Способ идентификации клопа вредной черепашки (eurygaster integriceps puton, 1881) на основе рестрикционного анализа гена цитохромоксидазы митохондриальной днк



Способ идентификации клопа вредной черепашки (eurygaster integriceps puton, 1881) на основе рестрикционного анализа гена цитохромоксидазы митохондриальной днк

 


Владельцы патента RU 2617935:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Воронежский государственный университет" (ФГБОУ ВО "ВГУ") (RU)

Изобретение относится к области микробиологии, а именно к молекулярно-генетическому способу идентификации клопа вредной черепашки (Eurygaster integriceps). Производят сбор биологического материала и выделяют ДНК. Проводят ПЦР участка цитохромоксидазы митохондриальной ДНК. В качестве праймеров используют прямой EuCO1F: GAATATGAGCCGGAATAGTAGGA (SEQ ID NO:3) и обратный EuCO1R: ATGTGTTGAAGTTACGGTCA (SEQ ID NO:4). Продукты ПЦР подвергают рестрикции. В качестве рестриктаз используют следующие: Ahl I, BamH I, Bst2U I, Psi I. Визуализацию продуктов рестрикции проводят с помощью электрофореза в 2% агарозном геле. Наличие одного из наборов фрагментов: 317, 268 п.н. для рестриктазы Ahl I, 471, 114 п.н. для BamH I, 364, 221 п.н. для Bst2U I и 435, 150 п.н. для Psi I указывает на принадлежность вредителя к роду Eurygaster integriceps. Изобретение позволяет в течение от 4,5 до 6 часов осуществить идентификацию Eurygaster integriceps на разных стадиях его развития и вне зависимости от пола насекомого. 2 ил., 1 пр.

 

Изобретение относится к области микробиологии, а именно к молекулярно-генетическим методам идентификации организмов – клопа вредной черепашки (Eurygaster integriceps), и может быть использовано при определении наличия этого вредителя на посевах пшеницы и ячменя.

В составе рода Eurygaster Laporte насчитывается 10 видов, непосредственно в России - 6 ( U. Family Scutelleridae Leach, 1815. In: Aukema В, Rieger С, editors. Catalogue of the Heteroptera of the Palaearctic Region, 5. Pentatomomorpha II. Netherlands Entomological Society; 2006; 233-414). Известно, что в европейской части России распространены 5 видов этого рода. Четыре из них являются вредителями зерновых культур: Еu. integriceps Puton, 1881, Еu. maura (Linnaeus, 1758), Еu. testudinaria (Geoffroy, 1785) и Еu. austriaca (Schrank, 1776). Пятый вид этого рода, встречающийся в фауне России, Еu. dilaticollis (Dohrn, 1860), живет в природных степных экосистемах и на пастбищах, питается соками дикорастущих злаков. Вред, наносимый сельскохозяйственным культурам Еu. dilaticollis, не установлен. Самым опасным представителем Eurygaster является Еu. integriceps. Данный вид широко распространен в Восточной Европе, Средней Азии и Ближнем Востоке, включая такие страны как Турция, Иран, Ирак, Сирия, Израиль, Хорватия, Сербия, Италия, Украина, Греция, Болгария, Румыния, Таджикистан, Узбекистан, Киргизия, Пакистан, Российская Федерация и др. (Critchley B.R. Literature review of sunn pest Eurygaster integriceps Put. (Hemiptera: Scutelleridae). Crop Protection. 1998; 17(4): 271-287). Он способен размножаться в высокой численности на посевах зерновых культур (пшенице, ячмене), снижая их урожайность. Установлено, что при поражении посевов зерновых этим видом клопов общие потери урожая могут достигать 20-30% для ячменя и 50-90% для пшеницы (Gul Α., Cuma Α., Mithat D. Sunn pest control policies and effect of Sunn pest damage on wheat quality and price in Turkey. Quality and Quanity. 2006; 40: 469-480). Кроме прямых потерь урожая пшеницы также сильно ухудшаются хлебопекарные качества муки, полученной из поврежденных зерен вследствие деградации протеолитическими ферментами клопа глютена зерен (Darkoh С., El-Bouhssini M., Baum M., Clack В. Characterization of a prolyl endoprotease from Eurygaster integriceps Puton (Sunn pest) infested wheat. Arch Insect Biochem. Physiol. 2010; 74(3): 163-78).

Из источников информации (Голуб В.Б., Великань B.C., Гурьева Е.Л. и др. Отряд Полужесткокрылые, или Клопы - Hemiptera (=Heteroptera). Определитель вредных и полезных насекомых и клещей зерновых культур в СССР. Сост. Л.М. Копанева. Л.: Колос. Ленингр. Отд-ние, 1980; 80-91) известно, что дифференцирование вредной черепашки от других представителей клопов-черепашек на данный момент возможно только по морфологическим признакам, что является сложной задачей, которую способен решить только высококвалифицированный специалист-энтомолог. Кроме того, данный способ не всегда можно применять при обнаружении вредителя на посевах, т.к. ключевые признаки, позволяющие дифференцировать вредную черепашку от других видов, имеются только у взрослых особей.

Известен способ определения сроков появления личинок вредной черепашки (патент РФ №2010515, МПК А01К 67/033), включающий учет температурных характеристик окружающей среды, отличающийся тем, что в полевых условиях определяют сроки появления первых яйцекладок вредной черепашки на полях озимой пшеницы и длительность развития стадии яйца вредителя, а сроки появления личинок определяют как сумму срока появления первых яйцекладок и длительности развития стадии яйца вредителя, при этом длительность развития стадии яйца определяют по формуле N=(0,2569+0,0358Tcp-0,0009Tcp2), где Ν - длительность развития стадии яйца, сут; Тср - средняя температура воздуха по данным метеослужбы за две декады вперед.

Недостатком данного способа является то, что не учитывается видовой состав популяции. Невозможно дифференцировать вредную черепашку от других видов того же рода по яйцам только по морфологическим признакам. Идентификация вредителя на основе ДНК позволит дифференцировать яйца вредной черепашки от яиц маврской черепашки, влаголюбивой черепашки и других морфологически сходных видов клопов.

В качестве прототипа рассмотрен способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1 (патент RU 2528743, МПК C12N 15/06, C12Q 1/68), включающий проведение ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1. Детекцию результатов ПЦР-ПДРФ осуществляли методом горизонтального электрофореза в 3% агарозном геле в буфере ТВЕ (рН 8,0), содержащем этидий бромид в концентрации 0,5 мкг/мл, с последующей визуализацией амплифицированных продуктов в ультрафиолетовом трансиллюминаторе (=310 нм). На этапе ПЦР используются последовательности олигонуклеотидных праймеров: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO: 1), DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO: 2), DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO: 3), а на этапе рестрикции применяется рестриктаза - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp, и генотип АК=100/82/18 bp.

Задачей настоящего изобретения является разработка молекулярно-генетического метода идентификации вредной черепашки, не требующего присутствия узко квалифицированного специалиста, для повышения эффективности мер по обработке посевов от вредителя.

Существенным преимуществом заявляемого молекулярно-генетического метода идентификации вредителя является возможность его определения еще на стадиях яйца, личинки и куколки в независимости от пола, что в свою очередь позволит применять превентивные меры защиты растений.

Нами предварительно проведен анализ нуклеотидной последовательности гена цитохромоксидазы субъединицы 1 у видов рода Eurygaster в России. Последовательности внесены в международную систему Genbank (acession numbers: KR105371.1, KR105370.1, KR105369.1, KU726545, KU760760, KU760761, KU760762, KU760763, KU760764). Установлены отличия в нуклеотидной последовательности между вредной черепашкой (Eurygaster integriceps) и остальными видами клопов-черепашек, которые позволяют разработать метод экспресс-идентификации данного вида клопа на основе рестрикционного анализа гена цитохромоксидазы.

Технический результат - проведение идентификации вредителя на его ранних стадиях развития (яйца, личинки) и взрослых вне зависимости от пола насекомого, а также возможность проведения идентификационных процедур в течение нескольких часов без привлечения энтомолога.

Технический результат достигается тем, что в способе идентификации вредной черепашки (Eurygaster integriceps) на основе рестрикционного анализа предварительно амплифицированного гена цитохромоксидазы митохондриальной ДНК, включающем выделение ДНК из предварительно собранного биологического материала, последующее проведение ПНР участка цитохромоксидазы митохондриальной ДНК, рестрикционного анализа ампликона, проведение электрофореза в агарозном геле, согласно изобретению, при проведении ПЦР используют праймеры прямой EuCO1F: GAATATGAGCCGGAATAGTAGGA (SEQ ID NO: 3) и обратный EuCO1R: ATGTGTTGAAGTTACGGTCA (SEQ ID NO: 4), а для рестрикционного анализа используют рестриктазы Аhl I, BamH I, Bst2U I, Psi I, причем наличие одного из наборов фрагментов: 317, 268 п.н. для рестриктазы Аhl I, 471, 114 п. н. для BamH I, 364, 221 п. н. для Bst2U I и 435, 150 п.н. для Psi I указывает на принадлежность вредителя к роду Eurygaster integriceps

Способ идентификации вредной черепашки (Eurygaster integriceps) на основе рестрикционного анализа предварительно амплифицированного гена цитохромоксидазы субъединицы 1 реализуется следующим образом:

1. Производится сбор биологического материала (взрослые насекомые, яйца, личинки) с посевов пшеницы или ячменя. Если анализ производится не в тот же день, то образцы для хранения помещают в 70% спиртовой раствор.

2. Производится выделение ДНК из полученных образцов, выделение ДНК можно проводить как с помощью коммерческих наборов отечественных и зарубежных производителей ("ДНК-технологии", "Праймтех", "Zymo research", БиоСилика и др.), так и общепринятыми методами (фенол-хлороформная экстракция, ЦТАБ-метод).

3. Проводят ПЦР. Используют следующие температурные циклы: 94°С 4 мин, 35 циклов: 94°С 30 сек, 58°С 30 сек, 72°С 40 сек, конечная элонгация 72°С 8 мин. В качестве праймеров используют следующие: прямой EuCO1F: GAATATGAGCCGGAATAGTAGGA (SEQ ID NO: 3), обратный EuCO1R: ATGTGTTGAAGTTACGGTCA (SEQ ID NO: 4), данные праймеры высокоспецифичны к роду Eurygaster и амплифицируют продукт гена цитохромоксидазы длиной 569 п.н.

4. Продукты ПЦР подвергают рестрикции по следующей схеме: берут 10 мкл ПЦР продукта, добавляют 1,5 мкл 10Х реакционного буфера, индивидуального для каждой рестриктазы, и 10 ед. рестриктазы. Объем доводят до 15 мкл деионизированной водой. Инкубируют смесь в течение 1,5 часов при 37°С, фермент инактивируют нагревом до 75°С в течение 15 минут. Визуализацию продуктов рестрикции проводят с помощью электрофореза в 2% агарозном геле. В качестве рестриктаз используют следующие: Аhl I, BamH I, Bst2U I, Psi I. Каждый из рестрикционных ферментов образует уникальные фрагменты у вредной черепашки (таблица 1). При этом для идентификации вредителя Е. integriceps можно использовать любую из представленных рестриктаз, либо несколько рестриктаз.

На фиг. 1 приведена Таблица 1 длины ожидаемых фрагментов при расщеплении последовательности цитохромоксидазы длиной 569 п. н.

На фиг. 2 изображена электрофореграмма продуктов рестрикции ПЦР цитохромоксидазы, субъединица 1.

Пример

На электрофореграмме (фиг. 2) 1 - рестриктаза BamH I, образец ДНК №1; 2 - рестриктаза BamH I, образец ДНК №2; 3 - Рестриктаза Ahl I, образец ДНК №1; 4 - Рестриктаза Ahl I, образец ДНК №2; M - маркер длин фрагментов ДНК, значения выражены в пар нуклеотидов.

При обработке рестриктазой BamH I продукта ПЦР образца ДНК №1 фрагменты не образовались, следовательно, это ДНК Еu. maura или Еu. testudinaria или Eu. dilaticollis. При обработке рестриктазой BamH I продукта ПЦР образца ДНК №2 образовались два фрагмента длиной 471 и 114 п.н., следовательно, это ДНК Eu. integriceps.

При обработке рестриктазой Аhl I продукта ПЦР образца ДНК №1 образовались 3 фрагмента длиной 316, 175, 93, следовательно, это ДНК Еu. maura или Eu. testudinaria или Eu. dilaticollis. При обработке рестриктазой Аhl I продукта ПЦР образца ДНК №2 образовались два фрагмента длиной 317 и 268 п. н., следовательно, это ДНК Eu. integriceps.

Предлагаемый способ идентификации вредной черепашки является высокочувствительным, хорошо воспроизводимым и недорогим. В зависимости от используемого способа выделения ДНК из биологических образцов анализ занимает от 4,5 до 6 часов. Анализ можно проводить в лабораториях, имеющих термоциклер, центрифугу, камеру для электрофореза и сопутствующие реактивы и расходные материалы.

Способ идентификации клопа вредной черепашки (Eurygaster integriceps) на основе рестрикционного анализа предварительно амплифицированного гена цитохромоксидазы митохондриальной ДНК, включающий выделение ДНК из предварительно собранного биологического материала, последующее проведение ПЦР участка цитохромоксидазы митохондриальной ДНК, рестрикционного анализа ампликона, проведение электрофореза в 2% агарозном геле, отличающийся тем, что при проведении ПЦР используют праймеры: прямой EuCO1F: GAATATGAGCCGGAATAGTAGGA (SEQ ID NO: 3) и обратный EuCO1R: ATGTGTTGAAGTTACGGTCA (SEQ ID NO: 4), a для рестрикционного анализа используют рестриктазы Ahl I, BamH I, Bst2U I, Psi I, причем наличие одного из наборов фрагментов: 317, 268 п.н. для рестриктазы Ahl I, 471, 114 п.н. для BamH I, 364, 221 п.н. для Bst2U I и 435, 150 п.н. для Psi I указывает на принадлежность вредителя к роду Eurygaster integriceps.



 

Похожие патенты:

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития раннего тромбоза зоны реконструкции после реконструктивных операций на брюшной аорте и артериях нижних конечностей.

Изобретение относится к области медицины. Предложен способ персонифицированного назначения стандартного или комбинированного режимов поддержки лютеиновой фазы (ЛФ) в программе ЭКО.

Изобретение относится к области медицины и предназначено для прогнозирования риска кальцификации биологических протезов клапанов сердца, имплантированных в митральную позицию.

Изобретение относится к биотехнологии. Описан способ анализа нейротоксина Clostridium botulinum (BoNT) на активность, включающий: контактирование нервной клетки, происходящей от индуцированной полипотентной стволовой клетки (hiPS) человека, с композицией, включающей BoNT и анализ указанного BoNT на биологическую активность путем определения присутствия или отсутствия расщепления субстрата BoNT в подвергшейся контакту нервной клетке, и/или присутствия или отсутствия высвобождения нейромедиатора из подвергшейся контакту нервной клетки.

Изобретение относится к области микробиологии и медицины. Способ представлен диагностикой состояния микробиоты кишечника на фоне эрадикационной терапии Helicobacter pylori, заключающейся в установлении нуклеотидных последовательностей отдельных микроорганизмов микробиоты кишечника пациента по бактериальному гену 16S рРНК, на основании которых рассчитывают состав, количество видов и индекс разнообразия Шеннона H микробного сообщества до, в процессе и после эрадикации.

Изобретение относится к биохимии. Описан способ получения специального вида расходных материалов для медико-биологических исследований - маркеров длин фрагментов нуклеиновых кислот (ДНК и РНК маркерных лестниц).

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития миоматозных узлов больших размеров у пациенток с миомой матки.

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярно-генетической диагностики вирусных болезней животных. Описан способ выявления ДНК провируса лейкоза и иммунодефицита крупного рогатого скота методом мультиплексной ПЦР.

Изобретение относится к области биохимии, в частности к биологическому ДНК-маркеру для определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки, а также к способу определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки в исследуемых образцах с его использованием.

Изобретение относится к области медицины и предназначено для прогнозирования устойчивости к инотропной терапии у новорожденных с артериальной гипотензией. Из образцов периферической крови выделяют ДНК.

Изобретение относится к молекулярной биологии, микробиологии и медицине. Предложен способ экспресс-анализа генетического полиморфизма для выявления генетической предрасположенности к раку молочной железы (РМЖ). На микрочипе иммобилизуют олигонуклеотиды длиной 40 оснований, содержащие генетический маркер и не содержащие генетический маркер, представленные в табл. 1, по 3 повтора каждого олигонуклеотида, а также представленные в табл. 3 олигонуклеотиды из генов домашнего хозяйства человека в качестве позитивного контроля и из генов других организмов, не имеющих гомологии в человеческом геноме, в качестве негативного контроля. Выделяют нуклеиновые кислоты из образца крови, причем используют тотальную РНК или ДНК. Получают меченый зонд для гибридизации методом реакции обратной транскрипции с одновременным мечением флуоресцентной меткой для РНК, или мечением методом ник-трансляции для ДНК. Гибридизуют полученный зонд с иммобилизованными на микрочипе олигонуклеотидами. Отмывают не специфически связавшийся зонд в условиях, дискриминирующих мутантные генотипы. Сканируют микрочип и проводят оценку результатов. Изобретение позволяет повысить специфичность и достоверность проводимого анализа и с большей достоверностью оценить риски развития РМЖ. 3 табл., 1 ил.

Изобретения относятся к области биохимии. Группа изобретений включает способ и устройство для получения нуклеиновых кислот из биологического образца, а также способ амплификации нуклеиновых кислот в биологическом образце. Способ получения нуклеиновых кислот включает контактирование образца с субстратом, содержащим целлюлозный материал. При этом целлюлозный материал функционализирован биоцидным агентом. Биоцидный агент содержит четвертичное аммониевое соединение и способен ослаблять клеточную мембрану, клеточную стенку, вирусную оболочку, вирусный капсид или лизировать клеточный или вирусный материал. Устройство включает вышеуказанный субстрат. Способ амплификации включает получение нуклеиновых кислот вышеуказанным способом и стадию амплификации полученных нуклеиновых кислот. Изобретения обеспечивают быстрое и простое получение нуклеиновых кислот из биологического образца для дальнейшей обработки. 3 н. и 15 з.п. ф-лы, 11 ил., 6 пр.
Изобретение относится к области медицины, в частности к педиатрии, и предназначено для оценки эффективности терапии инфекции, вызванной вирусом Эпштейна-Барр (ВЭБ) у детей. У ребенка до начала терапии, затем через один, три и шесть месяцев от начала лечения определяют вирусную нагрузку (ВН) ДНК ВЭБ методом ПЦР в соскобе из эпителия ротоглотки. При снижении ВН через указанные промежутки времени на 2 log10 и более делают вывод о высокой эффективности терапии. При снижении ВН более чем на 1 log10, но менее чем на 2 log10 - об умеренной эффективности. При снижении ВН менее чем на 1 log10 - о низкой эффективности лечения. Изобретение обеспечивает контроль эффективности терапии ВЭБ-инфекции по показателям вирусной нагрузки с помощью количественной ПЦР со 100% специфичностью и высокой чувствительностью. 3 пр.

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для дифференциальной диагностики рака предстательной железы (РПЖ). В плазме крови пациента методом микрочипового анализа измеряют экспрессию микроРНК hsa-miR-619-5p и hsa-miR-1184. При величинах экспрессии микроРНК hsa-miR-619-5p в log2-шкале более 1,25 и микроРНК hsa-miR-1184 более 3,5 диагностируют РПЖ. Если величина экспрессии микроРНК hsa-miR-619-5p в log2-шкале менее 1,25 и микроРНК hsa-miR-1184 менее 3,5, диагностируют доброкачественную гиперплазию предстательной железы (ДГПЖ). Изобретение обеспечивает получение новых диагностических маркеров РПЖ и ДГПЖ, позволяющих при сопоставимой достоверности и специфичности осуществлять дифференциальную диагностику РПЖ и ДГПЖ. 3 табл., 6 пр.

Изобретение относится к области медицины, в частности к педиатрии, аллергологии, пульмонологии, и предназначено для оценки врожденного иммунитета у детей с бронхиальной астмой. В соскобах со слизистой полости носа с помощью полимеразной цепной реакции в реальном времени определяют уровень экспрессии генов Toll-подобных рецепторов TLR2 и TLR9. При одновременном повышении уровней экспрессии указанных генов, по меньшей мере, в 20 и 9 раз соответственно по сравнению с их уровнем, установленным для здоровых детей, диагностируют нарушение врожденного иммунитета, приводящее к обострению бронхиальной астмы на фоне острой респираторной инфекции. Изобретение обеспечивает эффективный неинвазивный способ оценки врожденного иммунитета у детей с бронхиальной астмой при одновременном повышении достоверности и специфичности диагностики. 3 пр.

Изобретение относится к области клинико-лабораторной диагностики. Предложен способ прогнозирования качества гамет при лечении женского бесплодия в программах вспомогательных репродуктивных технологий (ВРТ). Проводят генотипирование пациенток по полиморфным локусам FSHR 2039 G>A (Ser680Asn) [rs6166], SERPINE1 (PAI-1) -675(5G>4G) [rs1799889], ESR2 G>A [RsaI] [rs4986938] и VEGFA -634 G>C [rs2010963]. По результатам генотипирования определяют вероятность получения ооцитов, пригодных для оплодотворения. При значениях p больше 0,5 прогнозируют получение ооцитов, пригодных для оплодотворения. При значениях p меньше 0,5 получение ооцитов, пригодных для оплодотворения, не прогнозируют. Изобретение обеспечивает эффективный способ прогнозирования качества гамет, что может значительно повысить шанс успешных исходов в программах ВРТ и рождения здоровых детей. 1 ил., 1 табл., 2 пр.

Изобретение относится к области медицины и предназначено для определения генетической предрасположенности к заболеванию инфекционным эндокардитом (ИЭ) и высокого риска развития ИЭ. У русских пациентов группы риска осуществляют забор образцов венозной крови, выделение геномной ДНК, проведение аллель-специфической полимеразной цепной реакции и определение полиморфных локусов Lys268Arg гена NAT2 и Ile105Val гена GSTP1. У носителей сочетания генотипов NAT2 Arg268Arg × GSTP1 Ile105Val выявляют генетическую предрасположенность и 11,3-кратный риск развития ИЭ. Изобретение обеспечивает установление генетической предрасположенности к ИЭ у пациентов из группы риска, что способствует эффективному определению комплекса профилактических и лечебных мероприятий. 1 з.п. ф-лы, 2 ил., 1 табл., 2 пр.

Изобретение относится к биохимии. Заявлен способ повышения экспрессии полинуклеотида PTEN в клетках или тканях пациента in vivo или in vitro, включающий контактирование указанных клеток или тканей с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10-30 нуклеотида, мишенью которого является природный антисмысловой полинуклеотид PTEN, выбранный из SEQ ID NOs: 14 и 15; посредством чего осуществляется повышение экспрессии полинуклеотида PTEN в клетках или тканях пациента in vivo. Также представлены соответствующий олигонуклеотид, композиция, его содержащая, и способ профилактики или лечения заболевания, связанного с по меньшей мере одним полинуклеотидом PTEN и/или по меньшей мере одним кодируемым им продуктом с помощью данного олигонуклеотида. Изобретение расширяет арсенал средств для лечения профилактики или лечения заболевания, связанного с по меньшей мере одним полинуклеотидом PTEN и/или по меньшей мере одним кодируемым им продуктом. 4 н. и 16 з.п. ф-лы, 9 ил., 1 табл., 2 пр.

Изобретение относится к области биохимии, в частности к способу идентификации растения, включающего последовательность ДНК, вносящую вклад в устойчивость к заболеванию килой крестоцветных у Brassica napus. Способ включает выделение геномной ДНК из растения Brassica, и скрининг выделенной геномной ДНК на молекулярный маркер нуклеиновой кислоты, представляющий собой повтор короткой последовательности (SSR), содержащий полинуклеотид, который амплифицируется при полимеразной цепной реакции парой олигонуклеотидных праймеров SEQ ID NO: 18 и SEQ ID NO: 19 и парой праймеров SEQ ID NO: 20 и SEQ ID NO: 21, где присутствие молекулярного маркера нуклеиновой кислоты SSR является показателем наличия последовательности ДНК, вносящей вклад в устойчивость к заболеванию килой крестоцветных у Brassica napus. Изобретение позволяет эффективно идентифицировать растения, обладающие устойчивостью к заболеванию килой крестоцветных у Brassica napus. 2 н. и 11 з.п. ф-лы, 9 ил., 6 табл., 8 пр.

Группа изобретений относится к области биохимии. Предложен нагревательный блок, чип и устройство для полимеразной цепной реакции (ПЦР). Нагревательный блок выполнен в форме подложки и содержит нагреватели. Каждый нагреватель имеет компенсирующий контур для регулирования сопротивления. Чип включает вышеуказанный нагревательный блок и реакционный блок ПЦР в форме пластины. Причём реакционный блок ПЦР связан с упомянутым нагревательным блоком ПЦР и оснащен реакционными каналами. Устройство содержит вышеуказанный нагревательный блок ПЦР, реакционный блок ПЦР в форме пластины и блок питания для подачи питания в нагреватели. Изобретения обеспечивают улучшение числа переносов ПЦР с одновременной и быстрой амплификацией нескольких образцов нуклеиновой кислоты. 3 н. и 11 з.п. ф-лы, 33 ил.
Наверх