Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение



Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение
Новая комбинация, содержащая n-ацетил-l-цистеин, и ее применение

 


Владельцы патента RU 2605287:

Иасомай АБ (SE)

Группа изобретений относится к фармацевтической области и касается медицинского продукта, содержащего комбинацию N-ацетил-L-цистеина, селена в форме селенометионина и мелатонина. Описанный продукт может применяться для лечения карциномы, дерматологических заболеваний, хронической обструктивной болезни легких (ХОБЛ), амилоидоза, эндометриоза и бактериальных инфекций, вызванных Е. coli., для косметического лечения кожи, а также в качестве антибактериального агента с медицинским устройством, адаптированным для применения в контакте с жидкостями организма. Группа изобретений обеспечивает синергетический эффект по сохранению N-ацетил-L-цистеина, благоприятный эффект на лечение ХОБЛ, эндометриоза, амилоидоза, дерматологических заболеваний и кожных состояний, таких как витилиго, псориаз, алопеция, себорейный дерматит, а также улучшенную пероральную абсорбцию. 3 н. и 9 з.п. ф-лы, 9 ил., 1 табл., 5 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к комбинации N-ацетил-L-цистеина, селена, предпочтительно в виде селенометионина, и мелатонина и к фармацевтической композиции, содержащей такую комбинацию, полезной для лечения ряда заболеваний и состояний, например доброкачественной и злокачественной неоплазии, включая раковые заболевания различного вида, аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета 2 типа, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи, дерматологических заболеваний, включая витилиго, алопецию и псориаз. Комбинация также является полезной в качестве антибактериального агента и для косметических целей.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Контроль и модуляция восстановления и окисления (редокс) во внутриклеточной среде имеет основополагающее значение для клеточных процессов. Например, ослабление редокс-контроля в клеточном цикле может приводить к более окислительной среде, способствуя переходу от G1- к S-фазе и, следовательно, приводя к аберрантной пролиферации, отличительному признаку различных неоплазий. Также большинство хронических воспалительных заболеваний сопровождается ослаблением редокс-контроля. Дисрегуляцию в сторону более окисленной внутриклеточной среды, таким образом, ассоциируют с аберрантной пролиферацией и воспалением и поэтому, в конечном счете, связывают с заболеваниями, такими как, без ограничения, рак, нейродегенеративное заболевание, диабет, аберрантное заживление ран, фиброз. Кроме того, в окислительных средах белки могут подвергаться окислительной модификации, процессу, часто сопровождающемуся образованием агрегатов, также в форме амилоидов.

Функциональный статус клеток находится под контролем внешних стимулов, влияющих на функцию критических белков и экспрессию генов. Распознавание и трансдукция сигнала мессенджерами к специальным эффекторам действует посредством посттрансляционной модификации белков, среди которых тиоловые (-SH) переключатели восстановления/окисления (редокс) играют основополагающую роль. Чувствительные цистеиновые остатки в белках составляют указанные редокс-переключатели, где "чувствительные" указывает на более низкий электрохимический потенциал редокс-пары цистеин/цистин (SH/S-S), являющийся результатом специфической конформации белка. Все тиоловые редокс-переключатели, например, в ферментах, рецепторах, транспортерах, факторах транскрипции, структурных элементах, регуляторах миграции, синтеза и деградации белка и структуре цитоскелета, сильно затрагивают клеточный гемостаз в целом.

Продуцирование оксидантов в клетках млекопитающего обусловлено основополагающими процессами, такими как гликолиз и митохондриальная дыхательная цепь, завершающимися продуцированием активных форм кислорода, среди которых наиболее стабильный представлен перекисью водорода (H2O2). Продуцированные оксиданты должны находиться под строгим контролем, и реверсирование окислительного пути является необходимым. На редокс-контроль влияют некоторые низкомолекулярные вещества и сложная система ферментов, включая, среди прочего, глутатионредуктазу (GR) и семейство селензависимых глутатионпероксидаз (GPx). Восстановленный глутатион (GSH) является преобладающим низкомолекулярным тиоловым веществом у большинства организмов, чей редокс-потенциал используется многими ферментами при редокс-контроле в клетках, включая GR и GPx, для рециркуляции их собственного редокс-статуса.

Восстановленный глутатион (GSH) представляет собой трипептид, присутствующий во всех тканях человека в относительно высоких концентрациях, даже выше 10 мМ. Он обладает многими важными функциями в организме. Как описано выше, его можно рассматривать в качестве основного эндогенного антиоксиданта, участвующего: 1) в контроле редокс-статуса клетки и 2) в контроле окислительного статуса белков, имеющих отношение к передаче сигналов, включая рецепторы внешних стимулов (например, рецепторы гормонов). Он играет основополагающую роль в многочисленных метаболических и биохимических реакциях, таких как синтез и репарация ДНК, синтез белка, синтез простагландина, транспорт аминокислот и активация ферментов. Он также участвует в регуляции цикла окиси азота, обезвреживает многие канцерогены и другие ксенобиотики и имеет важное значение для оптимального ответа во многих частях иммунной системы. Таким образом, на большинство систем в организме может влиять состояние системы глутатиона. Например, состояния глутатионовой недостаточности включают ВИЧ/СПИД, химический и инфекционный гепатит, рак предстательной железы и другие раковые заболевания, катаракты, болезнь Альцгеймера, болезнь Паркинсона, хроническую обструктивную болезнь легких, астму, радиационное поражение, состояния нарушения питания, тяжелый физический стресс и старение, и они были ассоциированы с субоптимальным иммунным ответом. Низкий уровень глутатиона также сильно вовлечен в истощение и отрицательный азотистый баланс, как это видно при раке, СПИДе, сепсисе, травме, ожогах и даже спортивной перетренированности, а также при биполярном расстройстве, большом депрессивном расстройстве и шизофрении.

Глутатион синтезируется из аминокислот L-цистеин, L-глутаминовая кислота и глицин. Сульфгидрильная (тиоловая) группа (SH) цистеина служит в качестве донора протонов и отвечает за биологическую активность глутатиона. Запас цистеина является ограничивающим скорость фактором в синтезе глутатиона клетками, так как цистеин является довольно редким питательным веществом. Таким образом, при различных заболеваниях и симптомах было предложено добавление глутатиона.

Однако глутатион, принимаемый перорально, может деградировать уже в желудке и не абсорбируется как следует по всему желудочно-кишечному тракту. Таким образом, повышение уровней глутатиона через непосредственное добавление глутатиона является затруднительным. Вместо этого для увеличения концентрации глутатиона в плазме используют добавления агентов, которые служат в качестве предшественников глутатиона. N-ацетил-L-цистеин (в дальнейшем NAC) является более простой молекулой, чем глутатион, легко диффундирует почти во все ткани и клетки и представляет собой наиболее биодоступный предшественник глутатиона. Среди нескольких тиоловых агентов, прошедших тестирование на их эффективность в модуляции клеточного редокс-статуса, NAC имеет наибольшую перспективу для применения человеком. Важным преимуществом в клиническом применении NAC является предполагаемое отсутствие побочных эффектов. Это соединение долго являлось доступным для врачебной практики в качестве муколитического агента и в качестве противоядия после отравления парацетамолом.

В последние годы NAC также был признан в качестве имеющего другие полезные свойства. Например, сообщалось, что NAC обладает противовоспалительным эффектом и добавлен в семейство нестероидных противовоспалительных лекарственных средств (НСПВП). Авторы настоящего изобретения ранее показали, что в клетках млекопитающего in vitro NAC ингибирует пролиферацию и поддерживает состояние покоя, в дальнейшем переходящее в терминальную дифференцировку (WO 02/051405 A1, Т. Parasassi, et. al. (Cell Death and Differentiation (2005), Vol.12, No.10, pages 1285-1296); E.K. Krasnowska et. al. (Free Radicals Biology and Medicine 2008, 45(11): 1566-72) и A.C. Gustafsson et. al. (BMC Cancer (2005), 5:75)). В этом контексте было обнаружено, что NAC обладает заметным антипролиферативным действием на раковые клетки, а также было обнаружено, что он является эффективным в лечении эндометриоза. Кроме того, он был использован в лечении синдрома поликистозных яичников (PCOS), а также для лечения различных других заболеваний и состояний, например в качестве нефропротективного агента, интерстициального заболевания легких, шизофрении, биполярного расстройства и депрессии, и был предложен для различных других применений.

Таким образом, NAC является эффективным для многих применений. Однако длительное лечения NAC приводит к пониженному уровню NAC в плазме, так что его эффективная концентрация должна быть увеличена, а соответственно увеличивается риск нежелательных побочных эффектов (L Pendyala and Р J Creaven, Cancer Epidemiol Biomarkers Prev 1995; 4:245-251). Чтобы противодействовать падающему эффекту NAC, было предложено импульсное лечение, чтобы делать возможным период вымывания. Другим возможным решением могло бы быть понижение концентрации, при которой NAC является эффективным, что могло бы быть выгодным также для кратковременных лечений.

Недавно возник широкий интерес к защитной и/или терапевтической роли как селена (в дальнейшем Se), так и мелатонина (в дальнейшем Mel). Например, было предложено добавление Se в качестве антиоксиданта или агента, усиливающего иммунитет, для предупреждения рака. Подобным образом был изучен мелатонин в отношении лечения рака, иммунных заболеваний и различных других расстройств. Несмотря на это, также сообщалось о противоречивых эффектах этих двух веществ. Например, было признано, что Mel имеет антиоксидантное действие, но также иногда сообщалось, что он действует в качестве прооксиданта (Cemeli Е, Baumgartner A, Anderson D. Mutat Res. 2009; 681: 51-67; Wölfler A, Caluba HC, Abuja PM et al. FEBS Lett. 2001; 502(3): 127-31; Radogna F et al. Toxicology and Applied Pharmacology 2009; 239: 37-45).

Крупное исследование в отношении Se показало, что ожидаемое предупреждение рака предстательной железы или других раковых заболеваний не достигнуто (Lippman SM et al., Journal of American Medical Association. 2009; 301(1): 39-51). EAKlein (J Natl Cancer Inst. 2009; 101: 283-285) сделали вывод с предостерегающим наставлением, что "хорошо выполненные крупномасштабные контролируемые исследования не всегда подтверждают то, на что, по нашему мнению, указывает биология, и что наши модельные системы являются несовершенными эталонами клинических результатов в реальном мире." Также, хотя сообщали о профилактической роли Se в риске диабета и приписывали ее к "инсулиноподобной" активности Se и к антиоксидантным свойствам селеноферментов, в проспективном исследовании не было сообщено о какой-либо значительной взаимосвязи между селеном и риском диабета (Akbaraly TN et al., NutrMetab (Lond). 2010; 7:21).

УРОВЕНЬ ТЕХНИКИ

Balansky et al., "Interactions between N-axcetylcysteine and sodium selenite in modulating the clastogenicity of urethane and 2-acetylaminofluorene in mice", Int. J. Cancer, Vol.108, 2004, pp.158-161, раскрывают применение комбинации NAC и Se для ослабления неблагоприятных эффектов цитотоксических лекарственных средств и химиопрофилактических агентов в лечении рака.

Safarinejadet al., "Efficacy of selenium and/or N-acetyl-cysteine for improving semen parameters in infertile men: a double-blind, placebo controlled, randomized study", J. Urol., Vol.181, No.1, 2009, pp.741-751, Epub December 2008, раскрывают применение NAC и Se в комбинации или по отдельности для улучшения качества спермы у бесплодных мужчин. Введение NAC и Se в комбинации приводило к аддитивным благотворным эффектам.

Yalçin et al., "Synergistic action of sodium selenite and N-acetylcysteine in acetaminophen-induced liver damage", Hum. Exp. Toxicol., Vol.27, No.5, 2008, pp.425-429, раскрывают применение NAC и Se в комбинации или по отдельности для лечения передозировки ацетаминофена. Обнаружили, что NAC и Se в комбинации производят лучшую защиту против токсического действия на печень по сравнению с тем или другим агентом самим по себе.

Emonet et al., "Thiols и sele: protective effect on human skin fibroblasts exposed to UVA radiation", J. Photochem. Photobiol., Vol.40, No.1, 1997, pp.84-90, раскрывают применение NAC и Se в комбинации для защиты клеток против поражения УФ-А (ультрафиолетовым А) облучением.

Look et al., "Sodium selenite и N-acetylcysteine in antiretroviral-naive ВИЧ-1-infected patients: a randomized, controlled pilot study", J. Clin. Invest., Vol.28, No.5, 1998, pp.389-397, раскрывают совместное пероральное введение NAC и Se с целью улучшения картины крови и снижения вирусной нагрузки у пациентов с ВИЧ.

Sener et al., "Melatonin and N-acetylcysteine have beneficial effects during hepatic ischemia and reperfusion", Life Sciences, Vol.72, 2003, pp.2707-2718, раскрывают применение NAC и Mel, самих по себе или в комбинации, для лечения ишемии печени. Обнаружили, что Mel является более сильнодействующим, чем NAC, и что их комбинация является более эффективной, чем тот или другой сам по себе.

В WO 03/077900 A1 и US 25164911 A1 раскрывается способ предупреждения развития рака или нейродегенеративных заболеваний путем введения NAC, мелатонина или их комбинации, а также лекарственного средства, содержащего NAC и Mel.

В WO 00531376 описывается композиция, содержащая цистеин, селен и мелатонин совместно с рядом других компонентов. Во всех US 20070231312, US 2011027771, WO 9833494 и US 6207190 описываются разные композиции, содержащие, среди прочего, NAC, Se и Mel. Кроме того, в US 2004045566 описывается композиция, содержащая глутатион, селен и мелатонин, для абсорбции опасного компонента из табачного дыма. Ни в одном из указанных документов не описывается применение селенометионина.

Во всех документах, указанных в известном уровне техники, селен используют как таковой.

ЦЕЛИ ИЗОБРЕТЕНИЯ

Главной целью настоящего изобретения является предложение решения проблемы повышения эффективности NAC. Аспектом цели является предложение медицинского продукта или фармацевтической комбинации, обеспечивающих повышенную эффективность N-ацетил-L-цистеина (NAC). Аспектом цели является предложение медицинского продукта или фармацевтической комбинации, обеспечивающих повышенную эффективность NAC, для применения в лечении заболеваний у млекопитающих, таких как люди, например, доброкачественных и злокачественных гиперпролифераций, включая раковые заболевания различного вида, аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета 2 типа, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи, дерматологических заболеваний, включая витилиго, алопецию и псориаз, и бактериальных инфекций. Еще одним аспектом цели является предложение медицинского продукта, обеспечивающего повышенную эффективность NAC, для применения в качестве антибактериального агента и для косметических целей.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Авторы настоящего изобретение показывают, что эффект N-ацетил-L цистеина (NAC) усиливается, когда NAC вводят совместно с селеном (Se) в форме селенометионина и мелатонином (Mel). Селенометионин и Mel в комбинации сильно повышают эффективность NAC, а также позволяют понизить концентрацию NAC, таким образом улучшая его эффективность как при кратковременном, так и при длительном лечении. После испытания in vitro и in vivo эффективности такого комбинационного лечения при помощи NAC, Se (например, в форме селенометионина, в дальнейшем SeMet) и Mel авторы изобретения также показали, что удается избежать нежелательные эффекты Se и Mel.

Таким образом, в настоящем изобретении предложена комбинация NAC, SeMet и Mel, полезная для лечения ряда заболеваний и состояний, например доброкачественных и злокачественных гиперпролифераций, включая раковые заболевания различного вида, аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи, дерматологических заболеваний и бактериальных инфекций. Комбинация также полезна в качестве антибактериального агента и для косметических целей. Кроме того, в настоящем изобретении предложены медицинский продукт и фармацевтическая композиция, содержащие указанную комбинацию, а также способ лечения, включающий одновременное введение NAC, SeMet и Mel пациенту.

В одном аспекте изобретения предложен медицинский продукт, содержащий по отдельности или вместе N-ацетил-L-цистеин, селенометионин и мелатонин и/или их физиологически приемлемые соли. Под термином «по отдельности» подразумевается, что три вещества являются частью медицинского продукта, но могут быть представлены в отдельных ячейках, в виде отдельных единиц, медицинского продукта. Под термином «вместе» подразумевается, что, альтернативно, три вещества могут быть представлены в одной и той же части медицинского устройства, например в виде смеси. В одном аспекте изобретения медицинский продукт применяют для одновременного, последовательного или раздельного комбинационного введения млекопитающему.

В одном воплощении компоненты медицинского продукта предназначены для перорального введения; например N-ацетил-L-цистеин предназначен для введения в дозе 5-45 мг/кг/сутки, селен в форме селенометионина предназначен для введения в дозе 0,4-1,2 мкг/кг/сутки, и мелатонин предназначен для введения в дозе 0,02-0,08 мг/кг/сутки. В одном воплощении медицинский продукт представляет собой фармацевтическую композицию, содержащую N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин.

В другом воплощении медицинский продукт, содержащий по отдельности или вместе N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин, предназначен для нанесения на кожу. В таком медицинском продукте N-ацетил-L-цистеин, в одном воплощении, предназначен для введения в концентрации 3-10% масс, селен в форме селенометионина предназначен для введения в концентрации 0,3-1% масс, а мелатонин предназначен для введения в концентрации 0,01-0,2% масс. В одном воплощении медицинский продукт представляет собой фармацевтическую композицию, содержащую N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин.

В одном воплощении медицинский продукт предназначен для лечения доброкачественных или злокачественных неоплазий, включая раковые заболевания различного вида. В другом воплощении он предназначен для косметического лечения кожи и для лечения дерматологических заболеваний. Медицинский продукт можно также применять для лечения аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета 2 типа, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи и других заболеваний. В одном воплощении медицинский продукт предназначен для применения в качестве антибактериального агента.

В еще одном аспекте изобретения медицинский продукт, содержащий N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин, предназначен для применения в качестве антибактериального агента, для применения в медицинском устройстве, совместно с ним или на поверхности медицинского устройства, которое адаптировано для применения в контакте с жидкостями организма. Медицинский продукт можно, например, применять в покрытии для такого медицинского устройства или можно включать в материал, например пластмассы, такого медицинское устройство. В одном воплощении изобретения N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин содержатся в гидрогелевом покрытии для медицинского устройства. Медицинский продукт для применения в качестве антибактериального агента может дополнительно содержать дополнительные активные соединения, такие как бактерицидные лекарственные средства, растворы благородных металлов и/или дексаметазон.

В одном аспекте изобретения предложен антибактериальный агент, содержащий по отдельности или вместе N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин и/или их физиологически приемлемые соли. В одном воплощении антибактериальный агент предназначен для применения в гидрогелевом покрытии для медицинского устройства. В другом воплощении он предназначен для объединения с пластмассами медицинского устройства.

В другом аспекте изобретения предложено медицинское устройство, содержащее медицинский продукт, содержащий N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин и/или их физиологически приемлемые соли и, возможно, дополнительное активное соединение, такое как бактерицидные лекарственные средства, растворы благородных металлов и/или дексаметазон.

В одном аспекте изобретения предложено применение медицинского продукта, содержащего по отдельности или вместе N-ацетил-L-цистеин, селен в форме селенометионина и мелатонин и/или их физиологически приемлемые соли, для лечения доброкачественной и злокачественной неоплазии, включая раковые заболевания различного вида, аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета 2 типа, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи, дерматологических заболеваний, включая витилиго, алопецию или псориаз, или бактериальных инфекций. В изобретении также предложено применение медицинского продукта для косметического лечения кожи и в качестве антибактериального агента с медицинским устройством, которое адаптировано для применения в контакте с жидкостями организма.

В одном аспекте изобретения предложен способ лечения заболевания или для косметических целей, включающий одновременное, последовательное или раздельное комбинационное введение N-ацетил-L-цистеина, селена в форме селенометионина и мелатонина и/или их физиологически приемлемых солей пациенту человеку или млекопитающему. Заболевание или косметическая цель выбраны из доброкачественной и злокачественной неоплазии, включая раковые заболевания различного вида, аутоиммунных заболеваний, нейродегенеративных заболеваний, эндокринологических заболеваний, диабета 2 типа, всех видов фиброза, амилоидоза, эндометриоза, синдрома поликистозных яичников, дисменореи, дерматологических заболеваний, включая витилиго, алопецию или псориаз, или бактериальных инфекций или косметического лечения кожи.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Более подробно изобретение будет объясняться в дальнейшем описании со ссылкой на прилагаемые фигуры.

На Фиг.1 показана метаболическая рециркуляция глутатиона (GSH) посредством селензависимой глутатионпероксидазы (cGPx(Se)) и глутатионредуктазы (GR). Для активности GR требуется NADPH (восстановленный никотинамидадениндинуклеотидфосфат), который восполняется посредством активности фермента глюкозо-6-фосфатдегидрогеназы (G6PDH). G6P: глюкозо-6-фосфат; 6PG: 6-фосфоглюконат; RO•: радикал алкокси; •OH: гидроксильный радикал; ROOH: гидроперекись.

На Фиг.2 показан эффект трехмесячного лечения при помощи NAC+SeMet+Mel пациента с витилиго, как описано в Примере 1.

На Фиг.3A показано действие на структуру кожи одномесячного лечения при помощи NAC+SeMet+Mel, как описано в Примере 2. Полученные с помощью микроскопии изображения отпечатков кожи на силиконовом каучуке, показывающие сеть тонких линий, характеризующих микрорельеф поверхности кожи. Отмечена более регулярная сеть после лечения. Увеличение: 5-кратное или 10-кратное, как отмечено на панелях.

На Фиг.3B показано быстрое преобразование Фурье (FFT) для некоторых изображений Фиг.3A, показывающее неправильную конфигурацию с преобладающим одним направлением в образцах до лечения (А и В), в то время как после лечения наблюдается правильная круглая конфигурация (С и D).

На Фиг.4 показаны результаты экспериментов, описанных в Примере 3. Клетки K562 обрабатывали 0,2 мМ менадиона, и/или 0,4 мМ NAC, и/или 0,2 мМ, SeMet, и/или 2 мМ Mel, как указано. Обозначение Se на гистограмме всегда относится к SeMet.

На Фиг.5 показаны результаты экспериментов, описанных в Примере 3. Клетки HL60 обрабатывали 0,133 мМ менадиона, и/или 0,4 мМ NAC, и/или 0,2 мМ SeMet, и/или 2 мМ Mel, как указано. Обозначение Se на гистограмме всегда относится к SeMet.

На Фиг.6 показаны результаты экспериментов, описанных в Примере 3. Клетки HL60 обрабатывали 0,5 мМ менадиона, и/или 1 мМ NAC, и/или 0,2 мМ SeMet, и/или 1 мМ Mel, как указано. Обозначение Se на гистограмме всегда относится к SeMet.

На Фиг.7 показаны результаты экспериментов, описанных в Примере 3.

Клетки HL60 обрабатывали 0,133 мМ менадиона, 0,2 мМ SeMet, 2 мМ Mel и разными концентрациями NAC, как указано.

На Фиг.8 показаны результаты экспериментов, описанных в Примере 4, демонстрирующие антипролиферативное и дифференцирующее действие NAC в комбинации с SeMet и Mel. Средние кратные изменения ингибитора гена пролиферации Р21 (среднее из 5 эксп.) и маркеров дифференцировки SI (5 эксп.), ALPl (4 эксп.), CLDN1 (6 эксп.) и PCDH1 (5 эксп.). Достоверность, p<0,05, исключая два образца, отмеченных (*), когда комбинация NAC+Se и NAC+Mel не достоверно отличалась от NAC+SeMet+Mel. Обозначение Se на гистограмме всегда относится к SeMet.

На Фиг.9 показано сравнение эффектов NAC самого по себе и комбинации трех веществ. Обозначение Se на гистограмме всегда относится к SeMet.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

NAC

N-ацетил-L-цистеин (NAC) представляет собой хорошо известное низкомолекулярное фармацевтическое лекарственное средство с химической формулой

Для цели настоящего изобретения NAC можно также вводить в его димерной форме (di-NAC).

Обнаружено, что NAC оказывает влияние на молекулярные и физиологические эффекты посредством различных механизмов. Свойства NAC главным образом связаны с его тиоловой группой, что делает его эффективным в большей части биохимических путей, где действует глутатион (GSH). NAC перерабатывается клетками в L-цистеин и используется в синтезе GSH de novo и, таким образом, считается предшественником GSH.

Хотя детали механизмов действия NAC не полностью понятны, они несомненно должны относиться к его тиоловой группе. Он, таким образом, вовлечен в сложный окислительно-восстановительный цикл тиоловых групп в клетке и посредством этого оказывает воздействие на регуляцию окислительно-восстановительного состояния клетки, а также внутриклеточную и межклеточную передачу сигнала. В этом окислительно-восстановительном цикле действуют некоторые ферменты, чьи окислительно-восстановительные переходы совершаются посредством окисления/восстановления глутатиона (GSH). В этой ситуации имеются предшествующие данные вовлечения NAC, как обобщено на Фиг.1, обладающего подобной или даже более высокой эффективностью по сравнению с GSH. В этом отношении NAC можно считать сильнодействующим антиоксидантом.

Чрезвычайное физиологическое значение имеет цикл образования и разрушения дисульфида, общий механизм, посредством которого регулируется активность белка и клеточная передача сигнала. Ферменты, такие как протеинтирозинфосфатазы и тирозинкиназы, например, играют основные роли в контроле клеточного цикла, клеточной пролиферации и дифференцировки, и многие из них регулируются посредством редокс-состояния их цистеинов.

NAC был и по-прежнему является применяемым главным образом в качестве муколитического агента, где способ действия обычно относится к окислительно-восстановительному разрушению чувствительных цистеиновых дисульфидных мостиков в белках слизи. Кроме того, NAC является основным лечением отравления парацетамолом.

В последние годы было признано, что NAC также обладает другими полезными свойствами. Сообщалось, что NAC обладает, например, противовоспалительным эффектом, что является причиной его добавления в семейство нестероидных противовоспалительных лекарственных средств (НСПВП). Кроме того, было обнаружено, что NAC ингибирует клеточную пролиферацию и поддерживает состояние покоя, в дальнейшем переходящее в терминальную дифференцировку. В этом контексте было обнаружено, что NAC обладает заметным антипролиферативным действием на раковые клетки, а также было обнаружено, что он является эффективным в лечении эндометриоза. Например, авторы изобретения относительно недавно обнаружили, что NAC обладает заметным антипролиферативным действием на раковые клетки эпителиального происхождения (Cell Death and Differentiation 2005, 12(10): 1285-1296; BMC Cancer 2005, 5: 75).

В исследовании рака антипролиферативный эффект NAC не связывали с клеточной смертью или с токсичностью, но, вместо этого, объясняли активацией пути физиологической дифференцировки, что можно рассматривать как нормализацию клеточных функций в сторону ткани происхождения.

Важным преимуществом в применении NAC является предполагаемое отсутствие побочных эффектов. Его недостатком является пониженная эффективность при длительном лечении с описанным падением уровней в плазме, так что требующаяся доза увеличивается, тем самым увеличивая также риск некоторых нежелательных эффектов.

NAC в комбинации с Se и Mel

На этом основании авторы настоящего изобретения стремились к снижению эффективной дозы NAC путем одновременного применения других лекарственных средств, которые могут проявлять синергизм с NAC. Снижение эффективной дозы NAC является полезным как при длительном, так и при кратковременном лечении. Для этой цели фокусировали внимание на ферментной сети, регулирующей тиоловый окислительно-восстановительный цикл, особенно те реакции, которые вовлекают рециркуляцию глутатиона посредством ферментов, таких как глутатионпероксидаза (GPx) и глутатионредуктаза (GR). Внимание на протекании этих окислительно-восстановительных реакциях оправдано тем фактом, что на их долю приходится приблизительно 99,9% окислительно-восстановительных реакций в биологии (DP Jones. Am. J. Physiol. Cell Physiol. 2008; 295: C849-C868) и что действие NAC должно быть связано, главным образом, с модификацией активности этих разнообразных ферментов (Parasassi Т, Brunelli R, Costa G, et al. The Scientific World JOURNAL 2010; 10:1192-1202).

Сообщалось об уменьшении экспрессии GR после длительных лечений при помощи NAC (L Pendyala and Р J Creaven, Cancer Epidemiol Biomarkers Prev 1995; 4:245-251). Имеются также сообщения, показывающие, что добавление Mel может приводить к увеличенной экспрессии и/или активности GR, а также другого важного в тиоловой окислительно-восстановительной реакции фермента: глутатионпероксидазы (GPx) (Hardeland R, Cardinali DP, Srinivasan V, et al. Prog Neurobiol. 2011; 93(3): 350-84, Epub Dec 28 2010; Garcia T, Esparza JL, Giralt M, et al., Biol Trace Elem Res. 2010; 135: 220-32).

В этой картине Se представляет собой кофактор некоторых глутатионпероксидаз (GPx). Se необходим для активности GPx (см. например Bulato et al. Free Radic Biol Med. 2007; 42:118-23) и не проявляет никакого специфического антиоксидантного действия при отсутствии ферментов GPx.

По этой причине авторы изобретения доказывали, что для обеспечения сбалансированного действия, свободного от нежелательных эффектов, Se должен находиться в форме SeMet и вводиться совместно с Mel, т.е. в условиях, когда стимулируют GR и GPx, и GPx может полностью проявлять свою активность. В этом контексте NAC может гарантировать потенциал восстановления для осуществления общей кинетики - в этом случае являясь в конечном счете более эффективным, чем глутатион (GSH).

На основании биохимии тиоловой окислительно-восстановительной системы авторы изобретения стремились к увеличению эффекта NAC, к уменьшению терапевтической концентрации NAC и к обеспечению эффективности NAC в длительном лечении. Цель достигали путем стимулирования элементов, присутствующих в тиоловой окислительно-восстановительной системе.

С целью: 1) восстановления/усиления экспрессии/активности ферментов при тиоловом редокс-контроле передачи сигнала; 2) восстановления соответствующего действия NAC даже при длительных лечениях и 3) снижения эффективной концентрации NAC, лечение NAC комбинировали с добавлением селена в форме селенометионина и мелатонина. Эта комбинация была инспирирована необходимостью селена для активности GPx и описанным эффектом мелатонина в увеличении экспрессии/активности GR и, возможно, GPx.

Таким образом, изобретение основывается на цели усиления действия NAC посредством усиления тиоловой окислительно-восстановительной системы путем:

1) стимулирования активности глутатионпероксидазы (GPx) путем добавления Se в форме селенометионина (SeMet), представляющего собой биодоступную форму Se. Использование селенометионина вместо селена является очень важным для этого эффекта;

2) увеличения экспрессии и/или активности глутатионредуктазы (GR) и глутатионпероксидазы (GPx) посредством Mel.

Действие NAC в комбинации с этими двумя дополнительными веществами проверено путем испытания антиоксидантного, антипролиферативного и дифференцирующего эффектов NAC. Комбинационный эффект и возможный синергизм между NAC, Mel и Se в форме SeMet испытывали in vitro с использованием двух клеточных линий, стимулированных окислительным стимулом (Примеры 3 и 4), а также in vivo у пациента с витилиго и в дерматологическом исследовании (Примеры 1 и 2).

В отношении антиоксидантного эффекта NAC в тиоловой окислительно-восстановительной системе, измеренного как уменьшение стимулированного продуцирования перекиси водорода, обнаружили, что:

1) действие NAC определенно усиливается посредством этой ассоциации. В некоторых случаях NAC был почти в три раза более эффективным в комбинации с SeMet и Mel, чем сам по себе;

2) концентрация NAC может быть уменьшена, аналогичный эффект достигается с использованием менее половины концентрации;

3) в некоторых клеточных системах неожиданно наблюдался неблагоприятный оксидантный эффект при комбинировании только двух веществ, т.е. NAC+SeMet или NAC+Mel. Это удивительно, так как эти комбинации в научной литературе описывали как благотворные (Safarinejad MR. J Urol. 2009; 181: 741-51. Yalçin S et al. Hum Exp Toxicol. 2008; 27: 425-9). В противоположность этому наблюдали, что комбинация трех веществ восстанавливала защиту клетки с конечным эффектом почти полного отсутствия окислительного эффекта.

В отношении эффекта NAC, связанного с уменьшением клеточной пролиферации и индуцированием процесса дифференцировки, обнаружили, что:

1) антипролиферативное действие NAC удваивается посредством комбинации с SeMet и Mel по сравнению с применением NAC самого по себе;

2) дифференцирующее действие NAC определенно усиливается посредством указанной выше комбинации, становясь выше на 30-50% по сравнению с применением NAC самого по себе, в зависимости от специфического маркера;

3) путем анализа некоторых специфических маркеров дифференцировки, обнаружили, что комбинации NAC+SeMet или NAC+Mel обладали эффектом, сравнимым с эффектом комбинации этих трех веществ. Однако существует отчетливая тенденция к общему увеличенному действию NAC, когда эти три вещества используют в комбинации. Введение

Новую комбинацию NAC, Se в форме SeMet и Mel, описанную в данной заявке, можно вводить млекопитающему, такому как человек, одновременно, последовательно или раздельно в комбинации. Под одновременным комбинационным введением подразумевают, что все три вещества вводят совместно млекопитающему в один и тот же момент времени. Под последовательным комбинационным введением подразумевают, что эти три вещества вводят млекопитающему в течение одного и того же периода лечения, например в течение одних и тех же суток лечения, недели(ь) лечения или месяца(ев) лечения, так что все вещества присутствуют в млекопитающем в комбинации, причем вещества вводят, т.е. дают млекопитающему в разные моменты времени в установленном порядке. Под раздельным комбинационным введением подразумевают, что эти три вещества подобным образом вводят млекопитающему в течение одного и того же периода лечения, так что все вещества присутствуют в млекопитающем в комбинации, однако вещества вводят, т.е. дают млекопитающему в разные моменты времени в нерегулярном порядке. Введение может быть местным или системным (или энтеральным или парентеральным). Обычные пути введения включают пероральное введение и нанесение на кожу. Другие возможные пути введения включают внутривенное, внутрикожное, подкожное, внутримышечное, интравагинальное, внутриматочное, внутрибрюшинное, ректальное, назальное, внутриоболочечное, ингаляционное и внутрипузырное введение.

Композиции

Комбинацию NAC, SeMet и Mel по настоящему изобретению можно вводить в виде раздельных фармацевтических препаратов/композиций, где каждый(ая) содержит только один из трех активных ингредиентов, т.е. NAC, или SeMet, или Mel, соответственно. Альтернативно, комбинацию можно вводить в фармацевтической композиции, содержащей два или все три активных ингредиента. В любом случае фармацевтические композиции, содержащие либо только один или комбинации NAC и/или SeMet и/или Mel, можно получать способом, известным per se специалисту в фармацевтической области.

Фармацевтическая композиция может быть, например, адаптирована для перорального введения. Такие композиции могут быть введены в различных формах, в настоящее время предпочтительно в виде таблеток. Другие формы, такие как капсулы, суппозитории, растворы, суспензии, сиропы или тому подобное, также являются возможными. В фармацевтических композициях в форме дозированных единиц для перорального введения активный ингредиент или ингредиенты могут быть смешаны с твердым порошкообразным носителем или эксципиентом, который служит в качестве средства доставки или среды для активного ингредиента, таким как лактоза, сахароза, сорбит, маннит, крахмал, амилопектин, производные целлюлозы, желатин, лимонная кислота, цитрат натрия, карбонат натрия (кислый) или другой подходящий носитель; со стабилизирующими веществами, такими как щелочные соединения, например карбонаты, гидроксиды и оксиды натрия, калия, кальция, магния и т.п., а также со смазывающими агентами, такими как стеарат магния, стеарат кальция, стеарилфумарат натрия и полиэтиленгликолевые воски. Затем смесь перерабатывают в гранулы или прессуют в таблетки. Гранулы и таблетки можно покрывать энтеросолюбильным покрытием, которое защищает активное соединение от катализируемой кислотой деградации до тех пор, пока лекарственная форма остается в желудке. Энтеросолюбильное покрытие выбирают среди фармацевтически приемлемых веществ для энтеросолюбильного покрытия, например пчелиного воска, шеллака или анионных пленкообразующих полимеров и тому подобного, по желанию в комбинации с подходящим пластификатором. В покрытие можно добавлять различные красители, чтобы установить различие между таблетками или гранулами с разными количествами присутствующего активного соединения.

Мягкие желатиновые капсулы можно получать вместе с капсулами, содержащими смесь активного соединения, растительного масла, жира или другого подходящего средства доставки для мягких желатиновых капсул. Мягкие желатиновые капсулы можно также покрывать энтеросолюбильной оболочкой, как описано выше.

Твердые желатиновые капсулы могут содержать гранулы или покрытые энтеросолюбильной оболочкой гранулы активного соединения. Твердые желатиновые капсулы могут также содержать активное соединение в комбинации с твердым порошкообразным носителем, таким как лактоза, сахароза, сорбит, маннит, картофельный крахмал, амилопектин, производные целлюлозы или желатин. Капсулы можно покрывать энтеросолюбильной оболочкой, как описано выше.

Один вариант предусматривает предложение NAC и/или SeMet и/или Mel в композиции с медленным высвобождением (также означающие длительное высвобождение или контролируемое высвобождение). Будучи способной понижать скорость диффузии и поглощения активных веществ в кровотоке, такая композиция делает возможным введение большой дозы с продолжительными интервалами. Затем доза распределяется в крови в течение продолжительного времени в небольших количествах, например в течение 12+12 часов в случае схемы приема дважды в сутки. Многие разные технологии и композиции для медленного высвобождения уже давно известны в данной области техники и могут быть использованы в настоящем изобретении. В таких технологиях активное вещество, например, инкапсулируют в оболочку или матрицу, которая является нерастворимой или незначительно растворимой в жидкости организма, куда ее вводят. Композиции, обладающие комбинированным эффектом медленного высвобождения и защиты желудка, также являются возможными и могут применяться в настоящем изобретении.

Жидкий препарат для перорального введения можно приготовить в форме сиропов или суспензий, например растворов или суспензий, содержащих от 0,2% до 20% масс, активных ингредиентов и оставшуюся часть, состоящую из сахара или сахарных спиртов и смеси этанола, воды, глицерина, пропиленгликоля и/или полиэтиленгликоля. Если желательно, такие жидкие препараты могут содержать красители, корригенты, сахарин и карбоксиметилцеллюлозу или другие загустители. Жидкие препараты для перорального введения можно также получать в форме сухого порошка, подлежащего восстановлению подходящим растворителем перед применением.

Для местного введения NAC и/или SeMet и/или Mel можно наносить в чистой форме, т.е. в виде жидкостей. Более предпочтительно их можно вводить в композициях/препаратах, содержащих дерматологически приемлемый носитель, который может представлять собой твердое вещество или жидкость, т.е. в виде эмульгированного крема, мази, лосьона, линимента, порошка или тому подобного. Примеры жидких носителей включают воду, спирты или гликоли или смеси вода-спирт/гликоль, в которых присутствующие соединения могут быть растворены или диспергированы с эффективными уровнями, возможно с помощью нетоксичных поверхностно-активных веществ. Загустители, такие как синтетические полимеры, жирные кислоты, соли и сложные эфиры жирных кислот, жирные спирты, модифицированные целлюлозы или модифицированные минеральные вещества, можно добавлять для образования мазей, лосьонов, паст, гелей и тому подобного. Примеры твердых носителей включают тонко измельченные твердые вещества, такие как тальк, глина, микрокристаллическая целлюлоза, диоксид кремния, оксид алюминия и тому подобное. Также можно добавлять адъюванты, такие как ароматические вещества и дополнительные антимикробные агенты. В предпочтительном воплощении галеновая композиция для местного введения содержит воду, цетеарет 25, глицерилстеарат, ТЭА (триэтаноламин) стеарат, цетеариловый спирт, каприловый/каприновый триглицерид, диметикон, глицерин/гидрогенизированный полиизобутен, полисорбат 60, пентиленгликоль и, возможно, ваниль.

Для внутривенного или внутрибрюшинного введения растворы активных соединений можно получать в воде, возможно, смешанной с нетоксичным поверхностно-активным веществом. Дисперсии можно также получать в глицерине, жидких полиэтиленгликолях, триацетине и их смесях и в маслах, возможно, инкапсулированными в липосомы. Окончательная лекарственная форма должна быть стерильной, жидкой и стабильной в условиях изготовления и хранения. Жидкий носитель или средство доставки может представлять собой растворитель или жидкую дисперсную среду, содержащую, например, воду, этанол, полиол (например, глицерин, пропиленгликоль, жидкие полиэтиленгликоли и тому подобное), растительные масла, нетоксичные глицериновые эфиры и их подходящие смеси. Подходящую текучесть можно сохранять, например, посредством образования липосом, посредством сохранения требующегося размера частиц в случае дисперсий или посредством применения поверхностно-активных веществ. Предупреждение действия микроорганизмов можно осуществлять посредством различных антибактериальных и противогрибковых агентов, например парабенов, хлорбутанола, фенола, сорбиновой кислоты, тимеросала и тому подобного. Во многих случаях предпочтительно включать изотонические агенты, например, сахара, буферы или хлорид натрия. Пролонгированную абсорбцию инъецируемых композиций можно осуществить посредством применения в композициях агентов, задерживающих абсорбцию, например, моностеарата алюминия и желатина. Стерильные инъецируемые растворы приготавливают путем включения активных соединений в необходимом количестве в подходящий растворитель с различными другими ингредиентами, перечисленными выше, при необходимости, с последующей стерилизацией фильтрованием. В случае стерильных порошков для приготовления стерильных инъецируемых растворов, предпочтительными способами приготовления являются методы вакуумной сушки и лиофилизации, которые дают порошок активного ингредиента плюс любой дополнительный желаемый ингредиент, присутствующий в предварительно отфильтрованных стерильных растворах.

Дозированные единицы для ректального введения можно получать в форме суппозиториев, которые содержат активные вещества, смешанные с нейтральной жировой основой, или они могут быть получены в форме желатиновой ректальной капсулы, которая содержит активные вещества в смеси с растительным маслом, парафиновым маслом или другим подходящим средством доставки для желатиновых ректальных капсул, или они могут быть получены в форме готовой к применению микроклизмы, или они могут быть получены в форме сухой композиции для микроклизмы, подлежащей восстановлению в подходящем растворителе прямо перед введением.

Растворы для парентерального введения можно получать в виде растворов активных ингредиентов по изобретению в фармацевтически приемлемых растворителях, предпочтительно в концентрации от 0,1 до 10% масс. Эти растворы могут также содержать стабилизирующие агенты и/или буферизующие агенты и могут быть изготовлены в различных ампулах или флаконах со стандартными дозами. Растворы для парентерального введения можно также получать в виде сухих препаратов, подлежащих восстановлению подходящим растворителем непосредственно перед применением.

В отношении NAC в изобретении требуется строгая оценка фармацевтического качества препарата NAC для получения эффективной дозы. NAC не является стабильной молекулой, его активный тиоловый остаток может легко окисляться под действием кислорода, света и других излучений, так что эффективная доза не будет достигнута. Препарат, таким образом, предпочтительно защищают от света. Для перорального введения NAC предпочтительно приготовляют в растворимых таблетках с гидрокарбонатом натрия, что помогает частичному удалению кислорода из воды во время растворения.

Было обнаружено, что высокие дозы NAC могут вызывать абдоминальную боль. Для преодоления этого предлагается вариант, где NAC находится в композиции с защитой желудка, подходящей для предупреждения высвобождения/растворения NAC в желудке. Такие композиции хорошо известны в данной области техники и могут использоваться в настоящем изобретении. Например, можно использовать покрытия таблеток, которые являются устойчивыми к желудочным жидкостям и делают возможным высвобождение лекарственного средства только в кишечнике, после его прохождения через желудок. Обычно используемые композиции включают полимеры, такие как производные целлюлозы, сополимеры метакрилат/аминоэфир. Покрытие защищает ядро таблетки от разложения в кислой среде желудка посредством использования чувствительного к pH полимера, который набухает или солюбилизируется после прохождения через желудок в ответ на увеличение pH, с высвобождением лекарственного средства.

Дозировки

Для перорального введения человеку, а также другим млекопитающим, подходящая суточная доза NAC составляет приблизительно 5 и 45 мг/кг/сутки, предпочтительно 20-30 мг/кг/сутки. Подходящая суточная доза SeMet составляет приблизительно 0,0004-0,0012 мг/кг/сутки, предпочтительно приблизительно 0,0008 мг/кг/сутки, и подходящая суточная доза Mel составляет приблизительно 0,02-0,08 мг/кг/сутки, предпочтительно приблизительно 0,04 мг/кг/сутки. Доза может быть назначена один раз в сутки или может быть разделена на два или более чем два, предпочтительно три или четыре, введения в сутки или по одной, или по две дозы (например, пилюли) каждое, где каждая доза может содержать, например, 0,15-3,0 г NAC, предпочтительно 0,3-0,6 г NAC и предпочтительно три раза в сутки; 0,028-0,110 мг SeMet или предпочтительно приблизительно 0,055 мг SeMet; и 1-6 мг Mel или предпочтительно приблизительно 3 мг Mel.

Для перорального введения массовое отношение в суточной дозировке NAC к SeMet находится в диапазоне от 4000:1 до 60000:1, предпочтительно в диапазоне от 5000:1 до 40000:1 или от 25000:1 до 37000:1, наиболее предпочтительно 32500:1. Массовое отношение в суточной дозировке NAC к Mel находится в диапазоне от 60:1 до 2000:1, предпочтительно от 150:1 до 1000:1 или от 500:1 до 750:1, наиболее предпочтительно 600:1. Обычно три вещества вводят с массовым отношением в суточной дозировке NAC к SeMet к Mel, которое составляет приблизительно 32500:1:54. Вещества можно вводить одновременно, раздельно или в композиции, содержащей все три вещества в указанных отношениях.

Для нанесения на кожу (например, посредством эмульсии-крема, мазей, лосьонов, линиментов или подобного) подходящая концентрация NAC составляет приблизительно 3-10% масс, предпочтительно 5% масс. Подходящая концентрация SeMet составляет приблизительно 0,3-1% масс, предпочтительно 0,5% масс, и подходящая суточная доза Mel составляет приблизительно 0,01-0,2% масс, предпочтительно 0,1% масс. Крем, лосьон или подобное можно наносить один раз в сутки или можно наносить в ходе двух или более чем двух, предпочтительно трех или четырех, введений в сутки.

Для нанесения на кожу массовое % отношение NAC к SeMet находится в диапазоне от 3:1 до 33:1, предпочтительно приблизительно 10:1. Массовое % отношение NAC к Mel находится в диапазоне от 15:1 до 1000:1, предпочтительно приблизительно 50:1. Обычно три вещества наносят на кожу с массовым % отношением NAC к SeMet к Mel, которое составляет приблизительно 50:1:5. Вещества можно вводить одновременно, раздельно или в композиции, содержащей все три вещества в указанных отношениях.

Периоды лечения могут продолжаться в течение одних или нескольких суток вплоть до нескольких месяцев в зависимости от заболевания или состояния, подлежащего лечению.

Для более длительных периодов лечения при помощи NAC и SeMet и Mel, например 1-2 месяца или больше, лечение может быть периодическим. Под периодическим введением или лечением подразумевают, что лечение приостанавливают на время, т.е. фармацевтическую композицию вводят в течение периода времени, например нескольких суток, с последующей приостановкой введения, когда фармацевтическую композицию не вводят в течение периода времени, например в течение нескольких суток, и затем с последующим возобновлением введения. Периодическое лечение может быть регулярным, например, лечением в течение фиксированного количества суток или недель с последующей приостановкой на фиксированное количество суток или недель. Примеры включают повторяющиеся схемы с лечением в течение 4 суток с последующей приостановкой на 3 суток каждую неделю или лечение в течение 2 недель с последующей приостановкой на 1 неделю. Особым случаем регулярного периодического лечения является импульсное лечение, т.е. регулярное лечение и приостановочный период, например, введение через сутки или введение в течение двух суток с последующими двумя сутками приостановки и т.д. Схемы нерегулярного периодического лечения, которые не являются повторяющимися регулярно или имеют более сложную схему, которая повторяется, также возможны, например, в зависимости от ответа на лечение. В различных иллюстративных воплощениях настоящего изобретения предписанную дозу NAC и SeMet и Mel вводят в течение 3-5 календарных суток с последующими 2-4 сутками приостановки, или вводят в течение 1-3 календарных суток с последующими 1-2 сутками приостановки.

Предпочтительная доза NAC, SeMet и Mel будет зависеть от конкретной выбранной композиции, пути введения, природы заболевания или состояния, подлежащего лечению, а также массы, возраста, состояния и вида (человек или животное) пациента.

Известная предпочтительная доза NAC для лечения конкретного заболевания или состояния обычно может быть равна дозе, уменьшенной приблизительно в два раза, когда NAC вводят совместно с оптимальными дозами SeMet и Mel. В качестве примера, для лечения эндометриоза NAC предпочтительно вводят сам по себе в дозе 20-90 мг/кг/сутки, предпочтительно 30-60 мг/кг/сутки, перорально, в течение двух месяцев или более. Когда NAC вводят в комбинации с SeMet и Mel, дозировку NAC можно понижать до 15-30 мг/кг/сутки в течение двух месяцев или более.

Применение/медицинские показания по настоящему изобретению

Настоящее изобретение, включающее комбинацию NAC, Se в виде селенометионина и Mel, можно применять с любой целью, когда можно использовать NAC или известно, что он обладает эффектом, например в заболеваниях, где вовлечен глутатион, и/или в которых тиоловые (-SH) переключатели восстановления/окисления (редокс) играют основополагающую роль, как в случае передачи сигнала, также стимулируемого гормонами, или где можно использовать антипролиферативный и продифференцирующий эффект, антиоксидантный или противовоспалительный эффекты NAC. Его можно, например, применять для лечения доброкачественной и злокачественной неоплазии, включая раковые заболевания различного вида, диабета 2 типа, различных видов фиброза, эндометриоза, синдрома поликистозных яичников, дисменореи и дерматологических заболеваний, включая витилиго и псориаз. Вследствие важности явлений окисления в агрегации белков для образования амилоидов, настоящее изобретение можно применять для предупреждения и лечения различных видов амилоидоза, таких как болезнь Альцгеймера. Кроме того, его можно применять в качестве антибактериального агента и для косметических целей. Другие применения также включают лечение ВИЧ/СПИД, химического и инфекционного гепатита, катаракты, болезни Паркинсона, хронической обструктивной болезни легких, астмы, радиационного поражения, состояния нарушения питания, тяжелого физического стресса, старения, сепсиса, травмы, ожогов, биполярного расстройства, большого депрессивного расстройства и шизофрении, и для пациентов с субоптимальным иммунным ответом.

В качестве примера лечения дерматологических заболеваний, одного пациента с витилиго подвергали лечению при помощи комбинации трех веществ и после трех месяцев лечения наблюдали чрезвычайно сильное уменьшение депигментации (Пример 1, Фиг.2).

В качестве примера косметического лечения, наблюдали за строением кожи у субъекта, кожу лица которого обрабатывали в течение одного месяца галеновым препаратом, содержащим три соединения. После одного месяца комбинированного лечения при помощи препарата в форме крема, содержащего NAC, SeMet и Mel, линии поверхности лица выглядели более правильными, кожа выглядела более плотной и более гладкой, а неровности на коже и папулы уменьшались.

Комбинация NAC, SeMet и Mel для применения в качестве антибактериального агента

Авторы настоящего изобретения также показывают (Пример 5), что комбинация NAC, SeMet и Mel является эффективной для применения в качестве антибактериального агента, когда, например, содержится в покрытии на медицинских инструментах и устройствах, таких как катетеры из латекса или поливинилхлорида. Альтернативно, комбинацию NAC, SeMet и Mel можно включать в пластиковые материалы для применения в медицинских устройствах.

Например, гидрогелевое покрытие можно использовать в качестве способа модификации поверхности твердого субстрата. Примеры гидрогелевых покрытий включают не растворимый в воде гидрогель на основе полиуретана (PUR) или поливинилпирролидона (PVP). Кроме преимуществ, таких как улучшение биосовместимости, гидрофилизации и смазывания материала, гидрогелевое покрытие приводит к дополнительной возможности включения активных агентов в поверхность, например NAC, SeMet и Mel. Комбинация гидрофильной матрицы и гидрофобной лекарственной композиции NAC, SeMet и Mel представляется особенно перспективной.

Модифицированные гидрогелем поверхности обладают дополнительным преимуществом перед немодифицированными поверхностями, поскольку они могут служить в качестве резервуаров лекарственного средства для местной доставки лекарственного средства. Например, в некоторых обстоятельствах время дозировки лекарственного средства должно продолжаться по меньшей мере несколько часов, но не дольше 3 суток. Это может быть желательным, например в случае имплантации устройств, подобных трахеотомическим трубкам, когда противовоспалительные активные вещества должны высвобождаться в самом начале для предупреждения отдаленных побочных эффектов, подобных стенозу трахеи, но позже не должны прерывать нормальные клеточные деления во время последующего процесса заживления и образования эпителия. Путем использования гидрофильной гидрогелевой матрицы с гидрофобными NAC, SeMet и Mel такой профиль высвобождения можно легко получать благодаря свойствам гидрофильной матрицы как системы с контролируемым высвобождением лекарственного средства во время ее набухания.

В дополнение к NAC, SeMet и Mel дополнительные активные вещества можно добавлять к покрытиям или пластмассам для применения с медицинскими инструментами и устройствами, например бактерицидные лекарственные средства, растворы благородных металлов и/или дексаметазон.

Активный агент, т.е. NAC, SeMet и Mel, и, возможно, одно или более чем одно дополнительное активное вещество можно включать в покрытие двумя разными методами: (I) в качестве компонента раствора на любой стадии образования покрытия, например во время полимеризации гидрогелевого покрытия, или (II) посредством пропиточной ванны. Указанный последним метод (II) предпочтительно выполняют в качестве дополнительной стадии после образования гидрогелевого покрытия, но могут также выполнять без такого покрытия, непосредственно на медицинское устройство. Метод (II) дает возможность для модификации устройств, подобных силиконовым катетерам или рассасывающимся шовным материалам из полигликолевой кислоты, без стадии нанесения полимерного покрытия или с добавлением активных веществ после стадии нанесения полимерного покрытия.

Эффекты включения активного агента подтверждены авторами изобретения посредством испытаний растворения лекарственного средства в фосфатно-солевом буферном растворе (PBS) с 20% метанола или этанола, экстракцией, и, в случае бактерицидного лекарственного средства, посредством метода ингибирования зон роста (данные не показаны). Исследовали зависимость скорости растворения лекарственного средства и уровня нагрузки, а также стабильности покрытия от параметров процесса. Авторы изобретения наблюдали эффект распространения NAC, SeMet и Mel во время набухания гидрогеля, как твердые микрочастицы веществ (NAC, SeMet, Mel) осаждались из покрывающего слоя в окружающий раствор.

Авторы настоящего изобретения показывают (Пример 5), что нанесение гидрогелевых покрытий, содержащих NAC, SeMet и Mel, на материал катетера (поливинилхлорид, латекс) значительно понижает рост бактерий, а также образование бактериальных биопленок на таком материале, как по сравнению с непокрытым материалом основы, так и по сравнению с материалом, покрытым гидрогелем без NAC, SeMet и Mel.

ПРИМЕРЫ

ПРИМЕР 1: лечение витилиго

Витилиго представляет собой приобретенное расстройство пигментации, при котором происходит потеря меланоцитов кожи. В результате в разных частях тела на коже появляются белые пятна. Уровень распространения витилиго варьирует в диапазоне 0,1-2% по всему миру. Витилиго может являться физиологически изнуряющим для пораженного пациента и может влиять на качество жизни, чувство собственного достоинства, брак и работу (Halder RM, Chappell JL. SeminCutan Med Surg. 2009; 28(2):86-92). Точный патогенез остается неясным, с предполагаемыми механизмами, попадающими в категории аутоиммунных, биохимических, окислительных-антиоксидантных, относящихся к нервной системе и вирусных. В некоторых исследованиях предположили, что накопление свободных радикалов, токсичных для меланоцитов, приводит к их разрушению. Действительно, по сравнению с контрольными пациентами, красные клетки пациентов с витилиго имеют более низкие уровни глутатиона.

В данном примере авторы изобретения сообщают о случае 45-летней женщины с диффузным витилиго вокруг ее шеи и в обеих подмышечных ямках. Ее подвергали лечению в течение трех месяцев, применяя следующие имеющиеся в продаже лекарственные средства в форме таблеток, принимаемых перорально, с протоколом: 0.6 г NAC, три раза/сутки; SeMet, 55 микрограмм/один раз в сутки; Mel, 3 мг/один раз в сутки; все три лекарственных средства в течение одних и тех же трех суток/недели с последующими 4 сутками приостановки (без введения).

Фотографии ее шеи и обеих подмышечных ямок были сделаны в начале и в конце трехмесячного лечения.

О неблагоприятных побочных эффектах не сообщалось.

Из фотографий на Фиг.2 является очевидным явное уменьшение депигментации с почти полной репигментацией в обеих подмышечных ямках.

ПРИМЕР 2: косметическое лечение кожи

Старение кожи можно распознать макроскопически по морщинам, потере эластичности, обвисанию и истончению, что постепенно случается у взрослого. Поэтому определение структуры поверхности кожи имеет особое значение в области дерматологии, так как такие измерения можно использовать для диагностики кожи и оценивания терапевтического или косметического лечений.

Возрастающую важность имеет влияние загрязнения окружающей среды на кожу, часто ухудшаемую загрязняющими агентами с ассоциированными старением и дисфункциями. Кожа непосредственно подвергается воздействию загрязнения с индивидуальной поверхностью, оцениваемой примерно в 2 квадратных метра, что больше любой другой ткани человека. Механизмы повреждений, обусловленных загрязнением, главным образом заключаются в индуцировании окислительного стресса и воспалительного ответа. Эти механизмы побудили авторов изобретения применять NAC в комбинации с SeMet и Mel в случае умеренно состаренной жирной кожи с папулами.

43-летняя женщина посещала дерматолога по причине своей жирной кожи, имеющей покраснение и папулы. Ее лечили в течение одного месяца галеновым препаратом, содержащим: воду, цетеарет 25, глицерилстеарат, TEA стеарат, цетеариловый спирт, NAC 5%, SeMet 0,5%, Mel 0,1%, каприловый/каприновый триглицерид, диметикон, глицерин/

гидрогенизированный полиизобутен, полисорбат 60, пентиленгликоль, ваниль.

Структуру кожи оценивали по отпечатку кожи на силиконовом каучуке, изготовленному дерматологом, затем наблюдали под микроскопом (Фиг.3A), следуя описанной процедуре (Setaro М, Sparavigna A. Irregularity skin index (ISI): a tool to evaluate skin surface texture. Skin Res Technol. 2001; 7(3): 159-63). Как показано этими авторами, посредством анализа линий на коже микроскопия отпечатков кожи показывает изменение в регулярности структуры поверхности кожи. После одного месяца комбинированного лечения при помощи препарата в форме крема, содержащего NAC, SeMet и Mel, линии поверхности лица выглядели более правильными, с впечатляюще возросшим порядком в их сети, особенно в сравнении с появлением беспорядочных витков, наблюдаемых до лечения. Анализ быстрого преобразования Фурье (FFT) для изображений, выполненный следуя методу Setaro и Sparavigna, действительно показывал (Фиг.3B) до лечения конфигурацию с преимущественным направлением - как показано стрелками на левых панелях А и В, указывая на нерегулярную структуру. После лечения анализ FFT показал вместо этого почти полностью равномерно круглую конфигурацию, указывая на регулярную структуру кожи.

Через месяц лечения как дерматолог, так и пациент сообщали о видимом уменьшении неровностей кожи с более плотным и более гладким внешним видом, нормализации сальной секреции и исчезновении покраснения и папул.

ПРИМЕР 3: антиоксидантное действие на культивированные in vitro линии бластоидных клеток

Способы

Использовали линии лимфобластоидных HL60 и проэритробластоидных K562 клеток человека, выращенных при 37°C в среде RPMI 1640 (Invitrogen, Gibco, Milano, Italy), дополненной 10% фетальной бычьей сывороткой, 5 мкг/мл пенициллином, 5 мкг/мл стрептомицином, 2 мМ глутамином, и, как положено, субкультивировали три раза в неделю. Клетки обрабатывали или с помощью менадиона самого по себе (контроль), с помощью одного NAC, с помощью NAC+Se-метионин (SeMet), с помощью NAC+Mel или с помощью NAC+SeMet+Mel. В случаях добавления SeMet такое добавление выполняли за двое суток до экспериментов путем использования раствора SeMet в буфере (концентрации, как они указаны в описании Фиг.4-7). В случаях добавления Mel такое добавление выполняли за 20 часов до экспериментов путем использования раствора в этаноле (концентрации, как они указаны в описании Фиг.4-7). Концентрация этанола в ростовой среде составляла ≤1,3%, а контроли только с этим растворителем также выращивали параллельно.

Эффект NAC, Mel, SeMet и комбинации этих веществ на защиту клеток от окислительного стимулирования обнаруживали путем применения флуоресцентного зонда 5-(и-6)-хлорметил-2′,7′-дихлордигидрофлуоресцеина диацетата, ацетилового эфира (CM-H2DCFDA) (Invitrogen, Molecular Probes). CM-H2DCFDA представляет собой проникающий в клетку индикатор активных форм кислорода, который не флуоресцирует до отщепления его ацетатных групп внутриклеточными эстеразами и окисления в клетке. За увеличением гидропероксидов (главным образом H2O2) в клетке, таким образом, наблюдают по увеличению флуоресценции. Окислительное стимулирование для увеличения H2O2 выполняли с использованием менадиона.

Клетки подсчитывали и осторожно отбирали для поддержания постоянным соотношения между клетками и флуоресцентным зондом. Промытые клетки ресуспендировали в 2 мл HBSS (сбалансированный солевой раствор Хенкса) в концентрации 106/мл, затем переносили в кювету и уравновешивали при 37±0,1°C в кюветном отделении флуориметра в течение 15 мин при умеренном перемешивании. Затем добавляли два мкл раствора CM-H2DCFDA в DMSO (диметилсульфоксид) и измеряли интенсивность флуоресценции в зависимости от времени. После первых 200 с измерения добавляли подходящую аликвоту раствора NAC в фосфатном буфере (концентрации, как они указаны в описании Фиг.4-7) и 10 мкл 0,1 М раствора менадиона в этаноле и продолжали измерение интенсивности флуоресценции. Во время измерений интенсивности образцы подвергали непрерывному умеренному перемешиванию.

За интенсивностью флуоресценции непрерывно наблюдали в течение 20 мин на флуориметре K2 (ISS Inc. Champaign, IL), оснащенном ксеноновой дуговой лампой, с применением возбуждения при 495 нм и эмиссии при 530 нм с полосой пропускания 8 нм.

Результаты

Типичные результаты окислительного ответа в клетках после соответствующего лечения показаны на Фиг.4, 5 и 6. Испытывали разные концентрации менадиона, NAC, SeMet и Mel и показывали разные ответы, в зависимости также от клеточной линии. Однако комбинация трех веществ всегда получалась наиболее эффективной в предупреждении вызванного окислением увеличения флуоресценции. После окислительного стимулирования менадионом интенсивность флуоресценции DCFDA увеличивалась. Добавление NAC приводило к существенному уменьшению кинетики этого увеличения интенсивности, которое оценивали по его наклону. Присутствие либо SeMet либо Mel совместно с NAC имело разные эффекты в зависимости от типа клеток и от концентрации.

Следует отметить, что в некоторых случаях наблюдали, что пары NAC+SeMet или NAC+Mel вместо уменьшения ответа ускоряли увеличение флуоресценции, таким образом указывая на прооксидантный эффект. Типичный пример описан на Фиг.6. Однако даже в этих случаях комбинация трех компонентов, NAC+SeMet+Mel, приводила к максимальному уменьшению наклона, и таким образом окислительного ответа, в сравнении с контролем.

Сильная антиоксидантная защита, выполняемая комбинацией NAC+SeMet+Mel, давала возможность уменьшить концентрацию NAC на 60%. Это показано на Фиг.7, где защита, приводимая в действие 1 мМ NAC, сравнима с защитой, полученной с использованием только 0,4 мМ NAC в комбинации с SeMet и Mel.

Выводы

Комбинация NAC с SeMet и Mel определенно увеличивает антиоксидантную защиту NAC. Комбинация проявляет синергический эффект не только по отношению к действию NAC, но также по отношению к действию каждого из этих трех компонентов самих по себе. Относительно NAC самого по себе, в некоторых случаях антиоксидантный эффект был в три раза эффективнее, когда NAC использовали в комбинации с SeMet и Mel.

Концентрация NAC может быть уменьшена, аналогичный эффект достигался с использованием менее чем половины концентрации.

Неожиданно в некоторых случаях наблюдали неблагоприятный прооксидантный эффект SeMet или Mel, также в комбинации с NAC. Хотя механизмы все еще обсуждаются, о неблагоприятных прооксидантных эффектах как для Se, так и для Mel, сообщалось в литературе. Однако в экспериментах авторов изобретения комбинация трех веществ, где Se находится в форме SeMet, восстанавливала антиоксидантную защиту клетки, с конечным эффектом пренебрежимо малого окисления даже после стимулирования окислителем.

ПРИМЕР 4: дифференцирующий эффект в клетках карциномы ободочной кишки.

Ранее сообщалось, что NAC модулирует клеточную пролиферацию и дифференцировку, особенно снижает пролиферацию путем переключения клеток в сторону нормального пути дифференцировки. По имеющимся сообщениям, это действие происходит в нормальных клетках, а также в раковых клетках.

Экспрессию генов, связанных с пролиферацией и дифференцировкой, в клеточной линии карциномы ободочной кишки (Сасо-2), обработанной NAC в комбинации с SeMet или Mel или с тем и другим, анализировали, как показано ниже. Результаты показаны на Фиг.8 и 9.

Способы

Клетки карциномы ободочной кишки Сасо-2 (субклон ТС7, Chantret et al., J. Cell Sci. 107:213-225; 1994) сохраняли, как положено, в DMEM (модифицированная по способу Дульбекко среда Игла) (Gibco, Invitrogen, Milan, Italy) с высоким содержанием глюкозы, содержащей 10% инактивированную нагреванием фетальную бычью сыворотку, FBS (Gibco, Invitrogen). Клетки высевали с плотностью 3×103/см2 в шестилуночные планшеты. Через 24 ч после посева клетки обрабатывали NAC (2 мМ) и/или SeMet (25 нМ) и/или Mel (25 мкМ). Через 72 часа после обработки клетки анализировали на экспрессию генов.

Оценивали экспрессию характерных генов дифференцировки энтероцитов; двух генов, кодирующих гидролазы щеточной каемки, кишечную щелочную фосфатазу (ALPI) и сахаразу-изомальтазу альфа-глюкозидазу (SI); двух генов, кодирующих белки адгезионного межклеточного комплекса, клаудин 1 плотного контакта (CLDN1) и протокадгерин 1 адгезионного контакта (PCDH1). Также анализировали экспрессию важного ингибитора клеточного цикла, ингибитора 1А циклин-зависимой киназы (CDKN1A/P21waf1/cip1), в качестве маркера блокирования клеточного цикла, который обычно сопровождает дифференцировку клеток Сасо-2. Глицеральдегид-3-фосфатдегидрогеназу (GAPDH) использовали в качестве конститутивного гена.

Последовательности специфических праймеров разрабатывали, используя программное обеспечение Primer-BLAST, доступное на: http://www.ncbi.nlm.nih.gov. и они описаны в Таблице 1.

Тотальную РНК экстрагировали в TRIzol Reagent (Invitrogen). Один микрограмм тотальной РНК из каждого образца обрабатывали 1 ME ДНКазы I (Invitrogen) и обратно транскрибировали с 200 ME обратной транскриптазы Superscript III (Invitrogen), используя 250 нг случайных праймеров в 20 мкл (конечный объем). Количественную RT-PCR (полимеразную цепную реакцию с обратной транскрипцией) в реальном времени выполняли на ABI Prism 7000 (Applied Biosystems, Monza, Italy), используя 5 Prime RealMasterMix SYBR ROX 2.5X (Eppendorf, Milan, Italy) в 25 мкл реакционного объема, содержащих 10 нг кДНК и 0,6 мкл каждого праймера (10 мкМ), согласно следующему протоколу: 1 цикл 10 мин при 95°C, 40 циклов по три стадии, включая 20 с при 95°C, 40 с при 60°C и 45 с при 68°C. Все эксперименты выполняли с дублированием в трех или более отдельных анализах. Отрицательный контроль (без матрицы) прогоняли с каждой реакцией для подтверждения отсутствия загрязнений, и специфичность амплификации подтверждали посредством анализа кривой плавления. Все данные анализировали в виде средних значений со стандартной ошибкой, и достоверность оценивали посредством параметра p, используя ANOVA (дисперсионный анализ). Для определения относительного содержания транскрипта использовали способ 2ΔCT (Livak KJ, Schmittgen TD. Methods 2001; 25:402-408.).

Таблица 1
Целевая мРНК Праймеры SEQ ID NO: Последовательность
SI прямой 1 ACGATGGGGAGGACACTGGCT
NM_001041.2 обратный 2 TCCAAGTTGCATCCAGCGGGT
ALPI прямой 3 GTATGTGTGGAACCGCACTG
NM_001631.3 обратный 4 CTGGTAAGCCACACCCTCAT
CLDN1 прямой 5 TGGCTGTCATTGGGGGTGCG
NM_021101.3 обратный 6 GCAGCAGCCCAGCCAGTGAA
PCDH1 прямой 7 CCTATCCAGCCTGAGCTTTG
NM_002587.3 обратный 8 GGCAGTGATATAGGGTGCGT
P21/cdkn1a прямой 9 TGAGCTGCGCCAGCTGAGGT
NM_000389.3 обратный 10 GCTGCTCGCTGTCCACTGGG
GAPDH прямой 11 GTCAGTGGTGGACCTGACC
NM_002046.3 обратный 12 AGGGGTCTACATGGCAACTG

Результаты

Результаты представлены на Фиг.8 и 9, показывая увеличение (кратное изменение) генной экспрессии пяти генов, когда клетки подвергали соответствующей обработке. Данные количественной RT-PCR в реальном времени явно показывают, что:

1) антипролиферативное действие NAC (что показано увеличенной экспрессией гена Р21) удваивается посредством комбинации с SeMet и Mel по сравнению с NAC самим по себе;

2) дифференцирующее действие NAC (что показано увеличенной экспрессией генов-маркеров SI, ALPI, CLDN1, PCDH1) определенно усиливается посредством указанной выше комбинации, с экспрессией генов-маркеров выше на 40-80%, по сравнению с одним NAC;

3) хотя при анализе некоторых специфических маркеров дифференцировки, например ALPI, CLDN1 и PCDH1, наблюдали, что пара комбинаций NAC+SeMet или NAC+Mel обладают эффектом, который является сравнимым с эффектом комбинации трех веществ, тем не менее существует отчетливая тенденция к общей увеличенной индукции дифференцировки, когда эти три вещества применяют в комбинации.

ПРИМЕР 5: антибактериальный эффект NAC, SeMet и Mel в гидрогелевых покрытиях медицинских устройств

Способы

Гидрогелевое покрытие

Как известно в данной области техники, способ покрытия полимера не растворимым в воде гидрогелем на основе полиуретана (PUR) и поливинилпирролидона (PVP), разработанный для медицинских полимерных устройств, применяли для покрытия уретральных поливинилхлоридных катетеров, а также латексных катетеров. Этот гидрогелевый слой предварительно был охарактеризован посредством инфракрасной спектроскопии нарушенного полного отражения с преобразованием Фурье (FTIR-ATR), коэффициента статического и кинематического трения относительно непокрытого материала основы и против обратной стороны свиной ткани, угла смачивания водой и наблюдений под микроскопом. Испытания, выполненные авторами изобретения (данные не показаны), подтверждают изменения в поверхностной композиции, сверхгидрофильности и смазывающей способности в гидратированном состоянии, включая уменьшение коэффициента трения. В случае уретральных поливинилхлоридных катетеров с покрытой гидрогелем внутренней поверхностью наблюдали явление капиллярного действия, обеспечивающего высокую аффинность между покрытием и молекулами воды.

Бактериальный рост и образование биопленки

Для измерения воздействия на образование примыкающих сессильных бактерий изготавливали искусственный катетер согласно методике, описанной Nickel и коллегами (Antimicrob Agents Chemother. 1985; 27(4): 619-24). Материалы, используемые для катетера, представляли собой латекс, латекс, покрытый благородным металлом, содержащий гидрогель, латекс, покрытый NAC, SeMet и Mel (NAC+SeMet+Mel), и латекс, покрытый как благородным металлом, так и (NAC+SeMet+Mel). Искусственное катетерное устройство подключали к двухлитровому резервуару, функционирующему в качестве in vitro мочевого пузыря, помещенному на водяную баню при 37°C. Среду, содержащую Escherichia Coli (Е.coli), откачивали из резервуара через искусственный катетер насосом с заданной передачей 50 мл/ч. 10 см2 средней части катетера испытывали до и после воздействия Е.coli. Используемый в этих экспериментах штамм Е.coli выделяли у пациента с ассоциированной с катетером инфекцией мочевых путей. Используемая среда представляла собой искусственную мочу, дополненную 0,4% питательным бульоном. Бактерии хранили на скошенном агаре в пробирке (скошенная питательная среда) при -70°C и серийно культивировали с интервалами 10 ч. За бактериальным ростом в мочевом пузыре in vitro наблюдали путем использования стандартизованной мутности в качестве параметра роста при помощи спектрофотометра при 600 нм.

Искусственную мочу, содержащую Е.coli, пропускали через искусственный катетер в течение 10 ч и за развитием бактериальной биопленки наблюдали путем отбора проб с поверхностей материала катетера. Для сканирующей электронной микроскопии асептически извлекали диски образца, несущего сессильные бактерии. Также, количественные подсчеты жизнеспособных примыкающих бактерий получали путем маломощной ультразвуковой обработки соскоба с поверхности катетерного диска в стерильном фосфатно-солевом буферном растворе. Готовили серийные разведения вплоть до 10-4 и распределяли по поверхности питательного агара, из которых получали количественное определение микроорганизмов чашечным подсчетом. Образцы катетера, предназначенные для SEM, извлекали из искусственного катетера и помещали в фиксирующий раствор, состоящий из 5% глатаральдегида в какодилатном буфере (0,1 М, pH 7,2), на 1 ч при 22°C с последующей дегидратацией в последовательно расположенных водных растворах этанола (20-100%) и растворах фреон 113-этанол (30-100%) и затем сушили на воздухе. Образцы покрывали золотом в устройстве для нанесения покрытий металлизированием и изучали с применением сканирующего электронного микроскопа (SEM).

Результаты

Рост на питательном агаре соскоба с поверхности катетерного диска выявил, что количество жизнеспособных Е.coli значительно уменьшалось на покрытом гидрогелем материале по сравнению с непокрытым материалом основы. Дальнейшее значительное уменьшение количества прикрепленных бактериальных колоний отмечали при добавлении NAC, SeMet и Mel к гидрогелю.

Количество колоний на материале основы: 100.

Количество колоний на покрытом гидрогелем материале: 73.

Количество колоний на материале, покрытым гидрогелем с NAC, SeMet и Mel: 58.

Изучение с помощью SEM показало, что диски латекса катетера, латекса, покрытого благородным металлом, латекса, покрытого (NAC+SeMet+Mel), и латекса, покрытого благородным металлом + (NAC+SeMet+Mel), не несли значительных количеств убитых этанолом бактериальных клеток до воздействия Е.coli. Через десять минут после воздействия клеток Е.coli в искусственной моче значительные количества прикрепленных бактериальных клеток обнаружили на латексных дисках, тогда как имела место минимальная колонизация на латексе, покрытом благородным металлом, или на дисках, покрытых (NAC+SeMet+Mel), и отсутствовала колонизация на дисках, покрытых благородным металлом + (NAC+SeMet+Mel). После 10 ч колонизации характерная пластинчатая поверхность непокрытых латексных дисков была полностью окклюдирована большим количеством прикрепленных бактерий, которые внедрились в большие количества их собственных аморфных экзополисахаридов с образованием толстой прикрепленной биопленки. На покрытых благородным металлом дисках и на покрытых (NAC+SeMet+Mel) катетерных дисках имели место редкие признаки образования биопленки, тогда как на дисках, покрытых комбинацией благородного металла и (NAC+SeMet+Mel), биопленка отсутствовала.

1. Применение медицинского продукта, содержащего по отдельности или вместе:
(1) N-ацетил-L-цистеин;
(2) селен в форме селенометионина; и
(3) мелатонин,
и/или их физиологически приемлемые соли
в дозе: N-ацетил-L-цистеин 5-45 мг/кг/сутки, селен в форме селенометионина 0,4-1,2 мкг/кг/сутки и мелатонин 0,02-0,08 мг/кг/сутки,
для лечения карциномы, дерматологических заболеваний, хронической обструктивной болезни легких (ХОБЛ), амилоидоза, эндометриоза и бактериальных инфекций, вызванных Е. coli.

2. Применение по п. 1, где продукт предназначен для одновременного, последовательного или раздельного комбинационного введения млекопитающему.

3. Применение по п. 2, где компоненты (1), (2) и (3) продукта предназначены для перорального введения.

4. Применение по п. 1, где медицинский продукт представляет собой фармацевтическую композицию, содержащую компоненты (1) N-ацетил-цистеин, (2) селенометионин и (3) мелатонин.

5. Применение по п. 1, где компоненты (1) N-ацетил-цистеин, (2) селенометионин и (3) мелатонин предназначены для нанесения на кожу.

6. Применение по п. 5, где компонент (1) предназначен для введения в концентрации 3-10% масс., компонент (2) предназначен для введения в концентрации 0,3-1% масс. и компонент (3) предназначен для введения в концентрации 0,01-0,2% масс., где компоненты (1), (2) и (3) вводят вместе в виде фармацевтической композиции.

7. Применение по любому из пп. 1-6 для лечения карциномы.

8. Применение по любому из пп. 1-6 для лечения дерматологических заболеваний, включая витилиго, алопецию или псориаз.

9. Применение медицинского продукта, содержащего по отдельности или вместе:
(1) N-ацетил-L-цистеин;
(2) селен в форме селенометионина; и
(3) мелатонин,
и/или их физиологически приемлемые соли
в дозе: N-ацетил-L-цистеин 5-45 мг/кг/сутки, селен в форме селенометионина 0,4-1,2 мкг/кг/сутки и мелатонин 0,02-0,08 мг/кг/сутки, для косметического лечения кожи.

10. Применение медицинского продукта, содержащего по отдельности или вместе:
(1) N-ацетил-L-цистеин;
(2) селен в форме селенометионина; и
(3) мелатонин,
и/или их физиологически приемлемые соли
в дозе: N-ацетил-L-цистеин 5-45 мг/кг/сутки, селен в форме селенометионина 0,4-1,2 мкг/кг/сутки и мелатонин 0,02-0,08 мг/кг/сутки,
в качестве антибактериального агента с медицинским устройством, адаптированным для применения в контакте с жидкостями организма, где медицинское устройство представляет собой катетер и где компоненты вводят вместе.

11. Применение по п. 10, где компоненты (1) N-ацетил-L-цистеин, (2) селенометионин и (3) мелатонин содержатся в гидрогелевом покрытии для медицинского устройства.

12. Применение по п. 10 или 11, где продукт дополнительно содержит дополнительные активные соединения, такие как бактерицидные лекарственные средства, растворы благородных металлов и/или дексаметазон.



 

Похожие патенты:
Группа изобретений относится к области средств личной гигиены и раскрывает поверхностно-активный продукт, содержащий первый материал, выделяющий пузырьки газа, и второй материал, выделяющий пузырьки газа, где при контакте с водой скорость выделения пузырьков газа первого материала, выделяющего пузырьки газа, является больше, чем скорость выделения пузырьков газа второго материала, выделяющего пузырьки газа, где первый материал, выделяющий пузырьки газа, содержит, по крайней мере, бикарбонат натрия и лимонную кислоту, где второй материал, выделяющий пузырьки газа, содержит, по крайней мере, поверхностно-активное вещество, бикарбонат натрия, лимонную кислоту и кислый виннокислый калий, и где первый и второй материалы, выделяющие пузырьки газа, отличаются друг от друга, и второй материал, выделяющий пузырьки газа, полностью покрывает первый материал, выделяющий пузырьки газа.

Изобретение относится к области биотехнологии, конкретно к модифицированным полипептидам остеопонтина, и может быть использовано в косметологии и медицине. Получают модифицированный остеопонтин, в котором RGD домен инактивирован.
Группа изобретений относится к области средств для ухода за полостью рта и способов их применения. Предлагаемая композиция средства для чистки зубов содержит: 1-5 мас.% комплексной глины, содержащей силикат магния и щелочного металла; перорально приемлемый анионный полимер, который представляет собой сополимер метилвинилового эфира/малеинового ангидрида, в основе средства для чистки зубов в количестве 1-5 % от массы композиции; эффективное количество фторида, который представляет собой соль, выбранную из фторида олова, фторида натрия, фторида калия, монофторфосфата натрия или их комбинаций; нитрат калия или хлорид калия в количестве, эффективном для снижения чувствительности дентина; причем в композиции после включения в средство для чистки зубов глина остается по существу негидратированной.
Изобретение относится к области косметологии и представляет собой косметический крем на основе гиалуронидазы, содержащий косметическую основу, отличающийся тем, что в качестве фермента используют иммобилизованную гиалуронидазу, ковалентно связанную с полимерным носителем и обладающую гиалуронидазной активностью, при этом в качестве косметической основы используют липодерм 4/1 и воду, причем компоненты в креме находятся в определенном соотношении, в мас.%.
Группа изобретений относится к области средств для ухода за полостью рта и их применения. Предлагаемая композиция для ухода за полостью рта содержит: источник фторид-ионов; от 2 до 10 мас.% сополимера поли(пропиленоксид)/поли(этиленоксид); фумаровую кислоту в количестве, эффективном для увеличения доставки фторида в эмаль, а именно в количестве от 0,01 до 0,25 % в расчете на полную массу композиции.

Изобретение относится к косметической промышленности и представляет собой косметическую композицию для ухода за кожей, содержащую в физиологически приемлемой водной среде соединение формулы I, где R1 обозначает радикал COOR3, где R3 обозначает атом водорода или С1-С4алкильный радикал, необязательно замещенный одной или несколькими гидроксильными группами, R2 обозначает насыщенный или ненасыщенный линейный углеводородный радикал, содержащий от 1 до 18 атомов углерода, или разветвленный или циклический, содержащий от 3 до 18 атомов углерода, а также их оптические изомеры и соответствующие соли, гомополимер мономера, содержащего сульфоновую группу, и сшитый гомополимер акриловой кислоты.

Группа изобретений относится к области косметологии и касается композиции для окрашивания кератиновых волокон, содержащей i) по меньшей мере один субстантивный краситель, содержащий дисульфидную, тиольную или тиол-защищенную функцию, и ii) по меньшей мере один загущающий органический полимер не на основе целлюлозы, iii) по меньшей мере один щелочной агент, iv) по меньшей мере один восстанавливающий агент и необязательно v) по меньшей мере одно поверхностно-активное вещество.

Изобретение относится к фармацевтической промышленности и косметологии и представляет собой лекарственную композицию для ухода за стареющей кожей с целью поддерживания барьерной функции кожи, содержащую комбинацию активных ингредиентов для ухода за стареющей кожей и состоящую из следующих компонентов: миндального масла, жирных кислот льняного масла, аминокислот, креатина и формообразующих компонентов, причем компоненты в композиции находятся в определенном соотношении, мас.%, или состоящую из следующих компонентов: миндального масла, жирных кислот растительного происхождения с соотношением омега-6 и омега-3 жирных кислот 1 к >1, аминокислот, выбранных из одной или нескольких аминокислот, к которым относятся аргинин, глутамин, гистидин и серин, и/или как минимум одного натурального увлажняющего фактора, предпочтительно пирролидинкарбоновой кислоты РСА и/или урокановой кислоты UCA, креатина и формообразующих компонентов, причем компоненты в композиции находятся в определенном соотношении, мас.%, при этом лекарственная композиция для защиты кожи предусмотрена в форме эмульсии типа «вода в масле» или эмульсии типа «вода в масле в воде» Изобретение обеспечивает восстановление барьерной функции кожи, уменьшение сухости, зуда и раздражения кожи.

Изобретение относится к зубной пасте, содержащей загуститель, наполнитель, увлажняющий компонент, абразив и основу - воду очищенную, причем в качестве увлажняющего компонента используют глицерин, в качестве загустителя - целлюлозу монокристаллическую, в качестве наполнителя - цинка оксид, в качестве абразива - наноалмазы, при этом компоненты взяты в следующем соотношении, мас.%: загуститель - целлюлоза микрокристаллическая 17,91-17,56; наполнитель - цинка оксид 17,91-17,56; увлажняющий компонент - глицерин 11,94-11,70; основа - вода очищенная 51,74-50,68; абразив - наноалмазы 0,5-2,5.

Изобретение относится к области косметологии и представляет собой способ восстановления эластической структуры кожи индивидуума, включающий следующие этапы: обеспечение присутствия индивидуума, нуждающегося в восстановлении эластической структуры; определение участка обработки на коже индивидуума, где участок обработки представляет собой участок кожи, в котором необходимо восстановить эластическую структуру; инъекции тропоэластиновой композиции в ткань кожи в пределах участка обработки, чтобы создать количество тропоэластина в пределах участка обработки, которое увеличено по сравнению с кожей, находящейся за пределами участка обработки; где тропоэластиновую композицию инъецируют в ткань кожи в пределах участка обработки в соответствии с предварительно установленным графиком обработки, определяющим заданное количество обработок, при котором каждую обработку в виде инъекции осуществляют в заданный момент времени; и где, по меньшей мере, одна обработка из графика обработки включает многократные инъекции, причем каждую инъекцию в обработке осуществляют в месте инъекции, отстоящем от других мест инъекции на предварительно установленное расстояние, тем самым поддерживая количество тропоэластина в участке обработки в течение предварительно установленного периода времени в соответствии с графиком обработки для восстановления эластической структуры кожи индивидуума.

Группа изобретений относится к области медицины, а именно к онкологии, и предназначена для повышения выживаемости без прогрессирования болезни у пациента, страдающего метастатическим раком ободочной и прямой кишок.

Изобретение относится к соединениям общей формулы I, где R представляет собой C6-C10 арил, необязательно замещенный одним или более атомами галогена, или его фармацевтические приемлемые соли.

Изобретение относится к конъюгату двойного действия формулы I, в котором доцетаксел связан с производным мурамилдипептида, что обеспечивает достижение противоопухолевого и противометастатического эффекта.

Изобретение относится к биохимии. Описаны каркасы, которые содержат тяжелые цепи, являющиеся асимметричными в различных доменах (например, СН2 и СН3), для того, чтобы достичь селективности между различными Fc рецепторами, участвующими в модуляции эффекторной функции, селективности более высокой, чем селективность, достигаемая при использовании натуральной гомодимерной (симметричной) Fc молекулы, и повышенной устойчивости и чистоты полученных в результате вариантных Fc гетеродимеров.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении злокачественных новообразований. Способ включает проведение химиотерапии и подкожное введение Эноксапарина натрия.

Данное изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, которые связываются с CD70 человека, охарактеризованные аминокислотными последовательностями CDR вариабельных доменов тяжелой и легкой цепи.

Настоящее изобретение относится к соединениям пиразина , используемым в качестве ингибиторов протеинкиназы ATR, к фармацевтическим композициям, содержащим соединения по данному изобретению, и применению соединений по данному изобретению для повышения чувствительности клеток к ДНК-повреждающим средствам и в качестве радиосенсибилизирующего вещества и химиосенсибилизирующего средства.
Изобретение относится к способам получения химико-фармакологических препаратов, обладающих биологической активностью. Описан способ получения препарата на основе взаимодействия водного раствора комплексного соединения платины с 50% водным раствором арабиногалактана при нагревании на водяной бане, фильтровании и высаживании в спирт, отличающийся тем, что в качестве комплексного соединения используется транс-дихлородиамминплатина(II), причем реакцию ведут при нагревании в течение 30 минут в молярном соотношении исходных веществ 1:1.

Изобретение относится к новой соли - дихлорацетату N-{2-[(2-диметиламиноэтил)метил-амино]-5-[4-(1-метил-1Н-индол-3-ил)пиримидин-2-иламино]-4-метоксифенил}акриламида, которая обладает свойствами ингибиторов EGFR и может быть использована для лечения видов рака, опосредованного активностью EGFR и его мутантов, выбранных из L858R, 1790М и Exon19.

Изобретение относится к новой кристаллической безводной модификации N-{3-хлор-4-[(3-фторбензил)окси]фенил}-6-[5-({[2-(метансульфонил)этил]амино}метил)-2-фурил]-4-хиназолинамина бис (4-метилбензолсульфоната) моногидрата (лапатиниб дитозилат моногидрат), а именно γ-модификации, характеризующаяся определенным набором дифракционных максимумов (d, Å) и их интенсивностью (Iотн, %) и определенными тепловыми эффектами и их температурами на кривой дифференциальной сканирующей калориметрии, а также к способу ее получения и применению в составе фармацевтической композиции в качестве обратимого селективного ингибитора внутриклеточной тирозинкиназы рецепторов эпидермального фактора роста для лечения распространенного и/или метастатического рака молочной железы.

Настоящее изобретение относится к соединению и его фармацевтически или косметически приемлемым солям, применимым в качестве ингибитора натрий-зависимого котранспортера глюкозы, антиоксиданта и для депигментации кожи в медицине и косметологии, следующей формулы (I): а также к способам его получения и композициям на его основе, где n, m и р представляют собой независимо друг от друга 0 или 1, R представляет собой СН2ОН или CH2OR11, R1 и R2 представляют собой ОН или OR15, R3 представляет собой ОН или OR18, R4 представляет собой атом водорода, когда n=1, или атом водорода, атом галогена или группу ОН, когда n=0; X1 представляет собой атом водорода, атом галогена, группу ОН, (С1-С6)-алкил или OR24; U, V и W представляют собой фенил, пиразолил, N-(С1-С6)алкил-пиразолил или тиенил, необязательно замещенные одним или более заместителями, выбранными из атома галогена, ОН, (С1-С6)-алкила и OR24; R11, R15 и R18 представляют собой арил-(С1-С6)-алкил и R24 представляет собой (С1-С6)-алкил или арил-(С1-С6)-алкил.
Наверх