Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia raoultii генотипа dns28



Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia raoultii генотипа dns28
Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia raoultii генотипа dns28

 


Владельцы патента RU 2616287:

Федеральное бюджетное учреждение науки "Омский научно-исследовательский институт природно-очаговых инфекций" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к области биотехнологии. Представлено применение штамма Rickettsia raoultii «23/95-Еланда» генотипа DnS28, депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 135, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотип DnS28. Штамм R. raoultii «23/95-Еланда» активно размножается на культуре клеток Vero и Help-2 и может использоваться в качестве продуцента диагностических препаратов для идентификации риккетсий группы клещевой пятнистой лихорадки. Изобретение обеспечивает оптимизацию лабораторной диагностики риккетсиозов. 4 пр.

 

Изобретение относится к области биотехнологии. Штамм риккетсий «23/95-Еланда» является представителем вида Rickettsia raoultii, принадлежит к генотипу DnS28, изолированным на территории РФ. На основании изучения фенотипических и генотипических признаков штамм отнесен к порядку Rickettsiales, семейству Rickettsiaceae, роду Rickettsia, виду Rickettsia raoultii. По результатам изучения и сравнения нуклеотидных последовательностей гена gltA и гена ompA штамм «23/95-Еланда» имеет 100% гомологии с Rickettsia raoultii sp.DnS28 strain DnS28, описанной no образцу ДНК риккетсий из клещей Dermacentor nuttalli без изоляции штамма Рыдкиной с соавторами (Rydkina Е., Roux V., Fetisova N., Rudakov N., Gafarova M., Tarasevich I. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg.Infect.Dis., 1999. - 5. - P. 811-814). Штамм «23/95-Еланда» культивируется в культуре клеток Vero.

Штамм R. raoultii генотипа DnS28 «23/95-Еланда» выделен в 1995 году из имаго клещей Dermacentor nuttalli, собранных с растительности в республике Алтай, окрестности с. Еланда.

Штамм «23/95-Еланда» хранится во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под инвентарным номером 135 от 09.06.1999 г.

В 1999 году в клещах, собранных на территории России, с использованием амплификации и секвенирования rrs (16S rRNA), gltA и ompA генов были идентифицированы три новых, тесно генетически связанных генотипа риккетсий: RpA4, DnS14 и DnS28. Rickettsia sp.генотипы DnS14 и DnS28 были выявлены в клещах Dermacentor nuttalli, собранных в Сибири (республика Алтай), в то время как генотип RpA4 был обнаружен в клещах Rhipicephalus pumilio, собранных в Астраханской области (Rydkina Е., Roux V., Fetisova N., Rudakov N., Gafarova M., Tarasevich I. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg.Infect.Dis., 1999. - 5. - P. 811-814). Эти риккетсиальные агенты формируют достоверный кластер внутри Rickettsia massiliae группы. Данная группа имеет определенные филогенетические и фенотипические характеристики и включает R.massiliae, R.rhipicephali, R.aeschlimannii и R.montanensis, которые отличаются от остальных представителей рода Rickettsia своей устойчивостью к рифампицину, обусловленной Phe-to-Leu мутацией в гене rpoB (Rolain J.M., Maurin М., Vestris G., Raoult D. In vitro susceptibilities of 27 rickettsiae to 13 antimicrobials// Antimicrob Agents Chemother, 1998. - 42. - P. 1537-1541; Drancourt M., Raoult D. Characterization of mutations in the rpoB gene in naturally rifampin-resistant Rickettsia species // Antimicrob. Agents. Chemother. - 1999. - V. 43. - P. 2400-2403). В 2008 году эти генотипы (RpA4, DnS14 и DnS28) описаны как принадлежащие к новому виду риккетсий группы КПЛ Rickettsia raoultii sp.nov. (вид назван в честь руководителя лаборатории риккетсиозов Средиземноморского университета профессора Didier Raoult) (Mediannikov О., Matsumoto К., Samoylenko I., Drancourt M., Roux V., Rydkina E. Rickettsia raoultii sp.nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia // Intern. J. Syst. Evol. Microbiol., 2008. - V.58. - P. 1635-1639).

R.raoultii широко распространена в клещах рода Dermacentor в очагах клещевого риккетсиоза в России и Казахстане (Шпынов С.Н., Рудаков Н.В., Ястребов В.К., Леонова Т.Н., Хазова Т.Г., Егорова Н.В., Борисова О.Н., Прейдер В.П., Безруков Г.В., Федоров Е.Г., Федянин А.П., Шерстнева М.Б., Турышев А.Г., Гаврилов А.П., Танкибаев М.А., Тарасевич И.В., Fournier Р.-Е., Raoult D. Выявление новых генотипов риккетсий группы клещевой пятнистой лихорадки на юге Урала, в Сибири, на Дальнем Востоке и в Казахстане// Эпидемиология и инфекционные болезни, 2005. - №1. - С. 23-27;

Shpynov S., Fournier P.-E., Rudakov N., Tankibaev M., Tarasevich I. and Raoult D. Detection of Rickettsia Closely Related to Rickettsia aeschlimannii, "Rickettsia heilongjiangensis", Rickettsia sp.Strain RpA4, and Ehrlichia muris in Ticks Collected in Russia and Kazakhstan// Journal of Clinical microbiology, 2004. -V.42. - 5. - P. 2221-2223), а также в различных странах Евразии (преимущественно в клещах рода Dermacentor) (Рудаков Н.В., Шпынов С.Н., Самойленко И.Е., Оберт А.С. Клещевой риккетсиоз и риккетсий группы клещевой пятнистой лихорадки в России. Омск: ИЦ «Омский научный вестник», 2011. - 232 с; Parola P., Rovery С, Rolain J.M., Brouqui P., Davoust В., and Raoult D. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses// Emerg. Infect. Dis., 2009. - 15 (7). - P. 1105-1108). Установлена высокая инфицированность клещей этой риккетсией.

В отношении возможной патогенности R. raoultii для человека имеются следующие сведения. В Европе получены данные о вероятной роли этой новой риккетсий в возникновении синдрома TIBOLA (от англ. "tick-borne lymphadenopathy" - лимфаденопатия после присасывания клеща) или DEBONEL (Dermacentor-borne necrosis erythema and lymphadenopathy), который ранее связывали только с R. slovaca (Ibarra V., Portillo A., Santibanez S., Blanco J.R., Perez-Martinez L., Marquez J. DEBONEL/TIBOLA: is Rickettsia slovaca the only etiological agent?// Ann. N.Y. Acad. Sci., 2005. - 1063. - P. 346-348; Mediannikov O., Matsumoto K., Samoylenko I., Drancourt M., Roux V., Rydkina E. Rickettsia raoultii sp.nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia // Intern. J. Syst. Evol. Microbiol., 2008. - V.58. - P. 1635-1639; Parola P., Rovery C, Rolain J.M., Brouqui P., Davoust В., and Raoult D. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses// Emerg. Infect. Dis., 2009. - 15 (7). - P. 1105-1108). В Китае описано два случая инфекции, связанной с R.raoultii (Jia N., Zheng Y.-C, Ma 1., Huo Q.-B., Ni X.-B., Jiang B.-G., Chu Y.-L., Jiang R.-R., Jiang J.-F., Cao W.-C. Human infections with Rickettsia raoultii, China// Emer. Inf. Dis., 2014. - 20 (5). - P. 866-868), при отсутствии классической клиники клещевого риккетсиоза или синдрома TIBOLA, с преобладанием местных проявлений на месте присасывания клеща в виде болезненной эритематозной сыпи.

Заболеваемость риккетсиозом, вызываемым R. raoultii, в настоящее время в России не регистрируется, поскольку диагностические препараты для верификации данного риккетсиоза в РФ не выпускаются. Диагноз риккетсиоза, ассоциированного с R. raoultii, может быть поставлен только при лабораторном обследовании с использованием тест-систем на основе производственных штаммов вида R. raoultii.

Задача изобретения - оригинальный штамм вида Rickettsia raoultii DnS28, который может быть использован для разработки и изготовления диагностических препаратов (наборов реагентов).

Технический результат - использование штамма Rickettsia raoultii «23/95-Еланда» в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого R. raoultii. Заявляемый штамм обладает биологически и технологически значимыми свойствами, такими как: генетическая идентичность типовому штамму R. raoultii, способность активно размножаться на культуре клеток Vero и накапливать производственную биомассу в процессе культивирования, что позволяет использовать его для серийного (коммерческого) выпуска диагностических препаратов (наборов реагентов). Использование штамма Rickettsia raoultii «23/95-Еланда» в качестве продуцента диагностических препаратов позволяет оптимизировать лабораторную диагностику риккетсиозов.

Генотипические характеристики

Выделенный штамм R. raoultii «23/95-Еланда» характеризуется следующими признаками.

Морфологические признаки

Типичны для риккетсий, но чаще встречаются кокковидные и палочковидные формы (типы а и b по классификации П.Ф. Здродовского). Грамотрицательны.

Культуралъные свойства

1). Успешно пассируются в культурах клеток Vero и Нер-2 с накоплением до 2 крестов в поле зрения, с локализацией как в цитоплазме, так и в ядрах клеток.

2). Успешно пассируется в организме иксодовых клещей рода Dermacentor, характеризуется высоким уровнем вертикальной передачи. При моделировании естественного цикла метаморфоза в четвертом поколении переносчиков (F4) уровень трансовариальной передачи риккетсий составил 99,5+/-0,5%, уровень трансфазовой передачи - 100%. Средний уровень накопления риккетсий в голодных личинках - 6, после кровопитания личинок на сосунках белых мышей - 24 риккетсий в поле зрения (тотальные мазки исследованы в МФА с поликлональными антителами к риккетсиям группы КПЛ). Средний уровень накопления риккетсий в голодных нимфах составил - 10, после кровопитания нимф 50 риккетсий в поле зрения, использованием клещевой экспериментальной модели и высушен из имаго четвертого поколения естественно инфицированной линии клещей D. nuttalli.

Антигенные свойства. Антигенные детерминанты R. raoultii выявляются методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы клещевой пятнистой лихорадки люминесцирующими, сухими (НПО «Биомед»). Антигенные свойства соответствуют риккетсиям группы КПЛ по данным МФА с поликлональными антителами к риккетсиям группы КПЛ.

Генотипические характеристики

Определена нуклеотидная последовательность гена цитрат синтазы (gltA) длиной 1234 пар оснований штамма «23/95-Еланда», которая имела 100% гомологии с последовательностью гена цитрат синтазы Rickettsia sp.DnS28 strain DnS28, депонированной в GenBank под номером AF120027:

Последовательность нуклеотидов гена белка наружной мембраны риккетсий (OmpA) длиной 587 пар оснований имеет 100% гомологии с депонентом GenBank под номером AF120018 Rickettsia sp.DnS28 OmpA (ompA) gene:

На основании морфологических, антигенных и генетических признаков изолированный штамм относят к роду Rickettsia виду Rickettsia raoultii, генотипу DnS28.

Изобретение иллюстрируется следующими примерами.

Пример 1. Идентификация на основании генотипических признаков

Экстракция ДНК

Экстракцию риккетсиальной ДНК из пробы культур клеток осуществляют, применяя QIAamp Tissue Kit (QIAGEN, Hilden, Germany) и протеиназу К в концентрации 2,0 мг/мл (Boehringer Mannheim, Mannheim, Germany) в соответствии с протоколом QIAamp Tissue Kit.

Полимеразная цепная реакция (ПЦР) и секвенс-реакция.

Полимеразную цепную реакцию (ПНР) и секвенс-реакцию выполняют, применяя праймеры, специфичные для Rickettsiae, используют две пары праймеров, амплифицирующие gltA ген, кодирующий цитрат синтетазу: CS1d(5-ATGACTAATGGCAATAATAA-3) и CS535r(5-GAATATTTATAAGACAT-TGC-3), CS409d(5-CCTATGGCTATTATGCTTGC-3) и RP1258n(5-ATTGCAAAAAGTACAGTGAACA-3), а также праймеры 190.70(ATGGCGAATATTTCTCCAAAA), 190.180(GCAGCGATAATGCTGAGTA) и 190.701(GTTCCGTTAATGGCAGCATCT), амплифицирующие ompA ген, кодирующий белок наружной мембраны (Roux, V., et al., 1997; Fournier, P-E., etal., 1998).

Однораундовую ПЦР выполняют в термоциклере Peltier модель РТС-200 (Mj Research, Inc, Watertown, MA). Реакцию амплификации выполняют в объеме 25 мкл, в присутствии 5 пкМ каждого праймера и 1 ед. Taq-полимеразы, 2,5 мкл смеси дезоксинуклеотидов трифосфатов (2% dATP, 2% dCTP, 2% dTTP, 2% dGTP в стерильной воде), 1 мкл 25 mM раствора MgCl2, 2,5 мкл 10x реакционного буфера (Perkin-Elmer Cetus, Norwalk, Conn.). Профиль амплификации включает начальную денатурацию в течение 15 минут при 95°С, 39 циклов амплификации (денатурация при 94°С - 60 с, отжиг праймеров при 54°С - 30 с, элонгация при 72°С - 60 с) и финальную элонгацию в течение 5 минут при 72°С. Каждая постановка ПЦР включает отрицательный контроль (дистиллированная вода) и положительный контроль (ДНК R. montanensis).

Пурификацию ПЦР-продукта проводят, применяя QIAquick PCR Purification Kit (Germany) в соответствии с протоколом.

Секвенс-реакцию с ПЦР-продуктами выполняют, применяя d-Rhodamine Terminator Cycle Sequencing Ready Reaction kit (Applied Biosistems, Warrington, UK). Секвенирование выполняют на ABI 3100 PRISM (Applied Biosystems) автоматическом секвенаторе. Анализ полученных нуклеотидных последовательностей для сравнения степени гомологии с последовательностями Банка данных GenBank проводят с помощью программы BLAST в режиме прямого доступа.

Пример 2. Культивирование риккетсий и идентификация на основании фенотипических (культуральных и антигенных) свойств

2.1. Культивирование риккетсий с использованием экспериментальной клещевой модели.

Культивирование и изучение уровня трансовариальной и трансфазовой передачи проводят с использованием экспериментальной клещевой модели (Тагильцев А.А., Тарасевич Л.Н., Богданов И.И., Якименко В.В. Изучение членистоногих убежищного комплекса в природных очагах трансмиссивных вирусных инфекций: Руководство по работе в полевых и лабораторных условиях, - Томск, 1990) в сочетании с методами выявления и изучения риккетсий. Кормление пары естественно инфицированных имаго клещей (самка и самец) проводят на взрослых лабораторных животных (морские свинки или белые мыши). Появившееся потомство содержат в серийных кормлениях-линьках «личинка-нимфа-имаго». Для определения наличия риккетсий в потомстве образцы появившихся личинок и нимф исследуют методом флюоресцирующих антител с поликлональными антителами как в голодном состоянии, так и после напитывания.

2.2. Культивирование риккетсий с использованием перевиваемых культур клеток.

Версенизация и выращивание клеточных культур.

Для работы культуры клеток Vero и Нер-2 подвергают версенизации по стандартной методике Соловьева, Бектемирова 1972 г., в матрац добавляют 0,25% раствора версена и 0,25% раствора трипсина, от объема матраца. На флакон с культуральной поверхностью 25 см2 достаточно 0,5 мл раствора. Его равномерно распределяют по слою клеток покачиванием флакона; выдерживают флакон при 36°С до тех пор, пока все клетки не отделятся от ростовой поверхности (проверяют под микроскопом), энергично постукивают по стенке флакона; ресуспендируют клетки в ростовой среде (4,5 мл на флакон с ростовой поверхностью 25 см2), которая останавливает действие трипсина. Суспензию всасывают несколько раз через тонкую пастеровскую пипетку, чтобы раздробить агрегаты клеток; разводят суспензию клеток ростовой средой Игла MEM с двойным набором аминокислот до нужной концентрации, основываясь на подсчете клеток, 150 тыс. на 1 мл. К общему объему добавляют до 5% эмбриональной сыворотки. Рассевают полученную клеточную суспензию в культуральные флаконы или пробирки, плотно закрывают и помещают в термостат при 37°С. Когда монослой почти сформирован (1-2 дня) заменяют ростовую среду поддерживающей средой. Культуры обычно перевивают каждые 5-7 дней.

Заражение культур клеток

Клеточную культуру во флаконе заражают 50% суспензией, полученной из высушенных штаммов, в дозе 0,5 мл на флакон. Флаконы с зараженными клетками центрифугируют при 800 об/мин при температуре 22° в течение 30 мин, после центрифугирования во все флаконы добавляют среду поддержки (Игла MEM с добавлением 1% эмбриональной сыворотки) в объеме 1,5 мл на флакон (Raouit D., 2000). Флаконы с зараженными клетками культивируют в углекислотном термостате при температуре 37°С в течение 8-14 суток, в зависимости от культуры клеток. После завершения инкубации все флаконы подвергают замораживанию в низкотемпературном холодильнике при -20°С, затем размораживают, для разрушения клеток и максимального выхода из них микроорганизмов. После разморозки, материал центрифугируют 10 минут при 3000 об/мин, супернатант в объеме 0,5 мл берут на следующий пассаж, а из 0,2 мл делают мазки, остатки супернатанта хранят в криопробирках в низкотемпературном холодильнике. Инфицированность и стерильность культуры клеток определяют в мазках, окрашивая их по Романовскому - Гимза.

Полученные образцы исследуют методом флюоресцирующих антител по стандартной методике, используют иммуноглобулины диагностические для выявления риккетсий группы КПЛ, антитела люминесцирующие сухие (НПО «Биомед). Изучение морфологических и тинкториальных свойств проводят по методу Здродовского (Здродовский, Голиневич, 1972). 2.3 Изучение антигенных свойств.

а) Антигенные детерминанты Rickettsia raoultii генотипа DnS28 в клещах и на культуре клеток выявляют методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы КПЛ, люминесцирующими, сухими (НПО «Биомед»).

б) С целью лабораторной диагностики сыворотки крови больных клещевыми инфекциями исследуют в реакции непрямой флюоресценции с корпускулярными антигенами известных видов риккетсий и полученным на культуре клеток корпускулярным антигеном Rickettsia raoultii генотипа DnS28.

Пример 3. Приготовление корпускулярного антигена

После завершения культивирования культуру зараженных клеток замораживают в низкотемпературном холодильнике при - 20С°, а потом размораживают для разрушения клеток и максимального выхода из них риккетсий. Материал центрифугируют 10 минут при 3000 оборотах в минуту. Супернатант используют для нанесения корпускулярного антигена на стекла и проведения реакции непрямой иммунофлюоресценции для исследования сывороток крови больных после присасывания иксодовых клещей.

Пример 4. Приготовление цельнорастворимых антигенов

Для приготовления антигена зараженные культуры клеток подвергают центрифугированию при 6000 оборотах в минуту в течение 20 минут, далее удаляют супернатант, а из полученной взвеси делают мазки, которые окрашивают по Романовскому - Гимза.

После микроскопического контроля во взвесь зараженных клеток добавляют физиологический раствор и 0,5% фенол. После встряхивания в шейкере пробирки с зараженной клеточной взвесью помещают в рефрижератор на 3-4 дня для осаждения посторонних белковых примесей.

После этого клеточную взвесь подвергают многократной эфирной обработке по Craigie (1945 г.). При первой эфирной обработке к материалу добавляют 1,5-2 объема наркозного эфира и после встряхивания оставляют при комнатной температуре до следующего дня в темном месте. Затем водную фазу отделяют, и второй раз обрабатывают эфиром (равный объем эфира в отношении водной фазы), встряхивают и оставляют на 2 часа, затем водную фазу вновь отделяют и в третий раз обрабатывают эфиром (1/2 объема эфира по отношению к объему водной фазы) таким же образом.

После третьей обработки при образовании среднего тканевого слоя делают повторную эфирную обработку. После окончания эфирной обработки производят отгонку эфира под небольшим вакуумом. Пробирки с антигеном оставляют в течение суток в холодильнике для испарения эфира. Полученные серии антигенов испытывают в реакции связывания комплемента РСК на антикомплементарность, специфичность, чувствительность и устанавливают титр. Также антигены стандартизуют по уровню аминного азота методом формольного титрования (%) и белка с помощью биуретовой реакции (%). После испытания антигены разливают в ампулы по 1,0 мл и лиофильно высушивают. Высушенный антиген хранят при температуре - 20 С.

Таким образом, по результатам сравнения нуклеотидных последовательностей гена gltA и гена ompA штамм имеет 100% гомологии с Rickettsia raoultii генотип DnS28 (strain DnS28), активно размножается на культурах клеток Vero и Нер-2, что позволяет в процессе культивирования накапливать производственную биомассу. С учетом этого он может быть использован в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотипа DnS28.

Применение штамма Rickettsia raoultii «23/95-Еланда» генотипа DnS28, депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им. Н.Ф. Гамалеи под номером 135, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii.



 

Похожие патенты:

Изобретение относится к области микробиологии и медицины. Способ представлен диагностикой состояния микробиоты кишечника на фоне эрадикационной терапии Helicobacter pylori, заключающейся в установлении нуклеотидных последовательностей отдельных микроорганизмов микробиоты кишечника пациента по бактериальному гену 16S рРНК, на основании которых рассчитывают состав, количество видов и индекс разнообразия Шеннона H микробного сообщества до, в процессе и после эрадикации.
Изобретение относится к биотехнологии. Способ предусматривает следующее.

Изобретение относится к биотехнологии. Способ предусматривает забор исследуемого материала, посев его на селективные питательные среды, инкубирование посевов при заданных параметрах с последующей идентификацией выросших колоний.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp.

Группа изобретений относится к определению уровней активности бактерий в легких пациентов. Группа изобретений раскрывает способ предсказания усиления уровня бактериальной активности Pseudomonas aeruginosa в легких пациента, а также способ определения эффективности лечения антибиотиком бактериальной инфекции легких, вызванной Pseudomonas aeruginosa, в которых осуществляется измерение уровней маркеров процесса захвата железа бактериями (например, сидерофоров) и уровней секретированных бактериальных белков с течением времени.

Предложен способ первичной идентификации микобактерий комплекса М. tuberculosis от нетуберкулезных микобактерий.

Изобретение относится к области микробиологии. Способ обнаружения кластера микроорганизмов на поверхности предусматривает этапы, на которых: а) определяют топографическое представление упомянутой поверхности; b) обнаруживают на топографическом представлении, по меньшей мере, один контур, ограничивающий область, которая может соответствовать скоплению биологических частиц.

Настоящее изобретение относится к области микробиологии и касается способа определения таких характеристик, как типирование, потенциальная устойчивость по меньшей мере к одному антимикробному средству и фактора вирулентности, по меньшей мере, одного микроорганизма из образца.

Изобретение относится к клинической микробиологии и может быть использовано при определении эффективных мер лечения хронических инфекционных заболеваний кожи и слизистых оболочек человека.

Изобретение относится к санитарной микробиологии. Дифференциально-диагностическая питательная среда содержит аланин, натрия хлорид и дистиллированную воду в заданных соотношениях компонентов.

Изобретение относится к микробиологии и биотехнологии и может быть использовано для очистки почвы и воды от нефти и нефтепродуктов. Препарат представляет собой иммобилизованную на вспученном вермикулите биомассу углеводородоксиляющих бактерий Bacillus subtilis СНБС-1 при соотношении 1:1.
Изобретение относится к области биотехнологии. Предложен штамм бактерий Pseudomonas yamanorum ВКМ В-3033D, предназначенный для активизации биодеструкции нефти и нефтепродуктов в воде, а также в масляных грунтах на участках железной дороги.

Группа изобретений относится к бактериальному экстракту для лечения воспалений и его применению. Бактериальный экстракт получен после культивирования и лизиса бактерии, депонированной в CNCM 8 апреля 2010 г.

Изобретение относится к биотехнологии и может быть использовано в ветеринарии. Штамм Bacillus amyloliquefaciens В-20 депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12168.

Изобретение относится к области биотехнологии. Штамм Micrococcus luteus, депонированный под регистрационным номером В-12410 во Всеросиийской Коллекции Промышленных Микроорганизмов ФГУП ГосНИИГенетика, является продуцентом сайт-специфической метилзависимой эндонуклеазы MluVI.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к трансформированному микроорганизму Escherichia sp., продуцирующему О-ацетилгомосерин.
Изобретение относится к применению штамма цианобактерий Anabaena sp. РСС 7120 для получения наночастиц серебра.

Изобретение относится к биотехнологии, пищевой и медицинской промышленности и может быть использовано в получении пробиотиков, предназначенных для непосредственного потребления или в качестве биологически активной добавки к продуктам питания, при производстве кисломолочных продуктов профилактического назначения, предназначенных в частности для нормализации уровня холестерина и полезной микрофлоры желудочно-кишечного тракта человека и повышения общей резистентности организма.

Группа изобретений относится к биотехнологии и касается штаммов бактерий B.adolescentis 150 и B.angulatum GT 102. Штаммы бактерий B.adolescentis и B.angulatum депонированы во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационными номерами ВКПМ Ас-1974 и ВКПМ Ас-1973 и обладают способностью синтезировать гамма- аминомасляную кислоту (ГАМК).
Изобретение относится к биотехнологии. Способ предусматривает следующее.
Наверх