий введение млекопитающему композиции, содержащей модифицированный живой вирус BVDV-1b и приемлемый в ветеринарии носитель, где композиция включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу и где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

20. Способ по п. 19, отличающийся тем, что млекопитающее инфицировано или является предрасположенным к инфицированию вирусом бычьей вирусной диареи.

21. Способ по п. 19, отличающийся тем, что млекопитающее относится к полорогим жвачным животным.

22. Способ предупреждения, лечения, ведения или облегчения одного или более симптомов заболевания, вызванного инфекцией вируса бычьей вирусной диареи, включающий введение млекопитающему композиции, содержащей модифицированный живой вирус BVDV-1b и фармацевтически приемлемый носитель, где композиция включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу и где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

23. Способ по п. 22, отличающийся тем, что композиция дополнительно содержит иммуноген, полученный из одного или более из: ротавируса крупного рогатого скота, BRSV, BHV-1, бычьего коронавируса, PI3, бычьего парамиксовируса, вируса ящура, вируса бычьего инфекционного ринотрахеита, BVDV-1a, BVDV-2, Mannheimia haemolytica типа A1, Mannheimia haemolytica типа A6, Pasteurella multocida, Histophilus somni и Mycoplasma bovis.

24. Способ по п. 22, отличающийся тем, что млекопитающее относится к полорогим жвачным животным.

25. Способ защиты млекопитающего от заболевания, вызванного BVDV-1b, включающий введение млекопитающему композиции, содержащей модифицированный живой вирус BVDV-1b и фармацевтически приемлемый носитель, где композиция включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу и где модифицированный живой BVDV-1b представляет собой штамм TGAC BVDV-1b, измененный путем перевивания в клетках культуры ткани.

26. Способ по п. 25, дополнительно включающий совместное введение вируса бычьего инфекционного ринотрахеита, бычьего респираторно-синцитиального вируса или вируса парагриппа 3 или их комбинации.

27. Способ по п. 25, где заболевание представляет собой транспортную лихорадку, комплекс респираторных заболеваний коров или бычью вирусную диарею.

28. Вакцина, включающая иммуногенную композицию по п. 1 и адъювант, где иммуногенная композиция включает по меньшей мере 2×103 TCID50 модифицированного живого вируса BVDV-1b на дозу.

29. Вакцина по п. 28, дополнительно включающая иммунологически эффективное количество по меньшей мере одного инактивированного микробного патогена.

30. Вакцина по п. 28, дополнительно включающая одно или более из:
по меньшей мере 5×103 TCID50 модифицированного живого вируса BHV-1 на дозу;
по меньшей мере 5×103 TCID50 модифицированного живого вируса BVDV-1a на дозу;
по меньшей мере 3×103 TCID50 модифицированного живого вируса BVDV-2 на дозу;
по меньшей мере 6×104 TCID50 модифицированного живого вируса PI3 на дозу; и
по меньшей мере 7×102 TCID50 модифицированного живого вируса BRSV на дозу.



 

Похожие патенты:

Изобретение относится к лекарственному средству с противовирусной активностью в отношении ВИЧ инфекции и вируса гепатита В, представляющему собой производное 2-хлор-5-фенил-5Н-пиримидо[5′,4′:5,6]пирано[2,3-d]пиримидин-4-ола общей формулы (I) где X выбран из группы Н, NO2, Hal, ОМе; R1 выбран из группы: Cl, ОН; R2 выбран из группы: Cl, SH, ОН.

Изобретение относится к области ветеринарии и предназначено для получения гипериммунной сыворотки против парагриппа-3 крупного рогатого скота. Быков иммунизируют вакциной «Паравак» через каждые 7 дней.

Изобретение относится к фармацевтической промышленности, в частности к противовирусному средству. Противовирусное средство на основе экстракта базидиомицета Coprinus comatus (O.F.

Изобретение относится к фармацевтической промышленности, а именно к применению суммы флавоноидов из корней или надземной части Alchemilla vulgaris L. в качестве противовирусного средства в отношении РНК-содержащего вируса гриппа А и ДНК-содержащих ортопоксвирусов и вируса простого герпеса 2-го типа.

Изобретение относится к фармацевтической промышленности, а именно к противовирусному средству на основе экстракта ксилотрофного базидиомицета Bjerkandera adusta (Willd.) P. Karst, представляющему собой сухой экстракт гриба, приготовленный методом высушивания водного извлечения биологически активных веществ из измельченного и гомогенизированного сырья, при определенном содержании компонентов в сухом экстракте.

Изобретение относится к области биохимии, в частности к аминокислотным последовательностям, которые направлены против и/или которые могут специфически связывать белок F hRSV.

Изобретение относится к новым ингибиторам репликации вируса гепатита В, представляющим собой 1,1-диоксо-1,4-дигидро-2Н-бензо[1,2,4]тиадиазин-3-оны общей формулы 1, их фармацевтически приемлемые соли и/или гидраты.

Изобретение относится к фармацевтической промышленности и представляет собой Фармацевтическое средство для ингибирования рецидива гепатоклеточной карциномы после ее лечения, содержащее перетиноин в сочетании с L-изолейцином, L-лейцином и L-валином.

Изобретение относится к области органической химии, а именно к соединению, выбранному из группы N-{4-[7-трет-бутил-8-метокси-5-(2-оксо-1,2-дигидро-пиридин-3-ил)-хинолин-2-ил]-фенил}-метансульфон-амида; N-{4-[7-трет-бутил-8-метокси-5-(6-метил-2-оксо-1,2-дигидро-пиридин-3-ил)-хинолин-2-ил]-фенил}-метансульфонамида; и N-{4-[7-трет-бутил-5-(2,4-диоксо-3,4-дигидро-2H-пиримидин-1-ил)-8-метокси-хинолин-2-ил]-фенил}-метансульфонамида; или к его фармацевтически приемлемой соли.

Изобретение относится к новым соединениям формулы (I), которые обладают свойствами ингибитора HCV NS5B РНК-полимеразы. Соединения могут быть использованы для лечения или профилактики инфекции, вызванной вирусом гепатита С (HCV). В формуле (I) : X представляет собой СН или N, R1 выбран из группы, состоящей из R1a, R1c: где R1a возможно замещен C1-6алкилом, C1-6алкокси или гидрокси, и где R1c возможно замещен C1-6алкилом; R2 представляет собой (а) арил, выбранный из фенила, или (б) NRaRb, где указанный арил возможно замещен (CH2)nNRcRd; Ra и Rb вместе с атомом азота, к которому они присоединены, представляют собой 5-членный циклический амин, замещенный группой (CH2)nNRcRd, где n означает число от нуля до двух; Rc и Rd независимо представляют собой водород, O2SR4, где R4 представляет собой C16алкил; R3 представляет собой CR4aR4bR4c, где: 1) R4a, R4b и R4c независимо выбраны из С1-3алкила.

Представленная группа изобретений касается способа получения антигенной композиции, содержащей цирковирус свиней типа 2 (PCV-2), антигенной композиции, иммуногенной композиции, способа уменьшения симптомов вызываемой PCV-2 инфекции у животного и способа повышения иммуногенности иммуногенной композиции.

Группа изобретений касается выделенной полинуклеотидной молекулы нуклеиновой кислоты, кодирующей северо-американский вирус репродуктивно-респираторного синдрома свиней (PRRS), клетки-хозяина для генерирования вируса PRRS, трансфецированной такой полинуклеотидной молекулой, вакцины для защиты свиньи против инфекции вирусом PRRS, молекулы РНК, кодирующей вирус PRRS, способа генерирования вируса PRRS in vitro и плазмиды, для экспрессии вируса PRRS.

Изобретение относится к медицине, а именно к вакцинопрофилактике. Предложена композиция вакцины, содержащая один или более антигенов, и адъювант, содержащий олеиновую кислоту и моноолеин для применения в интраназальной вакцинации пациента.

Группа изобретений относится к ветеринарии и может быть использована для вакцинации животных против вируса лейкемии кошек (FeLV). Композиция по изобретению содержит вектор экспрессии, содержащий первый полинуклеотид, кодирующий оптимизированный полипептид оболочки ENV вируса лейкемии кошек FeLV, и второй полинуклеотид, кодирующий полипептид GAG/PRO FeLV.

Bvdv-вакцина // 2578943
Группа изобретений относится к медицине, а именно к ветеринарии, и может быть использована для защиты восприимчивых жвачных животных против BVDV. Комбинированная вакцина содержит первый BVDV, принадлежащий к первому типу и несущий ген Е2 BVDV указанного первого типа, второй BVDV, принадлежащий к первому типу, где этот ген Е2 BVDV, принадлежащего к указанному первому типу, заменен геном Е2 BVDV, принадлежащего ко второму типу, и фармацевтически приемлемый носитель.

Изобретения относятся к области иммунологии и вирусологии и касаются иммунобиологического средства (варианты) и способа его использования (варианты). Представленное иммунобиологическое средство может быть получено на основе аденовируса человека пятого серотипа, содержащего кассету со вставкой модифицированного гена GP вируса Эбола /H.sapiens-wt/SLE/2014/Makona-ЕМ124.1 GenBank ID KM233045.1 с последовательностью, выбранной из SEQ ID NO 1, SEQ ID NO 2 (вариант 1).

Изобретение относится к иммунологии и вирусологии. Разработано иммунобиологическое средство для индукции специфического иммунного ответа к вирусу Эбола.

Изобретение относится к медицине, а именно к иммунологии и может быть использовано для создания вакцин против ВИЧ/СПИД. Для этого иммуногенная композиция содержит синтетические пептиды, повторяющие консенсусную последовательность группы М V1-, V2-, V3 - петли и V3 - петлю российского изолята RU A022a2 оболочечного белка gp120 ВИЧ1, а также иммуноадъювант или нагруженные пептидами дендридные клетки.

Предложенное изобретение относится к области биотехнологии, а именно к вирусоподобной частице (VLP) для применения в вакцинах или антигенных композициях для лечения или профилактики инфекции вируса бешенства (RV), а также способам их получения и применения.

Изобретение относится к области биотехнологии, вирусологии и ветеринарии. Изобретение раскрывает применение иммуногенной композиции, содержащей рекомбинантный белок PCV2 ORF2, для индукции иммунного ответа против PCV2 или для получения лекарственного средства для индукции иммунного ответа против PCV2.

Изобретение относится к области биотехнологии и вирусологии. Описана самореплицирующаяся молекула РНК. Молекула содержит первую нуклеотидную последовательность, кодирующую первый белок вируса герпеса, и вторую нуклеотидную последовательность, кодирующую второй белок вируса герпеса. Молекула предназначена для получения комплексов белков в клетке. Также описаны частица репликона альфавируса, содержащая такую молекулу РНК, композиция, содержащая такой альфавирус, и способы индукции иммунного ответа у индивидуума, с использованием таких молекул РНК, альфавируса и композиции. Изобретение может быть использовано в медицине. 10 н. и 21 з.п. ф-лы, 57 ил., 11 табл., 7 пр.
Наверх