Маркеры тромбоэмболической болезни



Маркеры тромбоэмболической болезни

 


Владельцы патента RU 2606758:

ХЕНДИАГ.ЭКСЕ, С.Л. (ES)

Настоящее изобретение относится к области генетики. Предложен способ оценки риска возникновения у индивида тромбоэмболического эпизода или диагностики возникновения или наличия такой болезни или эпизода на основании присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, rs8176743 и rs8176750. Кроме того, предложен способ идентификации индивида, нуждающегося в терапевтическом лечении антикоагулянтом и/или антитромбином, либо в профилактическом лечении антикоагулянтом и/или антитромбином на основании присутствия по меньшей мере одного аллеля каждого из указанных полиморфных вариантов. Данное изобретение может найти дальнейшее применение в терапии тромбоэмболических заболеваний. 2 н. и 5 з.п. ф-лы, 2 ил., 8 табл., 1 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области тромбоэмболических болезней или нарушений. В частности, настоящее изобретение относится к маркерам, предназначенным для определения у индивида, в частности у человека, риска возникновения тромбоэмболической болезни или нарушения, эпизода вызывающего тромбоэмболическую болезнь или нарушение, или осложнения тромбоэмболической болезни, а также к способам применения указанных маркеров.

Уровень техники

Тромбоэмболическая болезнь является главной причиной заболеваемости и смертности в развитых странах (America Heart Association 2010. Circulation 2010; 121:e46-e215). Тромбоз артерий является наиболее распространенной причиной возникновения острого инфаркта миокарда, негеморрагических инсультов и заболевания периферических сосудов. Патологическими признаками венозной тромбоэмболии (VTE) являются главным образом тромбоз глубоких вен (DVT) и эмболия легочной артерии (РЕ). Хотя тромбоэмболические эпизоды артерий являются главной причиной смертности и инвалидности, заболевание вен также имеет важное значение. Ежегодно в США VTE возникает у 100 из 100000 человек (America Heart Association 2010. Circulation 2010; 121:e46-e215). Примерно у трети индивидов с симптомами VTE имеются признаки эмболии легочной артерии, при этом две трети индивидов страдают только тромбозом глубоких вен (America Heart Association 2010. Circulation 2010; 121:e46-e215). Эмболия легочной артерии ежегодно является причиной смерти 60000 человек в США (Anderson FA. Arch Intern. Med. 1991: 151:933-8, Spencer FA. Arch Inter. Med. 168:425-430).

В медицинских изданиях и эпидемиологических исследованиях тромбоэмболические болезни артерий и вен рассматриваются как независимые заболевания, каждое из которых имеет собственную патофизиологическую основу, присущую только им, факторы риска и независимые схемы лечения (Bauer KA, Hematology Am. Soc. Hematol. Educ. Program 2002; 353-368). Артериальные тромбы обычно возникают в пораженных сосудах, и наиболее распространенной причиной поражения сосудов в системе артерий является атеросклероз сосудов (AVD) (Lane DE 2000. Thromb Haemost 2000; 76:651-62). Поэтому считается, что факторы риска возникновения тромбоза артерий аналогичны факторам риска AVD. Артериальные тромбы возникают в быстром кровотоке с большим сдвигом, и такие тромбы, также именуемые белыми тромбами, содержат тромбоциты в большом количестве. Профилактика и лечение тромбоза артерий часто направлены на ингибирование тромбоцитов. Хотя повреждение сосудов может способствовать образованию венозных тромбов, стаз и изменения в составе крови (тромбофилия) являются наиболее важными факторами риска возникновения венозных тромбов (Lane DE 2000. Тhromb Haemost. 2000; 76:651-62). Венозные тромбы образуются в системе с медленным кровотоком, содержат большое количество фибрина в смеси с эритроцитами и определяются как красные тромбы. Ингибирование образования фибрина является основным направлением профилактики и лечения тромбоза вен. В научной литературе часто указывается, что факторы риска тромбоза артерий и вен имеют значительные отличия (Bauer KA, Hematology, Am. Soc. Hematol. Educ. Program, 2002; 353-368).

Однако недавно проведенные исследования свидетельствуют о тесной связи между тромбозом артерий и вен на разных уровнях. В частности, показано, что:

1) тромбозы артерий и вен имеют общие факторы риска (Doggen CJM, Arteroscler. Thromb. Vasc. Biol. 2004; 24:1970-5, Goldhaber SZ in: Bloom AL, Forbes CD, Thomas DP, Tuddenham EGD, eds. Hemostasis and Thrombosis. New York: Churchill and Livingstone: 1997; 1327-1333);

2) индивиды, страдающие идиопатической венозной тромбоэмболией, подвергаются большому риску возникновения сердечно-сосудистого заболевания (Becattini C. European Heart Journal 2005; 26:77-83);

3) у индивидов, страдающих идиопатической венозной тромбоэмболией, чаще возникает атеросклероз сосудов (Becattini C, European Heart Journal 2005; 26:77-83); и

4) у индивидов, страдающих идиопатической венозной тромбоэмболией, значительно чаще возникает метаболический синдром (Ageno W., J. Thromb. Haemost. 2006; 4:1914-8).

Факторы риска, как отмечено в научных публикациях, являются общими для тромбоза артерий и вен и представляют собой существенную опасность возникновения обоих заболеваний у индивидов пожилого возраста, с большой массой тела, курящих, принимающих эстрогены и имеющих диабет. Кроме того, показано, что высокие уровни холестерина HDL снижают риск возникновения тромбоза вен, в то время как повышенные уровни триглицерида и/или общего холестерина повышают указанный риск. Другие факторы риска, которые, как известно, являются общими для тромбоза артерий и вен, включают наличие антифосфолипидных антител, дисфибриногенемии, гипергомоцистеинемии и повышенных уровней фибриногена, липопротеина (а) и фактора VIII.

Одним из наиболее выраженных свидетельств наличия связи между тромбозом артерий и вен является генетический анализ в процессе исследования идиопатической тромбофилии (GAIT) (Souto JS, Am. J. Hum. Genet. 2000; 67:1452-1459). Такое исследование семейной генетики тромбоза у населения Испании было проведено с целью определения наследуемости тромбоза. Было обследовано триста двадцать восемь человек в 21 родословной с использованием новой адаптированной компьютерной многомерной пороговой модели. Был сделан вывод о том, что более 60% случаев возникновения тромбоза определяются генетическими факторами. Данное исследование является необычным с точки зрения того, что в анализ были включены венозные и артериальные тромбоэмболические эпизоды. При проведении совместного анализа тромбозы вен и артерий существенно коррелируют в генетическом отношении. То есть в патогенезе артериальных и венозных заболеваний участвуют многие одинаковые гены.

Также были проведены исследования (Doggen CJM, Smith NL, Lamahre RN, et al., Arteros Thromb. Vasc. Biol. 2004; 24:1970-5; Becattini E., European Heart Journal 2005; 26:77-83; Ageno W. Thromb. Haemost. 4:1914-8), показывающие, что тромбозы артерий и вен характеризуются разными проявлениями одного и того же заболевания, и данный процесс определяется общим набором генов.

А. Профилактика первого проявления тромбоэмболии

Симптоматический тромбоз (артерий или вен) является многофакторных заболеванием, которое проявляется, когда индивид, предрасположенный к тромбозу (тромбофилия также определяется как тромбофилическое нарушение или синдром гиперкоагуляции), подвергается воздействию клинических факторов риска.

Определение наличия тромбофилии не ограничивается лабораторным исследованием, а начинается с подробного изучения истории болезни и физического обследования. Всестороннее выявление симптомов и признаков факторов риска (имеющиеся заболевания, лекарственное лечение и клинические условия), связанных с тромбозом, является важной частью первоначальной оценки, как и полное физическое обследование. Помимо лабораторного исследования, соответствующего возрасту и симптомам индивида, важное значение имеет объективное подтверждение венозной тромбоэмболии.

Лабораторное исследование

В настоящее время не существует одного единого лабораторного анализа, позволяющего обнаружить наличие тромбофилии. Таким образом, лабораторное исследование можно разделить на следующие категории: (1) общее диагностическое исследование; (2) специальное исследование свертываемости крови и (3) дополнительное исследование нарушений, которые, как известно, предрасполагают к тромботическим нарушениям.

Специальное исследование свертываемости крови

Специальное исследование свертываемости крови состоит из нескольких комплексных анализов тромбофилии (на основе белка и ДНК), проводимых с целью выявления наследственной или приобретенной тромбофилии. Однако на результаты анализов, не основанных на использовании ДНК, влияют многие условия, предшествующие проведению анализа (например, антикоагулянты, острый тромбоз, заболевание печени и т.д.), поэтому результаты анализа следует рассматривать с учетом условий, связанных с данным исследованием. Дополнительным фактором, влияющим на результаты исследования, является этническая принадлежность исследуемых индивидов. Преобладание фактора V Leiden (FVL) варьируется от 3% до 7% у европейцев, населяющих Кавказ, но находится на очень низком уровне у индивидов, принадлежащих к другим этническим группам: 0% у коренного населения Америки/Австралии и Африки, 0,16% у китайцев и 0,6% у населения Малой Азии (Индия, Пакистан, Шри-Ланка). Этническая принадлежность имеет важное значение, особенно в случае анализа небольшого числа (одного или двух) генетических маркеров.

Факторы, влияющие на результаты специального исследования свертываемости крови на основе белка

Влияние острого тромбоза

Во время острой стадии тромбоза могут быть временно снижены уровни антитромбина, протеина С и протеина S; поэтому без повторного проведения исследования при отсутствии тромботического эпизода и после лечения антикоагулянтами индивиду может быть поставлен неправильный диагноз врожденной недостаточности.

Влияние антикоагулянтов

- Гепарин. Лечение гепарином может ложно снижать уровни антитромбина. Хотя большинство люпус-антикоагулянтов (LAC) [например, разведенный яд цепочной гадюки (DRVVT) и АРТТ Стадота] содержит нейтрализаторы гепарина, способные нейтрализовать до 1 ед./мл гепарина, присутствие избытка гепарина может привести к ложному положительному результату анализа, влияющему на продолжительность вторичной профилактики. Таким образом, положительные результаты исследования LAC, полученные во время лечения гепарином, должны быть подтверждены после прохождения индивидом курса лечения гепарином.

- Лечение антагонистом витамина К (VKA). Уровни протеина С и S снижаются в процессе лечения VKA (например, при использовании варфарина, так как указанные белки зависят от витамина К). Кроме того, лечение VKA может стать причиной ложного положительного результата при проведении определенных анализов LAC (например, DRVVT).

- Ингибиторы тромбина (DTI; например, аргатробан, лепирудин, бивалирудин). Так как обнаружение бляшек при помощи большинства анализов активности антикоагулянтов базируется на образовании тромбина, присутствие DTI может влиять на полученные результаты и замедлять образование бляшек. Данный процесс может быть причиной ложного положительного результата анализа LAC или ложного определения пониженных уровней протеина С и S. Результаты хромогенных анализов заслуживают доверия.

Влияние заболевания печени

Большинство белков антикоагулянтов и прокоагулянтов образуется в печени. При запущенном заболевании печени уровни белков антикоагулянтов и прокоагулянтов снижаются.

Получение и исследование образцов

На практике лечащие врачи имеют ограниченный доступ к получению и исследованию образцов; однако информация о влиянии таких факторов может позволить лечащему врачу потребовать повторного исследования образцов, если полученные данные являются неожиданными или не соответствуют предполагаемой картине [например, пониженная устойчивость к активированному протеину С (APC-R) предполагает наличие низкого соотношения APC-R, но при этом результат исследования FVL является отрицательным].

- Влияние типа антикоагулянта в пробирке для образца

Стандартные пробирки для сбора образцов содержат 0,105-0,109 моль цитрата для достижения оптимальных результатов. Образцы могут быть случайно помещены в этилендиаминтетрауксусную кислоту (EDTA), в результате чего будут ложно определены пониженные уровни белка и более низкое соотношение APC-R.

- Влияние методики исследования образцов

Образцы должны быть дважды центрифугированы как можно раньше после их получения, чтобы свести к минимуму количество остаточных тромбоцитов. Присутствие остаточных тромбоцитов может стать причиной ложного отрицательного результата анализа LAC.

Определение риска тромботического заболевания на молекулярном уровне

Хотя наследственную причину сильного кровотечения часто приписывают патологии одного или нескольких генов, существуют многочисленные данные, позволяющие предположить, что клинические проявления гиперкоагуляции обычно являются результатом вредного взаимодействия многих генов и окружающей среды. Таким образом, использование молекулярной диагностики для определения маркеров риска возникновения тромбоза (тромбофилии) является гораздо более эффективным, чем в случае наследственных геморрагических нарушений. Несмотря на то что при соответствующем исследовании тромбофилические мутации могут быть идентифицированы у индивидов после первого клинического случая проявления тромбоэмболии, по-прежнему существует проблема интерпретации полученных результатов.

Наследственная устойчивость к активированному протеину С: фактор V Leiden

До 1994 г. обследование индивидов с клиническими признаками гиперкоагуляции обычно было неэффективным. Однако после обнаружения Далбэком и Хильдебрандом наследственной формы устойчивости к протеолитическому воздействию активированного протеина С и последующего открытия миссенс-мутации в гене фактора V, сделанного Бертина с коллегами в Лейдене, был достигнут большой прогресс в лабораторном определении риска возникновения тромбоза.

Мутация Leiden характеризуется заменой аргинина глутамином в положении аминокислотного остатка 506 в факторе V, который является сайтом первичного расщепления активированного протеина С. Указанная мутация может быть легко обнаружена рядом методов на основе ПЦР. Установлено, что от 2% до 5% населения западных стран является гетерозиготным в отношении фактора V Leiden. В отличие от этого указанная мутация является чрезвычайно редкой у коренного населения Азии и Африки.

В некоторых лабораториях наличие устойчивости к активированному протеину С определяют, используя в качестве индикатора анализ на основе пролонгирования времени неполной активации тромбопластина; индивидов, у которых были получены положительные результаты при проведении данного анализа (пролонгирование в присутствии плазмы с отсутствием фактора V), подвергают дальнейшему обследованию методом ПЦР.

В лабораториях, позволяющих проводить молекулярный анализ на основе ПЦР, часто сразу же проводят генетическое исследование, так как получаемый результат является достоверным, и устойчивость к активированному протеину С более чем на 95% определяется одной указанной мутацией.

У индивидов, являющихся гетерозиготными в отношении мутации фактора V Leiden, риск возникновения тромбоза вен примерно в 5 раз выше. Данный результат получен у 15-20% индивидов, у которых впервые был обнаружен тромбоз вен. Гиперкоагулируемый фенотип, обусловленный фактором V Leiden, характеризуется неполной пенетрантностью, и у некоторых индивидов никогда не может возникнуть клинический тромботический эпизод. В отличие от повышенного относительного риска возникновения тромбоза вен, обусловленного фактором V Leiden, указанный генетический вариант не связан с повышенным риском тромбоза артерий или рецидивом тромбоза вен.

Наследование других факторов риска возникновения тромбоза или воздействие факторов риска окружающей среды может в значительной степени увеличить риск возникновения тромбоза у носителей фактора V Leiden. Многие клиницисты проводят анализы с целью обнаружения указанного нарушения у индивидов с семейным анамнезом тромбоза, у которых может быть выявлен приобретенный фактор риска возникновения тромбоза. У индивидов, являющихся гомозиготными в отношении указанной мутации, относительный риск возникновения тромбоза вен выше в 70 раз, из чего следует, что указанный фенотип передается в виде кодоминантного признака.

Вариант 3-концевой некодирующей последовательности в положении 20210 протромбина

В 1996 г. Пурт с коллегами обнаружили взаимосвязь между полиморфизмом нуклеотида G-A в положении 20210 3-концевой нетранслированной области (UTR) гена протромбина, повышенными уровнями протромбина в плазме и повышенным риском возникновения тромбоза вен. Указанная замена полиморфного нуклеотида происходит в самом конце 3-концевой UTR и влияет на уровни протромбина в гетерозиготном состоянии. Хотя уровни протромбина в плазме индивидов, являющихся гетерозиготными в отношении указанного полиморфизма, в среднем выше, чем у индивидов с нормальным генотипом протромбина, все же содержание протромбина находится в пределах нормального диапазона. Поэтому указанный полиморфизм может быть обнаружен только в результате генетического исследования, выполняемого при помощи анализа на основе ПЦР, который в настоящее время чаще всего проводят в виде количественного анализа в реальном времени.

Так же, как в случае генотипа с фактором V Leiden, наличие варианта G-А в положении 20210 протромбина является относительно высоким у населения и составляет 1-5%. Указанный вариант также является редким у коренного населения Азии и Африки. Гетерозиготное состояние связано с двух-четырехкратным увеличением относительного риска возникновения тромбоза вен. Данное состояние не влияет на рецидив тромбоза вен. Взаимосвязь мутации G2010A протромбина на тромбоз артерий является весьма умеренным (OR 1,32; 95% Cl 1,03-1,69) (Kim RJ, Am. Heart J. 2003; 146:948-957).

Термолабильный вариант 5,10-метилентетрагидрофолат-редуктазы С671Т

Третьим, широко распространенным вариантом гена tic, который, как первоначально считалось, связан с повышенным риском возникновения тромбоза, является вариант С-Т в положении нуклеотида 677 (замена аланина валином) гена 5,10-метилентетрагидрофолатредуктазы (MTHFR). Указанный генотип характеризуется экспрессией фермента с повышенной термолабильностью. Гомозиготность в отношении данного варианта связана с гипергомоцистеинемией, особенно при недостатке фолата. У многих народов (население южной Европы и испанское население Америки) примерно 10% индивидов являются гомозиготными в отношении варианта С677Т, в котором изменение последовательности может быть легко обнаружено при помощи метода на основе ПЦР. Однако после проведения дальнейшего всестороннего анализа было установлено, что в отличие от фактора V Leiden и вариантов протромбина 20210 роль полиморфизма C677T MTHFR в качестве независимого фактора риска возникновения венозной тромбоэмболии является незначительной.

В. Диагностика венозной тромбоэмболии

Объективное исследование с целью обнаружения тромбоза глубоких вен и эмболии легочной артерии имеет важное значение, так как результат только клинического анализа является ненадежным. Безуспешность диагностики венозной тромбоэмболии является причиной высокой смертности, в то время как ненужная антикоагуляция может привести к серьезным осложнениям, в том числе к кровотечению со смертельным исходом.

Диагностика тромбоза глубоких вен

Клинические симптомы тромбоза глубоких вен включают местное опухание, эритему, болезненность при дотрагивании и дистальный отек. Однако указанные симптомы не являются специфическими, и примерно 85% амбулаторно обследуемых индивидов с подозрением на тромбоз глубоких вен имеют другую причину указанных симптомов. Дифференциальная диагностика тромбоза глубоких вен включает:

- целлюлит;

- перфорированную кисту Бейкера;

- разрыв мышц, судороги мышц, гематому мышц;

- сдавливание наружных вен;

- поверхностный тромбофлебит;

- посттромботический синдром.

Флебография

Флебография является стандартным исследованием при диагностике тромбоза глубоких вен. Преимуществом данного метода по сравнению с другими исследованиями является возможность обнаружения тромбоза проксимальных вен и тромбоза изолированной икроножной вены. Однако недостатки флебографии состоят в том, что указанный метод:

- является инвазивным, дорогостоящим и требует проведения технической экспертизы;

- предполагает воздействие контрастной среды, при этом существует риск возникновения у индивида аллергической реакции или ухудшения работы почек.

По указанным причинам флебографию заменяют такими неинвазивными исследованиями, как ультразвуковая эхография и анализ D-димера, которые проводят отдельно или в комбинации с клиническим обследованием.

Компрессионная ультразвуковая эхография вен

Ультразвуковая эхография является неинвазивным методом диагностики DVT. Общая бедренная вена, поверхностная бедренная вена, подколенная вена и проксимальные глубокие икроножные вены визуализируют в реальном времени и сдавливают зондом с передатчиком. Тромбоз вен диагностируется при невозможности полного сдавливания вен. Ультразвуковая эхография вен является высокоточным методом обнаружения тромбоза проксимальных вен, где точность достигает примерно 97%, специфичность составляет примерно 94%, и величина отрицательного прогнозирования равна примерно 98% у индивидов, имеющих указанные симптомы. Если DVT не может быть исключен при помощи ультразвуковой эхографии проксимальных вен в комбинации с другими методами (такими как, например, низкая клиническая вероятность или нормальный D-димер), через неделю проводят повторную ультразвуковую эхографию для проверки наличия тромбоза икроножной вены (присутствует примерно у 2% индивидов). Если повторная ультразвуковая эхография является нормальной, то риск симптоматической VTE в течение следующих 6 месяцев составляет менее 2%.

Точность ультразвуковой эхографии вен значительно снижается, если результаты данного исследования расходятся с клинической оценкой и/или поражены небольшие сегменты глубоких вен. В идеальном случае, у таких индивидов должна быть получена флебограмма, так как результат флебографии отличается от ультразвуковой эхографии вен примерно в 25% случаев. Если флебография не может быть выполнена, проводят дополнительное исследование (такое как, например, анализ D-димера или ультразвуковая эхография вен), которое позволит уточнить диагноз и избежать назначения ненужного лечения антикоагулянтами.

Ультразвуковую эхографию икроножных вен выполнить труднее (например, точность 70%), и результат данного исследования является противоречивым. Некоторые исследователи считают, что для исключения DVT необходимо выполнить одну полную компрессионную ультразвуковую эхографию, включающую исследование икроножных вен. Исследования с применением данного метода позволили выявить VTE в 0,5% случаев в течение 3 месяцев после получения отрицательного результата исследования, из чего следует, что ультразвуковая эхография вен, в том числе икроножных вен, позволяет исключить VTE. Однако при помощи указанного метода может быть диагностирован DVT икроножных вен, который спонтанно исчез без лечения, и могут быть получены ложные положительные результаты, вследствие чего индивиды могут быть подвергнуты риску возникновения кровотечения из-за лечения антикоагулянтами без четко выраженного благоприятного воздействия.

Анализ крови в отношении D-димера

D-димер образуется при расщеплении плазмином поперечно сшитого фибрина, и уровни D-димера обычно повышаются в случае DVT и/или РЕ. Нормальные уровни позволяют исключить VTE, но повышенные уровни D-димера не являются специфичными и имеют низкое положительное прогностическое значение. Анализы D-димера значительно отличаются по диагностическим свойствам в отношении VTE. Нормальный результат высокоточного анализа D-димера (то есть точность, равная примерно 98%) позволяет исключить VTE [то есть указанный метод характеризуется высоким отрицательным прогностическим значением (NPV)]. Однако высокоточные анализы D-димера обладают низкой специфичностью (примерно 40%), что ограничивает их применение из-за большого числа ложных положительных результатов. Для исключения DVT и/или РЕ менее точный анализ D-димера (то есть примерно 85%) необходимо объединить с анализом низкой клинической вероятности или с другим объективным анализом, имеющим высокое значение NPV, но не являющимся диагностическим по своей природе (например, отрицательная ультразвуковая эхография проксимальных вен). Так как менее точные анализы D-димера являются более специфичными (примерно 70%), такие анализы дают возможность получить меньше ложных положительных результатов.

Специфичность D-димера снижается с возрастом и при наличии сопутствующего заболевания, такого как рак. Поэтому исследование D-димера может иметь ограниченное значение в качестве диагностического исследования в отношении VTЕ у госпитализированных индивидов (больше ложных положительных результатов) и является бесполезным на раннем послеоперационном периоде.

Флебография с использованием компьютерной томографии (СТ) и магнитного резонанса (МR)

Флебография с использованием компьютерной томографии и магнитного резонанса позволяет диагностировать DVT в тех случаях, когда точность компрессионной ультразвуковой эхографии ограничена (например, DVT изолированной тазовой вены у индивидов с отсутствием симптомов). Установлено, что точность и специфичность флебографии с использованием CT по сравнению с компрессионной ультразвуковой эхографией при обнаружении DVT составляют 89%-100% и 94%-100% соответственно. Однако с учетом стоимости, воздействия радиации и ограниченной доступности флебографии с использованием CT, данный метод в настоящее время находит ограниченное применение при диагностике DVT. При сравнении флемографии с использованием MR с обычной флемографией общая точность при диагностике DVT проксимальных вен составляет 92% и специфичность составляет 95%. Как и в случае флебографии с использованием CT, стоимость и доступность флебографии с использованием MR препятствует широкому использованию данного метода для точной диагностики DVT.

Диагностика эмболии легочной артерии (РЕ)

Клинические признаки эмболии легочной артерии могут включать:

- боль в области плевры;

- одышку;

- обморок;

- кровохарканье;

- учащенное сердцебиение.

Как и в случае DVT, указанные признаки не являются специфическими, и поэтому необходимо провести объективное исследование для подтверждения или исключения диагноза эмболии легочной артерии.

Ангиография легочной артерии

Ангиография является стандартным методом диагностики эмболии легочной артерии. Однако указанный метод имеет много таких же ограничений, как и флебография.

Ангиография легочной артерии с использованием компьютерной томографии (СТРА)

Спиральная компьютерная томография с введением радиографического контрастного вещества (СТРА) в периферические сосуды в настоящее время является стандартным методом диагностики РЕ (Stein PD, N. Engl. J. Med. 2006; 354:2317-2327, Roy PM, Br. Med. J. 2005; 331:259). По сравнению с вентиляционно-перфузионным сканированием легких СТРА, по-видимому, является более точным диагностическим методом (то есть примерно 10% против 60%) и позволяет идентифицировать альтернативную этиологию симптомов индивида. Точность указанного метода для РЕ составляет 83%, специфичность составляет 96%, NPV равен 95%, и положительное прогностическое значение равно 86%.

Точность СТРА изменяется в зависимости от размера самой большой легочной артерии и предварительного клинического значения вероятности. Например, положительное прогностическое значение СТРА равно 97% для эмболии главной или лобарной легочной артерии, но снижается до 68% для сегментарных артерий и является еще более низким для РЕ субсегментарных артерий (25%). У индивидов с высоким предварительным клиническим значением вероятности РЕ положительное прогностическое значение СТРА равно 96%, но указанное значение снижается до 92% у индивидов с предварительным техническим значением вероятности РЕ и до 58% у индивидов с низким предварительным клиническим значением вероятности РЕ.

При проведении исследований с использованием СТРА для диагностики РЕ менее чем у 2% индивидов, прошедших курс лечения антикоагулянтами на основании отрицательного значения СТРА, возникла симптоматическая VTE в последующий период. Вместе взятые вышеуказанные наблюдения позволяют предположить следующее:

- СТРА хорошего качества исключает РЕ при низком или среднем подозрении на наличие клинической вероятности.

- Внутренние поражения лобарных или более крупных легочных артерий обычно диагностируются в случае РЕ.

- Внутренние поражения сегментарных легочных артерий обычно диагностируются в случае РЕ при среднем или высоком подозрении на наличие клинической вероятности и не диагностируются, если подозрение является низким или обнаружены дискордантные признаки (например, отрицательный D-димер).

- Внутренние поражения субсегментарных легочных артерий не диагностируются, и индивиды, у которых получены такие результаты, нуждаются в дальнейшем исследовании.

Предупреждение: по возможности следует избегать обследования при помощи СТРА более молодых женщин (например, моложе 40 лет), так как данный метод предполагает облучение грудной клетки значительной дозой радиации, что повышает риск возникновения рака молочной железы.

Вентиляционно-перфузионное сканирование легких

В прошлом вентиляционно-перфузионное сканирование легких было первоначальным методом обследования индивидов с подозрением на РЕ, и данный метод по-прежнему применяется для обследования индивидов с противопоказаниями для введения контрастного вещества, используемого в рентгеноангиографии (например, в случае почечной недостаточности), и индивидов с повышенным риском возникновения рака молочной железы вследствие облучения (например, молодых женщин). Перфузионное сканирование исключает РЕ, но обнаруживает данное заболевание у незначительного числа индивидов (10-40%). Дефекты перфузии не являются специфическими; только примерно одна треть индивидов с дефектами перфузии страдает РЕ. Вероятность того, что дефект перфузии вызван РЕ, возрастает при наличии нормальной сканограммы вентиляции (”несоответствующий” дефект). Сканограмма легких с несоответствующими дефектами перфузии сегментарных или более крупных артерий предполагает ”высокую вероятность”. Один несоответствующий дефект связан с наличием РЕ примерно на 80%. Три или более несоответствующих дефектов связаны с наличием РЕ примерно на 90%. Результаты сканирования легких в значительной степени зависят от возраста, при этом относительно высокая доля нормальных сканирований и низкая доля недиагностируемых сканирований характерна для более молодых индивидов. Высокая частота нормальных сканирований легких также имеет место у беременных женщин, обследуемых с целью обнаружения РЕ.

Клиническая оценка

Как и в случае подозрения на DVT, клиническая оценка имеет важное значение для определения вероятности РЕ.

Исследование D-димера

Как было описано выше при рассмотрении диагностики DVT, нормальный результат D-димера, отдельно или в комбинации с другим отрицательным исследованием, может быть использован для исключения эмболии легочной артерии (РЕ).

Индивиды с отсутствием результатов диагностики при помощи комбинаций неинвазивных методов исследования РЕ

Примерно 20% индивидов с отсутствием результатов диагностики РЕ страдают эмболией легочной артерии, поэтому необходимо проведение дополнительных исследований для исключения РЕ.

Диагностика РЕ у беременных женщин

Беременные женщины с подозрением на РЕ могут быть обследованы так же, как и небеременные женщины, при внесении следующих изменений:

- сначала должна быть выполнена ультразвуковая эхография вен ног с последующим проведением вентиляционно-перфузионного сканирования легких при отсутствии DVT;

- должно быть уменьшено количество радиоактивного изотопа, используемого для сканирования перфузии, и сокращено время сканирования;

- при проведении ангиографии легочной артерии желательно вводить контрастное вещество в область плеча и производить скрининг брюшной аорты;

- обследования беременных женщин с помощью СТРА следует избегать из-за опасности облучения матери.

С. Риск рецидива после первого приступа симптоматической венозной тромбоэмболии

Венозная тромбоэмболия связана с различными факторами риска, некоторые из которых являются временными, такими как недавно проведенная хирургическая операция или беременность, а другие постоянными, такими как рак (в таблице 1 приведены факторы риска возникновения венозной тромбоэмболии). Когда венозная тромбоэмболия обусловлена приобретенным фактором риска, временным или постоянным, такая тромбоэмболия называется провоцированной. При наличии очевидного клинического фактора риска тромбоэмболия называется неспровоцированной или идиопатической.

Таблица 1
Факторы риска возникновения венозной тромбоэмболии
Основные временные факторы риска Потенциальные приобретенные или постоянные факторы риска
Госпитализация Коллагеноз сосудов
Неподвижность вследствие наложения гипсовой повязки Сердечная недостаточность
Хирургическая операция Злокачественное новообразование
Травма Лекарственное лечение
Второстепенные временные факторы риска Миелопролиферативные нарушения
Пероральные противозачаточные средства или гормональная терапия Нефротический синдром
Беременность
Наличие основных факторов риска за 1-3 месяца до появления венозной тромбоэмболии
Длительная поездка (≥2 часов)

Недавно было установлено, что присутствие или отсутствие временного или обратимого фактора риска в процессе развития венозной тромбоэмболии существенно влияет на риск рецидива после окончания лечения антикоагулянтами. Индивиды, страдающие венозной тромбоэмболией, спровоцированной временным фактором риска, подвергаются небольшому риску рецидива по сравнению с индивидами, у которых венозная тромбоэмболия вызвана постоянным фактором риска или не является спровоцированной венозной тромбоэмболией (Alfonso Iorio, Arch. Intern. Med. 2010; 170: 1710-1716). По указанной причине индивидам, страдающим венозной тромбоэмболией, спровоцированной временным фактором риска, обычно назначают курс лечения антикоагулянтами в течение 3 месяцев (Alfonso Iorio, Arch. Intern. Med. 2010; 170:1710-1716), при этом индивиды, страдающие венозной тромбоэмболией, которая не связана с временным фактором риска, часто проходят длительный курс лечения (Alfonso Iorio, Arch. Intern. Med. 2010; 170: 1710-1716). У индивидов, страдающих идиопатической венозной тромбоэмболией, кумулятивный риск рецидива через один, пять и 10 лет составляет соответственно 15, 41 и 53 процента по сравнению с 7, 16 и 23 процентами у индивидов, у которых венозная тромбоэмболия спровоцирована фактором риска (Galioto NJ, Am. Fam. Physician 2011; 83:293-300).

Несмотря на широкое признание того, что риск рецидива у индивидов, страдающих венозной тромбоэмболией, спровоцированной временным фактором риска, является достаточно низким, что позволяет прекратить лечение антикоагулянтами через 3 месяца, указанный риск рецидива не определен с достаточной степенью точности в количественном отношении. Кроме того, риск рецидива не может быть одинаковым у всех индивидов, страдающих венозной тромбоэмболией, спровоцированной временным фактором риска.

D. Риск возникновения тромбоза артерий

Тромбоз артерий является распространенной причиной госпитализации, смертности и инвалидности в развитых странах (и постоянно увеличивается в развивающихся странах из-за глобального распространения курения, ожирения и диабета). Тромбоз артерий обычно возникает после спонтанного отрыва атеросклеротической бляшки и:

- может быть клинически бессимптомным;

- может способствовать развитию атеросклеротических поражений, вызывающих стеноз коронарных артерий и стабильную стенокардию или стеноз артерий нижних конечностей и хромоту;

- может присутствовать в виде острой ишемии сердца (острые синдромы коронарных артерий: нестабильная стенокардия, инфаркт миокарда), головного мозга (преходящее ишемическое нарушение мозгового кровообращения или инсульт) или конечностей (острая ишемическая болезнь конечностей).

Традиционные факторы риска (см. таблицу 2) остаются наиболее важными маркерами заболевания артерий.

Таблица 2
Факторы риска
Дислипемия
Курение
Диабет
Гипертензия
Абдоминальное ожирение
Психосоциальные факторы

Мутации фактора V Leiden и протромбина характеризуются умеренной, но статистически значимой связью с ишемической болезнью сердца, инсультом и заболеваниями периферических артерий, особенно у более молодых индивидов (в возрасте моложе 55 лет) и у женщин. Взаимосвязь протромбина G2010A с тромбозом артерий является весьма умеренной (OR 1,32; 95% Cl 1,03-1,69) (Kim RJ, Am. Heart J. 2003; 146:948-957). Взаимосвязь мутации фактора V Leiden с ишемической болезнью артерий также является умеренной (OR 1,21; 95% Cl 0,99-1,49), при этом индивиды старше 55 лет подвержены большему риску возникновения ишемической болезни артерий (OR 1,37; 95% Cl 0,96-1,97) (Kim RJ, Am. Heart J. 2003; 146:948-957).

Существует мало данных, свидетельствующих о том, что другие врожденные тромбофилии связаны с повышенным риском заболевания артерий.

Потребность в новых факторах риска

Несмотря на наличие вышеуказанных факторов риска и средств ранней диагностики, тромбоз артерий и венозная тромбоэмболия, которые включают тромбоз глубоких вен и эмболию легочной артерии, являются основными причинами заболеваемости и смертности.

Даже в группах с высокой степенью риска невозможно выявить индивидов, у которых возникнет тромбоз и/или венозная тромбоэмболия. Поэтому, несмотря на наличие нескольких методов точной идентификации риска возникновения тромбоэмболии, профилактики или точной диагностики тромбоэмболии, в настоящее время еще не решена задача предотвращения клинического проявления тромбоза и/или тромбоэмболии (Ruppert A, Current Medical Research & Opinion 2010; 26:2465-2473).

Было предпринято несколько попыток использования молекулярной диагностики для выявления индивидов с высокой степенью риска возникновения тромбоза и/или тромбоэмболии. Сначала Бертина (Bertina RM, Nature 1994; 369:64-67) обнаружил миссенс-мутацию в гене фактора V, затем в научной литературе было представлено описание варианта 3'-концевой некодирующей последовательности протромбина 20210 (Poort SR, Blood 1996; 88:3698-3703) и варианта термолабильной 5,10-метилентетрагидрофолатредуктазы С677Т. В патенте ЕРО 0696325 В1 также описано использование мутаций в факторах коагуляции. В патенте ЕРО 0696325 В1 описано использование мутаций в факторе V, позволяющих идентифицировать индивидов с риском развития тромбоза. В патентном документе WO 05047533 А1 описан метод обнаружения присутствия или отсутствия вариантного нуклеотида по меньшей мере в двух сайтах SNP, связанных с тромбозом, которые были выбраны из группы, состоящей из фактора V Leiden G1691A, протромбина (фактор II) G20210A, MTHRF C677T, MTHFR A1298C, фактора XIII G4377T и ингибиторов тканевого фактора в плазме (TFPI) С536Т.

Однако ни одна из указанных попыток не оказалась достаточно эффективной, и первоначальные усилия по адаптации исследований должны быть подкреплены официальными свидетельствами клинической пользы, получаемой в результате выполнения такого исследования.

Таким образом, существует потребность в новых маркерах, в том числе в новых генетических маркерах и их специфических комбинациях, позволяющих успешно и плодотворно выявлять индивидов с высокой степенью риска развития тромбоэмболической болезни и/или осложнений тромбоэмболической болезни, которые включают, но не ограничиваясь ими, тромбоз глубоких вен, эмболию легочной артерии, острые синдромы коронарных артерий (острый инфаркт миокарда, нестабильную стенокардию), инсульт, преходящее ишемическое нарушение мозгового кровообращения, благодаря чему могут быть предприняты профилактические меры, позволяющие максимально уменьшить степень риска.

Также существует потребность в новых маркерах, в том числе в новых генетических маркерах и их специфических комбинациях, позволяющих успешно и плодотворно диагностировать тромбоэмболическую болезнь и/или осложнения тромбоэмболической болезни, которые включают, но не ограничиваясь ими, тромбоз глубоких вен, эмболию легочной артерии, острые синдромы коронарных артерий (острый инфаркт миокарда, нестабильную стенокардию), инсульт, преходящее ишемическое нарушение мозгового кровообращения, благодаря чему могут быть предприняты профилактические меры, позволяющие максимально уменьшить степень риска.

Сущность изобретения

В первом аспекте настоящее изобретение обеспечивает способ, который позволяет устранить ограничения методов, применяемых в настоящее время, для оценки риска возникновения тромбоэмболии и/или диагностики тромбоэмболических событий у конкретного индивида.

Способ по настоящему изобретению позволяет устранить ограничения, включающие стадии определения в образце, полученном у указанного индивида, присутствия по меньшей мере одного из следующих генетических вариантов серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII C46T (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови АВО rs8176719, группы крови АВО rs7853989, группы крови АВО rs8176743 и группы крови АВО rs8176750, которые являются более точными индикаторами риска возникновения тромбоэмболического эпизода (смертельного или несмертельного острого инфаркта миокарда, инсульта, преходящего ишемического нарушения мозгового кровообращения, периферической артериопатии, тромбоза глубоких вен или эмболии легочной артерии), по сравнению с методами оценки риска, применяемыми в настоящее время.

В другом аспекте настоящее изобретение относится к способам определения вероятности присутствия у индивида тромбоэмболического эпизода на основании присутствия одного или более приведенных выше полиморфизмов в комбинации с одним или более традиционными факторами риска.

В другом аспекте настоящее изобретение относится к способам определения вероятности наличия у индивида рецидива тромбоэмболического эпизода на основании присутствия одного или более приведенных выше полиморфизмов в комбинации с одним или более традиционными факторами риска, социодемографическими и клиническими характеристиками.

В другом аспекте настоящее изобретение относится к способам диагностики тромбоэмболического эпизода на основании присутствия одного или более приведенных выше генетических вариантов в комбинации с одним или более традиционными факторами риска, социодемографическими и клиническими характеристиками в случае вероятности такого диагноза.

В другом аспекте настоящее изобретение относится к способам определения необходимости профилактических мер для предотвращения развития тромбоэмболического эпизода на основании присутствия одного или более приведенных выше полиморфизмов в комбинации с одним или более традиционными факторами риска, социодемографическими и клиническими характеристиками.

В некоторых аспектах предложены следующие варианты изобретения:

1. Способ оценки риска возникновения у индивида тромбоэмболического эпизода, включающий стадии определения в полученном у указанного индивида образце присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750, указывающих на риск возникновения тромбоэмболического эпизода.

2. Способ диагностики возникновения или наличия у индивида тромбоэмболической болезни или эпизода, включающий стадии определения в полученном у указанного индивида образце присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750, указывающих на возникновение или наличие тромбоэмболической болезни или эпизода.

3. Способ в соответствии с 1 или 2, в котором тромбоэмболическая болезнь выбрана из группы, включающей смертельный или несмертельный инфаркт миокарда, инсульт, преходящее ишемическое нарушение мозгового кровообращения, периферическую артериопатию, тромбоз глубоких вен, эмболию легочной артерии или их комбинацию.

4. Способ идентификации индивида, нуждающегося в терапевтическом лечении антикоагулянтом и/или антитромбином, либо в профилактическом лечении антикоагулянтом и/или антитромбином, включающий стадии определения в полученном у указанного индивида образце присутствия по меньшей мере одного аллеля полиморфизмов серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750, указывающих на пониженную реакцию на лечение антитромбином и/или антикоагулянтом либо на необходимость раннего и инвазивного лечения антитромбином и/или антикоагулянтом, или на необходимость профилактического лечения антитромбином и/или антикоагулянтом.

5. Способ в соответствии с любым из 1-4, который дополнительно включает определение одного или более факторов риска возникновения сердечно-сосудистого заболевания или нарушения, выбранных из группы, состоящей из возраста, расовой принадлежности, пола, индекса массы тела, курения, систолического кровяного давления, диастолического кровяного давления, госпитализации, неподвижности вследствие наложения гипсовой повязки, хирургической операции, травмы, перорального противозачаточного средства или гормональной терапии, беременности, длительной поездки (≥2 часов), коллагеноза сосудов, сердечной недостаточности, злокачественного новообразования, лекарственного лечения, миелопролиферативных нарушений, нефротического синдрома, привычного выкидыша, ожирения, сахарного диабета, холестерина липопротеина низкой плотности (LDL), холестерина липопротеина высокой плотности (HDL), холестерина, уровней триглицеридов, семейного анамнеза тромбоэмболического эпизода, беременности и индекса массы тела.

6. Способ в соответствии с 1-4, в котором образец является образцом ткани из полости рта, соскобом, смывом или биологической жидкостью, предпочтительно слюной, мочой или кровью.

7. Способ в соответствии с 1-4, в котором присутствие или отсутствие полинуклеотида идентифицируют на основании амплификации или отсутствия амплификации продукта амплификации в образце, где продукт амплификации предпочтительно расщепляют рестрикционным ферментом до проведения анализа и/или идентифицируют SNP путем гибридизации образца нуклеиновой кислоты с меченым праймером, который является детектируемой частью.

8. Способ в соответствии с 1-4, в котором присутствие или отсутствие полинуклеотида идентифицируют путем гибридизации со специфическими зондами HairLoop™ SEQ ID NO: 1-24, нанесенными на микроматрицу.

9. Способ определения необходимости профилактики или лечения антитромбином и/или антикоагулянтом, в котором индивид, нуждающийся в указанном лечении, выбран на основании присутствия в полученном у указанного индивида образце серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750.

10. Способ в соответствии с 1-9, в котором тромбоэмболическая болезнь выбрана из группы смертельного или несмертельного инфаркта миокарда, инсульта, преходящего ишемического нарушения мозгового кровообращения, периферической артериопатии, тромбоза глубоких вен, эмболии легочной артерии или их комбинаций.

11. Способ определения вероятности наличия у индивида тромбоэмболической болезни или эпизода на основании присутствия классических факторов риска 1-Р и полиморфизмов 1-J, выбранных из группы, состоящей из серпина А10 (ингибитора протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбина) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750, используя формулу:

где

- вероятность означает вероятность наличия тромбоза у конкретного индивида, имеющего конкретные и измеряемые характеристики в ряде переменных 1, …, n, где указанная вероятность может находиться в диапазоне от 0 до 1;

- Ехр означает экспоненциальное природное основание;

- β0 означает коэффициент, определяющий риск (вероятность) тромбоза, не связанный с переменными 1-n, где указанный коэффициент может иметь значение от -∞ до +∞ и вычисляется как натуральный логарифм случаев возникновения тромбоза вен у населения;

- β1 означает коэффициент регрессии, выражающий риск (более высокий или более низкий) возникновения тромбоза, связанный со значением/присутствием независимой переменной x1, где указанный коэффициент может иметь значение от -∞ до +∞;

- x1 является значением, принимаемым независимой переменной x1 у индивида, где диапазон возможных значений зависит от указанной переменной;

- βn означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный со значением/присутствием независимой переменной xn, где указанный коэффициент может иметь значение от -∞ до +∞;

- xn является значением, принимаемым независимой переменной xn у индивида, диапазон возможных величин которого зависит от указанной переменной, где данная модель включает возможность комбинирования некоторых переменных с достижением взаимодействия или модификации выполняемого действия, вследствие чего величина действия (коэффициент регрессии) одной переменной (xf) может быть равна βf, но при комбинировании указанной переменной с другой переменной (xg) величина действия может изменяться (увеличиваться или уменьшаться), поэтому при рассмотрении величины действия переменной xf необходимо учитывать не только βf, но также второй коэффициент регрессии βf.g, складывая βf и βf.g, где

- βf.g означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный с объединенным присутствием независимых переменных xf и xg, где указанный коэффициент может иметь значение от -∞ до +∞;

- xf является значением, принимаемым независимой переменной xf у индивида, где диапазон возможных значений зависит от указанной переменной;

- xg является значением, принимаемым независимой переменной xg у индивида, где диапазон возможных значений зависит от указанной переменной;

- βh.i означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный с объединенным присутствием независимых переменных xh и xi, где указанный коэффициент может иметь значение от -∞ до +∞;

- xh является значением, принимаемым независимой переменной xh у индивида, где диапазон возможных значений зависит от указанной переменной;

- xi является значением, принимаемым независимой переменной xi у индивида, диапазон возможных величин которого зависит от указанной переменной, где если у индивида отсутствует любая мутация или генетический вариант риска, но данный индивид имеет положительный семейный анамнез тромбоза вен, в данную модель включается указанная переменная, и коэффициент регрессии такой переменной равен 1185 в диапазоне возможных значений от 0,200 до 2500.

12. Компьютерная программа или считываемая компьютером среда, содержащая средства для осуществления способа в соответствии с любым из 1-11.

13. Набор, содержащий реагенты для обнаружения нуклеотида, выбранного из группы, состоящей из серпина А10 (ингибитора протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбина) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750.

14. Набор, содержащий реагенты, предназначенные для обнаружения нуклеотида риска в последовательности нуклеиновой кислоты, выбранной из группы, включающей SEQ ID NO: 1-24.

15. Набор в соответствии с 13, который содержит одну или более пар праймеров, специфичных для амплификации области, включающей по меньшей мере серпин А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпин С1 (антитромбин) Ala384Ser (Cambridge II), фактор XII С46Т (rs1801020), фактор XIII Val34Leu (rs5985), фактор II (протромбин) G20210A (rs1799963), фактор V Leiden Arg506Gln (rs6025), фактор V Cambridge Arg306Thr, фактор V Hong Kong Arg306Gly, группу крови ABO rs8176719, группу крови ABO rs7853989, группу крови ABO rs8176743 и группу крови ABO rs8176750.

16. Набор в соответствии с 14, который содержит одну или более пар праймеров, специфичных для амплификации области, включающей последовательность нуклеиновой кислоты SEQ ID NO: 1-24.

Термин "тромбоэмболический эпизод" в контексте настоящего описания означает изменение гемостаза, вызывающее образование сгустка крови (тромба) внутри кровеносного сосуда (артерии или вены). Тромб может даже полностью заблокировать кровеносный сосуд и/или оторваться и заблокировать другой кровеносный сосуд.

Термин "тромбоэмболический эпизод" также означает следующие состояния: тромбоз артерий, смертельный или несмертельный инфаркт миокарда, инсульт, преходящее ишемическое нарушение мозгового кровообращения, тромбоз вен головного мозга, периферическую артериопатию, тромбоз глубоких вен и эмболию легочной артерии.

Термин "тромбоэмболический эпизод" в контексте настоящего описания использован взаимозаменяемо с термином "тромбоэмболия".

Термин "тромбоэмболический эпизод" в контексте настоящего описания использован взаимозаменяемо с термином "тромбоз".

Термин "тромбоэмболический эпизод" в контексте настоящего описания использован взаимозаменяемо с термином "тромбоэмболическое осложнение".

Термин "тромбофилия" в контексте настоящего описания означает нарушения гемостаза, которые предрасполагают к возникновению тромбоза. В определение данного термина входят наследственная недостаточность природных антикоагулянтов антитромбина, протеина С и протеина S, а также мутации в генах, кодирующих факторы свертывания крови, и приобретенную тромбофилию, обусловленную антифосфолипидными антителами.

Термины "болезнь" и "нарушение" имеют взаимозаменяемые значения в контексте настоящего описания.

Термин "мутация" в контексте настоящего описания означает изменение структуры гена, ведущее к образованию вариантной формы, передаваемой последующим поколениям, которое может быть вызвано заменой единичных оснований в ДНК, делецией, инсерцией или реаранжировкой более крупных фрагментов генов или хромосом.

Термин "генетические варианты" в контексте настоящего описания означает генетические различия внутри одной популяции и среди разных популяций. В человеческой популяции может быть много вариантов любого данного гена (аллели), ведущих к полиморфизму.

Термины "полиморфизм" и "полиморфизм единичных нуклеотидов" (SNP) имеют взаимозаменяемые значения и означают изменение нуклеотидной последовательности, происходящее в том случае, когда единичный нуклеотид в геноме или другой общей последовательности отличается у разных членов вида или между парными хромосомами у одного индивида. SNP также можно определить как мутацию с низкой частотой встречаемости аллеля, превышающей примерно 1% в данной популяции. Полиморфизмы единичных нуклеотидов по настоящему изобретению могут находиться в кодирующих последовательностях генов, некодирующих областях генов или в интронных областях между генами.

Термин "образец" в использованном здесь значении означает любой образец, полученный из биологического источника, который включает, но не ограничиваясь ими, культуры клеток или их экстракты, биопсийный материал, полученный из молочной железы, или его экстракты, кровь, слюну, мочу, экскременты, сперму, слезы, другие биологические жидкости или их экстракты.

Термин "традиционные факторы риска" в контексте настоящего описания имеет значения, приведенные в таблицах 1 и 2.

Термин "социодемографические и клинические характеристики" в контексте настоящего описания означает возраст, пол, сахарный диабет, курение, семейный анамнез тромбоэмболической болезни, беременность и индекс массы тела.

В дополнительном аспекте настоящее изобретение относится к компьютерной программе или машиночитаемому носителю, включающему средства для осуществления любых способов по настоящему изобретению.

В еще другом аспекте настоящее изобретение относится к набору, содержащему реагенты для обнаружения генетических вариантов серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, группы крови ABO rs8176743 и группы крови ABO rs8176750.

Подробное описание изобретения

Авторы настоящего изобретения решили указанные выше проблемы, присущие методам, используемым в настоящее время, для определения у индивида риска развития тромбоэмболического эпизода в соответствии с приведенным выше значением данного термина.

Авторы настоящего изобретения идентифицировали ряд генетических вариантов, связанных с риском присутствия тромбоэмболического эпизода. Указанные генетические варианты имеют прогностическое и диагностическое значение.

Способ устранения ограничений, присущих методам прогнозирования риска возникновения тромбоэмболического эпизода или диагностики тромбоэмболического эпизода

Настоящее изобретение позволяет устранить описанное выше ограничение, присущее методам, применяемым в настоящее время для определения риска возникновения тромбоэмболического эпизода и/или диагностики тромбоэмболического эпизода. Конкретная комбинация (как описано выше) генетических маркеров была использована, отобрана и оценена авторами изобретения после сложного и уникального анализа тысяч возможных маркеров. Используя разные возможные комбинации для оценки генетического риска (GRS), авторы изобретения выбрали одну конкретную комбинацию на основании лучших результатов. Для определения генетического риска было рассмотрено большое число аллелей, образующихся у каждого индивида в результате полиморфизма единичных нуклеотидов (SNP), которые приведены в таблице 3. В каждом из исследованных вариантов индивид может иметь 0, 1 или 2 аллеля риска. На основании вычисления суммарного числа аллелей риска, накопленных в разной совокупности отобранных вариантов (n=12), была дана оценка для каждого индивида от 0 до 24. Авторы настоящего изобретения создали новые алгоритмы оценки риска возникновения тромбоэмболической болезни.

Таблица 3
Ген SNP (предлагаемое название) Идентификация варианта rs Информативный аллель Другой аллель
FXII 46C>T FXII, 46C>T 1801020 T C
Группа крови АВО (аллель А1) 261delG Группа крови АВО 8176719 G delG
526C>G Группа крови АВО 7853989 С G
703G>A Группа крови АВО 8176743 G A
1059delC Группа крови АВО 8176750 С delC
Серпин А10 728C>T Серпин А10, Arg67Stop 2232698 Т С
Серпин С1 Серпин С1, Ala384Ser (Cambridge II) Серпин С1, Ala384Ser (Cambridge II) - T G
Фактор коагуляции FV FV Leiden (1746G>A) FV, R506Q (F5 Leiden) 6025 A G
FV Cambridge (1146G>C) FV, R306T (F5 Cambridge) - C G
FV Hong Kong (1145A>G) FV, R306G (F5 Hong Kong) - G A
Фактор коагуляции XIII (полипептид А1) V34L (226G>T) FXIII, Bal34Leu, rs 5985 G T
Фактор коагуляции II G20210A Протромбин, G20210A 1799963 A G

В таблице 3 приведен список полиморфизмов, используемых в способе по настоящему изобретению.

При использовании моделей прогнозирования, например,для принятия решения о назначении лечения, прогностические риски могут быть определены с использованием порогов отсечения рисков.

Специалистам в данной области будет понятно, что анализ нуклеотидов в нуклеиновой кислоте индивида, осуществляемый способом по настоящему изобретению, может быть проведен любым методом, позволяющим определить нуклеотиды, присутствующие в полиморфном сайте. Как известно в данной области, нуклеотиды, присутствующие в полиморфных маркерах, могут быть определены в одной или обеих цепях нуклеиновой кислоты.

После получения у индивида биологического образца (например, биологической жидкости, такой как моча, слюна, плазма, сыворотка, или образца ткани, такого как образец ткани щечной области или клетки щечной области) обычно выявляют изменение последовательности или SNP аллельного варианта. Для указанной цели может быть использован любой метод, известный квалифицированному специалисту в данной области. Наиболее приемлемым методом, вероятно, является определение последовательности геномной ДНК или кДНК и сравнение указанных последовательностей с SNP известных аллелей гена. Указанный метод является достаточно дорогостоящим и требует больших затрат времени. Тем не менее, данный метод широко распространен и хорошо известен.

При осуществлении способов по настоящему изобретению может быть использован любой из целого ряда методов, предназначенных для обнаружения изменений последовательностей. Конкретно используемый метод не имеет значения для оценки риска сердечно-сосудистого нарушения или выбора схемы лечения.

Высокопроизводительная идентификация SNP может быть осуществлена с помощью других коммерчески доступных методов без проведения прямого секвенирования последовательностей, такого как, например, метод Veracode компании Illumina, химический метод генотипирования SNP Taqman® и химический метод генотипирования SNP KASPar.

Вариантом прямого метода определения последовательности является метод Gene Chip™ компании Affymetrix. Кроме того, существуют другие коммерчески доступные надежные и менее дорогостоящие методы обнаружения изменений последовательностей ДНК. Компания Perkin Elmer адаптировала анализ TAQman™ для обнаружения изменения последовательности. Компания Orchid BioSciences разработала метод, получивший название SNP-IT™ (метод идентификации SNP), в котором использован праймер с мечеными аналогами нуклеотидов для определения нуклеотида, находящегося в положении рядом с 3'-концом олигонуклеотидного зонда, где данное основание затем идентифицируют при помощи прямого флуоресцентного анализа, непрямого колориметрического анализа, масс-спектрометрии или поляризации флуоресценции. Компания Sequenom разработала метод захвата путем гибридизации в сочетании с MALDI-TOF (лазерная десорбция с помощью матрицы/ионизация-времяпролетная масс-спектрометрия) для обнаружения генотипов SNP при помощи принадлежащей данной компании системы MassARRAY™. Компания Promega разработала систему генотипирования SNP READIT™ (патент США 6159693). При осуществлении указанного метода ДНК- или РНК-зонды гибридизируют с последовательностями-мишенями нуклеиновой кислоты. Зонды, которые являются комплементарными последовательности-мишени в положении каждого основания, деполимеризуются при помощи соответствующей смеси ферментов, в то время как зонды, отличающиеся от мишени в положении взаимосвязи, остаются интактными. В указанном методе использован химический метод пирофосфорилирования в сочетании с обнаружением люциферазы, что позволило создать высокочувствительный и адаптивный метод оценки SNP. Компания Third Wave Technologies разработала метод Invader OS™, в котором использованы соответствующие ферменты Cleavaseg, которые распознают и расщепляют только специфическую структуру, образованную во время осуществления процесса Invader. В основе метода Invader OS лежит линейная амплификация сигнала, образовавшегося в процессе Invader, а не экспоненциальная амплификация мишени. Ни на одной из стадий анализа Invader OS не проводится ПЦР. Кроме того, существует целый ряд судебных лабораторий, занимающихся исследованием ДНК, и много научно-исследовательских лабораторий, в которых осуществляют геноспецифическую ПЦР с последующим расщеплением рестрикционной эндонуклеазой и гель-электрофорезом (или другого метода разделения) для обнаружения полиморфизмов в рестрикционном фрагменте (RFLP).

В различных вариантах осуществления любого из вышеуказанных аспектов присутствие или отсутствие SNP определяют путем амплификации или на основании невозможности амплифицировать продукт из образца. Амплификация полинуклеотидов обычно зависит от матрицы. При проведении амплификации обычно используют матричную цепь для создания дополнительных копий матрицы. Праймеры представляют собой короткие нуклеиновые кислоты, способные инициировать синтез нуклеиновой кислоты на матрице, которые гибридизируют с матричной цепью. Праймеры обычно состоят из десяти-тридцати пар оснований, но могут быть использованы и более длинные последовательности. Праймеры могут быть получены в двухцепочечной и/или одноцепочечной форме, хотя одноцепочечная форма обычно является более предпочтительной. Часто создают пары праймеров, которые избирательно гибридизируют с разными областями матричной нуклеиновой кислоты и контактируют с матричной ДНК в условиях, обеспечивающих избирательную гибридизацию. В зависимости от требуемого применения может быть выбрана гибридизация в строгих условиях, в которых возможна гибридизация только с последовательностями, полностью комплементарными праймерам. В других вариантах осуществления изобретения гибридизация может быть выполнена в условиях пониженной жесткости, делающих возможной амплификацию нуклеиновых кислот, содержащих одно или более ошибочных спариваний с последовательностями праймеров. После гибридизации комплекс матрицы с праймерами вводят в соприкосновения с одним или более ферментами, которые облегчают синтез нуклеиновой кислоты на матрице. Проводят несколько циклов амплификации, пока не будет получено достаточное количество продукта амплификации.

Полимеразная цепная реакция

Существует целый ряд методов с использованием матрицы, предназначенных для амплификации олигонуклеотидных последовательностей, присутствующих в данном образце матрицы. Одним из наиболее известных методов амплификации является полимеразная цепная реакция. При осуществлении ПЦР пары праймеров, которые избирательно гибридизируют с нуклеиновыми кислотами, используют в условиях, обеспечивающих избирательную гибридизацию. Термин ”праймер” в использованном здесь значении означает любую нуклеиновую кислоту, способную активировать синтез нуклеиновой кислоты на матрице. Праймеры могут быть получены в двухцепочечной или одноцепочечной форме, хотя одноцепочечная форма является более предпочтительной. Праймеры используют при осуществлении любого метода на основании матрицы для амплификации последовательностей-мишеней гена, присутствующих в данном образце матрицы. Одним из наиболее известных методов амплификации является ПЦР, подробно описанная в патентах США 4683195, 4683202 и 4800159, которые включены в настоящее описание изобретения посредством ссылки. При осуществлении ПЦР получают последовательности двух праймеров, которые являются комплементарными областям в противоположных комплементарных цепях последовательности гена-мишени. Праймеры гибридизируют с образованием комплекса нуклеиновая кислота-праймер, если в образце присутствует последовательность гена-мишени. В реакционную смесь добавляют избыток трифосфатов дезоксирибонуклеозидов, наряду с ДНК-полимеразой, например Taq полимеразой, которая облегчает синтез нуклеиновой кислоты на матрице. В случае образования комплекса последовательности гена-мишени с праймером, указанная полимераза заставляет праймеры удлинять последовательность гена-мишени путем добавления нуклеотидов. В результате повышения и понижения температуры реакционной смеси удлиненные праймеры диссоциируют от гена-мишени, образуя продукты реакции, где избыточные праймеры связываются с геном-мишенью и продуктами реакции, и процесс повторяется. Проводят несколько циклов амплификации, пока не будет получено достаточное количество продукта амплификации.

Продукт амплификации может быть расщеплен рестрикционным ферментом до проведения анализа. В других вариантах осуществления любых вышеуказанных аспектов присутствие или отсутствие SNP определяют по гибридизации образца нуклеиновой кислоты с праймером, меченным детектируемой частью. В других вариантах осуществления любых вышеуказанных аспектов детектируемую часть обнаруживают при помощи ферментативного анализа, радиоизотопного анализа, иммуноанализа или флуоресценции. В других вариантах осуществления любых вышеуказанных аспектов праймер метят детектируемым красителем (например, SYBR Green I, YO-PRO-I, тиазоловым оранжевым, Hex, pico green, эданом, флуоресцеином, FAM или ТЕТ). В других вариантах осуществления любых вышеуказанных аспектов праймеры локализуют на чипе. В других вариантах осуществления вышеуказанных аспектов праймеры, предназначенные для амплификации, являются специфичными к указанным SNP.

Другим методом амплификации является лигазная цепная реакция (“ЛЦР”). ЛЦР отличается от ПЦР, так как в данном случае амплифицируется молекула зонда, в отличие от ампликона в полимеризации нуклеотидов. При осуществлении ЛЦР получают две пары комплементарных зондов, и в присутствии последовательности-мишени каждую пару связывают с противоположными комплементарными цепями мишени, в результате чего они соединяются. В присутствии лигазы две пары праймеров связываются с образованием одного звена. В результате циклического изменения температуры, как в случае ПЦР, связанные лигированные звенья диссоциируют от мишени и служат в качестве ”последовательностей-мишеней” для лигирования избытка пар зондов. В патенте США 4883750, который включен в настоящее описание изобретения посредством ссылки, описан метод, подобный ЛЦР, который предназначен для связывания пар зондов с последовательностью-мишенью.

Изотермальная амплификация

Метод изотермальной амплификации, при осуществлении которого используют рекстрикционные эндонуклеазы и лигазы для амплификации молекул-мишеней, содержащих нуклеотид-5'-[[альфа]тио]трифосфаты в одной цепи сайта рестрикции, также может быть использован для амплификации нуклеиновых кислот по настоящему изобретению. В одном варианте осуществления изобретения метод изотермальной амплификации, опосредованной петлей (LAMP), использован для типирования полиморфизма единичного нуклеотида (SNP).

Амплификация с заменой цепи

Амплификация с заменой цепи (SDA) является еще одним методом осуществления изотермальной амплификации нуклеиновых кислот, который включает несколько циклов замены цепи и синтеза, то есть ник-трансляцию. Подобный метод, называемый реакцией репарации цепи (RCR), включает отжиг нескольких зондов в области, предназначенной для амплификации, с последующим проведением реакции репарации, в которой присутствуют только два из четырех оснований. Два других основания могут быть добавлены в виде биотинилированных производных для простоты обнаружения.

Амплификация на основе транскрипции

Другие методы амплификации нуклеиновых кислот включают системы амплификации на основе транскрипции, включая амплификацию на основе последовательности нуклеиновой кислоты. При осуществлении амплификации на основе последовательности нуклеиновой кислоты предназначенные для амплификации нуклеиновые кислоты получают путем стандартной экстракции смесью фенол/хлороформ, тепловой денатурации клинического образца, обработки лизирующим буфером и в мини-центрифужных колонках для выделения ДНК и РНК или путем экстракции РНК хлоридом гуанидина. Указанные методы амплификации включают отжиг праймера, имеющего специфические последовательности-мишени. После полимеризации гибриды ДНК/РНК расщепляют РНКазой Н, где двухцепочечные молекулы ДНК снова подвергают тепловой денатурации. В любом случае из одноцепочечной ДНК получают полностью двухцепочечную молекулу путем добавления второй специфической праймера-мишени с последующим проведением полимеризации. Двухцепочечные молекулы ДНК затем несколько раз транскрибируют при помощи полимеразы, такой как Т7 или SP6. При проведении изотермальной циклической реакции РНК подвергают обратной транскрипции с образованием двухцепочечной ДНК и еще раз транскрибируют при помощи такой полимеразы, как Т7 или SP6. Полученные продукты в усеченном или полном виде представляют собой специфические последовательности-мишени.

В соответствии с настоящим изобретением могут быть использованы другие методы амплификации. В одном варианте осуществления изобретения в ПЦР-подобном синтезе на основе матрицы и ферментов используют ”модифицированные” праймеры. Праймеры могут быть модифицированы путем мечения захватывающей частью (например, биотином) и/или детектирующей частью (например, ферментом). В присутствии последовательности-мишени зонд связывается и расщепляется каталитическим путем. После расщепления высвобождается интактная последовательность-мишень, которая связывается избытком зонда. Расщепление меченого зонда сигнализирует о присутствии последовательности-мишени. В другом методе процесс амплификации нуклеиновой кислоты включает циклический синтез одноцепочечной РНК (“ssРНК”), ssДНК и двухцепочечной ДНК (dsДНК), которые могут быть использованы согласно настоящему изобретению. ssРНК является первой матрицей для первого затравочного олигонуклеотида, который удлиняется при помощи обратной транскриптазы (РНК-зависимая ДНК-полимераза). РНК затем удаляют из полученного дуплекса ДНК:РНК при помощи рибонуклеазы Н (РНКаза Н, РНКаза, специфичная к РНК в дуплексе с ДНК или РНК). Полученная ssДНК является второй матрицей для второго праймера, который также включает последовательности промотора РНК-полимеразы (в качестве примера можно привести РНК-полимеразу Т7) для гомологии с матрицей. Затем указанный праймер удлиняют при помощи ДНК-полимеразы (в качестве примера можно привести большой фрагмент Кленова ДНК-полимеразы I E. coli) с образованием молекулы двухцепочечной ДНК (“dsДНК”), имеющей последовательность, идентичную последовательности исходной РНК между праймерами, и имеющей, дополнительно у одного конца, последовательность промотора. Последовательность промотора может быть использована соответствующей РНК-полимеразой для получения множества РНК-копий ДНК. Указанные копии затем могут быть повторно подвергнуты циклической обработке с достижением очень быстрой амплификации. При соответствующем выборе ферментов амплификация может быть осуществлена изотермически без добавления ферментов в каждом цикле. Благодаря циклическому характеру данного процесса исходная последовательность может быть выбрана в форме ДНК или РНК.

Методы отделения нуклеиновой кислоты

Может быть желательно отделить продукты нуклеиновой кислоты от других веществ, таких как матрица и избыток праймера. В одном варианте осуществления продукты амплификации отделяют электрофорезом в агарозном геле, агароза-акриламидном геле или полиакриламидном геле, используя стандартные методы (Sambrook et al., 1989, см. ниже). Отделенные продукты амплификации могут быть отрезаны от геля и элюированы с целью дальнейшей обработки. При использовании агарозных гелей с низкой температурой плавления отделенная полоса может быть удалена путем нагревания геля с последующей экстракций нуклеиновой кислоты. Нуклеиновые кислоты могут быть также отделены хроматографическими методами, известными в данной области. Существует много типов хроматографии, которые могут быть использованы при осуществлении настоящего изобретения, включая адсорбционную, распределительную, ионообменную хроматографию, хроматографию на колонках с гидроксиапатитом, на молекулярных ситах, с обращенной фазой, на колонках, на бумаге, тонкослойную и газовую хроматографию, а также ВЭЖХ. В определенных вариантах осуществления изобретения продукты амплификации визуализируют. Обычный метод визуализации включает окрашивание геля бромидом этидия и визуализацию полос в УФ-свете. Альтернативно, при мечении продуктов амплификации радиоактивными или флуоресцирующими нуклеотидами отделенные продукты амплификации могут быть экспонированы на рентгеновской пленке или визуализированы в свете, показывающем соответствующие спектры возбуждения.

Альтернативно, присутствие полиморфных положений, согласно способам по настоящему изобретению, можно определить на основании присутствия или отсутствия гибридизации с приемлемым зондом нуклеиновой кислоты, специфичным к полиморфной нуклеиновой кислоте и не специфичным к немутированной нуклеиновой кислоте.

Термин ”гибридизация” означает образование двухцепочечной молекулы между комплементарными полинуклеотидными последовательностями или их частями в условиях разной степени строгости. Например, концентрация соли в строгих условиях гибридизации обычно составляет менее примерно 750 мМ NaCl и 75 мМ тринатрийцитрата, предпочтительно менее примерно 500 мМ NaCl и 50 мМ тринатрийцитрата и более предпочтительно менее примерно 250 мМ NaCl и 25 мМ тринатрийцитрата. Гибридизация в условиях пониженной жесткости может быть осуществлена при отсутствии органического растворителя, например формамида, в то время как гибридизация в строгих условиях может быть осуществлена в присутствии по меньшей мере примерно 35% формамида и более предпочтительно в присутствии по меньшей мере примерно 50% формамида. Температура в строгих условиях гибридизации обычно составляет по меньшей мере примерно 30°С, более предпочтительно по меньшей мере примерно 37°С и наиболее предпочтительно по меньшей мере примерно 42°С. Специалистам в данной области хорошо известны различные дополнительные параметры, такие как время гибридизации, концентрация детергента, например додецилсульфата натрия (SDS), и включение или исключение ДНК-носителя. Разные уровни строгости при необходимости достигаются путем объединения вышеуказанных разных условий. В предпочтительном варианте осуществления гибридизацию проводят при 30°С в 750 мМ NaCl, 75 мМ тринатрийцитрата и 1% SDS. В более предпочтительном варианте осуществления гибридизацию проводят при 37°С в 500 мМ NaCl, 50 мМ тринатрийцитрата, 1% SDS, 35% формамида и 100 [м.ед.] г/мл денатурированной ДНК спермы лосося (ssДНК). В наиболее предпочтительном варианте осуществления гибридизацию проводят при 42°С в 250 мМ NaCl, 25 мМ тринатрийцитрата, 1% SDS, 50% формамида и 200 [м.ед.] г/мл ssДНК. Специалистам в данной области будут очевидны приемлемые варианты вышеуказанных условий.

В большинстве применений стадии промывки, следующие за гибридизацией, также могут быть осуществлены в разных условиях строгости. Строгие условия промывки определяются концентрацией соли и температурой. Как указано выше, строгость промывки может быть увеличена путем уменьшения концентрации соли или повышения температуры. Например, концентрация соли в строгих условиях гибридизации на стадиях промывки предпочтительно составляет менее примерно 30 мМ NaCl и 3 мМ тринатрийцитрата и наиболее предпочтительно менее примерно 15 мМ NaCl и 1,5 мМ тринатрийцитрата. Температура в строгих условиях гибридизации на стадиях промывки обычно составляет по меньшей мере примерно 25°С, более предпочтительно по меньшей мере примерно 42°С и еще предпочтительнее по меньшей мере примерно 68°С. В предпочтительном варианте осуществления стадии промывки проводят при 25°С в 30 мМ NaCl, 3 мМ тринатрийцитрата и 0,1% SDS. В более предпочтительном варианте осуществления стадии промывки проводят при 42°С в 15 мМ NaCl, 1,5 мМ тринатрийцитрата и 0,1% SDS. В более предпочтительном варианте осуществления стадии промывки проводят при 68°С в 15 мМ NaCl, 1,5 мМ тринатрийцитрата и 0,1% SDS. Специалистам в данной области хорошо известны дополнительные варианты указанных условий. Методы гибридизации хорошо известны специалистам в данной области и описаны, например, в публикациях Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); и Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989.

Молекулы нуклеиновых кислот, пригодные для гибридизации при осуществлении способов по настоящему изобретению, включают любую молекулу нуклеиновой кислоты, которая благодаря своей идентичности способна специфически гибридизоваться с нуклеиновыми кислотами-мишенями. Полинуклеотиды, являющиеся ”по существу идентичными” эндогенной последовательности, обычно могут гибридизоваться по меньшей мере с одной цепью молекулы двухцепочечной нуклеиновой кислоты. Термин ”по существу идентичный” означает молекулу полипептида или нуклеиновой кислоты, которая по меньшей мере на 50% идентична эталонной аминокислотной последовательности или последовательности нуклеиновой кислоты. Такая последовательность предпочтительно по меньшей мере на 60%, более предпочтительно на 80% или 85% и более предпочтительно на 90%, 95% или даже на 99% идентична уровню аминокислоты или нуклеиновой кислоты в используемой для сравнения последовательности. Идентичность последовательности обычно измеряют при помощи программного обеспечения для анализа последовательностей (такого как, например, пакет программ для анализа последовательностей Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, программы BLAST, BESTFITR, GAP или PILEUP/PRETTYBOX). Такое программное обеспечение сравнивает идентичные или подобные последовательности, присваивая степени гомологии разным заменам, делециям и/или другим модификациям. Консервативные замены обычно включают замены в следующих группах: глицин, аланин; валин, изолейцин, лейцин; аспарагиновая кислота, глутаминовая кислота, аспарагин, глутамин; серин, треонин; лизин, аргинин; и фенилаланин, тирозин. В конкретном методе определения степени идентичности последовательностей программа BLAST может быть использована с оценкой вероятности от е<”3> до е<”100>, свидетельствующей о близкородственной последовательности.

Для одновременного измерения отсутствия, присутствия или величины гибридизации для всех разных последовательностей может быть использована система детектирования. Для определения уровней и паттернов флуоресценции предпочтительно используют сканер.

Другой метод обнаружения вариантов последовательностей основан на амплификации при помощи ПЦР специфических мишеней человека и последующем обнаружении их генотипа путем гибридизации со специфическими зондами HairLoop™, расположенными на микроматрице.

Зонд HairLoop™ представляет собой одноцепочечную ДНК с петлей-на-стволе, состоящую из последовательности зонда, заключенной между комплементарными последовательностями, образующими ствол шпильки. Указанный ствол прикрепляется к поверхности микроматрицы только одной из цепей. При отсутствии ДНК-мишени зонд HairLioop™ находится в замкнутом состоянии (фиг.1а). При идеальном связывании мишени (без ошибочного спаривания) с зондом HairLoop™ более высокая стабильность дуплекса зонда-мишени заставляет ствол развернуться с открытием зонда HairLoop™ (фиг.1b). Благодаря указанным уникальным структурным и термодинамическим свойствам зонд HairLoop™ обладает несколькими преимуществами по сравнению с линейными зондами, одним из которых является более высокая дифференциация специфичности двух последовательностей ДНК-мишени, отличающихся всего одним нуклеотидом.

Зонд HairLoop™ действует подобно выключателям, которые обычно находятся в закрытом или ”выключенном” состоянии. Связывание с флуоресцирующей ДНК-мишенью вызывает конформационные изменения, которые открывают структуру, в результате чего после промывки флуоресценция становится видимой или ”включенной”.

Один зонд HairLoop™ является специфичным к одному данному аллелю. Таким образом, оценка точечной мутации для биаллельного маркера требует двух зондов HairLoop™: одного для аллеля дикого типа и одного для мутантного аллеля. Специфические последовательности, предназначенные для обнаружения полиморфизмов, показанных в таблице 3, методом с использованием зонда HairLoop, приведены в таблице 4.

Таблица 4
SEQ ID NO: Название варианта Последовательность, включающая полиморфизм Аллель Номер доступа dbSNP Хромосома Положение в хромосоме Цепь
1 FXII, 46 C>T GGACGGATGCCATGA Риск rs1801020 5 176836532 +
2 GGACGGACGCCATGA Нет риска
3 ABO, 261 delG CTCGTGGTGACCCCT Риск rs8176719 9 136132908 -
4 CTCGTGGT ACCCCTT Нет риска
5 ABO, 526C>G GGAGGTGCGCGCCT Риск rs7853989 9 136131592 +
6 GGAGGTGGGCGCCT Нет риска
7 ABO, 703G>A TGCACCCCGGCTTCTAC Риск rs8176743 9 136131415 +
8 TGCACCCCAGCTTCTAC Нет риска
9 ABO, 1059delC TCCGGAACCCGTGAGC Риск rs8176750 9 136131059 +
10 TCCGGAA_CCGTGAGCG Нет риска
11 SERPINA10, 728 C>T CCTGCTGTGAAAGATCT Риск rs2232698 14 94756669 +
12 CCTGCTGCGAAAGATCT Нет риска
13 SERPINC1, Ala384Ser (Cambridge II) CGGTACTTGAAGCTGCTT Риск NA 1 173873176 _
14 CGGTACTTGCAGCTGCTT Нет риска
15 FV, R506Q (FV Leiden) ATTCCTTGCCTGTCC Риск rs6025 1 169519049 -
16 ATTCCTCGCCTGTCC Нет риска
17 FV, R306T (FV Cambrigde) GAAAACCACGAATCTTAAG Риск NA 1 169524537 +
18 GAAAACCAGGAATCTTAAG Нет риска
19 FV, R306G (FV Hong Kong) AAGAAAACCGGGAATCTTA Риск NA 1 169524536 +
20 AAGAAAACCAGGAATCTTA Нет риска
21 FXIII, Val34Leu GGGCACCACGCCCTGA Риск rs5985 6 6318795 -
22 GGGCACCAAGCCCTGA Нет риска
23 Протромбин, G20210A TCTCAGCAAGCCTCAAT Риск rs1799963 11 46761055 +
24 TCTCAGCGAGCCTCAAT Нет риска

Способ определения риска более приемлемым методом

Другим аспектом настоящего изобретения является создание алгоритма для определения риска возникновения и/или присутствия тромбоэмболического эпизода. Указанный алгоритм представлен в виде функций 1.

Функция 1

Оценка риска возникновения тромбоза

Оценка риска возникновения тромбоза у индивида основана на модели логистической регрессии. Целью указанной модели является вычисление вероятности присутствия у индивида тромбоза вен на основании генетических, социодемографических и клинических характеристик. Для вычисления указанной вероятности авторы использовали следующее уравнение:

Вероятность (Y=1|x1,..., xn)=1/1+exp(β01x1+...+βnxnf.gxf.xg+....+βh.ixh.xi),

где

- вероятность (Y=1|x1,..., xn) означает вероятность наличия тромбоза у конкретного индивида, имеющего конкретные и измеряемые характеристики в ряде переменных 1,..., n. Указанная вероятность может находиться в пределах от 0 до 1;

- Exp означает экспоненциальное природное основание;

- β0 означает коэффициент, определяющий риск (вероятность) тромбоза, не связанный с переменными 1-n. Указанный коэффициент может иметь значение от -∞ до +∞ и вычисляется как натуральный логарифм случаев возникновения тромбоза вен у населения;

- β1 означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный со значением/присутствием независимой переменной х1. Указанный коэффициент может иметь значение от -∞ до +∞;

- х1 является значением, принимаемым независимой переменной х1 у индивида. Диапазон возможных значений зависит от указанной переменной;

- βn означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный со значением/присутствием независимой переменной хn. Указанный коэффициент может иметь значение от -∞ до +∞;

- хn является значением, принимаемым независимой переменной х1 у индивида. Диапазон возможных значений зависит от указанной переменной.

Кроме того, данная модель включает возможность комбинирования некоторых переменных с достижением взаимодействия или модификации выполняемого действия. То есть величина действия (коэффициент регрессии) одной переменной (хf) может быть равна βf, но при комбинировании указанной переменной с другой переменной (хg) величина действия может изменяться (увеличиваться или уменьшаться), поэтому при рассмотрении величины действия переменной хf необходимо учитывать не только βf, но также второй коэффициент регрессии βf.g, складывая βf и βf.g. Таким образом:

- βf.g означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный с объединенным присутствием независимых переменных хf и хg. Указанный коэффициент может иметь значение от -∞ до +∞;

- хf является значением, принимаемым независимой переменной хf у индивида. Диапазон возможных значений зависит от указанной переменной;

- хg является значением, принимаемым независимой переменной хg у индивида. Диапазон возможных значений зависит от указанной переменной;

- βh.i означает коэффициент регрессии, определяющий риск (более высокий или более низкий) возникновения тромбоза, связанный с объединенным присутствием независимых переменных хh и хi. Указанный коэффициент может иметь значение от -∞ до +∞;

- хh является значением, принимаемым независимой переменной хh у индивида. Диапазон возможных значений зависит от указанной переменной.

- хi означает независимой переменной хi у индивида. Диапазон возможных значений зависит от указанной переменной;

Если у индивида отсутствует любая мутация или генетический вариант риска, но данный индивид имеет положительный семейный анамнез тромбоза вен, в данную модель должна быть включена указанная переменная. Коэффициент регрессии такой переменной равен 1185 в диапазоне возможных значений от 0,200 до 2500.

Переменные, входящие в данную модель, и коэффициенты регрессии каждой из указанных переменных представлены в таблице 5.

Таблица 5
Переменная Риск Коэффициент регрессии Нижний предел коэффициента регрессии Верхний предел коэффициента регрессии
Клинические факторы
Возраст <55 лет Нет 0
55-64 года Да 0,811 0,100 3,000
65-74 года Да 1,409 0,100 3,000
75-84 года Да 1,681 0,100 3,000
>84 лет Да 2,534 0,500 5,000
Мужчина Да 0,336 0,050 1,500
Диабет Да 0,351 0,050 1,500
Курение Да 0,166 0,050 1,500
Индекс массы тела
<25 кг/м2
25-29,9 кг/м2
≥30 кг/м2

Нет
Да
Да

0
0,412
0,820

0
0,050
0,100

0
1,500
3,000
Применение пероральных противозачаточных средств Да 1,131 0,100 3,000
Беременность Да 1,435 0,100 3,000
Семейный анамнез тромбоза* Да 1,185 0,100 3,000
Генетические факторы
Гетерозиготный фактор V Leiden AG 0,993 0,100 3,000
Гомозиготный фактор V Leiden АА 2,890 0,500 6,000
Протромбин AG 0,293 0,050 1,500
Серпин 10 ТG 1,358 0,100 3,000
Фактор XII TC/TT 1,633 0,100 3,000
Фактор XIII GT/GG 0,198 0,050 1,500
Серпин С TG 2,277 0,500 6,000
АВО (аллель А1) (см. таблицу 6) 0,956 0,100 3,000
Взаимодействия
Фактор V Leiden.протромбин AG.AG 1,114 0,100 3,000
Фактор V Leiden.АВО AG.(см. таблицу 6) 0,599 0,100 3,000
Фактор V Leiden⋅пероральные противозачаточные средства AG.Да 0,028 0,005 1,000
Фактор V Leiden.беременность AG.Да 1,191 0,100 3,000
Протромбин.пероральные противозачаточные средства AG.Да 0,542 0,100 3,000
Протромбин.беременность AG.Да 1,673 0,100 3,000
Протромбин.BMI ≥30 кг/м2 AG.Да 0,772 0,100 3,000
Пероральные противозачаточные средства.BMI ≥30 кг/м2 Да.Да 1,218 0,100 3,000
* Указанный фактор включается в модель только в том случае, если у индивида отсутствует любая мутация или генетический вариант риска, но имеется положительный семейный анамнез тромбоза вен.

Таблица 6
Определение аллеля А1
Индивид имеет по меньшей мере один аллель А1 в локусе АВО при наличии любой из следующих комбинаций
Генотипы
Комбинация rs8176719 rs7853989 rs8176743 rs8176750
1 GG CC GG CC
2 GG CC GG CdelC
3 GG CG GA CG
4 GdelG CC GG CG
5 GG CG GG CC

Весьма удивительным является то, что комбинация маркеров SNP, включенная в настоящее изобретение и приведенная в таблице 3, при использовании функции, описанной в разделе ”Функция 1”, позволяет определить риск возникновения тромбоэмболической болезни или эпизода с более высокой точностью по сравнению с точностью, достигаемой при использовании современных методов или опубликованных функций, включая генетическую информацию.

Весьма удивительным является то, что комбинация маркеров SNP, включенная в настоящее изобретение и приведенная в таблице 3, при использовании функции, описанной в разделе ”Функция 1”, позволяет диагностировать тромбоэмболическую болезнь или эпизод с более высокой точностью по сравнению с точностью, достигаемой при использовании современных методов или опубликованных функций, включая генетическую информацию.

Благодаря использованию описанных функций можно определить индивидуальный риск возникновения тромбоэмболического эпизода, в частности смертельный и несмертельный инфаркт миокарда, инсульт, преходящее ишемическое нарушение мозгового кровообращения, периферическую артериопатию, тромбоз глубоких вен, эмболию легочной артерии или их комбинацию.

Пример 1

Введение. Тромбоэмболическая болезнь имеет важный генетический компонент. Дополнительно к классическому фактору V Leiden (FVL) и протромбину G20210A (PT) были идентифицированы новые генетические варианты, связанные с указанным патологическим состоянием. Целью данного исследования было определение способности выбранного набора генетических вариантов (генетический профиль) повышать качество прогнозирования тромбоза с помощью FVL и РТ.

Методы. В настоящее изобретение включены два исследования (тромбоза) и контрольные образцы: MARTHA (1150 случаев заболевания/801 контрольный образец), предназначенные для оценки взаимосвязи FVL и РТ с другими факторами риска, а также исследование населения Испании: РЕ (249 случаев заболевания/248 контрольных образцов). Был проведен анализ следующего генетического профиля: FVL, PT, ABO, C46T (F12), A384S (серпин C1), R67X (серпин А10). Взаимосвязь между генетическими вариантами и тромбозом вычисляли, используя значение OR, соответствующее возрасту и полу. Прогностическую способность вычисляли при помощи статистических методов (AUC-ROC) и переклассификации (NRI, IDI), имевшей место при использовании FVL, PT или при использовании генетического профиля.

Результаты


Таблица 7
Взаимосвязь между вариантами и тромбозом [OR (95%)] и долей носителей FVL и РТ по сравнению с носителями генетического профиля (только случаи заболевания)
FVL PT A1 C46T A384S R67X
MARTHA 2,3
(1,8-2,8)
0,9
(0,7-1,1)
1,8
(1,2-2,7)
0,9
(0,6-1,4)
0,9
(0,2-3,7)
2,3
(1,2-4,6)
Случаи заболевания 50,4
87,5
РЕ 7,2
(2,8-18,9)
2,8
(1,2-6,8)
2,62
(1,8-3,8)
3,1
(1,1-8,8)
4,1
(0,5-36,9)
2,5
(0,8-8,1)
Случаи заболевания 19,7
71,5

Таблица 8
Статистика и переклассификация, NRI (улучшение конечной переклассификации) и IDI (улучшение комплексного распознавания) по сравнению с использованием генетического профиля FVL и РТ
Статистика NRI IDI
MARTHA PE MARTHA PE MARTHA PE
FVL+PT 0,54
(0,51-0,57)
0,58
(0,56-0,62)
Эталон Эталон Эталон Эталон
FVL+PT+другие 0,58
(0,55-0,61)
0,69
(0,64-0,73)
5,3
(-1,1-11,6)
23,4
(11,1-35,6)
1
(0,3-1,8)
5,9
(3,71-7,88)
Значение Р <0,001 <0,001 >0,05 <0,001 <0,05 <0,001

Рассмотрение результатов. Было показано, что выбранный генетический профиль значительно улучшает прогнозирование риска развития тромбоза, позволяя идентифицировать генетический риск возникновения тромбоэмболического эпизода у 51,6% людей, у которых имела место тромбоэмболия и при этом не был выявлен генетический риск в результате анализа FVL и РТ. Генетический профиль позволит улучшить диагностику, профилактику и лечение тромбоэмболической болезни в клинической практике.

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> Gendiag.exe, S.L.

<120> МАРКЕРЫ ТРОМБОЭМБОЛИТИЧЕСКОЙ БОЛЕЗНИ

<130> HE 156894

<140> PCT/EP2012/061185

<141> 2012-06-13

<150> EP 11170235.3

<151> 2011-06-16

<160> 24

<170> PatentIn version 3.4

<210> 1

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 1

ggacggatgc catga 15

<210> 2

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 2

ggacggacgc catga 15

<210> 3

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 3

ctcgtggtga cccct 15

<210> 4

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 4

ctcgtggtac ccctt 15

<210> 5

<211> 14

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 5

ggaggtgcgc gcct 14

<210> 6

<211> 14

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 6

ggaggtgggc gcct 14

<210> 7

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 7

tgcaccccgg cttctac 17

<210> 8

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 8

tgcaccccag cttctac 17

<210> 9

<211> 16

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 9

tccggaaccc gtgagc 16

<210> 10

<211> 16

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 10

tccggaaccg tgagcg 16

<210> 11

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 11

cctgctgtga aagatct 17

<210> 12

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 12

cctgctgcga aagatct 17

<210> 13

<211> 18

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 13

cggtacttga agctgctt 18

<210> 14

<211> 18

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 14

cggtacttgc agctgctt 18

<210> 15

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 15

attccttgcc tgtcc 15

<210> 16

<211> 15

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 16

attcctcgcc tgtcc 15

<210> 17

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 17

gaaaaccacg aatcttaag 19

<210> 18

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 18

gaaaaccagg aatcttaag 19

<210> 19

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 19

aagaaaaccg ggaatctta 19

<210> 20

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 20

aagaaaacca ggaatctta 19

<210> 21

<211> 16

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 21

gggcaccacg ccctga 16

<210> 22

<211> 16

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 22

gggcaccaag ccctga 16

<210> 23

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 23

tctcagcaag cctcaat 17

<210> 24

<211> 17

<212> ДНК

<213> Искусственная последовательность

<220>

<223> олигонуклеотид

<400> 24

tctcagcgag cctcaat 17

1. Способ оценки риска возникновения у индивида тромбоэмболического эпизода или диагностики возникновения или наличия у индивида тромбоэмболической болезни или эпизода, включающий стадию определения наличия в полученном у указанного индивида образце

серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698),

серпина С1 (антитромбин) Ala384Ser (Cambridge II),

фактора XII С46Т (rs1801020),

фактора XIII Val34Leu (rs5985),

фактора II (протромбин) G20210A (rs1799963),

фактора V Leiden Arg506Gln (rs6025),

фактора V Cambridge Arg306Thr,

фактора V Hong Kong Arg306Gly,

группы крови ABO rs8176719,

группы крови ABO rs7853989,

группы крови ABO rs8176743 и

группы крови ABO rs8176750,

где наличие всех упомянутых полиморфизмов указывает на риск возникновения тромбоэмболического эпизода или на развитие или наличие тромбоэмболической болезни или эпизода соответственно.

2. Способ идентификации индивида, нуждающегося в терапевтическом лечении антикоагулянтом и/или антитромбином, либо в профилактическом лечении антикоагулянтом и/или антитромбином, включающий стадии определения в полученном у указанного индивида образце по меньшей мере одного аллеля полиморфизмов

серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698),

серпина С1 (антитромбин) Ala384Ser (Cambridge II),

фактора XII С46Т (rs1801020),

фактора XIII Val34Leu (rs5985),

фактора II (протромбин) G20210A (rs1799963),

фактора V Leiden Arg506Gln (rs6025),

фактора V Cambridge Arg306Thr,

фактора V Hong Kong Arg306Gly,

группы крови ABO rs8176719,

группы крови ABO rs7853989,

группы крови ABO rs8176743 и

группы крови ABO rs8176750,

где наличие всех упомянутых полиморфизмов указывает на пониженную реакцию на лечение антитромбином и/или антикоагулянтом либо на необходимость раннего и инвазивного лечения антитромбином и/или антикоагулянтом, или на необходимость профилактического лечения антитромбином и/или антикоагулянтом.

3. Способ по п.1 или 2, который дополнительно включает определение одного или более факторов риска возникновения сердечно-сосудистого заболевания или нарушения, выбранных из группы, состоящей из возраста, расовой принадлежности, пола, индекса массы тела, курения, систолического кровяного давления, диастолического кровяного давления, госпитализации, неподвижности вследствие наложения гипсовой повязки, хирургической операции, травмы, перорального противозачаточного средства или гормональной терапии, беременности, длительной поездки (≥2 часов), коллагеноза сосудов, сердечной недостаточности, злокачественного новообразования, лекарственного лечения, миелопролиферативных нарушений, нефротического синдрома, привычного выкидыша, ожирения, сахарного диабета, холестерина липопротеина низкой плотности (LDL), холестерина липопротеина высокой плотности (HDL), холестерина, уровней триглицеридов, семейного анамнеза тромбоэмболического эпизода, беременности и индекса массы тела.

4. Способ по п.1 или 2, в котором образец является образцом ткани из полости рта, соскобом, смывом или биологической жидкостью, предпочтительно слюной, мочой или кровью.

5. Способ по п.1 или 2, в котором присутствие или отсутствие полинуклеотида идентифицируют на основании амплификации или отсутствия амплификации продукта амплификации в образце, где продукт амплификации предпочтительно расщепляют рестрикционным ферментом до проведения анализа и/или идентифицируют SNP путем гибридизации образца нуклеиновой кислоты с меченым праймером, который является детектируемой частью.

6. Способ по п.1 или 2, в котором присутствие или отсутствие полинуклеотида идентифицируют путем гибридизации со специфическими зондами HairLoop™ SEQ ID NO: 1-24, нанесенными на микроматрицу.

7. Способ по п.1 или 2, в котором тромбоэмболическая болезнь выбрана из группы смертельного или несмертельного инфаркта миокарда, инсульта, преходящего ишемического нарушения мозгового кровообращения, периферической артериопатии, тромбоза глубоких вен, эмболии легочной артерии или их комбинаций.



 

Похожие патенты:

Изобретение относится к проверке содержания медицинских документов. Техническим результатом является улучшение обнаружения нарушений в медицинской карте пациента.

Группа изобретений относится к медицинской технике. Устройство для пополнения имплантируемого насоса, содержащего емкость для лекарства, содержит множество независимых каналов для текучих сред, включающих в себя первый, второй и третий независимые каналы для текучих сред.

Изобретение относится к способу и устройству для беспроводного управления медицинским устройством с использованием пульта дистанционного управления. Согласно способу через первый блок ввода, предоставленный посредством сенсорного экрана (24) пульта (10, 60, 70, 80) дистанционного управления, вводят управляющую информацию для активирования и/или деактивирования функции управления для управления устройством (30).

Изобретение относится к автоматизации процессов, связанных с информационной поддержкой, а также повседневным и боевым управлением целевой военной техникой и средствами, обеспечивающими функционирование корабля (судна) по целевому признаку авианесущей и транспортной платформы.

Изобретение относится к области геофизики и может быть использовано для отслеживания трещин в процессе гидроразрыва пласта. Предложены система, способ и носитель данных, используемые для анализа микросейсмических данных, собранных при гидравлическом разрыве пласта в подземной зоне.

Группа изобретений относится к медицине, а именно к системам для наблюдения за состоянием здоровья множества пациентов, и может быть использована для прогнозирования в режиме реального времени внезапных происшествий.

Изобретение относится к системе и способу управления двигателем при одновременном воздействии водителя на педаль тормоза и педаль акселератора. Предложен двигатель с тормозной системой с вакуумным усилителем привода и быстрым восстановлением.

Изобретение относится к системе и способу прогнозирования риска в реальном времени во время буровых работ. Техническим результатом является повышение точности прогнозирования риска в реальном времени во время буровых работ.

Изобретение относится к системе и способу создания сетки мощности пласта для определения оценки запасов пласта. Техническим результатом является повышение точности определения объема пласта.

Изобретение относится к системе и способу определения оценок запасов для пласта. Техническим результатом является повышение точности определения объема пласта.

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеют следующий нуклеотидный состав: F1 р30 5'-GTTACGACCGCTATAAAAACA-3' R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3' Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3' Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии.

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения. Предсавленные синтетические олигонуклеотидные праймеры имеют нуклеотидные последовательности: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Предложенный способ включает выделение РНК из образцов эмбриональных сывороток и биоматериала, проведение обратной транскрипции и ПЦР с синтетическими олигонуклеотидными праймерами, перенос продукта амплификации на гель и оценку проведения реакции. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 320 п.н. Изобретения могут быть использованы в ветеринарии для выявления возможных контаминаций эмбриональных сывороток, используемых для культивирования культур клеток и производства биопрепаратов, атипичным пестивирусом крупного рогатого скота, а также для диагностики инфекционных заболеваний сельскохозяйственных животных, в частности инфекции, вызванной атипичным пестивирусом крупного рогатого скота. 2 н.п. ф-лы, 1 ил., 3 табл., 4 пр.
Наверх