Антитела к h7cr



Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr
Антитела к h7cr

Владельцы патента RU 2650756:

ДЗЕ ДЖОНС ХОПКИНС ЮНИВЕРСИТИ (US)
МедИммьюн, ЭлЭлСи (US)

Настоящая группа объектов изобретения относится к области иммунологии. Предложено антитело, которое специфически связывает B7-H7CR человека, и его антигенсвязывающий фрагмент. Также рассмотрены: фармацевтическая композиция, способ лечения заболевания, связанного с экспрессией В7-H7CR, способ усиления иммунного ответа, связанного с взаимодействием В7 и B7-H7CR, способ профилактического лечения заболевания, связанного с экспрессией B7-H7CR, и способ диагностики заболевания, связанного с экспрессией B7-H7CR. Антитело по настоящему изобретению обеспечивает усиление иммунного ответа, в связи с чем может найти дальнейшее применение в терапии и диагностике различных заболеваний. 7 н. и 26 з.п. ф-лы, 23 ил., 11 табл., 8 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Настоящая заявка представляет собой заявку PCT, по которой испрашивается приоритет предварительной заявки на патент США № 61/745296, поданной 21 декабря 2012 г., предварительной заявки на патент США 61/745312, поданной 21 декабря 2012 г., предварительной заявке на патент США № 61/827269, поданной 24 мая 2013 г., и предварительной заявки на патент США № 61/827279, поданной 24 мая 2013 г., и все заявки включены в настоящее описание в качестве ссылки в полном объеме.

ЗАЯВЛЕНИЕ ОТНОСИТЕЛЬНО ФИНАНСИРУЕМОГО ИЗ ГОСУДАРСТВЕННОГО БЮДЖЕТА ИССЛЕДОВАНИЯ ИЛИ РАЗРАБОТКИ

[0002] Настоящее изобретение было осуществлено отчасти при поддержке правительства Соединенных Штатов в виде грантов под номерами R01 CA097085-10 и ROl A172592 от Национальных институтов здравоохранения (NIH) и U19 CA113341 от Национального института рака (NCI). Правительство Соединенных Штатов может иметь определенные права на настоящее изобретение.

ССЫЛКА НА ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

[0003] Настоящая заявка включает один или несколько перечней последовательностей согласно пункту 1.821 статьи 37 C.F.R. и далее, которые раскрыты как бумажных и машиночитаемых носителях информации, и при этом раскрытия на данных бумажных и машиночитаемых носителях информации включены в данный документ по ссылке во всей своей полноте.

УРОВЕНЬ ТЕХНИКИ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

Область техники, к которой относится настоящее изобретение

[0004] Настоящее изобретение относится к антителам и их антигенсвязывающим фрагментам, а также к другим молекулам, которые способны иммуноспецифически связываться с контррецептором B7-H7, H7CR, и к их применению для лечения и диагностики злокачественных опухолей и других заболеваний.

Описание предшествующего уровня техники

[0005] Иммунная система людей и других млекопитающих отвечает за защиту против инфекции и заболевания. Такая защита обеспечивается гуморальным иммунным ответом и клеточно-опосредованным иммунным ответом. Гуморальный ответ приводит к индукции антител и других биомолекул, которые способны распознавать и нейтрализовать чужеродные мишени (антигены). В отличие от этого, клеточно-опосредованный иммунный ответ включает активацию макрофагов, природных киллеров (NK) и антиген-специфических цитотоксических T-лимфоцитов T-клетками, а также высвобождение различных цитокинов в ответ на распознавание антигена (Dong, C. et al. (2003) «Immune Regulation by Novel Costimulatory Molecules» Immunolog. Res. 28(1):39-48).

[0006] Способность T-клеток оптимально опосредовать иммунный ответ против антигена требует двух различных сигнальных взаимодействий (Viglietta, V. et al. (2007) «Modulating Co-Stimulation» Neurotherapeutics 4:666-675; Korman, A.J. et al. (2007) «Checkpoint Blockade in Cancer Immunotherapy» Adv. Immunol. 90:297-339). Во-первых, антиген, который был презентирован на поверхности антигенпрезентирующих клеток (APC) должен быть презентирован антиген-специфической наивной CD4+ T-клетке. Такая презентация доставляет сигнал с помощью Т-клеточного рецептора (TCR), который направляет T-клетку на инициацию иммунного ответа, который будет специфическим относительно презентированного антигена. Во-вторых, ряд костимулирующих и ингибирующих сигналов, опосредованных взаимодействиями между APC и отличающимися молекулами Т-клеточной поверхности, сначала запускает активацию и пролиферацию Т-клеток и в конечном итоге их ингибирование. Таким образом, первый сигнал придает специфичность в отношении иммунного ответа, в то время как второй сигнал служит для определения природы, величины и продолжительности ответа.

[0007] Иммунная система жестко контролируется костимулирующими и коингибирующими лигандами и рецепторами. Эти молекулы обеспечивают второй сигнал для активации Т-клеток и обеспечивают сбалансированную совокупность положительных и отрицательных сигналов для максимального увеличения ответов против инфекции при ограничении иммунитета организма в отношении самого себя (Wang, L. et al. (March 7, 2011) «VISTA, A Novel Mouse Ig Superfamily Ligand That Negatively Regulates T Cell Responses» J. Exp. Med. 10.1084/jem.20100619:1-16; Lepenies, B. et al. (2008) «The Role Of Negative Costimulators During Parasitic Infections» Endocrine, Metabolic & Immune Disorders - Drug Targets 8:279-288). Особенно важным является связывание между лигандами B7.1 (CD80) и B7.2 (CD86) антигенпрезентирующей клетки и рецепторами CD28 и CLTA-4 CD4+ T-лимфоцита (Sharpe, A.H. et al. (2002) «The B7-CD28 Superfamily» Nature Rev. Immunol. 2:116-126; Dong, C. et al. (2003) «Immune Regulation by Novel Costimulatory Molecules» Immunolog. Res. 28(1):39-48; Lindley, P.S. et al. (2009) «The Clinical Utility Of Inhibiting CD28-Mediated Costimulation» Immunol. Rev. 229:307-321). Связывание B7.1 или B7.2 с CD28 стимулирует активацию Т-клеток, а связывание B7.1 или B7.2 с CTLA4 ингибирует такую активацию (Dong, C. et al. (2003) «Immune Regulation by Novel Costimulatory Molecules» Immunolog. Res. 28(1):39-48; Lindley, P.S. et al. (2009) «The Clinical Utility Of Inhibiting CD28-Mediated Costimulation» Immunol. Rev. 229:307-321; Greenwald, R.J. et al. (2005) «The B7 Family Revisited» Ann. Rev. Immunol. 23:515-548). CD28 конститутивно экспрессируется на поверхности Т-клеток (Gross, J., et al. (1992) «Identification And Distribution Of The Costimulatory Receptor CD28 In The Mouse» J. Immunol. 149:380-388), в то время как экспрессия CTLA4 быстро активируется после активации Т-клеток (Linsley, P. et al. (1996) «Intracellular Trafficking Of CTLA4 And Focal Localization Towards Sites Of TCR Engagement» Immunity 4:535-543). Поскольку CTLA4 представляет собой рецептор с более высокой аффинностью (Sharpe, A.H. et al. (2002) «The B7-CD28 Superfamily» Nature Rev. Immunol. 2:116-126), то связывание сначала инициирует пролиферацию T-клеток (посредством CD28), а затем ингибирует ее (посредством начинающейся экспрессии CTLA4), таким образом ослабляя влияние в случае, когда пролиферация больше не требуется.

[0008] Дальнейшие исследования лигандов рецептора CD28 привели к идентификации и описанию характеристик ряда родственных молекул B7 («суперсемейство B7») (Coyle, A.J. et al. (2001) «The Expanding B7 Superfamily: Increasing Complexity In Costimulatory Signals Regulating T Cell Function» Nature Immunol. 2(3):203-209; Sharpe, A.H. et al. (2002) «The B7-CD28 Superfamily» Nature Rev. Immunol. 2:116-126; Greenwald, R.J. et al. (2005) «The B7 Family Revisited» Ann. Rev. Immunol. 23:515-548; Collins, M. et al. (2005) «The B7 Family Of Immune-Regulatory Ligands» Genome Biol. 6:223.1-223.7; Loke, P. et al. (2004) «Emerging Mechanisms Of Immune Regulation: The Extended B7 Family And Regulatory T Cells» Arthritis Res. Ther. 6:208-214; Korman, A.J. et al. (2007) «Checkpoint Blockade in Cancer Immunotherapy» Adv. Immunol. 90:297-339; Flies, D.B. et al. (2007) «The New B7s: Playing a Pivotal Role in Tumor Immunity» J. Immunother. 30(3):251-260; Agarwal, A. et al. (2008) «The Role Of Positive Costimulatory Molecules In Transplantation And Tolerance» Curr. Opin. Organ Transplant. 13:366-372; Lenschow, D.J. et al. (1996) «CD28/B7 System of T Cell Costimulation» Ann. Rev. Immunol. 14:233-258; Wang, S. et al. (2004) «Co-Signaling Molecules Of The B7-CD28 Family In Positive And Negative Regulation Of T Lymphocyte Responses» Microbes Infect. 6:759-766). В настоящее время известно восемь членов семейства: B7.1 (CD80), B7.2 (CD86), индуцибельный костимулирующий лиганд (ICOS-L), лиганд программируемой смерти 1 (PD-L1; B7-H1), лиганд программируемой смерти 2 (PD-L2; B7-DC), B7-H3, B7-H4 (также называемые B7x и B7S1; Sica, G.L. et al. (2003) «B7-4, A Molecule Of The B7 Family, Negatively Regulates T Cell Immunity» Immunity18:849-861; Zang, X. et al. (2003) «B7x: A Widely Expressed B7 Family Member That Inhibits T Cell Activation» Proc. Natl. Acad. Sci. (USA) 100:10388-10392; Prasad, D.V. et al. (2003) «B7S1, A Novel B7 Family Member That Negatively Regulates T Cell Activation» Immunity 18:863-873), B7-H6 (Collins, M. et al. (2005) «The B7 Family Of Immune-Regulatory Ligands» Genome Biol. 6:223.1-223.7) и B7-H7 (Flajnik, M.F. et al. (2012) «Evolution Of The B7 Family: Co-Evolution Of B7H6 And Nkp30, Identification Of A New B7 Family Member, B7H7, And Of B7's Historical Relationship With The MHC» Immunogenetics 64:571-590). Семейство генов B7 является основным в регуляции адаптивной иммунной системы. Большинство членов семейства B7 содержат домены вариабельного (V) и константного (C) типа суперсемейства иммуноглобулинов (IgSF).

[0009] Лиганды B7 экспрессируются на клеточной поверхности многих различных типов клеток, включая антигенпрезентирующие клетки (APC), и их взаимодействие с рецепторными молекулами на T-клетках обеспечивает активирующие и/или ингибирующие сигналы, которые регулируют активность и устойчивость Т-клеток (Collins, M. et al. (2005) «The B7 Family Of Immune-Regulatory Ligands» Genome Biol. 6:223,1-223,7). Некоторые ингибирующие лиганды B7 также экспрессируются на опухолевых клетках, приводя к подавлению иммунных ответов (Keir, M.E. et al. (2008) «PD-1 And Its Ligands In Tolerance And Immunity» Annu. Rev. Immunol. 26:677-704; Zou, W. et al. (2008) «Inhibitory B7-Family Molecules In The Tumour Microenvironment» Nat. Rev. Immunol. 8:467-477). Таким образом, стимулирование или ослабление взаимодействий лигандов B7 и их рецепторов имеет терапевтический потенциал для лечения аутоиммунных заболеваний и рака (WO 2011/020024; Flajnik, M.F. et al. (2012) «Evolution Of The B7 Family: Co-Evolution Of B7H6 And Nkp30, Identification Of A New B7 Family Member, B7H7, And Of B7's Historical Relationship With The MHC» Immunogenetics 64:571-590).

[0010] Несмотря на все предшествующие успехи в лечении воспаления или рака, сохраняется необходимость в композициях, способных обеспечить усиленную иммунотерапию для лечения таких состояний.

[0011] Целью настоящего изобретения являются композиции, способные обеспечить усиленную иммунотерапию для лечения рака, инфекционного заболевания, воспаления и других заболеваний и состояний.

КРАТКОЕ ОПИСАНИЕ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

[0012] Изобретение относится к антителам и к их антигенсвязывающим фрагментам и другим молекулам, которые способны иммуноспецифически связываться с контррецептором B7-H7, H7CR. Контррецептор B7-H7 также известен как B7-H7CR и CD28H (Yhu, et al., Nature Communications, 4:1-12 (2013)). Также изобретение относится к способам их применения для лечения и диагностики злокачественных опухолей, инфекционного заболевания, воспаления и других заболеваний и состояний. H7CR-связывающие молекулы могут представлять собой моноклональное антитело, антитело человека, химерное антитело или гуманизированное антитело.

[0013] Один из вариантов осуществления относится к H7CR-связывающим молекулам, в которых антигенсвязывающий фрагмент включает шесть CDR, где CDR включают по меньшей мере один CDR из CDR антител к H7CR: 1.3, 4.5 и 7.8 или их консенсусный CDR, причем все остальные CDR, выбраны из:

(A) трех CDR легкой цепи и трех СDR тяжелой цепи антитела 1.3 против H7CR;

(A) трех CDR легкой цепи и трех СDR тяжелой цепи антитела 4.5 против H7CR или

(A) трех CDR легкой цепи и трех СDR тяжелой цепи антитела 7.8 против H7CR.

[0014] Другой вариант осуществления относится к H7CR-связывающим молекулам, в которых шесть CDR представляют собой:

(A) три СDR легкой цепи и три СDR тяжелой цепи антитела 1.3 против H7CR;

(A) три СDR легкой цепи и три СDR тяжелой цепи антитела 4.5 против H7CR или

(A) три СDR легкой цепи и три СDR тяжелой цепи антитела 7.8 к H7CR.

[0015] Еще один вариант осуществления относится к H7CR-связывающим молекулам, имеющим антигенсвязывающий фрагмент гуманизированного варианта антитела 1.3 или 4.5 против H7CR человека, где молекула иммуноспецифически связывается с H7CR человека, и где антигенсвязывающий фрагмент содержит:

(A) (1) вариабельный участок легкой цепи гуманизированного варианта антитела 1.3 против H7CR человека, где указанный вариабельный участок легкой цепи имеет аминокислотную последовательность с любой последовательностью SEQ ID NO:17-22; и

(2) вариабельный участок тяжелой цепи гуманизированного варианта антитела 1.3 против H7CR человека, где указанный вариабельный участок тяжелой цепи имеет аминокислотную последовательность с любой последовательностью SEQ ID NO:23-28;

или

(В) (1) вариабельный участок легкой цепи гуманизированного варианта антитела 4.5 против H7CR человека, где указанный вариабельный участок легкой цепи имеет аминокислотную последовательность с любой последовательностью SEQ ID NO:33-38; и

(2) вариабельный участок тяжелой цепи гуманизированного варианта антитела 4.5 против H7CR человека, где указанный вариабельный участок тяжелой цепи имеет аминокислотную последовательность с любой последовательностью SEQ ID NO:39-44.

[0016] Предпочтительный вариант осуществления относится к варианту осуществления, где указанная H7CR-связывающая молекула иммуноспецифически связывается с H7CR, который:

(A) расположен на поверхности живой клетки или

(B) экспрессируется в эндогенной концентрации.

[0017] В одном из вариантов осуществления живая клетка представляет собой Т-клетку, NK-клетку или плазмацитоидную дендритную клетку.

[0018] В еще одном варианте осуществления молекула практически неспособна блокировать взаимодействие H7CR с B7-H7.

[0019] В другом варианте осуществления молекула способна связываться с H7CR и выступать в роли агониста активности H7CR.

[0020] Любое антитело может быть биспецифическим, триспецифическим или мультиспецифическим антителом. Молекула может иметь детектируемую метку или может содержать конъюгированный токсин, лекарственное средство, рецептор, фермент, лиганд рецептора или их комбинацию.

[0021] Другой вариант осуществления предполагает фармацевтическую композицию, содержащую терапевтически эффективное количество любых из вышеупомянутых молекул и физиологически приемлемый носитель или вспомогательное вещество.

[0022] Раскрытые композиции могут использоваться для лечения заболевания у индивида, проявляющего симптом заболевания, путем введения индивиду терапевтически эффективного количества любой из вышеупомянутых фармацевтических композиций для активации пути B7-H7 и стимуляции иммунного ответа. Конкретные показания к лечению включают, но или не ограничиваются, рак, инфекционное заболевание, хроническое вирусное заболевание, воспалительное состояние или аутоиммунное заболевание.

[0023] Также изобретение относится к способу лечения заболевания, где фармацевтическая композиция выступает в роли агониста функции H7CR.

[0024] Способы профилактического лечения заболевания включают введение индивиду профилактически эффективного количества любой из вышеуказанных фармацевтических композиций до проявления симптома заболевания.

[0025] Способы диагностики заболевания (особенно рака или заболевания, влияющего на количество и эффективность T-клеток) у индивида включают анализ клеток индивида в отношении их способности связываться с любой указанной H7CR-связывающей молекулой, где способ включает цитологический анализ для диагностики иммунологической реактивности или наличия заболевания у индивида.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[0026] На фигуре 1 представлена схема структуры, набор параметров экспрессии и взаимодействие между H7CR и B7-H7 на отдельных клетках.

[0027] На фигуре 2 представлена линейная диаграмма медианной интенсивности флуоресценции в зависимости от log [Ab] (нМ), показывающий соответствующие значения связывающей способности антител 1.3 к H7CR (Kd = 5,9 нМ) и 4,5 (Kd = 3,5 нМ) с трансфектантами H7CR CHO.

[0028] На фигурах 3A и 3B представлены линейные диаграммы медианной интенсивности флуоресценции в зависимости от log [Ab] (нМ), показывающие кривые связывания mAb к H7CR с наивными (CD45RA+) CD4 и CD8 T-клетками человека из PBMC (фигура 3B).

[0029] На фигурах 4(A)-4(C) представлены гистограммы данных проточной цитометрии, показывающие способность антител 1.3, 4.5 и 7.8 связываться с H7CR человека, экспрессируемыми на поверхности трансфектантов CHO. Данные представлены в виде количества импульсов от клеток в зависимости от логарифма флуоресценции Comp PE-A. Левый пик в каждой секции представляет антитело изотипического контроля, правый пик представляет антитело H7CR.

[0030] На фигурах 5A-5D представлены гистограммы данных проточной цитометрии, показывающие, что слитый белок B7-H7 Ig связывается с трансфектантом H7CR CHO. Данные представлены в виде количества импульсов от клеток в зависимости от логарифма флуоресценции Comp APC-A. Было обнаружено, что предварительная инкубация антител 1.3 (фигура 5B), 4.5 (фигура 5C) и 7.8 (фигура 5D) с трансфектантами H7CR в каждом случае была практически неспособна блокировать взаимодействие H7CR с B7-H7.

[0031] На фигуре 6 представлена микрофотография, показывающая способность антитела против H7CR человека (H7CR 4.5) связываться с H7CR, который эндогенно экспрессируется на поверхности ткани миндалин человека.

[0032] На фигуре 7 (секции A-C) представлены диаграммы рассеяния на основе данных проточной цитометрии, показывающие, что экспрессия H7CR в T- и NK-клетках была связана с фенотипом наивных Т-клеток. На секции A представлены диаграммы рассеяния от четырех доноров, показывающих экспрессию H7CR на CD3+ T-клетках относительно экспрессии у них CD45RO. На диаграммах рассеяния представлена флуоресценция антитела к H7-CR в зависимости от флуоресценции антитела к CD45RO. На секции B представлена диаграмма рассеяния, показывающая гейтирование T-клеток и NK-клеток на основе экспрессии маркеров CD3 и CD16. На диаграммах рассеяния представлена флуоресценция антитела к CD3 в зависимости от флуоресценции антитела к CD16. На секции С представлены диаграммы рассеяния от четырех доноров, показывающих экспрессию H7CR на CD16+ NK-клетках относительно экспрессии у них CD45RO. На диаграммах рассеяния представлена флуоресценция антитела к H7-CR в зависимости от флуоресценции антитела к CD45RO.

[0033] На фигурах 8A-8H представлены диаграммы рассеяния профилей экспрессии H7CR и B7-H7 в PMBC у четырех здоровых доноров (донор 1, фигуры 8A и 8B; донор 2, фигуры 8C и 8D; донор 3 (фигура 8E и фигура 8F) и донор 4 (фигура 8G и фигура 8H)). На фигурах 8A, 8C, 8E и 8G представлены диаграммы рассеяния логарифма флуоресценции с применением антитела 1.3 в зависимости от логарифма флуоресценции с применением антитела к CD3. На фигурах 8B, 8D, 8F и 8H представлены диаграммы рассеяния логарифма флуоресценции с применением антитела 2D3 к B7H7 в зависимости от антитела к CD14. У всех доноров показана экспрессия H7CR на CD3 T-клетке при минимальной экспрессии B7-H7 в PBMC.

[0034] На фигурах 9A-9H представлены диаграммы рассеяния профилей экспрессии H7CR и B7-H7 в PMBC у четырех здоровых доноров (донор 1, фигуры 9A и 9B; донор 2, фигуры 9C и 9D; донор 3, фигуры 9E и 9F, и донор 4, фигуры 9G и 9H). На фигурах 9A, 9C, 9E и 9G представлены диаграммы рассеяния флуоресценции с применением антитела 1.3 в зависимости от антитела к CD3. На фигурах 9B, 98D, 9F и 9H представлены диаграммы рассеяния флуоресценции с применением антитела 2D3 к B7H7 в зависимости от антитела к CD14. У доноров 2, 3, 4 показана экспрессия H7CR на CD3 T-клетках при минимальной экспрессии B7-H7 в PBMC. У донора 1 показан высокий уровень экспрессии B7-H7 на CD14+ моноцитах и низкий уровень экспрессии H7CR на CD3 T-клетках.

[0035] На фигурах 10A-10D представлены гистограммы на основе данных проточной цитометрии, показывающие экспрессию H7CR и B7-H7 моноцитами человека (10A, 10F, 10K, 10P, 10U и 10Z), CD8+ CD3+ лимфоцитами (10B, 10G, 10L, 10Q, 10V, 10AA), CD8- CD3+ лимфоцитами (10C, 10H, 10M, 10R, 10W и 10AB), CD16+ NK-клетками (10D, 10I, 10N, 10S, 10X и 10AC) и CD3- CD8- клетками. (10E, 10J, 10O, 10T, 10Y и 10AD). Антитела 18C3 (10A-10E) и 2D3 (10F-10J) представляют собой моноклональные антитела к B7-H7. На фигурах 10K-10O применяется антитело к PD-1. На фигурах 10P-T применяется антитело 1.3. На фигурах 10U-Y применяется антитело 4.5. На фигурах 10Z-AD применяется антитело 7.8.

[0036] На фигурах 11A-11D представлены гистограммы на основе данных проточной цитометрии, показывающие экспрессию H7CR и B7-H7 моноцитами яванского макака (11A, 11F, 11K, 11P, 11U и 11Z), CD8+ CD3+ лимфоцитами (11B, 11 G, 11L, 11Q, 11V, 11AA), CD8- CD3+ лимфоцитами (11C, 11H, 11M, 11R, 11W и 11AB), CD16+ NK-клетками (11D, 11I, 11N, 11S, 11X и 11AC) и CD3- CD8- клетками (11E, 11J, 11O, 11T, 11Y и 11AD). Антитела 18C3 (фигуры 10A-10E) и 2D3 (фигуры 10F-10J) представляют собой моноклональные антитела к B7-H7. На фигурах 10K-10O применяется антитело к PD-1. На фигурах 10P-T применяется антитело 1.3. На фигурах 10U-Y применяется антитело 4.5. На фигурах 10Z-AD применяется антитело 7.8.

[0037] На фигурах 12A-12K представлены гистограммы на основе данных проточной цитометрии для in vitro анализа экспрессии B7-H7 и других маркеров активации созревшими происходящими из моноцитов дендритными клетками. На фигуре 12A представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-FITC-A с применением антитела к HLA-ABC. На фигуре 12B представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PE-A с применением антитела к B7-H1. На фигуре 12С представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PerCP-Cy5-5-A с применением антитела к HLA-DR. На фигуре 12D представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PE-Cy7-A с применением антитела к CD40. На фигуре 12Е представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-APC-A с применением антитела к CD86. На фигуре 12F представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PacificBlue-A с применением антитела к CD83. На фигуре 12G представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-FITC-A с применением антитела к CD80. На фигуре 12H представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PE-A с применением антитела к B7-DC. На фигуре 12I представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PacificBlue-A с применением антитела к CD54. На фигуре 12J представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-PerCP-Cy5-5A с применением антитела к B7-H7. На фигуре 12K представлена гистограмма количества импульсов в зависимости от логарифма флуоресценции Comp-APC-A с применением антитела к CCR7. Сплошная серая линия представляет изотипический контроль. Пунктирная линия представляет незрелые дендритные клетки. Точечная линия представляет клетки, обработанные в течение одного дня TNFα и PGE2. Сплошная черная линия представляет клетки, обработанные в течение двух дней 1 нг/мл TNFa и 1 мкг/мл PGE2.

[0038] На фигуре 13 представлен линейный график процента поделившихся клеток (низкая интенсивность окрашивания CFSE) в зависимости от времени в днях для Ctl Ig (■), H7CR1.3 (•), H7CR4.5 (▲), H7CR7.8 (♦) и только T-клеток (—), и показано, что антитела к H7CR активируют специфические ответы Т-клеток на модельный антиген-столбнячный анатоксин.

[0039] На фигурах 14A-14L представлены столбиковые диаграммы, которые показывают природу и уровни цитокинов, экспрессируемых клетками, подвергнутыми стимуляции белком столбнячного анатоксина и обработке антителом H7CR или контрольным антителом. На фигуре 14A представлена столбиковая диаграмма экспрессирующих IFN-γ (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14B представлена столбиковая диаграмма экспрессирующих IL-5 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14D представлена столбиковая диаграмма экспрессирующих IL-13 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14Е представлена столбиковая диаграмма экспрессирующих GM-CSF (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14F представлена столбиковая диаграмма экспрессирующих IL-10 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14G представлена столбиковая диаграмма экспрессирующих IL-6 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14H представлена столбиковая диаграмма экспрессирующих IL-12p70 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14I представлена столбиковая диаграмма экспрессирующих MCP-1 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14J представлена столбиковая диаграмма экспрессирующих IL-17 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14K представлена столбиковая диаграмма экспрессирующих MIP-1β (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток. На фигуре 14L представлена столбиковая диаграмма экспрессирующих IL-8 (пг/нл) клеток, обработанных CtlIg, H7CR1.3, H7CR4.5, H7CR7.8, или только T-клеток.

[0040] На фигурах 15A и 15B представлены диаграммы рассеяния на основе данных проточной цитометрии, которые показывают, что обработка антителами к H7CR усиливала пролиферацию и внутриклеточную экспрессию IFNγ в антиген-специфических T-клетках. На фигуре 15A представлена диаграмма рассеяния логарифма флуоресценции Comp-PerCP-Cy5-5-A::IFNg в зависимости от Comp-FITC::CFSE с применением CtlIg. На фигуре 15B представлена диаграмма рассеяния логарифма флуоресценции Comp-PerCP-Cy5-5-A::IFNg в зависимости от Comp-FITC::CFSE.

[0041] На фигурах 16A-16B представлены столбиковые диаграммы, которые показывают влияния антител к H7CR на ответы Т-клеток человека. На фигуре 16A представлена столбиковая диаграмма поделившихся CD4+ T-клеток (%), которая показывает, что антитела к CD28H (закрашенный прямоугольник) опосредуют сильно увеличенную пролиферацию T-клеток в отсутствие CTLA4-Ig. На фигуре 16B показано, что антитела к CD28H (закрашенный прямоугольник) опосредуют повышение экспрессии цитокинов. Фигура 16B включает секцию A, на которой представлена столбиковая диаграмма для IFN-γ в пг/мл из T-клеток, обработанных контролем (незакрашеный прямоугольник) или антителом к CD28H (закрашенный прямоугольник). На секции B представлена столбиковая диаграмма в пг/мл для следующих цитокинов (закрашенный прямоугольник) слева направо: IL-5, IL-10, TNF-α, IL-17, контроль (незакрашеный прямоугольник).

[0042] На фигурах 17A-17B представлены двухмерные изображения в виде бусин в бусах (2D Collier Perles) вариабельных доменов легкой цепи (фигура 17A) и тяжелой цепи (фигура 17B) антитела 1.3. Петли трех CDR представлены наверху схем. Заштрихованные кружки представляют собой пропущенные остатки для этого mAb. Представленные в квадратиках аминокислоты представляют собой консервативные аминокислоты в этом положении.

[0043] На фигурах 18A-18B представлены двухмерные изображения в виде бусин в бусах (2D Collier Perles) вариабельных доменов легкой цепи (фигура 18A) и тяжелой цепи (фигура 18B) антитела 4.5. Петли трех CDR представлены наверху схем. Заштрихованные кружки представляют собой пропущенные остатки для этого mAb. Представленные в квадратиках аминокислоты представляют собой консервативные аминокислоты в этом положении.

[0044] На фигурах 19A-D представлены гистограммы полученного с помощью проточной цитометрии количества клеток в зависимости от CFSE, показывающие, что антитело 1.3 приводит к наращиванию числа CD4+ и CD8+ клетки человека in vivo. На фигурах 19A и 19C представлены контроли, показывающие количество клеток в зависимости от логарифма флуоресценции контрольного антитела. На фигуре 19B представлено количество CD4+ клеток в зависимости от логарифма флуоресценции с применением антитела 1.3 к H7CR. На фигуре 19D представлено количество CD4+ клеток в зависимости от логарифма флуоресценции с применением антитела 1.3 к H7CR. В качестве контрольного антитела использовали изотипический контроль из IgG хомяка (Biolegend).

[0045] На фигурах 20A-H представлены диаграммы рассеяния на основе данных проточной цитометрии, показывающие увеличение числа клеток, экспрессирующих CD40L, IFNγ и CD107a у NGS мышей, которым вводили инъекцией антитело 1.3. На фигуре 20A показан логарифм флуоресценции антитела к CD40L в зависимости от логарифма флуоресценции антитела к CD3 у необработанных CD4+ клеток. На фигуре 20B показан логарифм флуоресценции антитела к CD40L в зависимости от логарифма флуоресценции антитела к CD3 у CD4+ клеток, обработанных антителом 1.3 к H7CR. На фигуре 20С показан логарифм флуоресценции антитела к IFNγ в зависимости от логарифма флуоресценции антитела к CD3 у необработанных CD4+ клеток. На фигуре 20D показан логарифм флуоресценции антитела к IFNγ в зависимости от логарифма флуоресценции H у CD4+ клеток, обработанных антителом к H7CR. На фигуре 20Е показан логарифм флуоресценции антитела к CD107a в зависимости от логарифма флуоресценции антитела к CD3 у необработанных CD8+ клеток. На фигуре 20F показан логарифм флуоресценции антитела к CD107a в зависимости от логарифма флуоресценции антитела к CD3 у CD8+ клеток, обработанных антителом 1.3 к H7CR. На фигуре 20G показан логарифм флуоресценции антитела к IFNγ в зависимости от логарифма флуоресценции антитела к CD3 у необработанных CD8+ клеток. На фигуре 20Н показан логарифм флуоресценции антитела к IFNγ в зависимости от логарифма флуоресценции H у CD8+ клеток, обработанных антителом к H7CR.

[0046] На фигуре 21A представлена точечная диаграмма количества IFN-γ (пг/мл) в покоящихся PMBC человека, стимулируемых (слева направо) химерным мышиным антителом к H7CR (1.3), отрицательным контролем (Ctl Ig), OKT3, OKT3 +CD28, иммобилизированным химерным мышиным антителом к H7CR (1.3), иммобилизированным отрицательным контролем и иммобилизированным OKT3. На фигуре 21B представлена точечная диаграмма количества IFN-γ в активированных PMBC, стимулируемых (слева направо) химерным мышиным антителом к H7CR (1.3), отрицательным контролем (Ctl Ig), OKT3, OKT3 +CD28, иммобилизированным химерным мышиным антителом к H7CR (1.3), иммобилизированным отрицательным контролем и иммобилизированным OKT3. На фигуре 21B представлена точечная диаграмма количества IFN-γ в активированных PMBC, стимулируемых (слева направо) химерным мышиным антителом к H7CR (1.3), отрицательным контролем (Ctl Ig), OKT3, OKT3 +CD28, иммобилизированным химерным мышиным антителом к H7CR мыши (1.3), иммобилизированным отрицательным контролем и иммобилизированным OKT3 в концентрации 10 мкг/мл в течение ночи.

[0047] На фигуре 22 представлена столбиковая диаграмма процента разведенных в CFSE Т-клеток для происходящих из моноцитов дендритных клеток, созревающих под действием 1 нг/мл TNFα и 1 мкг/мл PGE2 в течение двух дней. Дендритные клетки инкубировали с мечеными CFSE аутологичными Т-клетками в течение двух недель в присутствии 100 нг/мл столбнячного анатоксина. Клетки обрабатывали (слева направо) 10 мкг/мл растворимого контрольного IgG4, химерным мышиным антителом к H7CR (1.3) и вариантами V1-V14 (см. таблицу 10).

[0048] На фигуре 23 представлен ряд диаграмм рассеяния на основе данных проточной цитометрии для тридцати шести гуманизированных H7CR4.5 с отмеченными тяжелыми и легкими цепями. Тридцать шесть вариантов инкубировали с трансфицированными слитым белком H7CR-GFP клетками CHO и окрашивали вторичным антителом к Ig человека. На оси X показана экспрессия H7CR-GFP, а на оси Y показано связывание вариантов с трансфектантами.

ПОДРОБНОЕ ОПИСАНИЕ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

[0049] Изобретение относится к антителам, гуманизированным вариантам антител и к их антигенсвязывающим фрагментам, а также к другим молекулам, которые способны иммуноспецифически связываться с контррецептором B7-H7, H7CR (также известным как B7-H7CR и CD28H), и их применения в лечении и диагностике рака и других заболеваний.

[0050] B7-H7 экспрессируется на антигенпрезентирующих клетках; он конститутивно экспрессируется на макрофагах и является индуцируемым на дендритных клетках. Для стимуляции иммунной системы и иммунных ответов B7-H7 взаимодействует с контррецептором (H7CR) (фигура 1). H7CR особенно экспрессируется на наивных T-клетках, NK-клетках и плазмацитоидных дендритных клетках (особенно в селезенке, лимфатических узлах и тимусе), а его экспрессия подвергается понижающей регуляции на созревших или активированных клетках. Такая понижающая регуляция экспрессии H7CR ослабляет выживаемость активированных Т-клеток/Т-клеток памяти in vivo и приводит к возврату иммунной системы к состоянию покоя у нормальных индивидов. Таким образом, взаимодействие между B7-H7 и H7CR является важным для примирования наивных Т-клеток и выживания активированных Т-клеток/Т-клеток памяти in vivo. Тем не менее, также было отмечено, что экспрессия H7CR подвергается понижающей регуляции в подверженных хроническому воздействию антигенов/истощенных Т-клетках. Молекулы, такие как B7-H7 Ig и антитела к H7CR, которые способны к связыванию с H7CR, способны служить в качестве агонистов для пролиферации Т-клеток и выработки цитокинов. Такие молекулы полезны при лечении рака, инфекционного заболевания и заболеваний, характеризующихся недостаточным Т-клеточным ответом. С другой стороны, молекулы, такие как антитела к B7-H7 и H7CR Ig, которые способны к блокированию взаимодействия между B7-H7 и H7C R, способны служить в качестве антагонистов пролиферации Т-клеток и выработки цитокинов. Такие молекулы полезны при лечении воспаления и, в частности, аутоиммунного заболевания.

A. B7-H7

[0051] B7-H7 был открыт в результате поиска в базах данных Xenopus как ген, который проявлял значительную гомологию с B7-H4 Xenopus. Белок B7-H4 имеет 282 аминокислотных остатка, которые были классифицированы как имеющие аминоконцевой внеклеточный домен, большой гидрофобный трансмембранный домен и очень короткий внутриклеточный домен (состоящий только из 2 аминокислотных остатков). Подобно другим членам семейства B7, B7-H4 имеет пару Ig-подобных участков в своем внеклеточном домене. Белок B7-H4 имеет общую структуру трансмембранного белка типа I.

[0052] Было обнаружено, что аминокислотная последовательность B7-H7 подобна ранее описанному гену человека, HHLA2 (связанный с длинными концевыми повторами белок 2 эндогенного ретровируса человека H (HHLA2); Mager, D.L. et al. (1999) «Endogenous Retroviruses Provide The Primary Polyadenylation Signal For Two New Human Genes (HHLA2 And HHLA3» Genomics 59:255-263), функция которого была неизвестна (Flajnik, M.F. et al. (2012) «Evolution Of The B7 Family: Co-Evolution Of B7H6 And Nkp30, Identification Of A New B7 Family Member, B7H7, And Of B7's Historical Relationship With The MHC» Immunogenetics 64:571-590).

[0053] Было обнаружено, что последовательность B7-H7 человека имеет гомологи у курицы, опоссума, копытных млекопитающих (например, лошади, свиньи), лосося и акулы. Тем не менее, у грызунов (мыши и крысы) к настоящему времени были идентифицированы только псевдогены. Аминокислотные последовательности таких генов проявляют подобные структуры доменов у всех видов с консервативностью канонических остатков доменов суперсемейства Ig.

[0054] Полипептид B7-H7 человека имеет длину 414 аминокислот, и было описано, что он содержит следующее: сигнальную последовательность, внеклеточный домен, 3 иммуноглобулин-подобных (Ig-подобных) домена, трансмембранный домен и цитоплазматический домен. В частности, было описано, что полипептид B7-H7 человека содержит Ig-подобный домен V-типа 1, Ig-подобный домен C-типа 1 и Ig-подобный домен V-типа 2. Существуют многочисленные встречающиеся в природе варианты B7-H7 (например, под номером доступа Q9UM44-1 (homo sapiens), NP_009003 (GI:5901964, homo sapiens) и AAD48396 (GI:15726285, homo sapiens); см. WO 2011/020024).

[0055] Выражение “нативный B7-H7” относится к любой встречающейся в природе аминокислотной последовательности B7-H7, включая незрелые формы или предшественники и зрелые формы. Зрелые формы B7-H7 включают белки B7-H7, которые подверглись посттрансляционной модификации, например, полипептиды B7-H7, которые имели отщепляемую сигнальную или лидерную аминокислотную последовательность. Аминокислотная последовательность иллюстративного B7-H7 человека под номером доступа Q9UM44-1 представляет собой (SEQ ID NO:1):

MKAQTALSFF LILITSLSGS QGIFPLAFFI YVPMNEQIVI GRLDEDIILP

SSFERGSEVV IHWKYQDSYK VHSYYKGSDH LESQDPRYAN RTSLFYNEIQ

NGNASLFFRR VSLLDEGIYT CYVGTAIQVI TNKVVLKVGV FLTPVMKYEK

RNTNSFLICS VLSVYPRPII TWKMDNTPIS ENNMEETGSL DSFSINSPLN

ITGSNSSYEC TIENSLLKQT WTGRWTMKDG LHKMQSEHVS LSCQPVNDYF

SPNQDFKVTW SRMKSGTFSV LAYYLSSSQN TIINESRFSW NKELINQSDF

SMNLMDLNLS DSGEYLCNIS SDEYTLLTIH TVHVEPSQET ASHNKGLWIL

VPSAILAAFL LIWSVKCCRA QLEARRSRHP ADGAQQERCC VPPGERCPSA

PDNGEENVPL SGKV

[0056] Описано, что по результатам анализа in silico B7-H7 человека содержит следующие предполагаемые домены: сигнальную последовательность в положениях аминокислотных остатков с 1 по 22 в SEQ ID NO:1, Ig-подобный домен V-типа 1 в положениях аминокислотных остатков с 61 по 131 в SEQ ID NO:1, Ig-подобный домен C-типа 1 в положениях аминокислотных остатков с 138 по 222 в SEQ ID NO:1, Ig-подобный домен V-типа 2 в положениях аминокислотных остатков с 235 по 328 в SEQ ID NO:1 и трансмембранный домен в положениях аминокислотных остатков с 345 по 365 в SEQ ID NO:1. Предполагаемая граница раздела в димере для полипептида B7-H7 человека представляет собой аминокислотные остатки 141-144, 156, 158, 160, 162, 193-196, 198, 200, 201, 224 и 225 в SEQ ID NO:1. Предполагаемые N-связанные сайты гликозилирования для полипептида B7-H7 человека расположены в положениях аминокислотных остатков 90, 103 и 318 в SEQ ID NO:1. Встречающиеся в природе варианты полипептида B7-H7 человека включают BOT, N344K и S346R (UniProt Q9UM44) (см. WO 2011/020024, упоминание которого включено в данный документ с помощью ссылки во всей своей полноте для объяснения структуры и последовательности B7-H7 человека).

[0057] Последовательность ДНК, кодирующая B7-H7 человека (SEQ ID NO:1) представляет собой (SEQ ID NO:2):

atgaaggcac agacagcact gtctttcttc ctcattctca taacatctct

gagtggatct caaggcatat tccctttggc tttcttcatt tatgttccta

tgaatgaaca aatcgtcatt ggaagacttg atgaagatat aattctccct

tcttcatttg agaggggatc cgaagtcgta atacactgga agtatcaaga

tagctataag gttcatagtt actacaaagg cagtgaccat ttggaaagcc

aagatcccag atatgcaaac aggacatccc ttttctataa tgagattcaa

aatgggaatg cgtcactatt tttcagaaga gtaagccttc tggacgaagg

aatttacacc tgctatgtag gaacagcaat tcaagtgatt acaaacaaag

tggtgctaaa ggtgggagtt tttctcacac ccgtgatgaa gtatgaaaag

aggaacacaa acagcttctt aatatgcagc gtgttaagtg tttatcctcg

tccaattatc acgtggaaaa tggacaacac acctatctct gaaaacaaca

tggaagaaac agggtctttg gattcttttt ctattaacag cccactgaat

attacaggat caaattcatc ttatgaatgt acaattgaaa attcactgct

gaagcaaaca tggacagggc gctggacgat gaaagatggc cttcataaaa

tgcaaagtga acacgtttca ctctcatgtc aacctgtaaa tgattatttt

tcaccaaacc aagacttcaa agttacttgg tccagaatga aaagtgggac

tttctctgtc ctggcttact atctgagctc ctcacaaaat acaattatca

atgaatcccg attctcatgg aacaaagagc tgataaacca gagtgacttc

tctatgaatt tgatggatct taatctttca gacagtgggg aatatttatg

caatatttct tcggatgaat atactttact taccatccac acagtgcatg

tagaaccgag ccaagaaaca gcttcccata acaaaggctt atggattttg

gtgccctctg cgattttggc agcttttctg ctgatttgga gcgtaaaatg

ttgcagagcc cagctagaag ccaggaggag cagacaccct gctgatggag

cccaacaaga aagatgttgt gtccctcctg gtgagcgctg tcccagtgca

cccgataatg gcgaagaaaa tgtgcctctt tcaggaaaag ta

[0058] В отличие от B7-H4 человека, который экспрессируется в различных местах, обнаружено, что B7-H7 человека проявляет более ограниченную экспрессию (например, экспрессируется в кишечнике, почках, легких, эпителиальных клетках и лимфоцитах). HHLA2 человека находится на хромосоме 3q13.33 возле B7.1 и B7.2. B7-H7 конститутивно экспрессируется на макрофагах и оказывает индуцирующее действие на дендритные клетки (DC).

B. H7CR

[0059] Применяемое в данном документе выражение «нативный H7CR» относится к любому встречающему в природе контррецептору B7-H7. H7CR также обозначается как B7-H7CR и CD28H. H7CR экспрессируется T-клетками, NK-клетками и плазмацитоидными дендритными клетками. В литературе/базах данных полипептид H7CR человека иначе обозначается как трансмембранный и содержащий домен 2 иммуноглобулина (TMIGD2) (Rahimi, N. et al. (Epub 2012 Mar 14) «Identification Of IGPR-1 As A Novel Adhesion Molecule Involved In Angiogenesis» Molec. Biol. Cell. 23(9):1646-1656), однако, функция B7-H7CR ранее не была установленной. Неограничивающие примеры номеров доступа для аминокислотной последовательности таких нативных молекул H7CR включают: Q96BF3-1 (homo sapiens), Q96BF3-2 (homo sapiens), NP_653216.1 (GI:21389429; homo sapiens) и NP_653216.2 (GI:281306838; homo sapiens). Иллюстративная аминокислотная последовательность (Q96BF3-2) нативной молекулы H7CR представлена ниже в виде SEQ ID NO:3:

MGSPGMVLGL LVQIWALQEA SSLSVQQGPN LLQVRQGSQA TLVCQVDQAT

AWERLRVKWT KDGAILCQPY ITNGSLSLGV CGPQGRLSWQ APSHLTLQLD

PVSLNHSGAY VCWAAVEIPE LEEAEGNITR LFVDPDDPTQ NRNRIASFPG

FLFVLLGVGS MGVAAIVWGA WFWGRRSCQQ RDSGNSPGNA FYSNVLYRPR

GAPKKSEDCS GEGKDQRGQS IYSTSFPQPA PRQPHLASRP CPSPRPCPSP

RPGHPVSMVR VSPRPSPTQQ PRPKGFPKVG EE

[0060] Последовательность ДНК, кодирующая H7CR человека (SEQ ID NO:3) представляет собой (SEQ ID NO:4):

atggggtccc cgggcatggt gctgggcctc ctggtgcaga tctgggccct

gcaagaagcc tcaagcctga gcgtgcagca ggggcccaac ttgctgcagg

tgaggcaggg cagtcaggcg accctggtct gccaggtgga ccaggccaca

gcctgggaac ggctccgtgt taagtggaca aaggatgggg ccatcctgtg

tcaaccgtac atcaccaacg gcagcctcag cctgggggtc tgcgggcccc

agggacggct ctcctggcag gcacccagcc atctcaccct gcagctggac

cctgtgagcc tcaaccacag cggggcgtac gtgtgctggg cggccgtaga

gattcctgag ttggaggagg ctgagggcaa cataacaagg ctctttgtgg

acccagatga ccccacacag aacagaaacc ggatcgcaag cttcccagga

ttcctcttcg tgctgctggg ggtgggaagc atgggtgtgg ctgcgatcgt

gtggggtgcc tggttctggg gccgccgcag ctgccagcaa agggactcag

gtaacagccc aggaaatgca ttctacagca acgtcctata ccggccccgg

ggggccccaa agaagagtga ggactgctct ggagagggga aggaccagag

gggccagagc atttattcaa cctccttccc gcaaccggcc ccccgccagc

cgcacctggc gtcaagaccc tgccccagcc cgagaccctg ccccagcccc

aggcccggcc accccgtctc tatggtcagg gtctctccta gaccaagccc

cacccagcag ccgaggccaa aagggttccc caaagtggga gaggag

C. Определения

[0061] Применяемая в данном документе молекула считается способной «иммуноспецифически связываться» со второй молекулой, если такое связывание проявляет специфичность и аффинность антитела к своему когнатному антигену. Считается, что антитела способны к «иммуноспецифическому связыванию» с целевым участком или конформацией («эпитопом») антигена (и, в частности, антигена H7CR), если такое связывание включает сайт распознавания антигена молекулы иммуноглобулина. Антитело, которое иммуноспецифически связывается с определенным антигеном, может связываться с другими антигенами с более низкой аффинностью, если другой антиген имеет некоторое сходство последовательности или конформационное сходство, то есть распознается сайтом распознавания антигена, что определяется, например, с помощью иммуноанализов, методик BIACORE® или других методов анализа, известных в данной области техники, однако, не будет связываться с абсолютно неродственным антигеном. Предпочтительно, однако, антитела (и их антигенсвязывающие фрагменты) не будут давать перекрестную реакцию с другими антигенами. Антитела также могут связываться с другими молекулами способом, который не является иммуноспецифическим, как например, с Fc-рецепторами (FcR), через связывающие домены в других участках/доменах молекулы, которые не включают сайт распознавания антигена, такой как Fc участок.

[0062] Предполагается, что выражение «практически», применяемое в контексте связывания или проявляемого эффекта, обозначает, что наблюдаемый эффект является физиологически или терапевтически значимым. Так, например, молекула способна практически блокировать активность H7CR, если степень блокирования является физиологически или терапевтически значимой (например, если такая степень составляет более 60% полной величины, более 70% полной величины, более 75% полной величины, более 80% полной величины, более 85% полной величины, более 90% полной величины, более 95% полной величины или более 97% полной величины). Аналогично, считается, что молекула имеет практически такую же иммуноспецифичность и/или характеристику, что и другая молекула, если такие иммуноспецифичности и характеристики являются более чем на 60% идентичными, более чем на 70% идентичными, более чем 75% идентичными, более чем на 80% идентичными, более чем на 85% идентичными, более чем на 90% идентичными, более чем на 95% идентичными или более чем на 97% идентичными.

[0063] Предполагается, что применяемое в данном документе выражение «субъект» обозначает млекопитающее, такое как млекопитающее, не относящиеся к приматам (например, коровы, свиньи, лошади, кошки, собаки, крысы и т.д.), и примат (например, обезьяна и человек), наиболее предпочтительно человек. Предполагается, что выражение «пациент» обозначает индивида, получающего раскрытую композицию с диагностической, терапевтической или профилактической целью.

[0064] Предполагается, что применяемое в данном документе выражение «антитело» обозначает молекулу иммуноглобулина, которая имеет сайт распознавания антигена «вариабельного участка». Предполагается, что выражение «вариабельный участок» отличает такой домен иммуноглобулина от доменов, которые, в целом, являются общими для антител (таких как Fc-домен антител). Вариабельный участок включает «гипервариабельный участок», остатки в котором отвечают за связывание с антигеном. Гипервариабельный участок включает аминокислотные остатки из «участка, определяющего комплементарность» или «CDR» (т.е. обычно остатки в положениях приблизительно 24-34 (L1), 50-56 (L2) и 89-97 (L3) в вариабельном домене легкой цепи и остатки в положениях приблизительно 27-35 (H1), 50-65 (H2) и 95-102 (H3) в вариабельном домене тяжелой цепи; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)), и/или такие остатки из «гипервариабельной петли» (т.е. остатки в положениях 26-32 (L1), 50-52 (L2) и 91-96 (L3) в вариабельном домене легкой цепи и 26-32 (H1), 53-55 (H2) и 96-101 (H3) в вариабельном домене тяжелой цепи; Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917). Остатки «каркасного участка» или «FR» остатки представляют собой такие остатки в вариабельном домене, которые отличаются от остатков в гипервариабельном участке, определенных в данном документе. Выражение «антитело» включает моноклональные антитела, мультиспецифические антитела, антитела человека, гуманизированные антитела, синтетические антитела, химерные антитела, камелизованные антитела (см., например, Muyldermans et al., 2001, Trends Biochem. Sci. 26:230; Nuttall et al., 2000, Cur. Pharm. Biotech. 1:253; Reichmann and Muyldermans, 1999, J. Immunol. Meth. 231:25; публикации международных заявок №№ WO 94/04678 и WO 94/25591; патент США №6005079), одноцепочечные Fv (scFv) (см., например, Pluckthun в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315 (1994)), одноцепочечные антитела, связанные дисульфидными связями Fv (sdFv), интраантитела и антиидиотипические (aнти-Id) антитела (включая, например, анти-Id и антитела к анти-Id, раскрытые в данном документе). В частности, такие антитела включают молекулы иммуноглобулинов любого типа (например, IgG, IgE, IgM, IgD, IgA и IgY), класса (например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2) или подкласса.

[0065] Применяемое в данном документе выражение «антигенсвязывающий фрагмент» антитела относится к одной или нескольким частям антитела, которые содержат участки, определяющие комплементарность («CDR»), и необязательно каркасные остатки, которые включают сайт распознавания антигена в «вариабельном участке» антитела и проявляют способность иммуноспецифически связываться с антигеном. Такие фрагменты включают Fab', F(ab')2, Fv, одноцепочечный фрагмент (ScFv) и их мутантные формы, встречающиеся в природе варианты и слитые белки, включающие сайт распознавания антигена в «вариабельном участке» антитела и гетерологический белок (например, токсин, сайт распознавания антигена для другого антигена, фермент, рецептор или лиганд рецептора и т.д.). Применяемое в данном документе выражение «фрагмент» относится к пептиду или полипептиду, включающему аминокислотную последовательность по меньшей мере из 5 смежных аминокислотных остатков, по меньшей мере из 10 смежных аминокислотных остатков, по меньшей мере из 15 смежных аминокислотных остатков, по меньшей мере из 20 смежных аминокислотных остатков, по меньшей мере из 25 смежных аминокислотных остатков, по меньшей мере из 40 смежных аминокислотных остатков, по меньшей мере из 50 смежных аминокислотных остатков, по меньшей мере из 60 смежных аминокислотных остатков, по меньшей мере из 70 смежных аминокислотных остатков, по меньшей мере из 80 смежных аминокислотных остатков, по меньшей мере из 90 смежных аминокислотных остатков, по меньшей мере из 100 смежных аминокислотных остатков, по меньшей мере из 125 смежных аминокислотных остатков, по меньшей мере из 150 смежных аминокислотных остатков, по меньшей мере из 175 смежных аминокислотных остатков, по меньшей мере из 200 смежных аминокислотных остатков или по меньшей мере из 250 смежных аминокислотных остатков.

[0066] Антитела человека, химерные или гуманизированные антитела являются особенно предпочтительными для применения in vivo у людей, однако, антитела мыши или антитела других видов могут успешно использоваться для многих применений (например, анализы для выявления in vitro или in situ, экстренное применение in vivo и т.д.). Полностью человеческие антитела особенно желательны для терапевтического лечения людей.

[0067] Антитела человека могут быть получены с помощью ряда способов, известных в уровне техники, включая способы фагового дисплея, описанные ранее, с использованием библиотек антител, полученных из последовательностей иммуноглобулинов человека (см. патенты США №№4444887 и 4716111; и публикации международных заявок №№ WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 и WO 91/10741). Антитела человека могут быть получены с использованием трансгенных мышей, которые неспособны к экспрессии функциональных эндогенных иммуноглобулинов, но которые могут экспрессировать гены иммуноглобулинов человека. Например, генные комплексы тяжелой и легкой цепей иммуноглобулинов человека могут быть введены случайным образом или с помощью гомологичной рекомбинации в эмбриональные стволовые клетки мыши. В качестве альтернативы, человеческие вариабельный участок, константный участок и участок разнообразия могут быть введены в эмбриональные стволовые клетки мыши в дополнение к генам тяжелой и легкой цепи человека. Гены тяжелой и легкой цепи иммуноглобулинов мыши можно сделать нефункциональными отдельно или одновременно с введением локусов иммуноглобулинов человека с помощью гомологичной рекомбинации. В частности, гомозиготная делеция участка JH предотвращает выработку эндогенных антител. Для получения химерных мышей модифицированные эмбриональные стволовые клетки разращивают и подвергают микроинъекции в бластоцисты. Затем химерных мышей скрещивают с получением гомозиготного потомства, которое экспрессирует антитела человека. Трансгенных мышей иммунизируют с помощью стандартных методик выбранным антигеном, например, всем полипептидом или его частью. Моноклональные антитела, направленные против антигена, могут быть получены из иммунизированных трансгенных мышей с помощью стандартной методики получения гибридом (см., например, патент США №5916771). Трансгены иммуноглобулинов человека, которые несут трансгенные мыши, перегруппировываются в ходе дифференцировки B-клеток, а затем подвергаются переключению класса и соматической мутации. Таким образом, с помощью такой методики возможно получить терапевтически полезные антитела IgG, IgA, IgM и IgE. Обзор этой технологии получения антител человека см. в Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93, который включен в данный документ с помощью ссылки во всей своей полноте). Подробное описание этой технологи получения антител человека и моноклональных антител человека, а также протоколы получения таких антител см., например, публикации международных заявок №№ WO 98/24893, WO 96/34096 и WO 96/33735 и патенты США №№5413923, 5625126, 5633425, 5569825, 5661016, 5545806, 5814318 и 5939598, которые включены в данный документ с помощью ссылки во всей своей полноте. Помимо этого, производством антител человека, направленных на выбранный антиген, могут заняться компании, такие как Abgenix, Inc. (Фримонт, Калифорния) и Medarex (Принстон, Нью-Джерси), с использованием технологии, подобной описанной выше.

[0068] “Химерное антитело” представляет собой молекулу, в которой различные части антитела получены из различных молекул иммуноглобулинов, такую как антитела, имеющие вариабельный участок, полученный из антитела, не являющегося человеческим, и константный участок иммуноглобулина человека. Способы получения химерных антител известны в уровне техники. См., например, Morrison, 1985, Science 229:1202; Oi et al., 1986, BioTechniques 4:214; Gillies et al., 1989, J. Immunol. Methods 125:191-202, и патенты США №№6311415, 5807715, 4816567 и 4816397. Химерные антитела, содержащие один или несколько CDR из не относящихся к человеку видов, и каркасные участки из молекулы иммуноглобулина человека, могут быть получены с помощью ряда методик, известных в уровне техники, включая, например, прививку CDR (EP 239400, публикация международной заявки №WO 91/09967 и патенты США №№5225539, 5530101 и 5585089), рекомбинацию поверхностных остатков (EP 592106, EP 519596; Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al., 1994, Protein Engineering 7:805, и Roguska et al., 1994, Proc. Natl. Acad. Sci. USA 91:969), и рекомбинацию целых полипептидных цепей (патент США №5565332).

[0069] В уровне техники известны «гуманизированные антитела» (см., например, европейские патенты №№EP 239400, EP 592106 и EP 519596; публикации международных заявок №№WO 91/09967 и WO 93/17105; патенты США №№5225539, 5530101, 5565332, 5585089, 5766886 и 6407213; и Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al., 1994, Protein Engineering 7(6):805-814; Roguska et al., 1994, PNAS 91:969-973; Tan et al., 2002, J. Immunol. 169:1119-1125; Caldas et al., 2000, Protein Eng. 13:353-360; Morea et al., 2000, Methods 20:267-79; Baca et al., 1997, J. Biol. Chem. 272:10678-10684; Roguska et al., 1996, Protein Eng. 9:895-904; Couto et al., 1995, Cancer Res. 55 (23 Supp):5973s-5977s; Couto et al., 1995, Cancer Res. 55:1717-22; Sandhu, 1994, Gene 150:409-10; Pedersen et al., 1994, J. Mol. Biol. 235:959-973; Jones et al., 1986, Nature 321:522-525; Reichmann et al., 1988, Nature 332:323-329; и Presta, 1992, Curr. Op. Struct. Biol. 2:593-596). Применяемое в данном документе выражение «гуманизированное антитело» относится к иммуноглобулину, включающему каркасный участок иммуноглобулина человека и один или несколько CDR иммуноглобулина, не являющегося человеческим (как правило, мышиного или крысиного). Не являющегося человеческим иммуноглобулин, предоставляющий CDR, называют «донорным», а иммуноглобулин человека, предоставляющий каркас, называется «акцепторным». Константные участки могут не присутствовать, однако, если они имеются, они должны быть практически идентичными константным участкам иммуноглобулинов человека, т.е. по меньшей мере приблизительно на 85-90%, предпочтительно приблизительно на 95% или более идентичными. Следовательно, все части гуманизированного иммуноглобулина, за исключением, возможно, CDR, практически идентичны соответствующим частям встречающихся в природе последовательностей иммуноглобулинов человека. Гуманизированное антитело представляет собой антитело, содержащее гуманизированную легкую цепь иммуноглобулина и гуманизированную тяжелую цепь иммуноглобулина. Например, гуманизированное антитело не будет охватывать типичное химерное антитело, поскольку, например, полный вариабельный участок химерного антитела не является человеческим. Донорное антитело было «гуманизировано» с помощью процесса «гуманизации», поскольку предполагается, что полученное в результате гуманизированное антитело связывается с тем же антигеном, что и донорное антитело, которое предоставляет CDR. В большинстве случаев гуманизированные антитела представляют собой иммуноглобулины человека (реципиентное антитело), в которых остатки в вариабельных участках реципиента заменены на остатки гипервариабельных участков из не относящихся к человеку видов (донорное антитело), таких как мышь, крыса, кролик или не относящий к человеку примат, имеющими желаемую специфичность, аффинность и активность. В некоторых случаях остатки в каркасном участке (FR) иммуноглобулина человека заменены на соответствующие остатки, не принадлежащие человеку. Более того, гуманизированные антитела могут включать остатки, которые не обнаруживаются в реципиентном антителе или в донорном антителе. Эти модификации осуществляют для дополнительного улучшения характеристик антител. Как правило, гуманизированное антитело будет включать практически все из по меньшей мере одного, а обычно двух вариабельных доменов, в которых все или практически все из гипервариабельных участков соответствуют таковым у иммуноглобулина, не являющегося человеческим, и все или практически все из FR являются таковыми из последовательности иммуноглобулина человека. Гуманизированное антитело необязательно будет также включать по меньшей мере часть константного участка иммуноглобулина (Fc), обычно участка иммуноглобулина человека, который иммуноспецифически связывается с полипептидом FcγRIIB, которая была изменена с помощью введения замен, делеций или добавлений аминокислотных остатков (т.e. мутаций).

[0070] Производные человеческих антител, химерных или гуманизированных антител к H7CR человека являются особенно предпочтительными для применения in vivo у людей, однако мышиные антитела или антитела других видов можно успешно использовать для многих применений (например, анализы для выявления in vitro или in situ, экстренное применение in vivo и т.д.). Такое антитело человека или гуманизированное антитело включает замены, делеции или добавления аминокислотных остатков в одном или нескольких CDR, не являющихся человеческими. Производное гуманизированного антитела может характеризоваться практически таким же связыванием, более сильным связыванием или более слабым связыванием по сравнению с гуманизированным антителом, не являющимся производным. В конкретных вариантах осуществления один, два, три, четыре или пять аминокислотных остатков в CDR были заменены, удалены или добавлены (т.e. мутированы). Полностью человеческие антитела особенно желательны для терапевтического лечения субъектов-людей.

[0071] Такие антитела человека могут быть получены с помощью ряда способов, известных в уровне техники, включая способы фагового дисплея с использованием библиотек антител, полученных из последовательностей иммуноглобулинов человека (см. патенты США №№ 4444887 и 4716111 и публикации международных заявок №№ WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 и WO 91/10741). Такие антитела человека могут быть получены с помощью трансгенных мышей, которые неспособны к экспрессии функциональных эндогенных иммуноглобулинов, но которые могут экспрессировать гены иммуноглобулинов человека. Например, генные комплексы тяжелой и легкой цепей иммуноглобулинов человека могут быть введены случайным образом или с помощью гомологичной рекомбинации в эмбриональные стволовые клетки мыши. В качестве альтернативы, человеческие вариабельный участок, константный участок и участок разнообразия могут быть введены в эмбриональные стволовые клетки мыши в дополнение к генам тяжелой и легкой цепи человека. Гены тяжелой и легкой цепей иммуноглобулинов мыши можно сделать нефункциональными отдельно или одновременно с введением локусов иммуноглобулинов человека с помощью гомологичной рекомбинации. В частности, гомозиготная делеция участка JH предотвращает выработку эндогенных антител. Для получения химерных мышей модифицированные эмбриональные стволовые клетки разращивают и подвергают микроинъекции в бластоцисты. Затем химерных мышей скрещивают для получения гомозиготного потомства, которое экспрессирует антитела человека. Трансгенных мышей иммунизируют с помощью стандартных методик выбранным антигеном, например, всем полипептидом или его частью. Моноклональные антитела, направленные против антигена, могут быть получены из иммунизированных трансгенных мышей с помощью стандартной методики получения гибридом (см., например, патент США №5916771). Трансгены иммуноглобулинов человека, которые несут трансгенные мыши, перегруппировываются в ходе дифференцировки B-клеток, а затем подвергаются переключению класса и соматической мутации. Таким образом, с помощью такой методики возможно получить терапевтически полезные антитела IgG, IgA, IgM и IgE. Обзор этой технологии получения антител человека см. в Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93, который включен в данный документ с помощью ссылки во всей своей полноте). Подробное описание этой технологи получения антител человека и моноклональных антител человека, а также протоколы получения таких антител см., например, публикации международных заявок №№ WO 98/24893, WO 96/34096 и WO 96/33735 и патенты США №№ 5413923, 5625126, 5633425, 5569825, 5661016, 5545806, 5814318 и 5939598, которые включены в данный документ с помощью ссылки во всей своей полноте. Помимо этого, производством антител человека, направленных на выбранный антиген, могут заняться компании, такие как Abgenix, Inc. (Фримонт, Калифорния) и Medarex (Принстон, Нью-Джерси), с использованием технологии, подобной описанной выше.

[0072] Антитела, применяемые в раскрытых способах, могут быть моноспецифическими. Также представляют интерес биспецифические антитела, триспецифические антитела или антитела с большей мультиспецифичностью, которые, помимо H7CR, проявляют специфичность к другим мишеням, таким как другие молекулы иммунной системы. Например, такие антитела могут связываться как с H7CR, так и с антигеном, который является важным для нацеливания антитела на конкретный тип клеток или тканей (например, на антиген, связанный с раковым антигеном в опухоли, подлежащей воздействию лечения). В другом варианте осуществления такое мультиспецифическое антитело связывается как с B7-H7, так и с H7CR, и таким образом, содействует образованию комплекса клеток, имеющих такие молекулы, таким образом выступая в роли агониста для T-клеточных ответов. Такие молекулы особенно полезны при лечении рака и инфекционного заболевания. В другом варианте осуществления для усиления иммуномодулирующих эффектов такое мультиспецифическое антитело связывается с молекулами (рецепторами или лигандами), включенными в альтернативные или дополнительные иммуномодулирующие пути, такими как CTLA4, TIM3, TIM4, OX40, CD40, GITR, 4-1-BB, B7-H4, LIGHT или LAG3. Также мультиспецифическое антитело может связываться с эффекторными молекулами, такими как цитокины (например, IL-7, IL-15, IL-12, IL-4 TGF-бета, IL-10, IL-17, IFNg, Flt3, BLys) и хемокины (например, CCL21), которые могут быть особенно уместными для модулирования острых и хронических иммунных ответов.

[0073] Последовательности ДНК, кодирующие предпочтительные акцепторные каркасные последовательности у человека включают без ограничений FR сегменты из сегментов VH1-18 и JH6 в человеческом гене VH иммуноглобулинов зародышевого типа и сегментов VK-A26 и JK4 в человеческом гене VL иммуноглобулинов зародышевого типа. В конкретном варианте осуществления один или несколько из CDR вводят в каркасные участки с помощью стандартных методик с использованием рекомбинантной ДНК. Каркасные участки могут быть встречающимися в природе или представлять собой консенсусные каркасные участки и, предпочтительно, каркасные участки человека (см., например, Chothia et al., 1998, «Structural Determinants In The Sequences Of Immunoglobulin Variable Domain» J. Mol. Biol. 278: 457-479, касательно перечня каркасных участков человека).

[0074] Раскрытое гуманизированное или химерное антитело может содержать практически все из по меньшей мере одного и обычно двух вариабельных доменов, в которых все или практически все из CDR участков соответствуют таковым у иммуноглобулина, не являющегося человеческим (т.e. донорного антитела), и все или практически все из каркасных участков являются таковыми из консенсусной последовательности иммуноглобулинов человека. Предпочтительно, антитело также включает по меньшей мере часть константного участка иммуноглобулина (Fc), обычно участка иммуноглобулина человека. Константные домены антител могут быть выбраны, исходя из предложенной функции антитела, в частности, эффекторной функции, которая может потребоваться. В некоторых вариантах осуществления константные домены антител представляют собой (или включают) домены IgA, IgD, IgE, IgG или IgM человека. В конкретном варианте осуществления применяются константные домены IgG человека, особенно изотипов IgG1 и IgG3, если гуманизированные антитела предполагается использовать для терапевтических применений и требуются эффекторные функции антител, такие как антителозависимая клеточно-опосредованная цитотоксическая (ADCC) и комплемент-зависимая цитотоксическая (CDC) активность. В альтернативных вариантах осуществления применяются изотипы IgG2 и IgG4, если антитело предполагается использовать для терапевтических применений и не требуется эффекторная функция антител. Константные домены Fc антител могут включать одну или несколько аминокислотных модификаций, которые изменяют эффекторные функции антител, как например, раскрытые в опубликованных заявках на патент США №№ 2005/0037000 и 2005/0064514.

[0075] В некоторых вариантах осуществления антитело содержит легкую цепь, а также по меньшей мере вариабельный домен тяжелой цепи. В других вариантах осуществления антитело может также включать один или несколько из CH1, шарнирных, CH2, CH3 и CH4 участков тяжелой цепи. Антитело можно выбрать из любого класса иммуноглобулинов, включая IgM, IgG, IgD, IgA и IgE, и любого изотипа, включая IgG1, IgG2, IgG3 и IgG4. В некоторых вариантах осуществления константный домен представляет собой фиксирующий комплемент константный домен в случае, когда предпочтительно, чтобы антитело проявляло цитотоксическую активность, и оно предпочтительно относится к классу IgG1. В других вариантах осуществления, где такая цитотоксическая активность не является предпочтительной, константный домен может относится к классу IgG2. Антитело может включать последовательности из более чем одного класса или изотипа, и выбор определенных константных доменов для оптимизации предпочтительных эффекторных функций находится в пределах компетенции специалиста в данной области техники.

[0076] В конкретном аспекте настоящее раскрытие предполагает вариант Fc, где Fc участок включает по меньшей мере одну модификацию (например, аминокислотные замены, аминокислотные вставки, аминокислотные делеции) в одном или нескольких положениях, выбранных из группы, состоящей из 228, 234, 235 и 331, согласно нумерации по EU-индексу, как изложено в Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Springfield, Va.). В одном аспекте модификация представляет собой по меньшей мере одну замену, выбранную из группы, состоящей из 228P, 234F, 235E, 235F, 235Y и 331S, согласно нумерации по EU-индексу, как изложено у Кэбота.

[0077] В другом конкретном аспекте настоящее раскрытие предполагает вариант Fc, где Fc участок представляет собой Fc участок IgG4 и включает по меньшей мере одну модификацию в одном или нескольких положениях, выбранных из группы, состоящей из 228 и 235, согласно нумерации по EU-индексу, как изложено у Кэбота. В еще одном конкретном аспекте настоящее раскрытие предполагает вариант Fc, где Fc участок представляет собой Fc участок IgG4 и включает по меньшей мере одну модификацию в одном или нескольких положениях, выбранных из группы, состоящей из 228 и 235, согласно нумерации по EU-индексу, как изложено у Кэбота.

[0078] В другом конкретном аспекте настоящее раскрытие предполагает вариант Fc, где Fc участок включает по меньшей мере одну не встречающуюся в природе аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 239, 330 и 332, согласно нумерации по EU-индексу, как изложено у Кэбота. В одном аспекте модификация представляет собой по меньшей мере одну замену, выбранную из группы, состоящей из 239D, 330L, 330Y и 332E, согласно нумерации по EU-индексу, как изложено у Кэбота. См. патент США №7317091, включенный в данный документ с помощью ссылки во всей своей полноте.

[0079] В конкретном аспекте настоящее раскрытие предполагает вариант 1 Fc, где Fc участок включает по меньшей мере одну не встречающуюся в природе аминокислоту в одном или нескольких положениях, выбранных из группы, состоящей из 252, 254 и 256, согласно нумерации по EU-индексу, как изложено у Кэбота. В одном аспекте модификация представляет собой по меньшей мере одну замену, выбранную из группы, состоящей из 252Y, 254T и 256E, согласно нумерации по EU-индексу, как изложено у Кэбота. См. патент США №7083784, включенный в данный документ с помощью ссылки во всей своей полноте.

[0080] В некоторых аспектах настоящее раскрытие предполагает вариант Fc, где Fc участок включает не встречающуюся в природе аминокислоту в положении 428, согласно нумерации по EU-индексу, как изложено у Кэбота. В одном аспекте модификация в положении 428 выбрана из группы, состоящей из 428T, 428L, 428F и 428S, согласно нумерации по EU-индексу, как изложено у Кэбота. См. патент США №7670600, включенный в данный документ с помощью ссылки во всей своей полноте. В другом аспекте вариант Fc может также включать не встречающуюся в природе аминокислоту в положении 434, согласно нумерации по EU-индексу, как изложено у Кэбота. В одном аспекте модификация в положении 434 выбрана из группы, состоящей из 434A, 434S и 434F, согласно нумерации по EU-индексу, как изложено у Кэбота. В других аспектах настоящее раскрытие предполагает вариант Fc, где Fc участок включает не встречающуюся в природе аминокислоту в положениях 428 и 434, согласно нумерации по EU-индексу, как изложено у Кэбота. В конкретном аспекте Fc участок включает 428L, 434S. См. патент США №8088376.

[0081] Каркасные участки и CDR участки гуманизированного антитела не должны точно соответствовать родительским последовательностям, например, донорный CDR или консенсусный каркасный участок можно подвергнуть мутагенезу путем замены, вставки или делеции по меньшей мере одного остатка для того, чтобы CDR или каркасный остаток в этом положении не соответствовал консенсусному или донорному антителу. Такие мутации, однако, предпочтительно, не являются обширными. Обычно по меньшей мере 75% остатков в гуманизированном антителе будут соответствовать остаткам в родительском каркасном участке (FR) и последовательностях CDR, чаще 90%, а наиболее предпочтительно более чем 95%. Гуманизированные антитела можно получить с помощью ряда методик, известных в уровне техники, включая без ограничений прививку CDR (Европейский патент № 239400, публикация международной заявки № WO 91/09967 и патенты США №№ 5225539, 5530101 и 5585089), рекомбинацию поверхностных остатков (Европейские патенты №№ 592106 и 519596; Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al., 1994, Protein Engineering 7(6):805, и Roguska et al., 1994, Proc. Natl. Acad. Sci. 91:969-973), рекомбинацию целых полипептидных цепей (патент США №5565332), а также методик, раскрытых, например, в патентах США №№6407213, 5766886, 5585089, публикации международной заявки №WO 9317105, Tan et al., 2002, J. Immunol. 169:1119-25, Caldas et al., 2000, Protein Eng. 13:353-60, Morea et al., 2000, Methods 20:267-79, Baca et al., 1997, J. Biol. Chem. 272:10678-84, Roguska et al., 1996, Protein Eng. 9:895-904, Couto et al., 1995, Cancer Res. 55 (23 Supp):5973s-5977s, Couto et al., 1995, Cancer Res. 55:1717-22, Sandhu, 1994, Gene 150:409-10, Pedersen et al., 1994, J. Mol. Biol. 235:959-73, Jones et al., 1986, Nature 321:522-525, Riechmann et al., 1988, Nature 332:323, и Presta, 1992, Curr. Op. Struct. Biol. 2:593-596. Часто каркасные остатки в каркасных участках будут замещаться соответствующим остатком из CDR донорного антитела для изменения, предпочтительно, улучшения связывания с антигеном. Эти замены в каркасных участках идентифицируют с помощью способов, известных в уровне техники, например, с помощью моделирования взаимодействий CDR и каркасных остатков для идентификации каркасных остатков, важных для связывания с антигеном, и сравнения последовательностей для идентификации необычных каркасных остатков в определенных положениях. (См., например, Queen et al., патент США № 5585089; публикации США №№ 2004/0049014 и 2003/0229208; патенты США №№ 6350861; 6180370; 5693762; 5693761; 5585089 и 5530101, и Riechmann et al., 1988, Nature 332:323).

[0082] Антитела можно получить с помощью любого способа, известного в данной области техники, пригодного для получения полипептидов, например, синтеза in vitro, образования рекомбинантной ДНК и т.п. Предпочтительно, гуманизированные антитела получают с помощью технологии с использованием рекомбинантной ДНК. Антитела можно получить с помощью технологии экспрессии рекомбинантных иммуноглобулинов. Рекомбинантное получение молекул иммуноглобулинов, включающих гуманизированные антитела, описано в патенте США № 4816397 (Boss и соавт.), патентах США №№ 6331415 и 4816567 (оба за авторством Cabilly и соавт.), патента Великобритании GB 2188638 (Winter и соавт.) и патента Великобритании GB 2209757. Методики рекомбинантной экспрессии иммуноглобулинов, включая гуманизированные иммуноглобулины, также можно найти в Goeddel et al., Gene Expression Technology Methods in Enzymology Vol. 185 Academic Press (1991), и Borreback, Antibody Engineering, W. H. Freeman (1992). Дополнительную информацию касательно создания, разработки и экспрессии рекомбинантных антител можно найти в Mayforth, Designing Antibodies, Academic Press, San Diego (1993).

[0083] Иллюстративный способ получения рекомбинантных химерных антител может включать следующее: a) конструирование с помощью стандартных способов молекулярной биологии вектора экспрессии, который кодирует и экспрессирует тяжелую цепь антитела, в которой CDR и вариабельный участок мышиного моноклонального антитела к H7CR человека слиты с Fc участком, полученным из иммуноглобулина человека, приводя таким образом к образованию вектора для экспрессии тяжелой цепи химерного антитела; b) конструирование с помощью стандартных способов молекулярной биологии вектора экспрессии, который кодирует и экспрессирует легкую цепь антитела мышиного моноклонального антитела к H7CR человека, приводя таким образом к образованию вектора для экспрессии легкой цепи химерного антитела; c) перенос векторов экспрессии в клетку-хозяина с помощью стандартных способов молекулярной биологии с получением трансфицированной клетки-хозяина для экспрессии химерных антител и d) культивирование трансфицированной клетки с помощью стандартных способов культивирования клеток с тем, чтобы получить химерные антитела.

[0084] Иллюстративный способ получения рекомбинантных гуманизированных антител может включать следующее: a) конструирование с помощью стандартных способов молекулярной биологии вектора экспрессии, который кодирует и экспрессирует тяжелую цепь антитела к H7CR человека, в котором CDR и минимальная часть каркасных остатков вариабельного участка, которые требуются для сохранения специфичности связывания донорного антитела, получены из иммуноглобулина, не являющегося человеческим, такого как мышиное моноклональное антитело к H7CR человека, а остальная часть антитела получена из иммуноглобулина человека, приводя таким образом к образованию вектора для экспрессии тяжелой цепи гуманизированного антитела; b) конструирование с помощью стандартных способов молекулярной биологии вектора экспрессии, который кодирует и экспрессирует легкую цепь антитела, в котором CDR и минимальная часть каркасных остатков вариабельного участка, которые требуются для сохранения специфичности связывания донорного антитела, получены из иммуноглобулина, не являющегося человеческим, такого как мышиное моноклональное антитело к H7CR человека, а остальная часть антитела получена из иммуноглобулина человека, приводя таким образом к образованию вектора для экспрессии легкой цепи гуманизированного антитела; c) перенос векторов экспрессии в клетку-хозяина с помощью стандартных способов молекулярной биологии с получением трансфицированной клетки-хозяина для экспрессии гуманизированных антител и d) культивирование трансфицированной клетки с помощью стандартных способов культивирования клеток с тем, чтобы получить гуманизированные антитела.

[0085] Что касается любого из иллюстративных способов, клетки-хозяева могут быть котрансфицированы такими векторами экспрессии, которые могут содержать различные селектируемые маркеры, однако, за исключением кодирующих последовательностей тяжелой и легкой цепей, являются предпочтительно идентичными. Эта процедура обеспечивает равную экспрессию полипептидов тяжелой и легкой цепей. В качестве альтернативы, можно использовать один вектор, который кодирует полипептиды как тяжелой, так и легкой цепей. Кодирующие последовательности для тяжелой и легкой цепей могут включать кДНК или геномную ДНК или и то, и другое. Клетка-хозяин, используемая для экспрессии рекомбинантного антитела, может быть бактериальной клеткой, такой как Escherichia coli, или более предпочтительно эукариотической клеткой (например, клеткой яичника китайского хомяка (CHO) или клеткой HEK-293). Выбор вектора экспрессии зависит от выбора клетки-хозяина, и ее можно выбрать так, чтобы иметь желательные характеристики экспрессии и регуляции в выбранной клетке-хозяине. Другие клеточные линии, которые можно использовать, включают без ограничений CHO-K1, NSO и PER.C6 (Crucell, Лейден, Нидерланды).

[0086] Любые из раскрытых антител можно использовать для создания антиидиотипических антител с помощью методик, хорошо известных специалистам в данной области техники (см., например, Greenspan, N.S. et al. (1989) «Idiotypes: Structure And Immunogenicity» FASEB J. 7:437-444; и Nisinoff, A. (1991) 2Idiotypes: Concepts And Applications» J. Immunol. 147(8):2429-2438).

[0087] Связывающие свойства раскрытых антител можно при необходимости дополнительно улучшить с помощью скрининга в отношении вариантов, которые проявляют такие предпочтительные характеристики. Например, такие антитела можно создавать с помощью различных способов фагового дисплея, известных в уровне техники. В способах фагового дисплея функциональные домены антител проявляются на поверхности фаговых частиц, которые несут последовательности полинуклеотидов, кодирующие их. В определенном варианте осуществления такой фаг можно использовать для проявления антигенсвязывающих доменов, таких как Fab и Fv или стабилизированные дисульфидными связями Fv, экспрессируемые из спектра или комбинаторной библиотеки антител (например, человека или мыши). Фаг, экспрессирующий антигенсвязывающий домен, который связывается с представляющим интерес антигеном, можно подвергнуть селекции или идентифицировать с помощью антигена, например, с помощью меченого антигена или антигена, связанного с твердой поверхностью или сферой или прикрепленного к ним. Фагом, применяемым в этих способах, обычно является нитчатый фаг, включая fd и M13. Антигенсвязывающие домены экспрессируются в виде рекомбинантно слитого белка либо с белком гена III, либо гена VIII фага. Примеры способов фагового дисплея, которые можно применять для получения иммуноглобулинов или их фрагментов, включают раскрытые в Brinkman, U. et al. (1995) «Phage Display Of Disulfide-Stabilized Fv Fragments» J. Immunol. Methods, 182:41-50, 1995; Ames, R.S. et al. (1995) «Conversion Of Murine Fabs Isolated From A Combinatorial Phage Display Library To Full Length Immunoglobulins» J. Immunol. Methods, 184:177-186; Kettleborough, C.A. et al. (1994) «Isolation Of Tumor Cell-Specific Single-Chain Fv From Immunized Mice Using Phage-Antibody Libraries And The Re-Construction Of Whole Antibodies From These Antibody Fragments» Eur. J. Immunol., 24:952-958, 1994; Persic, L. et al. (1997) «An Integrated Vector System For The Eukaryotic Expression Of Antibodies Or Their Fragments After Selection From Phage Display Libraries» Gene, 187:9-18; Burton, D.R. et al. (1994) «Human Antibodies From Combinatorial Libraries» Adv. Immunol. 57:191-280; PCT публикациях WO 92/001047; WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401 и патентах США №№5698426; 5223409; 5403484; 5580717; 5427908; 5750753; 5821047; 5571698; 5427908; 5516637; 5780225; 5658727; 5733743 и 5969108.

[0088] Как описано в вышеуказанных источниках, после селекции фага, кодирующие участки антитела из фага могут быть выделены и использованы для создания целых антител, включая гуманизированные антитела или любые другие предпочтительные фрагменты, и экспрессированы в любом желаемом хозяине, включая клетки млекопитающих, клетки насекомых, клетки растений, дрожжей и бактерий, например, как подробно описано ниже. Например, также можно использовать методики рекомбинантного получения фрагментов Fab, Fab' и F(ab')2 с применением способов, известных в уровне техники (таких как раскрытые в PCT публикации WO 92/22324; Mullinax, R.L. et al. (1992) «Expression Of A Heterodimeric Fab Antibody Protein In One Cloning Step» BioTechniques, 12(6):864-869; и Sawai et al. (1995) «Direct Production Of The Fab Fragment Derived From The Sperm Immobilizing Antibody Using Polymerase Chain Reaction And cDNA Expression Vectors» Am. J. Reprod. Immunol. 34:26-34; и Better, M. et al. (1988) «Escherichia coli Secretion Of An Active Chimeric Antibody Fragment» Science 240:1041-1043). Примеры методик, которые можно применять для получения одноцепочечных Fv и антител включают описанные в патентах США №№ 4946778 и 5258498; Huston, J.S. et al. (1991) «Protein Engineering Of Single-Chain Fv Analogs And Fusion Proteins» Methods in Enzymology 203:46-88; Shu, L. et al., «Secretion Of A Single-Gene-Encoded Immunoglobulin From Myeloma Cells» Proc. Natl. Acad. Sci. (USA) 90:7995-7999; и Skerra. A. et al. (1988) «Assembly Of A Functional Immunoglobulin Fv Fragment In Escherichia coli» Science 240:1038-1040.

[0089] Для повышения аффинности раскрытых антител к H7CR можно использовать технологию фагового дисплея. Эта методика будет полезной при получении антител с высокой аффинностью, которые могли бы использоваться в комбинаторных способах. Данная технология, называемая "созреванием аффинности", использует мутагенез или "прогулку по CDR" (последовательную модификацию остатков в CDR) и повторную селекцию с применением таких рецепторов или лигандов (или их внеклеточных доменов) или их антигенного фрагмента для идентификации антител, которые связываются с антигеном с более высокой аффинностью по сравнению с исходным или родительским антителом (см., например, Glaser, S.M. et al. (1992) «Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System» J. Immunol. 149:3903-3913). Мутагенез целых кодонов, а не отдельных нуклеотидов, приводит к образованию полурандомизированного спектра аминокислотных мутаций. Можно сконструировать библиотеки, состоящие из объединенной группы вариантных клонов, каждый из которых отличается изменением одной аминокислоты в одном CDR, и которые содержат варианты, представляющие каждую возможную аминокислотную замену для каждого остатка в CDR. Мутанты с повышенной связвающей способностью в отношении антигена можно подвернуть скринингу путем контакта иммобилизированных мутантов с меченым антигеном. Для идентификации мутантных антител с повышенной авидностью к антигену можно использовать любой способ скрининга, известный в уровне техники (например, ELISA) (см., например, Wu, H. et al. (1998) «Stepwise In Vitro Affinity Maturation Of Vitaxin, An Alphav Beta3-Specific Humanized Mab» Proc. Natl. Acad. Sci. (USA) 95(11):6037-6042; Yelton, D.E. et al. (1995) «Affinity Maturation Of The BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis» J. Immunol. 155:1994-2004). При необходимости можно использовать "прогулку по CDR", которая рандомизирует легкую цепь (см., Schier et al. (1996) «Isolation Of Picomolar Affinity Anti-C-Erbb-2 Single-Chain Fv By Molecular Evolution Of The Complementarity Determining Regions In The Center Of The Antibody Binding Site» J. Mol. Biol. 263:551-567).

[0090] Для идентификации улучшенных CDR также можно использовать случайный мутагенез. В качестве альтернативы, для повышения (или снижения) аффинности CDR, можно использовать технологию фагового дисплея. Данная технология, обозначаемая как созревание аффинности, использует мутагенез или «прогулку по CDR», а в повторной селекции антиген-мишень или его антигенный фрагмент используется для идентификации антител, имеющих СDR, которые связываются с антигеном с более высокой (или более низкой) аффинностью по сравнению с исходным или родительским антителом (см., например, Glaser, S.M. et al. (1992) «Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System» J. Immunol. 149:3903-3913). Мутагенез целых кодонов, а не отдельных нуклеотидов, приводит к образованию полурандомизированного спектра аминокислотных мутаций. Можно сконструировать библиотеки, состоящие из объединенной группы вариантных клонов, каждый из которых отличается изменением одной аминокислоты в одном CDR, и которые содержат варианты, представляющие каждую возможную аминокислотную замену для каждого остатка в CDR. Мутанты с повышенной (или пониженной) связывающей способностью в отношении антигена можно подвергать скринингу путем контакта иммобилизированных мутантов с меченым антигеном. Для идентификации мутантных антител с повышенной (или пониженной) авидностью к антигену можно использовать любой способ скрининга, известный в уровне техники (например, ELISA) (см., Wu, H. et al. (1998) «Stepwise In Vitro Affinity Maturation Of Vitaxin, An Alphav Beta3-Specific Humanized Mab» Proc. Natl. Acad. Sci. (USA) 95(11):6037-6042; Yelton, D.E. et al. (1995) «Affinity Maturation Of The BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis» J. Immunol. 155:1994-2004). При необходимости можно использовать "прогулку по CDR", которая рандомизирует легкую цепь (см., Schier et al. (1996) «Isolation Of Picomolar Affinity Anti-C-Erbb-2 Single-Chain Fv By Molecular Evolution Of The Complementarity Determining Regions In The Center Of The Antibody Binding Site» J. Mol. Biol. 263:551-567).

[0091] Способы осуществления такого "созревания аффинности" описаны, например, в: Krause, J.C. et al. (2011) «An Insertion Mutation That Distorts Antibody Binding Site Architecture Enhances Function Of A Human Antibody» MBio. 2(1) pii: e00345-10. doi: 10.1128/mBio.00345-10; Kuan, C.T. et al. (2010) «Affinity-Matured Anti-Glycoprotein NMB Recombinant Immunotoxins Targeting Malignant Gliomas And Melanomas» Int. J. Cancer 10.1002/ijc.25645; Hackel, B.J. et al. (2010) «Stability And CDR Composition Biases Enrich Binder Functionality Landscapes» J. Mol. Biol. 401(1):84-96; Montgomery, D.L. et al. (2009) «Affinity Maturation And Characterization Of A Human Monoclonal Antibody Against HIV-1 gp41» MAbs 1(5):462-474; Gustchina, E. et al. (2009) «Affinity Maturation By Targeted Diversification Of The CDR-H2 Loop Of A Monoclonal Fab Derived From A Synthetic Naïve Human Antibody Library And Directed Against The Internal Trimeric Coiled-Coil Of Gp41 Yields A Set Of Fabs With Improved HIV-1 Neutralization Potency And Breadth» Virology 393(1):112-119; Finlay, W.J. et al. (2009) «Affinity Maturation Of A Humanized Rat Antibody For Anti-RAGE Therapy: Comprehensive Mutagenesis Reveals A High Level Of Mutational Plasticity Both Inside And Outside The Complementarity-Determining Regions» J. Mol. Biol. 388(3):541-558; Bostrom, J. et al. (2009) «Improving Antibody Binding Affinity And Specificity For Therapeutic Development» Methods Mol. Biol. 525:353-376; Steidl, S. et al. (2008) «In Vitro Affinity Maturation Of Human GM-CSF Antibodies By Targeted CDR-Diversification» Mol. Immunol. 46(1):135-144, и Barderas, R. et al. (2008) «Affinity maturation of antibodies assisted by in silico modeling» Proc. Natl. Acad. Sci. (USA) 105(26):9029-9034.

[0092] Также предполагается получение и применение «производных» любого из вышеописанных антител и их антигенсвязывающих фрагментов.

[0093] Выражение «производное» относится к антителу или его антигенсвязывающему фрагменту, которые иммуноспецифически связываются с антигеном, но которые при этом включают одну, две, три, четыре, пять или более аминокислотных замен, добавлений, делеций или модификаций по отношению к «родительской» молекуле (или молекуле дикого типа). Такие аминокислотные замены или добавления могут вводить встречающиеся в природе (т.e. кодируемые ДНК) или не встречающиеся в природе аминокислотные остатки. Выражение «производное» охватывает, например, химерные или гуманизированные варианты любого из антител 1.3, 4.5 или 7.8, а также варианты, имеющие измененные CH1, шарнирный, CH2, CH3 или CH4 участки, для получения, например, антител и т.д., имеющих различные Fc участки, которые проявляют усиленные или ослабленные эффекторные или связывающие характеристики. Выражение «производное» дополнительно охватывает модификации, не относящиеся к аминокислотным, например, аминокислоты, которые могут быть гликозилированными (например, иметь измененное содержание маннозы, 2-N-ацетилглюкозамина, галактозы, фруктозы, глюкозы, сиаловой кислоты, 5-N-ацетилнейраминовой кислоты, 5-гликольнейраминовой кислоты и т.д.), ацетилированными, пегилированными, фосфорилированными, амидированными, дериватизированными известными защитными/блокирующим группами, протеолитическим расщеплением, связанными с клеточным лигандом или другим белком и т.д. В некоторых вариантах осуществления измененные модификации углеводов модулируют одно или несколько из следующего: растворимость антитела, облегчение внутриклеточного транспорта и секреции антитела, активацию сборки антитела, конформационную целостность и опосредованную антителом эффекторную функцию. В некоторых вариантах осуществления модификации с изменением углеводов усиливают опосредованную антителом эффекторную функцию по сравнению с антителом, не имеющим углеводной модификации. Модификации углеводов, которые приводят к измененной опосредованной антителом эффекторной функции, хорошо известны в уровне техники (например, см. Shields, R.L. et al. (2002) «Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIII And Antibody-Dependent Cellular Toxicity» J. Biol. Chem. 277(30): 26733-26740; Davies J. et al. (2001) «Expression Of GnTIII In A Recombinant Anti-CD20 CHO Production Cell Line: Expression Of Antibodies With Altered Glycoforms Leads To An Increase In ADCC Through Higher Affinity For FC Gamma RIII» Biotechnology & Bioengineering 74(4): 288-294). Способы изменения содержания углеводов известны специалистам в данной области техники, см,, например, Wallick, S.C. et al. (1988) «Glycosylation Of A VH Residue Of A Monoclonal Antibody Against Alpha (1----6) Dextran Increases Its Affinity For Antigen» J. Exp. Med. 168(3): 1099-1109; Tao, M.H. et al. (1989) «Studies Of Aglycosylated Chimeric Mouse-Human IgG. Role Of Carbohydrate In The Structure And Effector Functions Mediated By The Human IgG Constant Region» J. Immunol. 143(8): 2595-2601; Routledge, E.G. et al. (1995) «The Effect Of Aglycosylation On The Immunogenicity Of A Humanized Therapeutic CD3 Monoclonal Antibody» Transplantation 60(8):847-53; Elliott, S. et al. (2003) «Enhancement Of Therapeutic Protein In Vivo Activities Through Glycoengineering» Nature Biotechnol. 21:414-21; Shields, R.L. et al. (2002) «Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIII And Antibody-Dependent Cellular Toxicity» J. Biol. Chem. 277(30): 26733-26740).

[0094] В некоторых вариантах осуществления гуманизированное антитело представляется собой производное. Такое гуманизированное антитело включает замены, делеции или добавления аминокислотных остатков в одном или нескольких CDR не являющихся человеческими. Производное гуманизированного антитела может характеризоваться практически таким же связыванием, лучшим связыванием или худшим связыванием по сравнению с гуманизированным антителом, не являющимся производным. В конкретных вариантах осуществления один, два, три, четыре или пять аминокислотных остатков в CDR были замещены, удалены или добавлены (т.e. мутированы).

[0095] Производное антитела или фрагмента антитела можно модифицировать посредством химических модификаций с помощью методик, известных специалистам в данной области техники, включая без ограничений специфическое химическое расщепление, ацетилирование, создание составов, метаболический синтез туникамицина и т.д. В одном из вариантов осуществления производное антитела будет иметь подобную или идентичную родительскому антителу функцию. В другом варианте осуществления производное антитела будет проявлять измененную активность в сравнении с родительским антителом. Например, производное антитела (или его фрагмента) может связываться с его эпитопом более крепко или быть более устойчивым к протеолизу, нежели родительское антитело.

[0096] Замены, добавления или делеции в дериватизированных антителах могут находиться в Fc участке антитела и могут, таким образом, служить для модификации способности антитела к связыванию с одним или несколькими FcγR. В данной области техники известны способы модификации антител с модифицированным связыванием с одним или несколькими FcγR, см., например, PCT публикации №№ WO 04/029207, WO 04/029092, WO 04/028564, WO 99/58572, WO 99/51642, WO 98/23289, WO 89/07142, WO 88/07089 и патенты США №№ 5843597 и 5642821. Некоторые варианты осуществления охватывают антитела, Fc участок которых был удален (например, Fab или F(ab)2 и т.д.) или модифицирован таким образом, чтобы молекула проявляла пониженную активность связывания, или не проявляла активность связывания с Fc-рецептором (FcR), или проявляла повышенные антителозависимую клеточно-опосредованную цитотоксическую (ADCC) и комплемент-зависимую цитотоксическую (CDC) активности. Некоторые варианты осуществления охватывают антитела, которые имеют измененную аффинность в отношении активирующего FcγR, например, FcγRIIIA. Предпочтительно, такие модификации также имеют измененную Fc-опосредованную эффекторную функцию. Модификации, которые влияют на Fc-опосредованную эффекторную функцию, хорошо известны в уровне техники (см. патент США №6194551 и WO 00/42072). В одном из вариантов осуществления модификация Fc участка приводит к образованию антитела с измененной опосредованной антителом эффекторной функцией, измененным связыванием с другими Fc-рецепторами (например, активирующими Fc-рецепторами), измененной антителозависимой клеточноопосредованной цитотоксической (ADCC) активностью, измененной C1q-связывающей активностью, измененной комплемент-зависимой цитотоксической активностью (CDC), фагоцитарной активностью или их комбинацией.

[0097] Дериватизированные антитела можно использовать для изменения периодов полувыведения (например, периодов полувыведения из сыворотки) родительских антител у млекопитающего, предпочтительно человека. Предпочтительно, такое изменение будет приводить к периоду полувыведения более 15 дней, предпочтительно более 20 дней, более 25 дней, более 30 дней, более 35 дней, более 40 дней, более 45 дней, более 2 месяцев, более 3 месяцев, более 4 месяцев или более 5 месяцев. Увеличенный период полувыведения гуманизированных антител или их фрагментов у млекопитающего, предпочтительно человека, приводит к более высокому титру упомянутых антител или фрагментов антител в сыворотке у млекопитающего и, следовательно, снижает частоту введения упомянутых антител или фрагментов антител или снижает концентрацию упомянутых антител или фрагментов антител, которые необходимо вводить. Антитела или их фрагменты, имеющие увеличенные периоды полувыведения in vivo, можно создать с помощью методик, известных специалистам в данной области техники. Например, антитела или их фрагменты с увеличенными периодами полувыведения in vivo можно создать с помощью модификации (например, замен, удаления или добавления) аминокислотных остатков, идентифицированных как участвующие во взаимодействии между Fc-доменом и FcRn-рецептором. Гуманизированные антитела можно подвергнуть воздействию способов генной инженерии для увеличения периодов полувыведения из организма (см., например, патент США №6277375). Например, гуманизированные антитела можно подвергнуть воздействию способов генной инженерии в Fc-шарнирном домене для того, чтобы получить увеличенные периоды полувыведения in vivo или в сыворотке.

[0098] Антитела или их фрагменты с увеличенными периодами полувыведения in vivo можно создать с помощью присоединения к упомянутым антителам или фрагментам антител полимерных молекул, таких как полиэтиленгликоль (PEG) с высокой молекулярной массой. PEG можно присоединить к упомянутым антителам или фрагментам антител с помощью или без помощи мультифункционального линкера либо посредством сайт-специфической конъюгации PEG с N- или C-концевым участком упомянутых антител или фрагментов антител, либо через эпсилон-аминогруппы, присутствующие на остатках лизина. Будет использоваться дериватизация линейными или разветвленными полимерами, которая приводит к минимальной потере биологической активности. Для обеспечения соответствующей конъюгации молекул PEG с антителами степень конъюгации будет тщательно контролироваться с помощью SDS-PAGE и масс-спектрометрии. Непрореагировавший PEG можно отделить от конъюгатов антитело-PEG с помощью, например, гель-хроматографии или ионообменной хроматографии.

[0099] Антитела также можно модифицировать с помощью способов и связывающих средств, описанных Davis и соавт. (см. патент США №4179337), для получения композиций, которые можно вводить инъекцией в кровеносную систему млекопитающего практически без иммуногенного ответа.

[00100] Каркасные остатки гуманизированных антител можно модифицировать. Каркасные остатки в каркасных участках можно замещать соответствующим остатком от CDR донорного антитела для изменения, предпочтительно улучшения связывания с антигеном. Эти замены в каркасных участках идентифицируют с помощью способов, хорошо известных в уровне техники, например, путем моделирования взаимодействий CDR и каркасных остатков для идентификации каркасных остатков, важных для связывания с антигеном, и сравнения последовательностей для идентификации необычных каркасных остатков в конкретных положениях. (см., например, патент США № 5585089; и Riechmann, L. et al. (1988) «Reshaping Human Antibodies For Therapy» Nature 332:323-327).

[00101] Предполагаются антитела к H7CR человека (и более предпочтительно, гуманизированные антитела) и их антигенсвязывающие фрагменты, которые рекомбинантно слиты или химически конъюгированы (включая ковалентные и нековалентные конъюгации) с гетерологической молекулой (т.e. неродственной молекулой). Слияние необязательно должно быть непосредственным, а может происходить посредством линкерных последовательностей.

[00102] В одном из вариантов осуществления такими гетерологическими молекулами являются полипептиды, имеющие по меньшей мере 10, по меньшей мере 20, по меньшей мере 30, по меньшей мере 40, по меньшей мере 50, по меньшей мере 60, по меньшей мере 70, по меньшей мере 80, по меньшей мере 90 или по меньшей мере 100 аминокислот. Такими гетерологическими молекулами могут необязательно быть ферменты, гормоны. рецепторы клеточной поверхности, фрагменты лекарственных средств, такие как: токсины (такие как абрин, рицин A, экзотоксин синегнойной палочки (т.e. PE-40), дифтерийный токсин, рицин, гелонин или противовирусный белок лаконоса), белки (такие как фактор некроза опухоли, интерферон (например, α-интерферон, β-интерферон), фактор роста нервов, тромбоцитарный фактор роста, тканевой активатор плазминогена или апоптическое средство (например, фактор некроза опухоли α, фактор некроза опухоли β)), модификаторы биологического ответа (такие как, например, лимфокин (например, интерлейкин-1 («IL-1»), интерлейкин-2 («IL-2»), интерлейкин-6 («IL-6»)), гранулоцитарно-макрофагальный колониестимулирующий фактор («GM-CSF»), гранулоцитарный колониестимулирующий фактор («G-CSF») или макрофагальный колониестимулирующий фактор («M-CSF»)) или факторы роста (например, гормон роста («GH»))), цитотоксины (например, цитостатическое или разрушающее клетки средство, такое как паклитаксел, цитохалазин B, грамицидин D, этидия бромид, эметин, митомицин, этопозид, тенопозид, винкристин, винбластин, колхицин, доксорубицин, даунорубицин, дигидроксиантрациндион, митоксантрон, митрамицин, актиномицин D, 1-дегидротестостерон, глюкокортикоиды, прокаин, тетракаин, лидокаин, пропранолол и пуромицин и их аналоги или гомологи), антиметаболиты (например, метотрексат, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-фторурацил, дакарбазин), алкилирующие средства (например, мехлорэтамин, тиотепа, хлорамбуцил, мелфалан, BiCNU® (кармустин; BSNU) и ломустин (CCNU), циклотосфамид, бусульфан, дибромманнитол, стрепрозоцин, митомицин C и цис-диамино-дихлорплатина (II) (DDP), цисплатин), антрациклины (например, даунорубицин (ранее называвшийся дауномицин) и доксорубицин), антибиотики (например, дактиномицин (ранее называвшийся актиномицин), блеомицин, митрамицин и антрамицин (AMC)) или антимитотические средства (например, винкристин и винбластин).

[00103] Методики конъюгирования таких терапевтических фрагментов с антителами хорошо известны, см., например, Arnon et al., «Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy», in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), 1985, pp. 243-56, Alan R. Liss, Inc.); Hellstrom et al., «Antibodies For Drug Delivery», in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), 1987, pp. 623-53, Marcel Dekker, Inc. ); Thorpe, «Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review», in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), 1985, pp. 475-506); «Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy», in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), 1985, pp. 303-16, Academic Press; и Thorpe et al. (1982) «The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates» Immunol. Rev. 62:119-158.

[00104] В одном из вариантов осуществления антитела или слитые молекулы включают Fc часть. Fc часть таких молекул может варьировать по изотипу или подклассу, может быть химерной или гибридной, и/или может быть модифицирована, например, для улучшения эффекторных функций, контроля периода полувыведения, тканевой доступности, улучшения биофизических характеристик, таких как стабильность, и улучшения эффективности получения (и меньших затрат). В данной области техники известно много модификаций, полезных при конструировании раскрытых слитых белков, и способов их получения, см., например, Mueller, J.P. et al. (1997) «Humanized Porcine VCAM-Specific Monoclonal Antibodies With Chimeric IgG2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells» Mol. Immun. 34(6):441-452, Swann, P.G. (2008) «Considerations For The Development Of Therapeutic Monoclonal Antibodies» Curr. Opin. Immun. 20:493-499 (2008), и Presta, L.G. (2008) «Molecular Engineering And Design Of Therapeutic Antibodies» Curr. Opin. Immun. 20:460-470. В некоторых вариантах осуществления Fc участком является нативный Fc участок IgG1, IgG2 или IgG4. В некоторых вариантах осуществления Fc участок является гибридным, например, химерным, состоящим из константных Fc участков IgG2/IgG4. Модификации Fc участка включают без ограничений IgG4, модифицированный для предотвращения связывания с Fc-гамма рецепторами и комплементом, IgG1, модифицированный для улучшения связывания с одним или несколькими Fc-гамма рецепторами, IgG1, модифицированный для сведения к минимуму эффекторной функции (аминокислотные изменения), IgG1 с измененным гликаном/без гликана (обычно с помощью изменения хозяина экспрессии) и IgG1 с измененным pH-зависимым связыванием с FcRn, а также IgG4 с серином в положении аминокислоты #228 в шарнирном участке, замененном на пролин (S228P) для повышения стабильности. Fc участок может включать весь шарнирный участок или менее чем весь шарнирный участок.

[00105] Терапевтический результат у пациентов, получавших ритуксимаб (химерное моноклональное антитело IgG1 мыши/человека к CD20) для лечения неходжкинской лимфомы или макроглобулинемии Вальденстрема, коррелировал с экспрессией у индивидов аллельных вариантов Fc-рецепторовγ с отличающимися свойственными аффинностями к Fc-домену IgG1 человека. В частности, пациенты с аллелями высокой аффинности активирующего Fc-рецептора CD16A с низкой аффинностью (FcγRIIIA) показывали более высокие уровни ответа, а в случае неходжкинской лимфомы улучшенную выживаемость без прогрессирования. В другом варианте осуществления Fc-домен может содержать одну или несколько аминокислотных вставок, делеций или замен, которые снижают связывание с ингибирующим Fc-рецептором CD32B с низкой аффинностью (FcγRIIB) и сохраняют уровни связывания дикого типа или усиливают связывание с активирующим Fc-рецептором CD16A с низкой аффинностью (FcγRIIIA).

[00106] Другой вариант осуществления включает гибриды IgG2-4 и мутанты IgG4, которые характеризуются пониженным связыванием с FcR, что увеличивает их период полувыведения. Типичные гибриды IG2-4 и мутанты IgG4 описаны в Angal, S. et al. (1993) «A Single Amino Acid Substitution Abolishes The Heterogeneity Of Chimeric Mouse/Human (Igg4) Antibody» Molec. Immunol. 30(1):105-108; Mueller, J.P. et al. (1997) «Humanized Porcine VCAM-Specific Monoclonal Antibodies With Chimeric Igg2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells» Mol. Immun. 34(6):441-452; и патенте США №6982323. В некоторых вариантах осуществления домен IgG1 и/или IgG2 удаляют, например, Angal S. и соавт. описывают IgG1 и IgG2 с серином 241, замененным на пролин.

[00107] В предпочтительном варианте осуществления Fc-домен содержит аминокислотные вставки, делеции и замены, которые усиливают связывание с CD16A. В уровне техники известно множество замен в Fc-домене IgG1 человека, которые повышают связывание с CD16A и снижают связывание с CD32B и которые описаны в Stavenhagen, J.B. et al. (2007) «Fc Optimization Of Therapeutic Antibodies Enhances Their Ability To Kill Tumor Cells In Vitro And Controls Tumor Expansion In Vivo Via Low-Affinity Activating Fcgamma Receptors» Cancer Res. 57(18):8882-8890. Иллюстративные варианты Fc-доменов IgG1 человека со сниженным связыванием с CD32B и/или повышенным связыванием с CD16A содержат замены F243L, R929P, Y300L, V305I или P296L. Эти аминокислотные замены могут присутствовать в Fc-домене IgG1 человека в любой комбинации. В одном из вариантов осуществления вариант Fc-домена IgG1 человека содержит замену F243L, R929P и Y300L. В другом варианте осуществления вариант Fc-домена IgG1 человека содержит замену F243L, R929P, Y300L, V305I и P296L. В другом варианте осуществления вариант Fc-домена IgG1 человека содержит замену N297Q, поскольку эта мутация устраняет связывание FcR.

[00108] Для облегчения очистки описанные молекулы могут быть слиты с маркерными последовательностями, такими как пептид. В предпочтительных вариантах осуществления маркерной аминокислотной последовательностью является гексагистидиновый пептид, гемагглютининовая “HA” метка, которая соответствует эпитопу, полученному из гемагглютининового белка вируса гриппа (Wilson, I.A. et al. (1984) «The Structure Of An Antigenic Determinant In A Protein» Cell, 37:767-778), и меткой «flag» (Knappik, A. et al. (1994) «An Improved Affinity Tag Based On The FLAG Peptide For The Detection And Purification Of Recombinant Antibody Fragments» Biotechniques 17(4):754-761).

[00109] Антитела или их антигенсвязывающие фрагменты могут быть конъюгированы с диагностическим или терапевтическим средством или любой другой молекулой, для которой предпочтительным является увеличение периода полувыведения из сыворотки. Антитела можно применять в диагностических целях (in vivo, in situ или in vitro), например, для отслеживания развития или прогрессирования заболевания, нарушения или инфекции, как часть процедуры клинического исследования, например, для определения эффективности определенной схемы лечения. Выявление можно облегчить с помощью связывания антитела с выявляемым веществом. Примеры выявляемых веществ включают различные ферменты, простетические группы, флуоресцентные материалы, люминесцентные материалы, биолюминесцентные материалы, радиоактивные материалы, позитронно-активные металлы и нерадиоактивные парамагнитные ионы металлов. Выявляемое вещество может быть связано или конъюгировано с антителом прямо или опосредовано, через посредника (такого как, например, линкер, известный в уровне техники) с помощью методик, известных в уровне техники. См., например, патент США №4741900 в отношении ионов металлов, которые могут быть конъюгированы с антителами для применения в качестве диагностических средств. Такую диагностику и выявление можно осуществлять с помощью соединения антитела с выявлемыми веществами, включая без ограничений различные ферменты, ферменты, включая без ограничений пероксидазу хрена, щелочную фосфатазу, бета-галактозидазу или ацетилхолинэстеразу; комплексы с простетической группой, такие как стрептавидин/биотин и авидин/биотин; флуоресцентные материалы, такие как без ограничений умбеллиферон, флуоресцеин, флуоресцеина изотиоцинат, родамин, дихлортриазиниламин-флуоресцеин, дансилхлорид или фикоэритрин; люминесцентный материал, такой как без ограничений люминол; биолюминесцентные материалы, такие как без ограничений люцифераза, люциферин и экворин; радиоактивный материал, такой как без ограничений висмут (213Bi), углерод (14C), хром (51Cr), кобальт (57Co), фтор (18F), гадолиний (153Gd, 159Gd), галлий (68Ga, 67Ga), германий (68Ge), гольмий (166Ho), индий (115In, 113In, 112In, 111In), йод (131I, 125I, 123I, 121I), лантан (140La), лютеций (177Lu), марганец (54Mn), молибден (99Mo), палладий (103Pd), фосфор (32P), празеодим (142Pr), прометий (149Pm), рений (186Re, 188Re), родий (105Rh), рутений (97Ru), самарий (153Sm), скандий (47Sc), селен (75Se), стронций (85Sr), сера (35S), технеций (99Tc), таллий (201Ti), олово (113Sn, 117Sn), тритий (3H), ксенон (133Xe), иттербий (169Yb, 175Yb), иттрий (90Y), цинк (65Zn); позитронно-активные металлы при использовании различных видов позитронно-эмиссионной томографии, а также нерадиоактивные парамагнитные ионы металлов.

[00110] Молекулы могут быть конъюгированы со вторым антителом с образованием гетероконъюгата антитела, как описано Segal в патенте США №4676980. Такие гетероконъюгатные антитела можно дополнительно связывать с гаптенами (такими как флуоресцеин и т.д.), или клеточными маркерами (например, 4-1-BB, B7-H4, B7-H7, CD4, CD8, CD14, CD25, CD27, CD40, CD68, CD163, CTLA4, GITR, LAG-3, OX40, TIM3, TIM4, TLR2, LIGHT и т.д.) или цитокинами (например, IL-7, IL-15, IL-12, IL-4 TGF-бета, IL-10, IL-17, IFNg, Flt3, BLys), или хемокинами (например, CCL21) и т.д.

[00111] Молекулы могут прикрепляться к твердым подложкам, которые особенно полезны для иммунологических анализов или очистки целевого антигена или других молекул, которые способны к связыванию с целевым антигеном, который был иммобилизирован на подложке посредством связывания с антителом или антигенсвязывающим фрагментом. Такие твердые подложки включают без ограничений стекло, целлюлозу, полиакриламид, нейлон, полистирол, поливинилхлорид или полипропилен.

[00112] Предполагаются молекулы нуклеиновых кислот (ДНК или РНК), которые кодируют любые такие антитела, слитые белки или фрагменты, а также векторные молекулы (такие как плазмиды), которые способны к переносу или репликации таких молекул нуклеиновых кислот и экспрессии таких антител, слитых белков или фрагментов в клеточной линии. Нуклеиновые кислоты могут быть одноцепочечными, двухцепочечными, могут содержать одноцепочечные и двухцепочечные части.

D. Предпочтительные модуляторные композиции

[00113] Применяемое в данном документе выражение «модулировать» относится к способности изменять эффект или результат. В частности, гуманизированный вариант антитела к H7CR человека или любой из его антигенсвязывающих фрагментов, который иммуноспецифически связывается с H7CR человека или молекулами, которые физиоспецифическим образом связываются с H7CR, способны к модулированию связывания между H7CR и его когнатными лигандами и/или модулированию передачи сигнала, которая проходит вследствие связывания H7CR-когнатный лиганд.

[00114] Антитело может представлять собой антитело-агонист, которое выступает в роли агониста H7CR. Выступающие в роли агониста антитела могут связываться с H7CR и стимулировать передачу сигнала через H7CR.

[00115] В одном из вариантов осуществления антитела, или их фрагменты, или слитые молекулы иммуноспецифически связываются с H7CR, но практически неспособны блокировать взаимодействие H7CR с B7-H7 in vitro или у индивида-реципиента или пациента-реципиента. Как используется в данном документе, молекула, которая «практически неспособна блокировать взаимодействие H7CR с B7-H7» обозначает, что присутствие таких молекул ослабляет взаимодействия H7CR-B7-H7 менее чем на 50%, более предпочтительно, менее чем на 40%, еще более предпочтительно, менее чем на 30%, еще более предпочтительно, менее чем на 20%, еще более предпочтительно, менее чем на 10%, еще более предпочтительно, менее чем на 5%, еще более предпочтительно, менее чем на 1%, и наиболее предпочтительно, совсем не может ослабить такое взаимодействие, что измеряется с помощью любого из анализов, раскрытых в данном документе. Такие антитела, фрагменты и слитые молекулы являются особенно полезными в качестве терапевтических средств или в диагностических, цитологических и гистологических анализах экспрессии H7CR (или B7-H7). Кроме того, мультиспецифические антитела к H7CR, антигенсвязывающие фрагменты антител к H7CR и их соответствующие слитые продукты, которые характеризуются дополнительной способностью связываться с B7-H7 или другими клеточными лигандами или рецепторами, являются особенно полезными в облегчении совместной локализации клеток, экпрессирующих такие лиганды или рецепторы, с клетками, которые экспрессируют H7CR.

[00116] Во втором варианте осуществления антитела или их фрагменты или слитые молекулы иммуноспецифически связываются с H7CR и способны практически блокировать взаимодействие H7CR с B7-H7 in vitro или у индивида-реципиента или пациента-реципиента. Применяемая в данном документе молекула, которая «способна практически блокировать взаимодействие H7CR с B7-H7» обозначает, что наличие таких молекул ослабляет взаимодействия H7CR-B7-H7 более чем на 50%, более предпочтительно, более чем на 60%, более чем на 70%, более чем на 80%, более чем на 90%, более чем на 95%, более чем на 99%, и наиболее предпочтительно, полностью ослабляет такое взаимодействие, что измеряется с помощью любого из анализов, раскрытых в данном документе. Такие антитела, фрагменты и слитые молекулы являются особенно полезными в ослаблении биологических эффектов взаимодействий H7CR-B7-H7.

[00117] Предпочтительный вариант осуществления предполагает гуманизированные антитела и фрагменты гуманизированных антител или антитела человека и фрагменты антител человека.

[00118] Более предпочтительно, такие молекулы будут иметь достаточную аффинность и авидность для возможности связывания с H7CR, когда они при экспрессируются в эндогенной концентрации и расположены на поверхности клеток индивида. Выражение “эндогенная концентрация” относится к уровню, на котором молекула экспрессируется в нативном состоянии (например, в отсутствие векторов экспрессии или рекомбинантных промоторов) в нормальной, опухолевой или инфицированной патогеном клетке.

(1) Предпочтительные антитела грызунов к H7CR человека и их CDR

[00119] Такие молекулы могут быть получены с помощью скрининга линий гибридом в отношении линий, вырабатывающих антитела, которые являются иммуноспецифическими к H7CR человека, и последующего необязательного скрининга среди таких линий в отношении линий, проявляющих модулирующую активность (например, нейтрализующую активность, агонистическую активность, измененную активность передачи сигнала и т.д.). В одном из вариантов осуществления антителами являются клоны антител хомяка к H7CR человека: 1.3, 4.5 и 7.8. Эти антитела способны к связыванию с H7CR человека и практически неспособны к блокированию взаимодействия H7CR с B7-H7. Антитела, экспрессируемые клонами антител к H7CR человека, были секвенированы для выявления их вариабельных доменов. Последовательности CDR вариабельных доменов показаны жирным шрифтом и подчеркнуты:

Клон 1.3 антитела к H7CR человека

Вариабельный участок легкой цепи:

DIVMTQSPSS LAVSAGEKVT ISCLSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR LTGVPDRFIG SGSGTDFTLT ISSVQAEDLG DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:5)

Вариабельный участок тяжелой цепи:

QIQLQESGPG LVKPSQSLSL TCSVTGFSIS TSGYYWTWIR QFPGKRLEWM

GYINYGGGTS YNPSLKSRIS ITRDTSKNQF LLHLNSVTTE DTATYCCATM

ADRFAFFDV W GQGIQVTVSS (SEQ ID NO:6)

Клон 4.5 антитела к H7CR человека

Вариабельный участок легкой цепи:

DIVMTQSPSS LAVSAGEKVT ISCLSSQSLF SSNTKRNYLN WYLQKPGQSP

KLLIYHASTR LTGVPGRFIG SGSGTDFTLT VSTVQAEDLG DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:7)

Вариабельный участок тяжелой цепи:

QIQLQESGPG LVKPSQSLSL TCSVTGFSIT TGGYYWNWIR QFPGKKLEWM

GYIYTSGRTS YNPSLKSRIS ITRDTSKNQF FLQLNSMTTE DTATYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:8)

Клон 7.8 антитела к H7CR человека

Вариабельный участок легкой цепи:

DIVMTQSPSS LTVSAGEKVT ISCLSSQSLF SSNTNRNYLS WYLQRPGQSP

KLLIYHASTR LTGVPGRFIG SGSGTDFTLT VSTVQAGDLG DYFCQQHYVT

PLT FGDGTRL EIK (SEQ ID NO:9)

Вариабельный участок тяжелой цепи:

QIQLQESGPG LVKPSQSLSL TCSVTGFSIT TGGYYWNWIR QFPGKKLEWM

GYIYSSGRTS YNPSLKSRIS ITRDTSKNQF FLQLNSVTTE DTATYYCADM

ADKGGWFDY W GQGTLVTVSS (SEQ ID NO:10)

(2) Консенсусные CDR антител к H7CR человека

[00120] Проводили анализ CDR идентифицированных антител для идентификации последовательностей консенсусных CDR и вероятных последовательностей вариантных CDR, которые обеспечивали бы подобные характеристики связывания. Такие вариантные CDR рассчитывали с помощью анализа Blosum62.iij в соответствии с таблицей 1. В таблице 1 представлены оценки замен в Blosum62.iij. Чем больше значение, тем более консервативной является замена, и, таким образом, более вероятно, что замена не повлияет на функцию.

Таблица 1
A R N D C Q E G H I L K M F P S T W Y V
A +4 -1 -2 -2 0 -1 -1 0 -2 -1 -1 -1 -1 -2 -1 +1 0 -3 -2 0
R -1 +5 0 -2 -3 +1 0 -2 0 -3 -2 +2 -1 -3 -2 -1 -1 -3 -2 -3
N -2 0 +6 +1 -3 0 0 0 +1 -3 -3 0 -2 -3 -2 +1 0 -4 -2 -3
D -2 -2 +1 +6 -3 0 +2 -1 -1 -3 -4 -1 -3 -3 -1 0 -1 -4 -3 -3
C 0 -3 -3 -3 +9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1
Q -1 +1 0 0 -3 +5 +2 -2 0 -3 -2 +1 0 -3 -1 0 -1 -2 -1 -2
E -1 0 0 +2 -4 +2 +5 -2 0 -3 -3 +1 -2 -3 -1 0 -1 -3 -2 -2
G 0 -2 0 -1 -3 -2 -2 +6 -2 -4 -4 -2 -3 -3 -2 0 -2 -2 -3 -3
H -2 0 +1 -1 -3 0 0 -2 +8 -3 -3 -1 -2 -1 -2 -1 -2 -2 +2 -3
I -1 -3 -3 -3 -1 -3 -3 -4 -3 +4 +2 -3 +1 0 -3 -2 -1 -3 -1 +3
L -1 -2 -3 -4 -1 -2 -3 -4 -3 +2 +4 -2 +2 0 -3 -2 -1 -2 -1 +1
K -1 +2 0 -1 -3 +1 +1 -2 -1 -3 -2 +5 -1 -3 -1 0 -1 -3 -2 -2
M -1 -1 -2 -3 -1 0 -2 -3 -2 +1 +2 -1 +5 0 -2 -1 -1 -1 -1 +1
F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 +6 -4 -2 -2 +1 +3 -1
P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 +7 -1 -1 -4 -3 -2
S +1 -1 +1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 +4 +1 -3 -2 -2
T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 +1 +5 -2 -2 0
W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 +1 -4 -3 -2 +11 +2 -3
Y -2 -2 -2 -3 -2 -1 -2 -3 +2 -1 -1 -2 -1 +3 -3 -2 -2 +2 +7 -1
V 0 -3 -3 -3 -1 -2 -2 -3 -3 +3 +1 -2 +1 -1 -2 -2 0 -3 -1 +4

[00121] Раскрыты антитела и антигенсвязывающие фрагменты, имеющие 1, 2, 3, 4, 5 или 6 вариантных CDR. Было идентифицировано значительное количество отличающихся CDR, что обеспечило распознавание CDR остатков, которые, по-видимому, требуются в любом варианте конкретного идентифицированного CDR. Такие остатки показаны жирным шрифтом в таблице 2 и таблице 3. Для тех остатков, которые, как обнаружено, варьируют в пределах сравниваемых CDR, на основе оценок замен в таблице 1 предполагается способ определения значений идентичности разрешенных замен. Например, если обнаружено, что конкретный остаток в конкретном CDR варьирует по R или S, то поскольку R и S имеют оценку замены -1, любая замена R или S, имеющая оценку замены -1 или более, также вероятна, как и наблюдаемые варианты (R или S) (или более вероятны, чем R или S), для создания CDR варианта, имеющего характеристики связывания, которые достаточно похожи на таковые конкретного CDR для обеспечения использования CDR варианта вместо него с целью создания функционального антитела к H7CR или антигенсвязывающего фрагмента. Для каждого положения выбор остатка, имеющего более высокую оценку замены, является более предпочтительным по сравнению с выбором остатка, имеющего более низкую оценку замены.

[00122] В таблице 2 представлен анализ CDR легкой цепи антител к H7CR и предложена консенсусная последовательность определенных и предпочтительных вариантных CDR легкой цепи (“LC”) антител к H7CR.

Таблица 2
CDR легкой цепи антител к H7CR
CDR1 легкой цепи
Антитело Последовательность SEQ ID NO
1,3 Q S L F S S N T N R N Y 29
4,5 Q S L F S S N T K R N Y 30
7,8 Q S L F S S N T N R N Y 29
Консенсусная последовательность CDR1 LC: Q S L F S S N T X1 R N Y 31
X1 представляет собой N, или K, или замену, имеющую равную или большую оценку замены (т.e. ≥ 0): R, N, Q, E, K или S
CDR2 легкой цепи
Антитело Последовательность SEQ ID NO
1,3 H A S 32
4,5 H A S 32
7,8 H A S 32
Консенсусная последовательность CDR2 LC: H A S 32

CDR3 легкой цепи
Антитело Последовательность SEQ ID NO
1,3 Q H H Y E T P L T 45
4,5 Q Q H Y E T P L T 46
7,8 Q Q H Y V T P L T 47
Консенсусная последовательность CDR3 LC: Q X1 H Y X2 T P L T 48
X1 представляет собой H, или Q, или замену, имеющую равную или большую оценку замены (т.e. ≥ 0): R, N, Q, E или H
X2 представляет собой E, или V, или замену, имеющую равную или большую оценку замены (т.e. ≥ -2): A, Q, E, K, M, P, S, T, Y или V

[00123] В таблице 3 представлен анализ CDR тяжелой цепи антител к H7CR и предложена консенсусная последовательность определенных и предпочтительных вариантных CDR тяжелой цепи (“HC”) антител к H7CR.

Таблица 3
CDR тяжелой цепи антител к H7CR
CDR1 тяжелой цепи
Антитело Последовательность SEQ ID NO
1,3 G F S I S T S G 49
4,5 G F S I T T G G 50
7,8 G F S I T T G G 50
Консенсусная последовательность CDR1 HC: G F D I X1 T X2 G 51
X1 представляет собой S, или T, или замену, имеющую равную или большую оценку замены (т.e. ≥ +1): S или T
X2 представляет собой S, или G, или замену, имеющую равную или большую оценку замены (т.e. ≥ 0): A, N, G или S

CDR2 тяжелой цепи
Антитело Последовательность SEQ ID NO
1,3 I N Y G G G T 52
4,5 I Y T S G R T 53
7,8 I Y S S G R T 54
Консенсусная последовательность CDR2 HC: I X1 X2 X3 G X4 T 55
X1 представляет собой N, или Y, или замену, имеющую равную или большую оценку замены (т.e. ≥ -2): A, R, N, Q, E, H, K, M, S, T, Y
X2 представляет собой Y, T, или S, или замену, имеющую равную или большую оценку замены (т.e. ≥ -2): A, R, N, C, Q, E, H, I, L, K, M, F, S, T, Y или V
X3 представляет собой S, или G, или замену, имеющую равную или большую оценку замены (т.e. ≥ 0): A, N, G или S
X4 представляет собой G, или R, или замену, имеющую равную или большую оценку замены (т.e. ≥ -2): A, R, N, D, Q, E, G, H, K, P, S или T
CDR3 тяжелой цепи
Антитело Последовательность SEQ ID NO
1,3 A T M A D R F A F F D V 56
4,5 A D M A D K G G W F A Y 57
7,8 A D M A D K G G W F D Y 58
Консенсусная последовательность CDR3 HC: A X1 M A D X2 X3 X4 X5 F X6 X7 59
X1 представляет собой T, или D, или замену, имеющую равную или большую оценку замены (т.e. ≥ -1): N, D, Q, E, K, P, S или T
X2 представляет собой R, или K, или замену, имеющую равную или большую оценку замены (т.e. ≥ +2): R или K

X3 представляет собой F, или G, или замену, имеющую равную или большую оценку замены (т.e. ≥ -3): A, R, N, D, C, Q, E, G, H, K, M, F, S, T, W, Y или V
X4 представляет собой A, или G, или замену, имеющую равную или большую оценку замены (т.e. ≥ 0): A, G или S
X5 представляет собой F, или W, или замену, имеющую равную или большую оценку замены (т.e. ≥ +1): F, W или Y
X6 представляет собой A, или D, или замену, имеющую равную или большую оценку замены (т.e. ≥ -4): A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y или V
X7 представляет собой V, или Y, или замену, имеющую равную или большую оценку замены (т.e. ≥ -2): A, R, N, D, Q, E, G, H, K, P, S или T

[00124] Таким образом, помимо антител и их антигенсвязывающих фрагментов, которые имеют CDR антител к H7CR: 1.3, 4.5 и 7.8, также предполагаются антитела и их антигенсвязывающие фрагменты, которые имеют CDR, имеющие описанные выше консенсусные последовательности легкой и/или тяжелой цепей.

[00125] Антитела или их фрагменты включают аминокислотную последовательность вариабельного домена тяжелой цепи и/или вариабельного домена легкой цепи, которая по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 55%, по меньшей мере на 60%, по меньшей мере на 65%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95% или по меньшей мере на 99% идентична аминокислотной последовательности вариабельного участка тяжелой цепи и/или легкой цепи моноклонального антитела хомяка, вырабатываемого любым из вышеупомянутых клонов, и они проявляют иммуноспецифическое связывание с H7CR. Кроме того, антитела или их фрагменты могут включать CDR, который по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 55%, по меньшей мере на 60%, по меньшей мере на 65%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95% или по меньшей мере на 99% идентичен аминокислотной последовательности CDR вышеупомянутых клонов, и они проявляют иммуноспецифическое связывание с H7CR. Определение процентной идентичности двух аминокислотных последовательностей можно определить с помощью сравнения белков в программе BLAST.

[00126] В конкретном варианте осуществления антитело или его антигенсвязывающий фрагмент содержит один, два, три, четыре, пять или, более предпочтительно, все 6 CDR вышеописанных предпочтительных антител и будет проявлять способность к связыванию с H7CR человека.

(3) Предпочтительные гуманизированные антитела к H7CR человека и их CDR

[00127] Были получены многочисленные гуманизированные производные легкой и тяжелой цепей антител 1.3 и 4.5 к H7CR человека.

(a) Гуманизированные варианты антитела 1.3 к H7CR человека

[00128] Аминокислотные последовательности вариабельного участка легкой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGKV4-1*01, показаны ниже (CDR показаны подчеркнутыми):

1. VL1A IGKV4-1*01 (гуманизированный 1):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTNRNYLA WYQQKPGQPP

KLLIYHASTR ESGVPDRFSG SGSGTDFTLT ISSLQAEDVA VYYCQHHYET

PLT FGQGTKL EIK (SEQ ID NO:17)

2. VL1B IGKV4-1*01 (гуманизированный 2):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTNRNYLN WYQQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:18)

3. VL1C IGKV4-1*01 (гуманизированный 3):

DIVMTQSPDS LAVSLGERAT INCLSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFIG SGSGTDFTLT ISSLQAEDVG DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:19)

[00129] Аминокислотные последовательности вариабельного участка легкой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGKV2D-28*01, показаны ниже (CDR показаны подчеркнутыми):

1. VL2A IGKV2D-28*01 (гуманизированный 1):

DIVMTQSPLS LPVTPGEPAS ISCRSSQSLF SSNTNRNYLD WYLQKPGQSP

QLLIYHASNR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:20)

2. VL2B IGKV2D-28*01 (гуманизированный 2):

DIVMTQSPLS LPVTPGEPAS ISCRSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:21)

3. VL2C IGKV2D-28*01 (гуманизированный 3):

DIVMTQSPLS LPVTPGEPAS ISCLSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:22)

[00130] Аминокислотные последовательности вариабельного участка тяжелой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGHV4-31*02, показаны ниже (CDR показаны подчеркнутыми):

1. VH1A IGHV4-31*02 (гуманизированный 1):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QHPGKGLEWI

GYINYGGGTY YNPSLKSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:23)

2. VH1B IGHV4-31*02 (гуманизированный 2):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QHPGKRLEWI

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYCCATM

A DRFAFFDV W GQGTMVTVSS (SEQ ID NO:24)

3. VH1C IGHV4-31*02 (гуманизированный 3):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QFPGKRLEWM

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:25)

[00131] Аминокислотные последовательности вариабельного участка тяжелой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса AAY33199.1, показаны ниже (CDR показаны подчеркнутыми):

1. VH2A AAY33199.1 (гуманизированный 1):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QYPGKGLEWI

GYINYGGGTY YNPSLKSRVT ISVDTSKNQF SLKLTSVTAA DTAVYHCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:26)

2. VH2B AAY33199.1 (гуманизированный 2):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QYPGKRLEWI

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLTSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:27)

3. VH2C AAY33199.1 (гуманизированный 3):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QFPGKRLEWM

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLTSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:28)

[00132] Антитела и их антигенсвязывающие фрагменты могут включать любую из 36 комбинаций вышеописанных гуманизированных вариантов антитела 1.3 к H7CR человека. Например, такие антитела включают комбинации, показанные в таблице 4:

Таблица 4
Гуманизированные варианты антитела 1.3 к H7CR человека
Гуманизи-рованный вариант № Легкая цепь SEQ ID NO. Тяжелая цепь SEQ ID NO.
1 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH1A IGHV4-31*02 (гуманизированный 1) 23
2 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH1B IGHV4-31*02 (гуманизированный 2): 24
3 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH1C IGHV4-31*02 (гуманизированный 3) 25
4 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH2A AAY33199.1 (гуманизированный 1) 26
5 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH2B AAY33199.1 (гуманизированный 2) 27

6 VL1A IGKV4-1*01 (гуманизированный 1) 17 VH2C AAY33199.1 (гуманизированный 3) 28
7 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH1A IGHV4-31*02 (гуманизированный 1) 23
8 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH1B IGHV4-31*02 (гуманизированный 2): 24
9 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH1C IGHV4-31*02 (гуманизированный 3) 25
10 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH2A AAY33199.1 (гуманизированный 1) 26
11 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH2B AAY33199.1 (гуманизированный 2) 27
12 VL1B IGKV4-1*01 (гуманизированный 2) 18 VH2C AAY33199.1 (гуманизированный 3) 28
13 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH1A IGHV4-31*02 (гуманизированный 1) 23
14 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH1B IGHV4-31*02 (гуманизированный 2): 24
15 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH1C IGHV4-31*02 (гуманизированный 3) 25
16 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH2A AAY33199.1 (гуманизированный 1) 26

17 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH2B AAY33199.1 (гуманизированный 2) 27
18 VL1C IGKV4-1*01 (гуманизированный 3) 19 VH2C AAY33199.1 (гуманизированный 3) 28
19 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH1A IGHV4-31*02 (гуманизированный 1) 23
20 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH1B IGHV4-31*02 (гуманизированный 2): 24
21 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH1C IGHV4-31*02 (гуманизированный 3) 25
22 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH2A AAY33199.1 (гуманизированный 1) 26
23 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH2B AAY33199.1 (гуманизированный 2) 27
24 VL2A IGKV2D-28*01 (гуманизированный 1) 20 VH2C AAY33199.1 (гуманизированный 3) 28
25 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH1A IGHV4-31*02 (гуманизированный 1) 23
26 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH1B IGHV4-31*02 (гуманизированный 2): 24
27 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH1C IGHV4-31*02 (гуманизированный 3) 25

28 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH2A AAY33199.1 (гуманизированный 1) 26
29 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH2B AAY33199.1 (гуманизированный 2) 27
30 VL2B IGKV2D-28*01 (гуманизированный 2) 21 VH2C AAY33199.1 (гуманизированный 3) 28
31 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH1A IGHV4-31*02 (гуманизированный 1) 23
32 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH1B IGHV4-31*02 (гуманизированный 2): 24
33 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH1C IGHV4-31*02 (гуманизированный 3) 25
34 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH2A AAY33199.1 (гуманизированный 1) 26
35 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH2B AAY33199.1 (гуманизированный 2) 27
36 VL2C IGKV2D-28*01 (гуманизированный 3) 22 VH2C AAY33199.1 (гуманизированный 3) 28

(b) Гуманизированные варианты антитела 4.5 к H7CR человека

[00133] Аминокислотные последовательности вариабельного участка легкой цепи предпочтительных гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGKV4-1*01, показаны ниже (CDR показаны подчеркнутыми):

1. VL1A IGKV4-1*01 (гуманизированный 1):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTKRNYLA WYQQKPGQPP

KLLIYHASTR ESGVPDRFSG SGSGTDFTLT ISSLQAEDVA VYYCQQHYET

PLT FGQGTRLEIK (SEQ ID NO:33)

2. VL1B IGKV4-1*01 (гуманизированный 2):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTKRNYLN WYQQKPGQPP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:34)

3. VL1C IGKV4-1*01 (гуманизированный 3):

DIVMTQSPDS LAVSLGERAT INCLSSQSLF SSNTKRNYLN WYQQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:35)

[00134] Аминокислотные последовательности вариабельного участка легкой цепи предпочтительных гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGKV2D-40*01, показаны ниже (CDR показаны подчеркнутыми):

1. VL2A IGKV2D-40*01 (гуманизированный 1):

DIVMTQTPLS LPVTPGEPAS ISCRSSQSLF SSNTKRNYLD WYLQKPGQSP

QLLIYHASYR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQQHYET

PLT FGQGTRL EIK (SEQ ID NO:36)

2. VL2B IGKV2D-40*01 (гуманизированный 2):

DIVMTQTPLS LPVTPGEPAS ISCRSSQSLF SSNTKRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:37)

3. VL2C IGKV2D-40*01 (гуманизированный 3):

DIVMTQTPSS LPVTPGEPAS ISCLSSQSLF SSNTKRNYLN WYLQKPGQSP

KLLIY HAS TR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYFC QQHYET

PLT FGDGTRL EIK (SEQ ID NO:38)

[00135] Аминокислотные последовательности вариабельного участка тяжелой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGHV4-31*02, показаны ниже (CDR показаны подчеркнутыми):

1. VH1A IGHV4-31*02 (гуманизированный 1):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWSWIR QHPGKGLEWI

GYIYTSGRTY YNPSLKSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:39)

2. VH1B IGHV4-31*02 (гуманизированный 2):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWNWIR QHPGKKLEWI

GYIYTSGRTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:40)

3. VH1C IGHV4-31*02 (гуманизированный 3):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWNWIR QFPGKKLEWM

GY IYTSGRT S YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYYC ADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:41)

[00136] Аминокислотные последовательности вариабельного участка тяжелой цепи предпочтительных гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGHV2-5*01, показаны ниже (CDR показаны подчеркнутыми):

1. VH2A IGHV2-5*01 (гуманизированный 1):

QITLKESGPT LVKPTQTLTL TCTFSGFSIT TGGYYVGWIR QPPGKALEWL

ALIYTSGRTR YSPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:42)

2. VH2B IGHV2-5*01 (гуманизированный 2):

QITLKESGPT LVKPTQTLTL TCTVSGFSIT TGGYYWNWIR QPPGKKLEWL

ALIYTSGRTS YNPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:43)

3. VH2C IGHV2-5*01 (гуманизированный 3):

QIQLKESGPT LVKPTQTLTL TCTVSGFSIT TGGYYWNWIR QPPGKKLEWM

AL IYTSGRT S YNPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYC ADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:44)

[00137] Антитела и их антигенсвязывающие фрагменты могут включать любую из 36 комбинаций вышеописанных гуманизированных вариантов антитела 4.5 к H7CR человека. В частности, такие антитела включают комбинации, показанные в таблице 5:

Таблица 5
Гуманизированные варианты антитела 4.5 к H7CR человека
Гуманизированный вариант № Легкая цепь SEQ ID NO. Тяжелая цепь SEQ ID NO.
1 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH1A IGHV4-31*02 (гуманизированный 1) 39

2 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH1B IGHV4-31*02 (гуманизированный 2): 40
3 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH1C IGHV4-31*02 (гуманизированный 3) 41
4 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH2A IGHV2-5*01 (гуманизированный 1) 42
5 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH2B IGHV2-5*01 (гуманизированный 2) 43
6 VL1A IGKV4-1*01 (гуманизированный 1) 33 VH2C IGHV2-5*01 (гуманизированный 3) 44
7 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH1A IGHV4-31*02 (гуманизированный 1) 39
8 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH1B IGHV4-31*02 (гуманизированный 2): 40
9 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH1C IGHV4-31*02 (гуманизированный 3) 41
10 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH2A IGHV2-5*01 (гуманизированный 1) 42
11 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH2B IGHV2-5*01 (гуманизированный 2) 43
12 VL1B IGKV4-1*01 (гуманизированный 2) 34 VH2C IGHV2-5*01 (гуманизированный 3) 44

13 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH1A IGHV4-31*02 (гуманизированный 1) 39
14 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH1B IGHV4-31*02 (гуманизированный 2): 40
15 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH1C IGHV4-31*02 (гуманизированный 3) 41
16 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH2A IGHV2-5*01 (гуманизированный 1) 42
17 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH2B IGHV2-5*01 (гуманизированный 2) 43
18 VL1C IGKV4-1*01 (гуманизированный 3) 35 VH2C IGHV2-5*01 (гуманизированный 3) 44
19 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH1A IGHV4-31*02 (гуманизированный 1) 39
20 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH1B IGHV4-31*02 (гуманизированный 2): 40
21 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH1C IGHV4-31*02 (гуманизированный 3) 41
22 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH2A IGHV2-5*01 (гуманизированный 1) 42
23 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH2B IGHV2-5*01 (гуманизированный 2) 43

24 VL2A IGKV2D-40*01 (гуманизированный 1) 36 VH2C IGHV2-5*01 (гуманизированный 3) 44
25 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH1A IGHV4-31*02 (гуманизированный 1) 39
26 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH1B IGHV4-31*02 (гуманизированный 2): 40
27 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH1C IGHV4-31*02 (гуманизированный 3) 41
28 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH2A IGHV2-5*01 (гуманизированный 1) 42
29 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH2B IGHV2-5*01 (гуманизированный 2) 43
30 VL2B IGKV2D-40*01 (гуманизированный 2) 37 VH2C IGHV2-5*01 (гуманизированный 3) 44
31 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH1A IGHV4-31*02 (гуманизированный 1) 39
32 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH1B IGHV4-31*02 (гуманизированный 2): 40
33 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH1C IGHV4-31*02 (гуманизированный 3) 41
34 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH2A IGHV2-5*01 (гуманизированный 1) 42

35 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH2B IGHV2-5*01 (гуманизированный 2) 43
36 VL2C IGKV2D-40*01 (гуманизированный 3) 38 VH2C IGHV2-5*01 (гуманизированный 3) 44

[00138] Раскрытые антитела или их фрагменты включают аминокислотную последовательность вариабельного домена тяжелой цепи и/или вариабельного домена легкой цепи, которая по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 55%, по меньшей мере на 60%, по меньшей мере на 65%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95% или по меньшей мере на 99% идентична аминокислотной последовательности вариабельного домена тяжелой цепи и/или легкой цепи мышиного моноклонального антитела, вырабатываемого любым из вышеупомянутых клонов, и они проявляют иммуноспецифическое связывание с H7CR человека. Другие антитела или их фрагменты включают CDR, который по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 55%, по меньшей мере на 60%, по меньшей мере на 65%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95% или по меньшей мере на 99% идентичен аминокислотной последовательности CDR вышеупомянутых клонов, и они проявляют иммуноспецифическое связывание с H7CR. Определение процентной идентичности двух аминокислотных последовательностей можно выполнить с помощью сравнения белков в программе BLAST.

[00139] В предпочтительном варианте осуществления антитело представляет собой молекулу гуманизированного иммуноглобулина (например, антитело, диатело, слитый белок и т.д.), которая включает один, два или три CDR легкой цепи и один, два или три CDR тяжелой цепи (наиболее предпочтительно три CDR легкой цепи и три CDR тяжелой цепи), где CDR легкой цепи включают:

(1) CDR1 легкой цепи гуманизированного варианта антитела 1.3 к H7CR человека;

(2) CDR2 легкой цепи гуманизированного варианта антитела 4.5 к H7CR человека;

(3) CDR3 легкой цепи гуманизированного варианта антитела 7.8 к H7CR человека;

(4) CDR1 легкой цепи и CDR2 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(5) CDR1 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(6) CDR2 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

или

(7) CDR1 легкой цепи, CDR2 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека.

[00140] В альтернативном предпочтительном варианте осуществления молекула гуманизированного иммуноглобулина включает один, два или три CDR легкой цепи и один, два или три CDR тяжелой цепи (наиболее предпочтительно три CDR легкой цепи и три CDR тяжелой цепи), где CDR тяжелой цепи включают:

(1) CDR1 тяжелой цепи гуманизированного варианта антитела 1.3 к H7CR человека;

(2) CDR2 тяжелой цепи гуманизированного варианта антитела 4.5 к H7CR человека;

(3) CDR3 тяжелой цепи гуманизированного варианта антитела 7.8 к H7CR человека;

(4) CDR1 тяжелой цепи и CDR2 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(5) CDR1 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(6) CDR2 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

или

(7) CDR1 тяжелой цепи, CDR2 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека.

[00141] В особо предпочтительном варианте осуществления антитело представляет собой молекулу гуманизированного иммуноглобулина, которая включает один, два или три CDR легкой цепи и один, два или три CDR тяжелой цепи (наиболее предпочтительно три CDR легкой цепи и три CDR тяжелой цепи), где CDR легкой цепи включают:

(1) CDR1 легкой цепи гуманизированного варианта антитела 1.3 к H7CR человека;

(2) CDR2 легкой цепи гуманизированного варианта антитела 4.5 к H7CR человека;

(3) CDR3 легкой цепи гуманизированного варианта антитела 7.8 к H7CR человека;

(4) CDR1 легкой цепи и CDR2 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(5) CDR1 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(6) CDR2 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

или

(7) CDR1 легкой цепи, CDR2 легкой цепи и CDR3 легкой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека,

и где CDR тяжелой цепи включают:

(1) CDR1 тяжелой цепи гуманизированного варианта антитела 1.3 к H7CR человека;

(2) CDR2 тяжелой цепи гуманизированного варианта антитела 4.5 к H7CR человека;

(3) CDR3 тяжелой цепи гуманизированного варианта антитела 7.8 к H7CR человека;

(4) CDR1 тяжелой цепи и CDR2 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(5) CDR1 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

(6) CDR2 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека;

или

(7) CDR1 тяжелой цепи, CDR2 тяжелой цепи и CDR3 тяжелой цепи гуманизированного варианта антитела 1.3, 4.5 или 7.8 к H7CR человека.

[00142] Наиболее предпочтительно, такие CDR будут относиться к одному и тому же гуманизированному варианту антитела 1.3, 4.5 или 7.8 к H7CR человека, соответственно.

[00143] В конкретном варианте осуществления антитело или его антигенсвязывающий фрагмент будут включать один, два, три, четыре, пять или, более предпочтительно, все 6 CDR гуманизированных вариантов антитела 1.3, 4.5 или 7.8 к H7CR человека и будут проявлять такую же способность к связыванию с H7CR человека, что и родительское антитело.

E. Терапевтические и профилактические применения предпочтительных композиций

[00144] Применяемые в данном документе выражения «лечить», «лечебный», «лечение» и «терапевтическое применение» относятся к устранению, снижению или ослаблению интенсивности одного или нескольких симптомов заболевания или нарушения, на которые будет оказывать благоприятное воздействие повышенный или пониженный иммунный ответ. Применяемое в данном документе выражение «терапевтически эффективное количество» относится к такому количеству терапевтического средства, достаточному для опосредования измененного иммунного ответа, и более предпочтительно, для клинически значимого измененного иммунного ответа, достаточного для опосредования снижения или ослабления интенсивности симптома заболевания или состояния. Эффект является клинически значимым, если его величина достаточна для воздействия на здоровье или прогноз заболевания индивида-реципиента. Терапевтически эффективное количество может относиться к количеству терапевтического средства, достаточному для снижения или сведения к минимуму развития заболевания, например, задержки или сведения к минимуму распространения рака. Терапевтически эффективное количество может также относиться к количеству терапевтического средства, которое обеспечивает терапевтический эффект при лечении или контроле заболевания. Также терапевтически эффективное количество по отношению к терапевтическому средству обозначает то количество терапевтического средства отдельно или в комбинации с другими видами терапии, которое обеспечивает терапевтический эффект при лечении или контроле заболевания, например, достаточный для усиления терапевтической эффективности терапевтического антитела, достаточной для лечения или контроля заболевания.

[00145] Применяемое в данном документе выражение «профилактическое средство» относится к средству, которое можно применять для предотвращения нарушения или заболевания до выявления любых симптомов такого нарушения или заболевания. «Профилактически эффективное» количество представляет собой количество профилактического средства, достаточного для опосредования такой защиты. Профилактически эффективное количество может также относиться к количеству профилактического средства, которое обеспечивает профилактический эффект в предотвращении заболевания. Также профилактически эффективное количество по отношению к профилактическому средству обозначает количество профилактического средства отдельно или в комбинации с другими средствами, которое обеспечивает профилактический эффект в предотвращении заболевания.

[00146] Величины дозы и частоты введения, предполагаемые в данном документе, охватываются выражениями терапевтически эффективный и профилактически эффективный. Доза и частота также обычно будут варьировать в зависимости от факторов, специфических для каждого пациента, в зависимости от вводимых специфических терапевтических или профилактических средств, тяжести и типа рака, пути введения, а также возраста, массы тела, ответа и истории болезни пациента. Подходящие схемы могут быть выбраны специалистом в данной области техники с учетом таких факторов и с учетом, например, доз, описанных в литературе и рекомендованных в Physician's Desk Reference (56th Ed., 2002).

1. Применения положительных модуляторов иммунной системы

[00147] Один вариант осуществления относится к H7CR-связывающим молекулам, таким как антитела к H7CR (и фрагментам таких молекул, которые связываются с H7CR) или B7-H7 Ig, которые посредством связывания с H7CR выступают в роли агониста (т.е. усиливают) T-клеточную пролиферацию и/или выработку цитокинов. Введение таких молекул индивиду положительно модулирует иммунную систему индивида. Поскольку экспрессия H7CR связана с фенотипом наивных Т-клеток, то введение таких молекул будет эффективным для повышения примирования и активации Т-клеток и поэтому будет благоприятным для комбинации с вакцинами. Более того, антитело-агонист к H7CR (и B7-H7 Ig) было бы благоприятным для комбинирования с молекулами, которые направлены на важные элементы в иммунной системе и ингибируют рецепторы, которые в норме ослабляли бы иммунный ответ: антитело к PD-1, антитело к B7-H1, антитело к CTLA4 и т.д. Такие антитела лучше вводить последовательно, т.e. сначала антитело к H7CR для усиления примирования T-клеток, затем, например, антитело к PD-1 для предотвращения истощения T-клеток. Также рассматриваются биспецифические молекулы, направленные на H7CR и блокирование важных элементов в иммунной системе.

[00148] Положительная модуляция иммунной системы особенно предпочтительна при лечении злокачественных опухолей и хронических инфекций (например, ВИЧ-инфекции, СПИДа и т.д.) и, таким образом, раскрытые молекулы полезны в лечении таких нарушений. Было показано, что макрофаги оказывают значительное влияние на начальных стадиях ВИЧ-инфекции (Carter, C. A. et al. (2008) «Cell Biology Of HIV-1 Infection Of Macrophages» Ann. Rev. Microbiol. 62:425-443; Noursadeghi, M. et al. (2006) «HIV-1 Infection Of Mononuclear Phagocytic Cells: The Case For Bacterial Innate Immune Deficiency In AIDS» Lancet Infect. Dis. 6:794-804). Соответственно, антитела (особенно если они конъюгированы с токсином), которые связываются с B7-H7, полезны для предотвращения и лечения ВИЧ-инфекции.

[00149] Применяемое в данном документе выражение «рак» относится к новообразованию или опухоли, возникшим в результате в результате аномального неконтролируемого роста клеток. Как используется в данном документе, рак явно включает лейкозы и лимфомы. Выражение относится к заболеванию, в которое вовлечены клетки, которые имеют потенциал к метастазированию в отдаленные участки и проявляют фенотипические признаки, которые отличаются от таковых у раковых клеток, не являющихся раковыми, например, формирование колоний на трехмерной подложке, такой как агар, или формирование тубулярных сетей или паутинообразных матриц в трехмерной базальной мембране или препарате внеклеточного матрикса. Клетки, не являющиеся раковыми, не формируют колоний в мягком агаре и формируют отдельные структуры сферического типа в трехмерной базальной мембране или препаратах внеклеточного матрикса.

[00150] Злокачественные опухоли и соответствующие нарушения, которые можно лечить или предотвращать, включают без ограничений следующее: лейкозы, включая без ограничений острый лейкоз, острый лимфоцитарный лейкоз, острые миелоцитарные лейкозы, такие как миелобластические, промиелоцитарные, миеломоноцитарные, моноцитарные лейкозы, эритролейкозы и миелодиспластический синдром, хронические лейкозы, такие как без ограничений хронический миелоцитарный (гранулоцитарный) лейкоз, хронический лимфоцитарный лейкоз, лейкоз волосковых клеток; истинная полицитемия; лимфомы, такие как без ограничений ходжкинская лимфома, неходжкинская лимфома; множественные миеломы, такие как без ограничений тлеющая множественная миелома, несекреторная миелома, остеосклеротическая миелома, лейкоз плазматических клеток, солитарная плазмоцитома и экстрамедуллярная плазмоцитома; макроглобулинемия Вальденстрема; моноклональная гаммапатия неустановленной этиологии; доброкачественная моноклональная гаммапатия; болезнь тяжелых цепей; саркомы костей и соединительной ткани, такие как без ограничений саркома кости, остеосаркома, хондросаркома, саркома Юинга, гигантоклеточная саркома, фибросаркома кости, хордома, периостальная саркома, саркомы мягких тканей, ангиосаркома (гемангиосаркома), фибросаркома, саркома Капоши, лейомиосаркома, липосаркома, лимфангиосаркома, неврилеммома, рабдомиосаркома, синовиальная саркома; опухоли мозга, включая без ограничений глиому, астроцитому, глиому ствола мозга, эпендимому, олигодендроглиому, неглиальную опухоль, неврилеммому слухового нерва, краниофарингиому, медуллобластому, менингиому, пинеоцитому, пинеобластому, первичную лимфому мозга; рак молочной железы, включая без ограничений аденокарциному, лобулярную (мелкоклеточную) карциному, внутрипротоковую карциному, медуллярный рак молочной железы, слизеобразующий рак молочной железы, тубулярный рак молочной железы, папиллярный рак молочной железы, болезнь Пэджета и отечно-инфильтративный рак молочной железы; рак надпочечников, включая без ограничений феохромоцитомную и адренокортикальную карциному; рак щитовидной железы, такой как без ограничений папиллярный или фолликулярный рак щитовидной железы, медуллярный рак щитовидной железы и анапластический рак щитовидной железы; рак поджелудочной железы, включая без ограничений инсулиному, гастриному, глюкагоному, випому, соматостатиному и карциноидную опухоль и опухоль островковых клеток; злокачественные опухоли гипофиза, включая без ограничений болезнь Кушинга, пролактиному, акромегалию и несахарный диабет; злокачественные опухоли глаз, включая без ограничений меланому глаза, такую как меланома радужной оболочки, хороидальную меланому и меланому цилиарного тела и ретинобластому; злокачественные опухоли влагалища, включая без ограничений плоскоклеточную карциному, аденокарциному и меланому; рак вульвы, включая без ограничений плоскоклеточную карциному, меланому, аденокарциному, карциному базальных клеток, саркому и болезнь Пэджета; злокачественные опухоли шейки матки, включая без ограничений плоскоклеточную карциному и аденокарциному; злокачественные опухоли матки, включая без ограничений карциному эндометрия и саркому матки; злокачественные опухоли яичников, включая без ограничений эпителиальную карциному яичников, пограничную опухоль, эмбрионально-клеточную опухоль и стромальную опухоль; злокачественные опухоли пищевода, включая без ограничений плоскоклеточный рак, аденокарциному, аденоидно-кистозную карциному, мукоэпидермоидную карциному, аденосквамозную карциному, саркому, меланому, плазмоцитому, бородавчатую карциному и овсяно-клеточную (мелкоклеточную) карциному; злокачественные опухоли желудка, включая без ограничений аденокарциному, грибовидно разрастающуюся (полипоид), изъязвленную, поверхностно распространяющуюся, диффузно распространяющуюся, злокачественную лимфому, липосаркому, фибросаркому и карциносаркому; злокачественные опухоли кишечника; злокачественные опухоли прямой кишки; злокачественные опухоли печени, включая без ограничений гепатоцеллюлярную карциному и гепатобластому, злокачественные опухоли желчного пузыря, включая без ограничений аденокарциному; холангиокарциномы, включая без ограничений папиллярные, узловые и диффузные; злокачественные опухоли легких, включая без ограничений немелкоклеточный рак легких, плоскоклеточную карциному (эпидермоидную карциному), аденокарциному, крупноклеточную карциному и мелкоклеточный рак легких; злокачественные опухоли яичек, включая без ограничений герминому, семиному, анапластическую, классическую (типичную), сперматоцитарную, несеминому, эмбриональную карциному, тератому, карциному, хориокарциному (опухоль желточного мешка), злокачественные опухоли предстательной железы, включая без ограничений аденокарциному, лейомиосаркому и рабдомиосаркому; злокачественные опухоли пениса; злокачественные опухли ротовой полости, включая без ограничений плоскоклеточную карциному; базальноклеточные злокачественные опухоли; злокачественные опухоли слюнных желез, включая без ограничений аденокарциному, мукоэпидермоидную карциному и аденоидо-кистозную карциному; злокачественные опухоли глотки, включая без ограничений плоскоклеточный рак и бородавчатый рак; злокачественные опухоли кожи, включая без ограничений базальноклеточную карциному, плоскоклеточную карциному и меланому, поверхностно распространяющуюся меланому, узелковую меланому, злокачественную меланому лентиго, акральную лентигинозную меланому; злокачественные опухоли почек, включая без ограничений почечно-клеточный рак, аденокарциному, гипернефрому, фибросаркому, рак переходных клеток (почечной лоханки и/или мочеточника); опухоль Вильмса; злокачественные опухоли мочевого пузыря, включая без ограничений карциному переходных клеток, плоскоклеточный рак, аденокарциному, карциносаркому. Также злокачественные опухоли включают миксосаркому, остеогенную саркому, эндотелиосаркому, лимфангиотелиосаркому, мезотелиому, синовиому, гемангиобластому, эпителиальную карциному, цистаденосаркому, бронхогенную карциному, карциному потовых желез, карциному сальных желез, папиллярную карциному и папиллярные аденокарциномы (обзор таких нарушений см. Fishman et al., 1985, Medicine, 2d Ed., J.B. Lippincott Co., Philadelphia and Murphy et al., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A., Inc., United States of America).

[00151] Соответственно, раскрытые способы и композиции также полезны в лечении, ингибировании и предотвращении ряда злокачественных опухолей или других аномальных пролиферативных заболеваний, включая (без ограничений) следующее: карциному, включая таковую мочевого пузыря, молочной железы, кишечника, почки, печени, легкого, яичника, поджелудочной железы, желудка, шейки матки, щитовидной железы и кожи; включая плоскоклеточную карциному; гематопоэтические опухоли лимфоидной клеточной линии, включая, лейкоз, острый лимфоцитарный лейкоз, острый лимфобластный лейкоз, B-клеточную лимфому, T-клеточную лимфому, лимфому Беркитта; гематопоэтические опухоли миелоидной клеточной линии, включая острые и хронические миелогенные лейкозы и промиелоцитарный лейкоз; опухоли мезенхимального происхождения, включая фибросаркому и рабдомиосаркому; другие опухоли, включая меланому, семиному, тератокарциному, нейробластому и глиому; опухоли центральной и периферической нервной системы, включая астроцитому, нейробластому, глиому и шванномы; опухоли мезенхимального происхождения, включая фибросаркому, рабдомиосаркому и остеосаркому; и другие опухоли, включая меланому, пигментную ксеродерму, кератоакантому, семиному, фолликулярный рак щитовидной железы и тератокарциному. Также предполагается, что злокачественные опухоли, вызванные аберрациями апоптоза, также будут подлежать лечению с помощью раскрытых способов и композиций. Такие злокачественные опухоли могут включать без ограничений фолликулярные лимфомы, карциномы с мутациями p53, гормон-зависимые опухоли молочной железы, предстательной железы и яичника, и предраковые изменения, такие как семейный аденоматозный полипоз и миелодиспластические синдромы. В конкретных вариантах осуществления с помощью раскрытых способов и композиций лечат или предотвращают злокачественную опухоль или диспролиферативные изменения (такие как метаплазии и дисплазии), или гиперпролиферативные нарушения в яичнике, мочевом пузыре, молочной железа, кишечнике, легком, коже, поджелудочной железе и матке. В других конкретных вариантах осуществления с помощью раскрытых способов и композиций лечат или предотвращают саркому, меланому или лейкоз.

[00152] Раковые клетки приобретают характерный набор функциональных возможностей в ходе своего развития, хотя и посредством разных механизмов. Такие возможности включают уклонение от апоптоза, самодостаточность в ростовых сигналах, нечувствительность к антиростовым сигналам, инвазию/метастазирование в ткани, неограниченный экспликативный потенциал и устойчивый ангиогенез. Выражение “раковая клетка” предусматривает охват как предзлокачественных, так и злокачественных раковых клеток. В некоторых вариантах осуществления рак относится к доброкачественной опухоли, которая осталась локализованной. В других вариантах осуществления рак относится к злокачественной опухоли, которая инвазировала и разрушила соседние структуры организма и распространилась в отдаленные участки. В других вариантах осуществления рак связан со специфическим раковым антигеном (например, антигеном панкарциномы (KS 1/4), антигеном карциномы яичника (CA125), простатоспецифическим антигеном (PSA), раково-эмбриональным антигеном (CEA), CD19, CD20, HER2/neu и т.д.).

[00153] Аналогично рассмотренному выше применению в отношении опухолей раскрытые антитела и антигенсвязывающие фрагменты можно применять отдельно или в виде адъюванта в комбинации с вакцинами или с противомикробными средствами для стимуляции иммунного ответа против токсинов или аутоантигенов или против патогенов (например, вирусов, таких как ВИЧ, HTLV, вирус гепатита, вирус гриппа, синцитиальный респираторный вирус человека, вирус коровьей оспы, вирус бешенства; бактерий, таких как таковые из Mycobacteria, Staphylococci, Streptococci, Pneumonococci, Meningococci, Conococci, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Corynebacteria, Salmonella, Vibrio, Clostridia, Bacilli, Pasteurella, Leptospirosis, Bordatella, и особенно таких патогенов, связанных с холерой, столбняком, ботулизмом, сибирской язвой, чумой и болезнью Лайма; или грибковых патогенов или паразитов, таких как Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus, Aspergillus (jumigatus, niger, etc.), род Mucorales (mucor, absidia, rhizophus), Sporothrix (schenkii), Blastomyces (dermatitidis), Paracoccidioides (brasiliensis), Coccidioides (immitis) and Histoplasma (capsulatum), Entamoeba, histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Toxoplasma gondi, etc.)., Sporothrix, Blastomyces, Paracoccidioides, Coccidioides, Histoplasma, Entamoeba, Histolytica, Balantidium, Naegleria, Acanthamoeba, Giardia, Cryptosporidium, Pneumocystis, Plasmodium, Babesia или Trypanosoma и т.д. Таким образом, антитела и антигенсвязывающие фрагменты полезны в лечении инфекционного заболевания.

[00154] Другим применением антител и антигенсвязывающих фрагментов является блокирование или истощение T-клеток у пациентов, имеющих злокачественные Т-клеточные опухоли. В одном из вариантов осуществления такое блокирование или истощение осуществляются с помощью антител к H7CR, которые связываются с участком, находящимся вблизи относительно участка связывания H7CR со его лигандом, таким образом, чтобы нормальное функционирование H7CR было ухудшено или нарушено. Вследствие такого нарушения эффективная (функциональная) концентрация T-клеток уменьшается. В предпочтительном варианте осуществления такое уменьшение осуществляется с помощью антител к H7CR, которые конъюгируют с токсином так, чтобы их связывание с T-клеткой приводило к гибели клетки. Предпочтительно, в каждом варианте осуществления последовательность Fc участка антитела будет удалена (например, Fab или F(ab)2 и т.д.) или модифицирована таким образом, что молекула будет проявлять сниженную активность связывания, или не будет проявлять активность связывания с Fc-рецептором (FcR), или будет проявлять повышенные антителозависимую клеточно-опосредованную цитотоксическую (ADCC) и комплемент-зависимую цитотоксическую (CDC) активности.

2. Применения отрицательных модуляторов иммунной системы

[00155] Альтернативный вариант осуществления относится к молекулам, таким как антитела к B7-H7 (и фрагменты таких антител, которые связываются с B7-H7 или B7-H7 Ig), которые при связывании с B7-H7 выступают в роли антагониста (т.е. ослабляют или ухудшают) функцию H7CR и T-клеточную пролиферацию и/или выработку цитокинов. Введение таких молекул индивиду отрицательно модулирует иммунную систему индивида и особенно полезно для лечения воспаления или аутоиммунного заболевания.

[00156] Другой вариант осуществления предполагает антитела, которые связываются с H7CR и блокируют взаимодействие лиганда с H7CR, а не выступают в роли агониста H7CR.

[00157] Отрицательное модулирование иммунной системы является желательным при лечении воспалительных и аутоиммунных заболеваний. Примеры аутоиммунных нарушений, которые можно лечить с помощью введения антител, включают без ограничений гнездную алопецию, анкилозирующий спондилит, антифосфолипидный синдром, аутоиммунную болезнь Аддисона, аутоиммунные заболевания надпочечников, аутоиммунную гемолитическую анемию, аутоиммунный гепатит, аутоиммунный оофорит и орхит, аутоиммунную тромбоцитопению, болезнь Бешета, буллезный пемфигоид, кардиомиопатию, дерматит целиакия-спру, синдром хронической усталости и иммунной дисфункции (CFIDS), хроническую воспалительную демиелинизирующую полинейропатию, синдром Черджа-Стросс, рубцовый пемфигоид, синдром CREST, болезнь холодовых агглютининов, болезнь Крона, дискоидную волчанку, эссенциальную криоглобулинемию смешанного типа, фибромиалгию-фибромиозит, гломерулонефрит, диффузный токсический зоб, синдром Гийена-Барре, тиреоидит Хашимото, идиопатический легочный фиброз, идиопатическую тромбоцитопеническую пурпуру (ITP), IgA-нейропатию, ювенильный артрит, красный плоский лишай, эритематозную волчанку, болезнь Меньера, смешанное заболевание соединительной ткани, рассеянный склероз, оптиконевромиелит (NMO), сахарный диабет 1 типа или иммуно-опосредованный сахарный диабет, миастению гравис, вульгарную пузырчатку, пернициозную анемию, узелковый полиартериит, полихондрит, полигландулярные синдромы, ревматическую полимиалгию, полимиозит и дерматомиозит, первичную агаммаглобулинемию, первичный биллиарный цирроз, псориаз, псориатический артрит, болезнь Рейно, синдром Рейтера, ревматоидный артрит, саркоидоз, склеродерму, синдром Шегрена, синдром мышечной скованности, системную красную волчанку, эритематозную волчанку, синдром Такаясу, височный артериит/гигантоклеточный артериит, язвенный колит, увеит, васкулит, такой как герпетиформный дерматит, витилиго и грануломатоз Вегенера.

[00158] Примеры воспалительных нарушений, которые можно предотвратить, лечить или контролировать, включают без ограничений астму, энцефалит, воспалительное заболевание кишечника, хроническое обструктивное заболевание легких (COPD), аллергические заболевания, септический шок, легочный фиброз, недифференцированную спондилоартропатию, недифференцированную артропатию, артрит, воспалительный остеолиз и хроническое воспаление, образованное в результате хронических вирусных или бактериальых инфекций.

[00159] Описанные антитела к H7CR можно использовать для получения антиидиотипических пептидов или антител (Wallmann, J. et al. (2010) «Anti-Ids in Allergy: Timeliness of a Classic Concept» World Allergy Organiz. J. 3(6):195-201; Nardi, M. et al. (2000) «Antiidiotype Antibody Against Platelet Anti-GpIIIa Contributes To The Regulation Of Thrombocytopenia In HIV-1-ITP Patients» J. Exp. Med. 191(12):2093-2100) или миметиков (Zang, Y.C. et al. (2003) «Human Anti-Idiotypic T Cells Induced By TCR Peptides Corresponding To A Common CDR3 Sequence Motif In Myelin Basic Protein-Reactive T Cells» Int. Immunol. 15(9):1073-1080; Loiarro, M. et al. (Epub 2010 Apr 8) «Targeting TLR/IL-1R Signalling In Human Diseases» Mediators Inflamm. 2010:674363) H7CR. Такие молекулы служат имитаторами для H7CR, и, следовательно, их введение индивиду отрицательно модулирует иммунную систему такого индивида путем захвата лиганда B7-H7 и предотвращения его связывания с эндогенным рецептором H7CR. Такие молекулы полезны при лечении реакции «трансплантат против хозяина. Подобным образом, агонистические антитела, которые усиливают связывание между такими антителами и таким рецептором/лигандом полезны в качестве агонистов при передаче сигнала с помощью H7CR и поэтому полезны в лечении воспалительного и аутоиммунного заболевания.

[00160] Таким образом, антитела и антигенсвязывающие фрагменты полезны при лечении воспалительных и аутоиммунных заболеваний.

F. Способы введения

[00161] Известны различные системы доставки, и их можно применять для введения терапевтических или профилактических композиций, описанных в данном документе, например, инкапсулирование в липосомы, микрочастицы, микрокапсулы, рекомбинантные клетки, способные к экспрессии антитела или слитого белка, опосредованный рецепторами эндоцитоз (см., например, Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), конструирование нуклеиновой кислоты как части ретровирусного или другого вектора и т.д.

[00162] Способы введения гуманизированного антитела включают без ограничений парентеральное введение (например, внутрикожное, внутримышечное, интраперитонеальное, внутривенное и подкожное), эпидуральное и слизистое (например, интраназальный и пероральный пути). В конкретном варианте осуществления раскрытые антитела вводят внутримышечно, внутривенно или подкожно. Композиции можно вводить любым удобным путем, например, путем инфузии или болюсной инъекции, путем всасывания через эпителиальные или кожно-слизистые покровы (например, слизистую ротовой полости, слизистую прямой кишки и кишечника и т.д.), и их можно вводить совместно с другими биологически активными средствами. Введение может быть системным или локальным. Кроме того, также можно использовать легочное введение, например, с помощью ингалятора или небулайзера, и состава с образующим аэрозоль средством. См., например, патенты США №№6019968; 598520; 5985309; 5934272; 5874064; 5855913; 5290540 и 4880078; и PCT публикации заявок №№ WO 92/19244; WO 97/32572; WO 97/44013; WO 98/31346 и WO 99/66903. В конкретном варианте осуществления может быть желательным введение фармацевтических композиций локально в необходимую требующую лечения область; этого можно достичь, например, но не с целью ограничения, путем локальной инфузии, путем инъекции или посредством имплантата, при этом упомянутый имплантат представляет собой пористый, непористый или гелеобразный материал, включающий мембраны, такие как силастические мембраны или волокна. Предпочтительно, при введении одного или нескольких из раскрытых антител следует уделить внимание применению материалов, на которых не абсорбируются антитело или слитый белок.

[00163] В некоторых вариантах осуществления гуманизированные или химерные антитела составляют в липосомы для направленной доставки раскрытых антител. Липосомы представляют собой пузырьки, состоящие из концентрически упорядоченных фосфолипидых бислоев, которые инкапсулируют водную фазу. Липосомы обычно включают различные типы липидов, фосфолипидов и/или поверхностно-активных веществ. Компоненты липосом расположены в бислойной конфигурации, подобной расположению липидов биологических мембран. Липосомы представляют собой особенно предпочтительные среды для доставки, отчасти, вследствие их биосовместимости, низкой иммуногенности и низкой токсичности. Способы получения липосом известны в уровне техники, см., например, Epstein et al., 1985, Proc. Natl. Acad. Sci. USA, 82: 3688; Hwang et al., 1980 Proc. Natl. Acad. Sci. USA, 77: 4030-4; патенты США №№4485045 и 4544545.

[00164] Для получения составов с антителами можно применять способы получения липосом с пролонгированным периодом полувыведения из сыворотки, т.e. с увеличенным периодом циркуляции, как например, липосомы, раскрытые в патенте США №5013556. Предпочтительные липосомы, применяемые в раскрытых способах, не выводятся быстро из кровотока, т.e. поглощаются ретикуло-эндотелиальной системой (MPS). Липосомы включают стерически стабилизированные липосомы, которые получают с помощью общепринятых способов, известных специалисту в данной области техники. Не вдаваясь в конкретный механизм действия, стерически стабилизированные липосомы содержат липидные компоненты с крупными и сверхгибкими гидрофильными группами, которые снижают возможность нежелательной реакции липосом с белками сыворотки, снижают опсонизацию с компонентами сыворотки и снижают распознавание MPS. Стерически стабилизированные липосомы предпочтительно получают с использованием полиэтиленгликоля. В отношении получения липосом и стерически стабилизированной липосомы см., например, Bendas et al., 2001 BioDrugs, 15(4): 215-224; Allen et al., 1987 FEBS Lett. 223: 42-6; Klibanov et al., 1990 FEBS Lett., 268: 235-7; Blum et al., 1990, Biochim. Biophys. Acta., 1029: 91-7; Torchilin et al., 1996, J. Liposome Res. 6: 99-116; Litzinger et al., 1994, Biochim. Biophys. Acta, 1190: 99-107; Maruyama et al., 1991, Chem. Pharm. Bull., 39: 1620-2; Klibanov et al., 1991, Biochim Biophys Acta, 1062; 142-8; Allen et al., 1994, Adv. Drug Deliv. Rev, 13: 285-309. Также можно применять липосомы, которые адаптированы для специфического нацеливания на орган, см., например, патент США №4544545, или для специфического нацеливания на клетки, см., например, публикацию заявки на патент США №2005/0074403. Особо полезные липосомы для применения в композициях и способах можно создать с помощью метода обращенно-фазового выпаривания с липидной композицией, включающей фосфатидилхолин, холестерин и дериватизированный PEG фосфатидилэтаноламин (PEG-PE). Липосомы экструдируют с помощью фильтров с определенным размером пор для получения липосом желательного диаметра. В некоторых вариантах осуществления фрагмент антитела, например, F(ab'), может быть конъюгирован с липосомами с помощью ранее описанных способов, см., например, Martin et al., 1982, J. Biol. Chem. 257: 286-288.

[00165] Составы с гуманизированными или химерными антителами также можно получать в виде иммунолипосом. Иммунолипосомы относятся к композиции липосом, в которой антитело или его фрагмент ковалентно или нековалентно связано с поверхностью липосомы. Химический процесс связывания антитела с поверхностью липосомы известен в уровне техники, см., например, патент США №6787153; Allen et al., 1995, Stealth Liposomes, Boca Rotan: CRC Press, 233-44; Hansen et al., 1995, Biochim. Biophys. Acta, 1239: 133-144.

[00166] Гуманизированные или химерные антитела могут быть упакованы в герметично запечатанный контейнер, такой как ампула или пакет-саше, с указанием количества антитела. В одном из вариантов осуществления антитела поставляются в виде сухого стерилизованного лиофилизованного порошка или безводного концентрата в герметично запечатанном контейнере, и их можно разводить, например, водой или физиологическим раствором до соответствующей концентрации для введения индивиду. Предпочтительно, антитела поставляются в виде сухого стерильного лиофилизованного порошка в герметично запечатанном контейнере в форме единичной дозы по меньшей мере 5 мг, более предпочтительно по меньшей мере 10 мг, по меньшей мере 15 мг, по меньшей мере 25 мг, по меньшей мере 35 мг, по меньшей мере 45 мг, по меньшей мере 50 мг или по меньшей мере 75 мг. Лиофилизованные антитела следует хранить при температуре от 2 до 8°C в своем исходном контейнере, и антитела следует ввести в течение периода 12 часов, предпочтительно в течение периода 6 часов, в течение 5 часов, в течение 3 часов или в течение 1 часа после разведения. В альтернативном варианте осуществления антитела поставляются в жидкой форме в герметично запечатанном контейнере с указанием количества и концентрации антитела, слитого белка или конъюгированной молекулы. Предпочтительно, жидкая форма антител поставляется в герметично запечатанном контейнере в концентрации антител по меньшей мере 1 мг/мл, более предпочтительно по меньшей мере 2,5 мг/мл, по меньшей мере 5 мг/мл, по меньшей мере 8 мг/мл, по меньшей мере 10 мг/мл, по меньшей мере 15 мг/мл, по меньшей мере 25 мг/мл, по меньшей мере 50 мг/мл, по меньшей мере 100 мг/мл, по меньшей мере 150 мг/мл, по меньшей мере 200 мг/мл.

[00167] Точная доза, которую следует использовать в составе, будет также зависеть от пути введения и тяжести состояния, и ее следует определять в соответствии с решением лечащего врача и состоянием каждого пациента. Эффективные дозы можно экстраполировать, исходя из кривых зависимости от дозы, полученных in vitro или в тест-системах модельных животных. Для раскрытых антител доза, вводимая пациенту, обычно составляет от 0,0001 мг/кг до 100 мг/кг массы тела пациента. Предпочтительно, доза, вводимая пациенту, составляет от 0,0001 мг/кг до 20 мг/кг, от 0,0001 мг/кг до 10 мг/кг, от 0,0001 мг/кг до 5 мг/кг, 0,0001-2 мг/кг, 0,0001-1 мг/кг, от 0,0001 мг/кг до 0,75 мг/кг, от 0,0001 мг/кг до 0,5 мг/кг, от 0,0001 мг/кг до 0,25 мг/кг, 0,0001-0,15 мг/кг, 0,0001-0,10 мг/кг, 0,001-0,5 мг/кг, 0,01-0,25 мг/кг или 0,01-0,10 мг/кг массы тела пациента. Как правило, антитела человека имеют более длительный период полувыведения из организма человека, чем антитела других видов вследствие иммунного ответа на чужеродные полипептиды. Следовательно, часто возможным является применение более низких доз антител человека и менее частое введение. Кроме того, дозу и частоту введения антител или их фрагментов можно снизить с помощью повышенного поглощения и проникновения антител в ткани путем модификаций, таких как, например, липидизация.

[00168] В еще одном варианте осуществления композиции можно доставлять в системе с контролируемым высвобождением или замедленным высвобождением. Для получения составов с замедленным высвобождением, включающих одно или несколько антител, можно применять любую методику, известную в уровне техники. См., например, патент США №4526938; публикацию PCT WO 91/05548; публикацию PCT WO 96/20698; Ning et al., 1996, «Intratumoral Radioimmunotheraphy of a Human Colon Cancer Xenograft Using a Sustained-Release Gel» Radiotherapy & Oncology 39:179-189, Song et al., 1995, «Antibody Mediated Lung Targeting of Long-Circulating Emulsions» PDA Journal of Pharmaceutical Science & Technology 50:372-397; Cleek et al., 1997, «Biodegradable Polymeric Carriers for a bFGF Antibody for Cardiovascular Application» Pro. Int'l. Symp. Control. Rel. Bioact. Mater. 24:853-854; и Lam et al., 1997, «Microencapsulation of Recombinant Humanized Monoclonal Antibody for Local Delivery» Proc. Int'l. Symp. Control Rel. Bioact. Mater. 24:759-760. В одном из вариантов осуществления в системе с контролируемым высвобождением можно использовать насос (см. Langer, выше; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald et al., 1980, Surgery 88:507; и Saudek et al., 1989, N. Engl. J. Med. 321:574). В другом варианте осуществления для достижения контролируемого высвобождения антител можно использовать полимерные материалы (см., например, Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J., Macromol. Sci. Rev. Macromol. Chem. 23:61; See also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 7 1:105); патент США №5679377; патент США №5916597; патент США №5912015; патент США №5989463; патент США №5128326; PCT публикация заявки №WO 99/15154 и PCT публикация заявки № WO 99/20253). Примеры полимеров, используемых в составах с замедленным высвобождением, включают без ограничений поли(2-гидроксиэтилметакрилат), поли(метилметакрилат), поли(акриловую кислоту), сополимер этилен-винилацетат, поли(метилакриловую кислоту), полигликолиды (PLG), полиангидриды, поли(N-винилпирролидон), поли(виниловый спирт), полиакриламид, поли(этиленгликоль), полиактиды (PLA), сополимеры лактид-гликолид (PLGA) и сложные полиортоэфиры. В еще одном варианте осуществления систему контролируемого высвобождения можно поместить вблизи относитель терапевтической мишени (например, легких), при этом требуется только часть системной дозы (см., например, Goodson, in Medical Applications of Controlled Release, выше, vol. 2, pp. 115-138 (1984)). В еще одном варианте осуществления применяются полимерные композиции, полезные в качестве имплантатов для контролируемого высвобождения, согласно Dunn и соавт. (см. патент США №5945155). Этот конкретный способ основан на терапевтическом эффекте контролируемого высвобождения in situ биоактивного материала из полимерной системы. Имплантацию обычно можно осуществлять в любом месте в теле пациента, нуждающегося в терапевтическом лечении. В другом варианте осуществления применяется неполимерная система замедленной доставки, при этом неполимерный имплантат в теле индивида применяется в качестве системы лекарственной доставки. При имплантации в теле органический растворитель имплантата будет рассеиваться, распыляться или вымываться из композиции в окружающую тканевую жидкость, а неполимерный материал будет постепенно коагулировать или осаждаться с образованием твердого, микропористого матрикса (см. патент США №5888533). Системы контролируемого высвобождения описаны в обзоре Langer (1990, Science 249:1527-1533). Для получения составов с замедленным высвобождением, включающих одно или несколько терапевтических средств, можно использовать любой метод, известный в уровне техники. См., например, патент США №4526938; публикации международных заявок №№ WO 91/05548 и WO 96/20698; Ning et al., 1996, Radiotherapy & Oncology 39:179-189; Song et al., 1995, PDA Journal of Pharmaceutical Science & Technology 50:372-397; Cleek et al., 1997, Pro. Int'l. Symp. Control. Rel. Bioact. Mater. 24:853-854; и Lam et al., 1997, Proc. Int'l. Symp. Control Rel. Bioact. Mater. 24:759-760.

[00169] В конкретном варианте осуществления, где терапевтическая или профилактическая композиция представляет собой нуклеиновую кислоту, кодирующую раскрытое антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту можно вводить in vivo для активации экспрессии кодируемого ею антитела путем получения ее в виде части соответствующего вектора экспрессии нуклеиновой кислоты и введения его для того, чтобы он становится внутриклеточным, например, с помощью ретровирусного вектора (см. патент США №4980286), или с помощью прямой инъекции, или с помощью бомбардировки микрочастицами (например, с помощью генной пушки; Biolistic, Dupont), или с помощью покрытия липидами или рецепторами клеточной поверхности или трансфицирующими средствами, или путем введения его соединенным с гомеобокс-пептидом, который, как известно, проникает в ядро (см., например, Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88:1864-1868) и т.д. В качестве альтернативы, нуклеиновую кислоту можно вводить внутрь клетки и встраивать для экспрессии в ДНК клетки-хозяина с помощью гомологической рекомбинации.

[00170] Лечение индивида терапевтически или профилактически эффективным количеством раскрытых антител может включать однократную обработку или, предпочтительно, может включать ряд обработок.

G. Фармацевтические композиции

[00171] Раскрытые композиции могут включать композиции в виде нерасфасованной лекарственной формы, пригодные в производстве фармацевтических композиций (например, неочищенные или нестерильные композиции), и фармацевтические композиции (т.e. композиции, которые подходят для введения пациенту или индивиду), которые можно применять при получении лекарственных форм. Такие композиции могут включать профилактически или терапевтически эффективное количество профилактического и/или терапевтического средства, раскрытого в данном документе, или комбинации этих средств и фармацевтически приемлемый носитель. Предпочтительно, композиция включает профилактически или терапевтически эффективное количество гуманизированных антител и фармацевтически приемлемый носитель.

[00172] В конкретном варианте осуществления выражение «фармацевтически приемлемый» обозначает разрешенный контролирующим органом федерального правительства или правительства штата или указанный в Фармакопее США или другой общепризнанной фармакопее для применения у животных и, в частности, у человека. Выражение «носитель» относится к разбавителю, адъюванту (например, адъюванту Фрейнда (полному и неполному), вспомогательному веществу или среде, с которыми вводится лекарственное средство. Такими фармацевтическими носителями могут быть стерильные жидкости, такие как вода и масла, включая таковые нефтяного, животного, растительного или синтетического происхождения, такие как арахисовое масло, соевое масло, минеральное масло, кунжутное масло и т.п. Вода является предпочтительным носителем, если фармацевтическая композиция вводится внутривенно. В качестве жидких носителей также могут использоваться физиологический раствор и водные растворы декстрозы и глицерина, особенно для инъекционных растворов. Подходящие фармацевтические вспомогательные вещества включают крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рис, муку, мел, силикагель, натрия стеарат, глицерин-моностеарат, тальк, натрия хлорид, сухое обезжиренное молоко, глицерол, пропилен, гликоль, воду, этанол и т.п. При необходимости композиция также может содержать незначительные количества увлажняющих или эмульгирующих средств или буферных веществ для стабилизации pH. Эти композиции могут принимать форму растворов, суспензий, эмульсии, таблеток, пилюль, капсул, порошков, составов с замедленным высвобождением и т.п.

[00173] Как правило, ингредиенты композиций могут либо поставляться отдельно, либо могут быть смешаны вместе в единичной лекарственной форме, например, в виде сухого лиофилизированного порошка или безводного концентрата в герметично запечатанном контейнере, таком как ампула или пакет-саше с указанием количества действующего средства. Если композицию необходимо вводить с помощью инфузии, ее можно распределить в инфузионный флакон, содержащий стерильную воду фармацевтической степени чистоты или солевой раствор. Если композицию вводят путем инъекции, ампула со стерильной водой для инъекции или физиологическим раствором может быть обеспечена для того, чтобы перед введением можно было смешать ингредиенты.

[00174] Композиции можно составлять в виде нейтральных или солевых форм. Фармацевтически приемлемые соли включают без ограничений соли, образованные анионами, такими как анионы, полученные из соляной, фосфорной, уксусной, щавелевой, винной кислот и т.д., и соли, образованные катионами, такими как катионы, полученные из натрия, калия, аммония, кальция, гидроксида железа, изопропиламина, триэтиламина, 2-этиламиноэтанола, гистидина, прокаина и т.д.

H. Наборы

[00175] Другой вариант осуществления предполагает фармацевтический комплект или набор, включающие один или несколько контейнеров, заполненных раскрытыми гуманизированными антителами. Кроме того, в фармацевтический комплект или набор также можно включить одно или несколько других профилактических или терапевтических средств, полезных для лечения заболевания. Фармацевтический комплект или набор может включать один или несколько контейнеров, заполненных одним или несколькими ингредиентами раскрытых фармацевтических композиций. Необязательно, вместе с таким контейнером(ами) может находиться уведомление в форме, предписанной государственным органом, регулирующим производство, применение и продажу фармацевтических средств или биологических препаратов, при этом в уведомлении указывается на разрешение органом производства, применения или продажи для введения человеку.

[00176] Наборы, которые можно применять в вышеупомянутых способах. В одном из вариантов осуществления набор может включать одно или несколько раскрытых гуманизированных антител. В другом варианте осуществления набор также включает один или несколько других профилактических или терапевтических средств, полезных для лечения рака, в одном или нескольких контейнерах. В другом варианте осуществления набор также включает одно или несколько цитотоксических антител, которые связываются с одним или несколькими раковыми антигенами, связанными с раком. В некоторых вариантах осуществления другим профилактическим или терапевтическим средством является химиотерапевтический препарат. В других вариантах осуществления профилактическим или терапевтическим средством является биологический или гормональный препарат.

I. Способы диагностики

[00177] Раскрытые антитела и их антигенсвязывающие фрагменты можно применять для диагностических целей, как например, для выявления, диагностики или мониторинга заболеваний, нарушений или инфекций, связанных с экспрессией H7CR. Выявление или диагностику заболевания, нарушения или инфекции, в частности, аутоиммунного заболевания, можно выполнить с помощью: (a) определения экспрессии H7CR в клетках или в образце ткани индивида с использованием одного или нескольких антител (или их фрагментов), которые иммуноспецифически связываются с такими антигенами; и (b) сравнения уровня антигена с контрольным уровнем, например, уровнями в образцах нормальных тканей или уровнями в ткани в другой момент времени, при этом повышение или снижение анализируемого уровня антигена по сравнению с контрольным уровнем антигена свидетельствует о заболевании, нарушении или инфекции. Такие антитела и фрагменты предпочтительно используются в иммунологических анализах, таких как иммуноферментный анализ (ELISA), радиоиммунологический анализ (RIA) и сортировка флуоресцентно-активированных клеток (FACS).

[00178] Один аспект связан с применением таких антител и фрагментов, и особенно таких антител и фрагментов, которые связываются с H7CR человека, в качестве реактивов для IHC анализа в клетках образца ткани in vitro, или in situ, или in vivo. Таким образом, антитела и фрагменты полезны при выявлении и диагностике заболевания, нарушения или инфекции у человека. В одном из вариантов осуществления такая диагностика включает: a) введение индивиду (например, парентерально, подкожно или интраперитонеально) эффективного количества меченого антитела или антигенсвязывающего фрагмента, которые иммуноспецифически связываются с H7CR; b) ожидание в течение временного интервала после введения, необходимого для обеспечения преимущественного концентрирования меченой молекулы в местах у индивида, где экспрессируется H7CR (и до установления фонового уровня несвязанной меченой молекулы); c) определения фонового уровня и d) выявление меченого антитела у индивида таким образом, что выявление меченого антитела выше фонового уровня указывает на то, что субъект имеет заболевание, нарушение или инфекцию. В соответствии с этим вариантом осуществления антитело метят фрагментом для визуализации, которая является выявляемой с помощью системы визуализации, известной специалисту в данной области техники. Фоновый уровень можно определить с помощью различных способов, включая сравнение количества определяемой меченой молекулы со стандартным значением, ранее определенным для конкретной системы.

[00179] Специалисту в данной области техники будет понятно, что размеры индивида и используемая система визуализации будут определять количество фрагмента для визуализации, необходимое для получения диагностических изображений. Визуализация опухолей in vivo описана в S.W. Burchiel et al., «Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments» (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).

[00180] В зависимости от нескольких переменных, включая тип используемой метки и режим введения, временной интервал после введения, необходимый для обеспечения преимущественного концентрирования меченой молекулы в участках у индивида и для установления фонового уровня несвязанной меченой молекулы, составляет от 6 до 48 часов, или от 6 до 24 часов, или от 6 до 12 часов. В другом варианте осуществления временной интервал после введения составляет от 5 до 20 дней или от 5 до 10 дней.

[00181] В одном из вариантов осуществления мониторинг заболевания, нарушения или инфекции проводят путем повторения способа диагностики заболевания, нарушения или инфекции, например, через один месяц после первоначальной диагностики, через шесть месяцев после первоначальной диагностики, через один год после первоначальной диагностики и т.д.

[00182] Присутствие меченой молекулы у индивида можно обнаружить с помощью способов, известных в области визуализации in vivo. Эти способы зависят от типа используемой метки. Специалисты в данной области техники смогут определить соответствующий способ выявления конкретной метки. Способы и устройства, которые можно применять в способах диагностики, включают без ограничений компьютерную томографию (CT), полноразмерную визуализацию, такую как позитронно-эмиссионную томографию (PET), магнитно-резонансную томографию (MRI) и ультразвуковую эхографию.

[00183] В конкретном варианте осуществления молекулу метят радиоизотопом и выявляют у пациента с помощью чувствительного к излучению хирургического инструмента (Thurston и соавт., патент США №5441050). В другом варианте осуществления молекулу метят флуоресцентным соединением и выявляют у пациента с помощью чувствительного к флуоресценции сканирующего инструмента. В другом варианте осуществления молекулу метят позитронно-активным металлом и выявляют у пациента с помощью позитронно-эмиссионной томографии. В еще одном варианте осуществления молекулу метят парамагнитной меткой и выявляют у пациента с помощью магнитно-резонансной томографии (MRI).

[00184] Описав к данному моменту, в целом, настоящее изобретение, его легче будет понять с учетом следующих примеров, которые представлены с целью иллюстрации, и не предполагаются как ограничивающие настоящее изобретение, если не указано иное.

Пример 1

Характеристика антител к H7CR человека и паттерн экспрессии H7CR

Материалы и способы

[00185] Для оценки связывающей способности 0,2 миллиона трансфектантов CHO.hH7CR (фигура 2), наивных CD4+ CD45RA+ T-клеток (фигура 3A) или наивных CD8+ CD45RA+ T-клеток (фигура 3B) ресуспендировали в 100 мкл буфера для проточной цитометрии (PBS+2%FBS). Серийное разведение химерных антител 1.3 и 4.5 в количестве 0, 0,1 нг, 0,3 нг, 1 нг, 3 нг, 10 нг, 30 нг, 100 нг, 300 нг, 1 мкг, 3 мкг и 10 мкг добавляли к клеткам и инкубировали при температуре 4°C в течение 30 минут. Затем клетки отмывали дважды 2 мл буфера для проточной цитометрии и ресуспендировали в 100 мкл буфера для проточной цитометрии. Добавляли 1 мкл вторичного антитела к hIg PE (Biolegend) и инкубировали с клетками в течение 15 минут. Затем образцы отмывали и ресуспендировали в 100 мкл буфера для проточной цитометрии. Данные проточной цитометрии получали с помощью BD Canto (BD Biosciences) в формате планшета и анализировали с помощью компьютерной программы FlowJo. Затем в компьютерную программу Prism 5 вводили данные окрашивания (MFI) для получения кривой связывания. По подбору кривой с помощью алгоритма с использованием одного сайт-специфического связывания рассчитывают отдельные KD для каждого антитела.

Для демонстрации специфичности связывания использовали 5 мкг/мл mAb 1.3, 4.5 и 7.8 к H7CR для окрашивания стабильных трансфектантов с H7CR (фигура 4). Для окрашивания трансфектантов H7CR CHO также использовали 10 мкг/мл слитого белка B7-H7mIg. Для оценки блокирующей способности mAb к H7CR в отношении взаимодействий B7-H7-H7CR в систему добавляли mAb к H7CR (фигура 5).

Иммуногистохимическое окрашивание в отношении H7CR на залитом в парафин срезе миндалины человека выполняли с помощью антитела 4.5 в концентрации 5 мкг/мл с помощью стандартного протокола (фигура 6). Для окрашивания клеточной поверхности и анализа с помощью проточной цитометрии клетки инкубировали с указанным mAb на 30 минут при температуре 4°C, отмывали буфером и анализировали. Экспрессию H7CR на PBMC человека и мыши оценивали с помощью маркера клеточной линии и окрашивания антитела 1.3 (фигура 7-11). Экспрессию B7-H7 на активированных происходящих из моноцитов DC оценивали с помощью окрашивания антитела к B7-H7 (фигура 12).

Результаты

[00186] Было обнаружено, что антитела 1.3, 4.5 и 7.8 хомяка способны к иммуноспецифическому связыванию с H7CR человека. На фигуре 2 показаны соответствующие значения связывающей способности антител 1.3 и 4.5 к H7CR. Было обнаружено, что антитело 4.5 имеет Kd 3,5 нМ. Было обнаружено, что антитело 1.3 имеет Kd 5,9 нМ. Кривые связывания mAb к H7CR с наивными CD4 и CD8 T-клетками указывали на то, что доза для насыщения рецепторов для обоих антител составляла 1 мкг/мл (фигура 3, секции A и B).

[00187] На фигуре 4 (секции A-C) показана способность антител 1.3, 4.5 и 7.8 связываться с H7CR человека, экспрессируемыми на поверхности CHO клеток. Антитела изучали в отношении их способности блокировать взаимодействие H7CR с B7-H7 путем инкубации антител с трансфектантами H7CR CHO в присутствии слитого белка B7-H7-IgG2a мыши. Как показано на фигуре 5 (секции A-D), присутствие антител H7CR не нарушало способность B7-H7 Ig связываться с H7CR. Таким образом, эти три антитела были неспособны значительно блокировать взаимодействие H7CR с B7-H7. Как показано на фигуре 6, было обнаружено, что антитело к H7CR человека (клон 4.5) способно к связыванию с H7CR, который эндогенно экспрессируется на поверхности ткани миндалин человека.

[00188] Антитела к H7CR обеспечивали определение профилей экспрессии H7CR и B7-H7. На фигуре 7 показано, что экспрессия H7CR в T- и NK-клетках была связана с фенотипом наивных Т-клеток. На фигуре 8 (секции A-H) показаны профили экспрессии H7CR и B7-H7 четырех здоровых доноров PMBC (донор 1, секции A и B; донор 2, секции C и D; донор 3 (секции E и F) и донор 4 (секции G и H)). На фигуре 9 (секции A-H) показаны профили экспрессии H7CR и B7-H7 четырех здоровых доноров PMBC (донор 1, секции A и B; донор 2, секции C и D; донор 3 (секции E и F) и донор 4 (секции G и H)). На фигуре 10 (секции A-AD) показана экспрессия H7CR и B7-H7 моноцитами человека, CD8+ CD3+ лимфоцитами, CD8- CD3+ лимфоцитами, CD16+ NK-клетками и CD3- CD8- клетками. На фигуре 11 (секции A-AD) показана экспрессия H7CR и B7-H7 моноцитами яванского макака, CD8+ CD3+ лимфоцитами, CD8- CD3+ лимфоцитами, CD16+ NK-клетками и CD3- CD8- клетками, и показано, что яванский макак является применимым видом для исследований in vivo и токсикологических исследований.

[00189] Был проведен функциональный in vitro анализ экспрессии B7-H7. Созревшие происходящие из моноцитов дендритные клетки оценивали в отношении их способности экспрессировать B7-H7 и другие маркеры активации. Результаты этого исследования (фигура 12, секции A-K) подтверждают экспрессию таких маркеров и показывают, что созревшие дендритные клетки применимы для функционального исследования in vitro.

Пример 2

Антитела к H7CR активируют антиген-специфические ответы Т-клеток памяти

Материалы и способы

[00190] Для дальнейшей характеристики антител к H7CR проводили анализ ответа воспроизведения памяти на столбнячный анатоксин (TT). Происходящие из моноцитов незрелые DC доводили до созревания путем инкубирования с 1 нг/мл TNFα и 1 мкг/мл PGE2 в течение двух дней и инкубировали в присутствии 50 мкг/мл столбнячного анатоксина (TT) в течение ночи на второй день после созревания DC. Дендритные клетки отмывали три раза средой X-Vivo и затем инкубировали в присутствии меченых сложным карбоксифлуоресцеин-сукцинимидиловым эфиром (CFSE) аутологичных T-клеток в соотношении 1:20 в течение двух недель в присутствии 100 нг/мл TT и 10 мкг/мл моноклонального антитела 1.3, 4.5 или 7.8 к H7CR (фигура 13) или гуманизированных вариантов 1.3 (фигура 23). Клеточную пролиферацию отслеживали по разведению CFSE с помощью проточной цитометрии. В некоторых экспериментах выполняли внутриклеточное окрашивание IFNγ и TNFα человека. В систему культуры DC-T клеток на 8 часов добавляли брефелдин А Golgi Blocker (eBioscience). Активированные Т-клетки человека собирали и отмывали холодным PBS. Сначала окрашивали маркеры клеточной поверхности. Внутриклеточное окрашивание IFNγ и TNFα выполняли в соответствии с протоколом производителя (Cytofix/Cytoperm, BD).

[00191] Для общего анализа цитокинов супернатанты культуры собирали в различные моменты времени с помощью набора Bio-Plex Pro Human Cytokine 17-Plex (M5000031YV, BioRad) в соответствии с руководством производителя. Данные собирали и анализировали с помощью системы Bio-Plex 200 (BioRad).

Результаты

[00192] Результаты этого анализа (фигура 13) показывают, что антитела к H7CR активируют антиген-специфические ответы T-клеток памяти. Для определения природы и уровней цитокинов, экспрессируемых клетками, оценивали супернатанты на 7 день. Результаты этого анализа показаны на фигуре 14 (секции A-L). Результаты показывают, что антитела 1.3, 4.5 и 7.8 к H7CR опосредовали неидентичные профили экспрессии цитокинов. Примечательно, что антитело 1.3 опосредовало высокие уровни IFNγ, TNFα, GM-CSF и IL-10, а антитело 4.5 опосредовало высокие уровни IL-5 и IL-13.

[00193] Клетки подвергали внутриклеточному окрашиванию через 5 часов после инкубации с Golgi Block (без PMA и ионмицина) и определяли их внутриклеточную экспрессию IFNγ и разведение сложным карбоксифлуоресцеин-сукцинимидиловым эфиром (CFSE). Результаты данного исследования показали, что обработка антителами к H7CR усиливала пролиферацию, это представлено по разведению CFSE и экспрессии IFNγ в антиген-специфических T-клетках (фигуры 15A и 15B). Процент IFNγ+ в делящихся T-клетках повышался с 0,15% (фигура 15A; контроль) до 0,96% (фигура 15B; под воздействием антитела 1.3).

[00194] Среди гуманизированных вариантов 1.3 (фигура 23), вариант 1, 3 и 5 показал сравнимое усиление разведения CFSE родительским химерным антителом 1.3 TT-специфических T-клеток.

Пример 3

Взаимодействие B7-H7:H7CR регулирует антиген-специфические ответы Т-клеток человека

Материалы и способы

[00195] Для определения роли пути B7-H7:H7CR в антиген-специфическом T-клеточном ответе очищенные CD4+ T-клетки человека метили CFSE и культивировали с аутологичными происходящими из моноцитов дендритными клетками, которые предварительно инкубировали с 50 мкг/мл столбнячного анатоксина (“TT”) в качестве антигена. Дендритные клетки отмывали три раза средой X-Vivo и затем инкубировали в присутствии меченых сложным карбоксифлуоресцеин-сукцинимидиловым эфиром (CFSE) аутологичных T-клеток в соотношении 1:20 в течение двух недель в присутствии 100 нг/мл TT и 10 мкг/мл моноклонального антитела. Клеточную пролиферацию отслеживали по разведению CFSE с помощью проточной цитометрии.

Результаты

[00196] Было обнаружено, что TT-специфическая пролиферация T-клеток значительно увеличивалась, когда агонистические mAb к H7CR инкубировали в культуре (для усиления сигнала H7CR на T-клетках) (фигура 16A). Включение CTLA4-Ig, слитого белка, блокирующего взаимодействия B7:CD28, вначале культивирования клеток значительно подавляло пролиферацию T-клеток, даже в присутствии агонистического mAb к H7CR. Эти результаты свидетельствуют о том, что костимуляция H7CR зависит от эндогенного взаимодействия B7:CD28.

[00197] Клетки, инкубируемые в присутствии агонистического mAb к H7CR, проявляли значительное усиление выработки цитокинов, включая IFN-γ (фигура 16B, секция A), а также IL-5, IL-10, TNF-α и IL-17 (фигура 16B, секция B). Эти результаты свидетельствуют о том, что костимуляция H7CR не является специфической для субпопуляции CD4+ T-хелперных клеток. Вместе эти результаты свидетельствуют о том, что сигнал H7CR активирует рост и дифференцировку CD4+ T-клеток человека, что является признаком, подобным костимуляции CD28.

Пример 4

Гуманизация антител 1.3 и 4.5 к H7CR

[00198] Антитела хомяка 1.3 и 4.5 к H7CR гуманизировали с помощью способа, который включает создание трехмерной структуры смоделированного на основе гомологии антитела и создание профиля родительского антитела на основе моделирования структуры. Создавали несколько гуманизированных последовательностей вариабельного участка тяжелой и легкой цепи, каждая из которых объединяла специфические участки последовательности родительского антитела с большинством каркасных последовательностей человека. Всего было получено 6 гуманизированных последовательностей тяжелой цепи и 6 гуманизированных последовательностей легкой цепи.

[00199] Выравнивание последовательностей, сравнивающее вариабельные домены антитела 1.3 с базой данных каркасных последовательностей иммуноглобулинов зародышевого типа человека выполняли с помощью Geneious. Выявляли предпочтительные акцепторные каркасы на основе идентичности всей последовательности в пределах каркаса, подбирая положение границы раздела, канонические положения, определяющие подобный класс CDR, и наличие участков N-гликозилирования, которые бы подлежали удалению.

[00200] Структурную модель вариабельных доменов легких и тяжелых цепей антител создавали с помощью Discovery Studio. Шаблонные структуры выявляли по поиску в базе данных PDB с применением последовательностей вариабельных доменов легкой цепи и тяжелой цепи 1.3 с и без их CDR. Выравнивание последовательностей 1.3 по отношению к шаблонам и моделирование структуры на основе гомологии проводили с помощью MODELLER (Sali, A. et al. (1993) «Comparative Protein Modelling By Satisfaction Of Spatial Restraints» J. Molec. Biol. 234(3):779-815).

[00201] Ряд гибридных последовательностей, которые объединяли различные участки последовательности родительского антитела с последовательностью каркасов человека, систематически анализировали с помощью трехмерной модели для выявления гибридных последовательностей, которые, как прогнозировалось, имеют наименьшее влияние на определенную структуру CDR (Chothia, C. et al. (1987) «Canonical Structures For The Hypervariable Regions Of Immunoglobulins» J. Mol. Biol. 196:901-917; Martin, A.C. et al. (1996) «Structural Families In Loops Of Homologous Proteins: Automatic Classification, Modelling And Application To Antibodies» J. Molec. Biol. 263(5):800-815). Особое внимание уделялось гибридным последовательностям, которые содержали аминокислоты из каркасных участков человека, которые находились в пределах 5Å петель CDR, в зоне Вернера, на границе раздела цепей VH/VL или в канонических положениях, определяющих класс CDR, поскольку считалось, что эти гибридные последовательности с большей вероятностью оказывают вредное воздействие на функцию образующегося в результате гуманизированного антитела.

[00202] Профиль родительского антитела создавали на основе анализа CDR и моделирования структуры. Акцепторные каркасные участки человека идентифицировали на основе сравнений последовательности и гомологии. Гуманизированные антитела разрабатывали путем созадния многочисленных гибридных последовательностей, которые сливают части последовательностей родительского антитела с каркасными последовательностями человека. С помощью трехмерной модели эти гуманизированные последовательности методически анализировали с помощью визуального и компьютерного моделирования для выделения последовательностей, которые наиболее вероятно сохраняли бы связывание с антигеном. Цель заключалась в максимальном увеличении количества последовательностей человека в конечном гуманизированном антителе при сохранении исходной специфичности антитела.

[00203] Изображение по типу "бусины в бусах" (Collier de Perles) представляет собой двухмерное представление вариабельных доменов и представляет информацию об аминокислотных положениях в бета-цепях и петлях в вариабельных доменах (Ruiz, M. et al. (2002) «IMGT Gene Identification And Colliers de Perles Of Human Immunoglobulins With Known 3D Structures» Immunogenetics 53(10-11):857-883). Изображение вариабельных участков легкой и тяжелой цепи антитела 1.3 по типу "бусины в бусах" показаны на фигуре 17A и фигуре 17B, соответственно. На фигурах 18A и 18B показано изображение по типу "бусины в бусах" вариабельных участков легкой и тяжелой цепи антитела 4.5, соответственно. Три петли CDR цепей представлены вверху схем. В вариабельных участках легкой и тяжелой цепи свободные остатки Cys или N-связанные сайты гликозилирования отсутствуют.

Гуманизация антитела 1.3

[00204] Выполняли выравнивание последовательностей, сравнивающее вариабельные домены антитела 1.3 хомяка с базой данных генов иммуноглобулинов зародышевого типа человека. На основании общей идентичности последовательности, подбора положения границы раздела и подобным образом расположенных канонических положения, определяющие подобный класс CDR, были идентифицированы два семейства генов иммуноглобулинов зародышевого типа в качестве возможных акцепторных каркасов для легкой цепи: IGKV4-1*01 и IGKV2D-28*01. Гены J-сегментов сравнивали с родительской последовательностью по FR4 и J-сегментам, и IGKJ2*01 был выбран для легкой цепи. Выравнивание родительской VL цепи 1.3 с этими акцепторными каркасами показано в таблице 6, неидентичные остатки показаны подчеркнутыми.

Таблица 6
Вариабельный домен легкой цепи SEQ ID # Последовательность
10 20 30 40
Хомяк 1.3 60 DIVMTQSPSS LAVSAGEKVT ISCLSSQSLF SSNTNRNYLN

IGKV4-1*01 61 DIVMTQSPDS LAVSLGERAT INCKSSQSVL YSSNNKNYLA
IGKV2D-28*01 62 DIVMTQSPLS LPVTPGEPAS ISCRSSQSLL HSN-GYNYLD
50 60 70 80
Хомяк 1.3 63 WYLQKPGQSP KLLIYHASTR LTGVPDRFIG SGSGTDFTLT
IGKV4-1*01 64 WYQQKPGQPP KLLIYWASTR ESGVPDRFSG SGSGTDFTLT
IGKV2D-28*01 65 WYLQKPGQSP QLLIYLGSNR ASGVPDRFSG SGSGTDFTLK
90 100 110
Хомяк 1.3 66 ISSVQAEDLG DYYCQHHYET PLTFGDGTKL EIK
IGKV4-1*01 67 ISSLQAEDVA VYYCQQYYST PYT
IGKV2D-28*01 68 ISRVEAEDVG VYYCMQALQT PYT
IGKJ2*01 69 FGQGTKL EIK

[00205] Было обнаружено, что тяжелая цепь антитела 1.3 хомяка наиболее подобна IGHV4-31*02 зародышевого типа. Среди первых 50 ближайших последовательностей генов иммуноглобулина зародышевого типа к тяжелой цепи антитела 1.3 ни один из CDR H3 не имеет такой же длины, как и тяжелая цепь 1.3. Таким образом, подвергшуюся перегруппировке тяжелую цепь выбирали в качестве второго акцепторного каркаса (AAY33199.1) на основании общего сходства, длины CDR и канонических структур CDR. Гены J-сегментов сравнивали с родительской последовательностью по FR4 и J-сегментам, и IGHJ3*01 был выбран для тяжелой цепи. Выравнивание родительской VH цепи с этими акцепторными каркасами показано в таблице 7, неидентичные остатки показаны подчеркнутыми.

Таблица 7
Вариабельный домен тяжелой цепи SEQ ID # Последовательность
10 20 30 40
Хомяк 1.3 70 QIQLQESGPG LVKPSQSLSL TCSVTGFSIS TSGYYWTWIR
IGHV4-31*02 71 QVQLQESGPG LVKPSQTLSL TCTVSGGSIS SGGYYWSWIR
AAY33199.1 72 QVQLQESGPG LVKPAQTLSL TCTVSGGSIS SVNYYWSWIR
50 60 70 80
Хомяк 1.3 73 QFPGKRLEWM GYINYGGGTS YNPSLKSRIS ITRDTSKNQF
IGHV4-31*02 74 QHPGKGLEWI GYIYYSGSTY YNPSLKSRVT ISVDTSKNQF
AAY33199.1 75 QYPGKGLEWI GYIYYRGSTY YNPSLKSRVT ISVDTSKNQF
90 100 110 120
Хомяк 1.3 76 LLHLNSVTTE DTATYCCATM ADRFAFFDVW GQGIQVTVSS
IGHV4-31*02 77 SLKLSSVTAA DTAVYYCAR
AAY33199.1 78 SLKLTSVTAA DTAVYHCARE RTMTGAFDIW GQGTMVTVSS
IGHJ3*01 79 DAFDVW GQGTMVTVSS

[00206] Что касается легкой цепи, то были созданы три гуманизированные цепи для каждого из двух акцепторных каркасов IGKV4-1*01 и IGKV2D-28*01 с образованием, таким образом, шести гуманизированных легких цепей антитела 1.3. Первая гуманизированная цепь для каждого акцепторного каркаса (VL1A, VL2A) содержит в преимущественно каркас человека (гуманизированная легкая цепь 1). Вторая гуманизировання цепь для каждого акцепторного каркаса (VL1B, VL2B) содержит некоторое количество родительской последовательности, слитой с каркасной последовательностью человека, что будет содействовать поддержанию исходной конформации CDR (гуманизированная легкая цепь 2). Третья гуманизировання цепь для каждого из акцепторных каркасов (VL1C, VL2C) содержит даже большее количество родительской последовательности, слитой с каркасом человека, что будет сохранять исходную специфичность антитела и структуру CDR (гуманизированная легкая цепь 3). Аминокислотные последовательности этих цепей указаны ниже.

[00207] Аминокислотные последовательности вариабельного участка легкой цепи гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGKV4-1*01 (CDR показаны подчеркнутыми):

1. VL1A IGKV4-1*01 (гуманизированный 1):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTNRNYLA WYQQKPGQPP

KLLIYHASTR ESGVPDRFSG SGSGTDFTLT ISSLQAEDVA VYYCQHHYET

PLT FGQGTKL EIK (SEQ ID NO:17)

2. VL1B IGKV4-1*01 (гуманизированный 2):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTNRNYLN WYQQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:18)

3. VL1C IGKV4-1*01 (гуманизированный 3):

DIVMTQSPDS LAVSLGERAT INCLSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFIG SGSGTDFTLT ISSLQAEDVG DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:19)

[00208] Аминокислотные последовательности вариабельного участка легкой цепи гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGKV2D-28*01 (CDR показаны подчеркнутыми):

1. VL2A IGKV2D-28*01 (гуманизированный 1):

DIVMTQSPLS LPVTPGEPAS ISCRSSQSLF SSNTNRNYLD WYLQKPGQSP

QLLIYHASNR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:20)

2. VL2B IGKV2D-28*01 (гуманизированный 2):

DIVMTQSPLS LPVTPGEPAS ISCRSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:21)

3. VL2C IGKV2D-28*01 (гуманизированный 3):

DIVMTQSPLS LPVTPGEPAS ISCLSSQSLF SSNTNRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYYCQHHYET

PLT FGDGTKL EIK (SEQ ID NO:22)

[00209] Что касается тяжелой цепи, то были созданы три гуманизированные цепи для каждого из акцепторных каркасов IGHV4-31*02 и AAY33199.1, идентифицированных выше. Подобно легкой цепи, первая гуманизированная цепь для каждого акцепторного каркаса (VH1A, VH2A) содержит преимущественно каркас человека (гуманизированный 1). Вторая гуманизированная цепь для каждого акцепторного каркаса (VH1B, VH2В) будет способствовать сохранению исходной конформации CDR (гуманизированный 2). Третья цепь для каждого из акцепторных каркасов (VH1C, VH2C) будет способствовать сохранению исходной специфичности антитела и структуры CDR (гуманизированный 3). Аминокислотные последовательности этих цепей указаны ниже.

[00210] Аминокислотные последовательности вариабельного участка тяжелой цепи гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса IGHV4-31*02 (CDR показаны подчеркнутыми):

1. VH1A IGHV4-31*02 (гуманизированный 1):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QHPGKGLEWI

GYINYGGGTY YNPSLKSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:23)

2. VH1B IGHV4-31*02 (гуманизированный 2):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QHPGKRLEWI

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:24)

3. VH1C IGHV4-31*02 (гуманизированный 3):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIS TSGYYWSWIR QFPGKRLEWM

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:25)

[00211] Аминокислотные последовательности вариабельного участка тяжелой цепи гуманизированных вариантов антитела 1.3 к H7CR человека, полученные из акцепторного каркаса AAY33199.1 (CDR показаны подчеркнутыми):

1. VH2A AAY33199.1 (гуманизированный 1):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QYPGKGLEWI

GYINYGGGTY YNPSLKSRVT ISVDTSKNQF SLKLTSVTAA DTAVYHCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:26)

2. VH2B AAY33199.1 (гуманизированный 2):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QYPGKRLEWI

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLTSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:27)

3. VH2C AAY33199.1 (гуманизированный 3):

QVQLQESGPG LVKPAQTLSL TCTVSGFSIS TSGYYWSWIR QFPGKRLEWM

GYINYGGGTS YNPSLKSRVT ISRDTSKNQF SLKLTSVTAA DTATYCCATM

ADRFAFFDV W GQGTMVTVSS (SEQ ID NO:28)

[00212] Предпочтительные антитела и их антигенсвязывающие фрагменты включают любую из 36 комбинаций вышеописанных гуманизированных вариантов антитела 1.3 к H7CR человека. Например, такие антитела содержат комбинации, показанные в таблице 4: Все 36 таких гуманизированных вариантов антитела 1.3 к H7CR человека оценивали в отношении их соответствующей способности к связыванию с молекулами H7CR человека в виде эктопически экспрессируемых на поверхности CHO клеток, и было обнаружено, что 28 из 36 могут связываться с такими молекулами H7CR человека.

Гуманизация антитела 4.5 к H7CR

[00213] Выполняли выравнивание последовательностей, сравнивающее вариабельные домены антитела 4.5 хомяка с базой данных генов иммуноглобулинов зародышевого типа человека. На основании общей идентичности последовательности, подбора положения границы раздела и подобным образом расположенных канонических положения, определяющие подобный класс CDR, были идентифицированы два семейства генов иммуноглобулинов зародышевого типа в качестве возможных акцепторных каркасов для легкой цепи: IGKV4-1*01 и IGKV2D-40*01. Гены J-сегментов сравнивали с родительской последовательностью по FR4 и J-сегментам, и IGKJ5*01 был выбран для легкой цепи. Выравнивание родительской VL цепи 1.3 с этими акцепторными каркасами показано в таблице 8, неидентичные остатки показаны подчеркнутыми.

Таблица 8
Вариабельный домен легкой цепи SEQ ID # Последовательность
10 20 30 40
Хомяк 4.5 80 DIVMTQSPSS LAVSAGEKVT ISCLSSQSLF SSNTKRNYLN
IGKV4-1*01 81 DIVMTQSPDS LAVSLGERAT INCKSSQSVL YSSNNKNYLA
IGKV2D-40*01 82 DIVMTQTPLS LPVTPGEPAS ISCRSSQSLL DSDDGNTYLD
50 60 70 80
Хомяк 4.5 83 WYLQKPGQSP KLLIYHASTR LTGVPGRFIG SGSGTDFTLT
IGKV4-1*01 84 WYQQKPGQPP KLLIYWASTR ESGVPDRFSG SGSGTDFTLT
IGKV2D-40*01 85 WYLQKPGQSP QLLIYTLSYR ASGVPDRFSG SGSGTDFTLK
90 100 110
Хомяк 4.5 86 VSTVQAEDLG DYFCQQHYET PLTFGDGTRL EIK
IGKV4-1*01 87 ISSLQAEDVA VYYCQQYYST PYT
IGKV2D-40*01 88 ISRVEAEDVG VYYCMQRIEF P
IGKJ5*01 89 ITFGQGTRL EIK

[00214] Было обнаружено, что тяжелая цепь антитела 4.5 хомяка наиболее подобна IGHV4-31*02 зародышевого типа. Среди первых 50 ближайших последовательностей генов иммуноглобулина зародышевого типа к тяжелой цепи антитела 4.5 вторым акцепторным каркасом, который имел структуру, подобную канонической, является IGHV2-5*01. Гены J-сегментов сравнивали с родительской последовательностью по FR4 и J-сегментам, и IGHJ5*01 был выбран для тяжелой цепи. Выравнивание родительской VH цепи с этими акцепторными каркасами показано в таблице 9, неидентичные остатки показаны подчеркнутыми.

Таблица 9
Вариабельный домен тяжелой цепи SEQ ID # Последовательность
10 20 30 40
Хомяк 4.5 90 QIQLQESGPG LVKPSQSLSL TCSVTGFSIT TGGYYWNWIR
IGHV4-31*02 91 QVQLQESGPG LVKPSQTLSL TCTVSGGSIS SGGYYWSWIR
IGHV2-5*01 92 QITLKESGPT LVKPTQTLTL TCTFSGFSLS TSGVGVGWIR
50 60 70 80
Хомяк 4.5 93 QFPGKKLEWM GYIYTSGRTS YNPSLKSRIS ITRDTSKNQF
IGHV4-31*02 94 QHPGKGLEWI GYIYYSGSTY YNPSLKSRVT ISVDTSKNQF
IGHV2-5*01 95 QPPGKALEWL ALIYWNDDKR YSPSLKSRLT ITKDTSKNQV
90 100 110 120
Хомяк 4.5 96 FLQLNSMTTE DTATYYCADM ADKGGWFAYW GQGTLVTVSS
IGHV4-31*02 97 SLKLSSVTAA DTAVYYCA-- --R
IGHV2-5*01 98 VLTMTNMDPV DTATYYCA-- --HR
IGHJ5*01 99 NWFDSW GQGTLVTVSS

[00215] Что касается легкой цепи, то были созданы три гуманизированные цепи для каждого из двух акцепторных каркасов IGKV4-1*01 и IGKV2D-40*01 с образованием, таким образом, шести гуманизированных легких цепей антитела 4.5. Первая гуманизированная цепь для каждого акцепторного каркаса (VL1A, VL2A) содержит преимущественно каркас человека (гуманизированная легкая цепь 1). Вторая гуманизировання цепь для каждого акцепторного каркаса (VL1B, VL2B) содержит некоторое количество родительской последовательности, слитой с каркасной последовательностью человека, что будет содействовать поддержанию исходной конформации CDR (гуманизированная легкая цепь 2). Третья гуманизировання цепь для каждого из акцепторных каркасов (VL1C, VL2C) содержит даже больше родительской последовательности, слитой с каркасом человека, что будет способствовать сохранению исходной специфичности антитела и структуры CDR (гуманизированная легкая цепь 3). Аминокислотные последовательности этих цепей указаны ниже.

[00216] Аминокислотные последовательности вариабельного участка легкой цепи гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGKV4-1*01 (CDR показаны подчеркнутыми):

1. VL1A IGKV4-1*01 (гуманизированный 1):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTKRNYLA WYQQKPGQPP

KLLIYHASTR ESGVPDRFSG SGSGTDFTLT ISSLQAEDVA VYYCQQHYET

PLT FGQGTRLEIK (SEQ ID NO:33)

2. VL1B IGKV4-1*01 (гуманизированный 2):

DIVMTQSPDS LAVSLGERAT INCKSSQSLF SSNTKRNYLN WYQQKPGQPP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:34)

3. VL1C IGKV4-1*01 (гуманизированный 3):

DIVMTQSPDS LAVSLGERAT INCLSSQSLF SSNTKRNYLN WYQQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLT ISSLQAEDVA DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:35)

[00217] Аминокислотные последовательности вариабельного участка легкой цепи гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGKV2D-40*01 (CDR показаны подчеркнутыми):

1. VL2A IGKV2D-40*01 (гуманизированный 1):

DIVMTQTPLS LPVTPGEPAS ISCRSSQSLF SSNTKRNYLD WYLQKPGQSP

QLLIYHASYR ASGVPDRFSG SGSGTDFTLK ISRVEAEDVG VYYCQQHYET

PLT FGQGTRL EIK (SEQ ID NO:36)

2. VL2B IGKV2D-40*01 (гуманизированный 2):

DIVMTQTPLS LPVTPGEPAS ISCRSSQSLF SSNTKRNYLN WYLQKPGQSP

KLLIYHASTR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYFCQQHYET

PLT FGDGTRL EIK (SEQ ID NO:37)

3. VL2C IGKV2D-40*01 (гуманизированный 3):

DIVMTQTPSS LPVTPGEPAS ISCLSSQSLF SSNTKRNYLN WYLQKPGQSP

KLLIY HAS TR LSGVPDRFSG SGSGTDFTLK ISRVEAEDVG DYFC QQHYET

PLT FGDGTRL EIK (SEQ ID NO:38)

[00218] Что касается тяжелой цепи, то были созданы три гуманизированные цепи для каждого из акцепторных каркасов IGHV4-31*02 и IGHV2-5*01, идентифицированных выше. Подобно легкой цепи, первая гуманизированная цепь для каждого акцепторного каркаса (VH1A, VH2A) содержит преимущественно каркас человека (гуманизированный 1). Вторая гуманизированная цепь для каждого акцепторного каркаса (VH1B, VH2В) будет способствовать сохранению исходной конформации CDR (гуманизированный 2). Третья цепь для каждого из акцепторных каркасов (VH1C, VH2C) будет способствовать сохранению исходной специфичности антитела и структуры CDR (гуманизированный 3). Аминокислотные последовательности этих цепей указаны ниже.

[00219] Аминокислотные последовательности вариабельного участка тяжелой цепи гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGHV4-31*02 (CDR показаны подчеркнутыми):

1. VH1A IGHV4-31*02 (гуманизированный 1):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWSWIR QHPGKGLEWI

GYIYTSGRTY YNPSLKSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:39)

2. VH1B IGHV4-31*02 (гуманизированный 2):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWNWIR QHPGKKLEWI

GYIYTSGRTS YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:40)

3. VH1C IGHV4-31*02 (гуманизированный 3):

QVQLQESGPG LVKPSQTLSL TCTVSGFSIT TGGYYWNWIR QFPGKKLEWM

GY IYTSGRT S YNPSLKSRVT ISRDTSKNQF SLKLSSVTAA DTAVYYC ADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:41)

[00220] Аминокислотные последовательности вариабельного участка тяжелой цепи гуманизированных вариантов антитела 4.5 к H7CR человека, полученные из акцепторного каркаса IGHV2-5*01 (CDR показаны подчеркнутыми):

1. VH2A IGHV2-5*01 (гуманизированный 1):

QITLKESGPT LVKPTQTLTL TCTFSGFSIT TGGYYVGWIR QPPGKALEWL

ALIYTSGRTR YSPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:42)

2. VH2B IGHV2-5*01 (гуманизированный 2):

QITLKESGPT LVKPTQTLTL TCTVSGFSIT TGGYYWNWIR QPPGKKLEWL

ALIYTSGRTS YNPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYCADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:43)

3. VH2C IGHV2-5*01 (гуманизированный 3):

QIQLKESGPT LVKPTQTLTL TCTVSGFSIT TGGYYWNWIR QPPGKKLEWM

AL IYTSGRT S YNPSLKSRLT ITKDTSKNQV VLTMTNMDPV DTATYYC ADM

ADKGGWFAY W GQGTLVTVSS (SEQ ID NO:44)

[00221] Предпочтительные антитела и их антигенсвязывающие фрагменты включают любую из 36 комбинаций вышеописанных гуманизированных вариантов антитела 4.5 к H7CR человека. Например, такие антитела включают комбинации, показанные в таблице 5: Все 36 таких гуманизированных вариантов антитела 4.5 к H7CR человека оценивали в отношении их соответствующей способности к связыванию с молекулами H7CR человека, которые эндогенно экспрессируются на поверхности клетки, и было обнаружено, что все они могут связываться с такими молекулами H7CR человека.

Пример 5

Антитело 1.3 повышает функциональность T-клеток in vivo

Материалы и способы

[00222] Мышам NOD-SCID Il2rg-/- (NSG) (Jackson Lab) интраперитонеально переносили 15~20 миллионами PBMC человека или 10 миллионами очищенных наивных CD4+ T-клеток человека. В день 0 и в день 2 каждую мышь инокулировали перитонеально 300 мкг контроля или mAb 1.3 к H7CR. Через 6 дней после переноса собирали спленоциты. T-клетки человека обнаруживали по окрашиванию в отношении CD45, CD3 и CD8 человека. Для отслеживания клеточного деления hPBMC метили CFSE до переноса.

Результаты

[00223] Анализ с помощью проточной цитометрии показал, что антитело 1.3 приводило к разрастанию ксенореактивных по отношению к мыши Т-клеток человека, о чем свидетельствовало увеличение разведенной CFSE популяции как среди CD4+, так и CD8+ T-клеток человека (фигуры 19A-19D).

Пример 6

Антитело 1.3 повышает экспрессию CD40L, IFNγ и CD107a in vivo: модель Xeno GvDH

Материалы и способы

[00224] Мышам NOD-SCID Il2rg-/- (NSG) (Jackson Lab) интраперитонеально переносили 15~20 миллионов PBMC человека или 10 миллионов очищенных наивных CD4+ T-клеток человека. В день 0 и в день 2 каждую мышь инокулировали перитонеально 300 мкг контроля или mAb 1.3 к H7CR. Через 6 дней после переноса собирали спленоциты. T-клетки человека обнаруживали по окрашиванию в отношении CD45, CD3 и CD8 человека. Спленоциты повторно стимулировали in vitro PMA совместно с иономицином для выявления клеток, продуцирующих IFN-γ или CD107a. Для отслеживания клеточного деления hPBMC метили CFSE до переноса.

Результаты

[00225] На фигурах 20А-20Н представлены диаграммы рассеяния на основе FACS анализа, показывающие повышенную экспрессию CD40L, IFNγ и CD107a у NGS мыши, которой вводили инъекцией антитело 1.3. Антитело 1.3 значимо усиливало экспрессию CD4+ T-клетками мембраносвязанного CD40L и выработку IFN по сравнению с мышами, обрабатываемыми контрольным антителом. Введение антитела 1.3 также повышало экспрессию CD107a на CD8+ T-клетках, что указывало на цитолитическую активность, а также выработку IFN. В заключение, обработка антителом 1.3 способствовала разрастанию и проявлению эффекторной функции ксенореактивных CD4+ и CD8+ T-клеток.

Пример 7

Характеристика вариантов антитела 1.3

Материалы и способы

[00226] 100 мкл 1 мкг/мл слитого белка H7CRECD-IgG1 Fc человека, разведенного в PBS иммоблизировали на плоскодонный 96-луночный планшет (Costar 9017) на ночь при температуре 4°C. Планшеты отмывали дважды PBS+0,1% PS-20 и блокировали 200 мкл/лунку PBS 10% FBS при комнатной температуре в течение 1 часа. 100 мкл IgG4 Fc химерного антитела 1.3 и 14 выбранных гуманизированных вариантов антитела 1.3, разбавленного в PBS 10%FBS, добавляли в каждую лунку и инкубировали при комнатной температуре в течение 1 часа. Планшеты отмывали три раза и в каждую лунку добавляли 100 мкл 1 мкг/мл HRP к IgG4 человека (Southern Biotech) и инкубировали при комнатной температуре в течение 1 часа. Планшеты отмывали шесть раз и в каждую лунку на 5-15 минут добавляли 100 мкл субстрата TMB (SurModics). В каждую лунку добавляли 100 мкл стоп-раствора (0,1 M серная кислота). Планшеты считывали при длине волны поглощения 450 нм с помощью многоканального ридера PerkinElmer EnVision 2104.

[00227] Значения связывающей способности для 14 вариантов антитела 1.3 изучали с помощью анализа ELISA со слитым белком H7CR.

Результаты

[00228] Результаты связывающей способности показаны в таблице 10.

[00229] На фигуре 21A и 21В представлены точечные диаграммы IFN-γ покоящихся и стимулированных PMBC, обработанных (слева направо) химерным антителом 1.3, отрицательным контролем, OKT3, OKT3 +CD28, гуманизированным иммобилизированным антителом, иммобилизированным отрицательным контролем и иммобилизированным OKT3. Статистически значимого повышения выработки цитокинов при воздействии химерного антитела 1.3 человека не наблюдалось. Таким образом, воздействие антитела 1.3 не индуцирует Т-клеточный цитокиновый шторм и этих условиях in vitro.

[00230] Последовательности химерного антитела 1.3 представлены ниже:

Последовательность нуклеиновой кислоты тяжелой цепи:

ATGGAATGGTCCTGGGTGTTCCTGTTCTTCCTGTCCGTGACCACCGGCGTGCACTCCCAGATCCAGCTGCAGGAATCTGGCCCTGGCCTCGTGAAGCCTTCCCAGTCCCTGTCCCTGACCTGCAGCGTGACCGGCTTCTCCATCTCCACCTCCGGCTACTACTGGACCTGGATCCGGCAGTTCCCTGGCAAGCGGCTGGAATGGATGGGCTACATCAACTACGGCGGAGGCACCTCCTACAACCCCAGCCTGAAGTCCCGGATCTCCATCACCCGGGATACCTCCAAGAACCAGTTCCTGCTGCACCTGAACTCCGTGACAACCGAGGACACCGCCACCTACTGCTGCGCTACCATGGCCGACAGATTCGCCTTCTTCGACGTGTGGGGCCAGGGCATCCAAGTGACCGTGTCCTCCGCTTCCACCAAGGGCCCCTCTGTGTTTCCTCTGGCCCCTTGCTCCCGGTCCACCTCTGAGTCTACAGCCGCTCTGGGCTGCCTCGTGAAAGACTACTTCCCCGAGCCCGTGACAGTGTCCTGGAACTCTGGCGCTCTGACCTCTGGCGTGCACACCTTCCCTGCTGTGCTGCAGTCTAGCGGCCTGTACTCCCTGTCCTCCGTCGTGACCGTGCCTTCCAGCTCTCTGGGCACCAAGACCTACACCTGTAACGTGGACCACAAGCCCTCCAACACCAAGGTGGACAAGAGAGTGGAATCTAAGTACGGCCCTCCCTGCCCCCCTTGTCCTGCCCCTGAATTTCTGGGCGGACCCTCCGTGTTTCTGTTCCCCCCAAAGCCCAAGGACACCCTGATGATCTCCCGGACCCCCGAAGTGACCTGCGTGGTGGTGGATGTGTCCCAGGAAGATCCCGAGGTGCAGTTCAATTGGTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACCAAGCCTAGAGAGGAACAGTTCAACTCCACCTACCGGGTGGTGTCCGTGCTGACCGTGCTGCACCAGGATTGGCTGAACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCTCCAGCATCGAAAAGACCATCTCCAAGGCTAAGGGCCAGCCCCGCGAGCCCCAGGTGTACACACTGCCTCCAAGCCAGGAAGAGATGACCAAGAATCAGGTGTCACTGACCTGTCTCGTGAAGGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAGTCCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGACTCCGACGGCTCCTTCTTTCTGTACTCTCGCCTGACCGTGGACAAGTCCCGGTGGCAGGAAGGCAACGTGTTCTCCTGCTCTGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGTCCCTGAGCCTGTCCCCCGGCTGATGA (SEQ ID NO:100).

[00231] Последовательность нуклеиновой кислоты легкой цепи:

ATGTCCGTGCCCACCCAGGTGCTGGGATTGCTGCTGCTGTGGCTGACCGACGCCAGATGCGACATCGTGATGACCCAGTCCCCCTCCTCCCTGGCTGTGTCTGCTGGCGAGAAAGTGACCATCTCCTGCCTGTCCTCCCAGTCCCTGTTCTCCTCCAACACCAACCGGAACTACCTGAACTGGTATCTGCAGAAGCCCGGCCAGTCCCCTAAGCTGCTGATCTACCACGCCTCCACCAGACTGACCGGCGTGCCCGATAGATTCATCGGCTCTGGCTCCGGCACCGACTTTACCCTGACCATCAGCTCCGTGCAGGCCGAGGACCTGGGCGACTACTACTGCCAGCACCACTACGAGACACCCCTGACCTTTGGCGACGGCACCAAGCTGGAAATCAAGCGGACCGTGGCCGCTCCCTCCGTGTTCATCTTCCCACCTTCCGACGAGCAGCTGAAGTCTGGCACCGCCTCTGTCGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAATCCGTGACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCAGCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAAGTGACCCACCAGGGCCTGTCTAGCCCCGTGACCAAGTCTTTCAACCGGGGCGAGTGCTGATGA (SEQ ID NO:101).

[00232] Белковая последовательность тяжелой цепи:

MEWSWVFLFFLSVTTGVHSQIQLQESGPGLVKPSQSLSLTCSVTGFSISTSGYYWTWIRQFPGKRLEWMGYINYGGGTSYNPSLKSRISITRDTSKNQFLLHLNSVTTEDTATYCCATMADRFAFFDVWGQGIQVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSPG** (SEQ ID NO:11).

[00233] Белковая последовательность легкой цепи:

MSVPTQVLGLLLLWLTDARCDIVMTQSPSSLAVSAGEKVTISCLSSQSLFSSNTNRNYLNWYLQKPGQSPKLLIYHASTRLTGVPDRFIGSGSGTDFTLTISSVQAEDLGDYYCQHHYETPLTFGDGTKLEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC** (SEQ ID NO:12).

Пример 8

Гуманизированные варианты антитела 4.5 к H7CR

Материалы и способы

[00234] 5 мкг/мл антител от тридцати шести вариантов инкубировали с трансфицированными слитым белком H7CR-GFP CHO клетками в течение 30 минут при комнатной температуре. Затем клетки дважды отмывали 2 мл буфера для проточной цитометрии и ресуспендировали в конечном объеме 100 мкл буфера для проточной цитометрии. Добавляли 1 мкл вторичного антитела к hIg PE (Biolegend) и инкубировали с клетками в течение 15 минут. Затем образцы отмывали и ресуспендировали в 100 мкл буфера для проточной цитометрии. Данные о проточной цитометрии получали с помощью BD Canto (BD Biosciences) в формате планшета и анализировали с помощью компьютерной программы FlowJo. На оси X показана экспрессия H7CR-GFP, а на оси Y показано связывание вариантов с трансфектантами.

Результаты

[00235] Тридцать шесть гуманизированных вариантов антитела 4.5 к H7CR изучали в отношении специфичности связывания с H7CR. Результаты представлены на фигуре 23. Все тридцать шесть гуманизированных вариантов антитела 4.5 сохраняют специфичность связывания с H7CR.

Таблица 11
Гуманизированные варианты антитела 4.5
Гуманизи-рованные варианты
4.5
Вариант № Тяжелая
цепь
Легкая
цепь
1 HC1-1 (SEQ ID NO:39) LC1-1 (SEQ ID NO:33)
2 HC1-1 (SEQ ID NO:39) LC1-2 (SEQ ID NO:34)
3 HC1-1 (SEQ ID NO:39) LC1-3 (SEQ ID NO:35)
4 HC1-1 (SEQ ID NO:39) LC2-1 (SEQ ID NO:36)
5 HC1-1 (SEQ ID NO:39) LC2-2 (SEQ ID NO:37)
6 HC1-1 (SEQ ID NO:39) LC2-3 (SEQ ID NO:38)
7 HC1-2 (SEQ ID NO:40) LC1-1 (SEQ ID NO:33)
8 HC1-2 (SEQ ID NO:40) LC1-2 (SEQ ID NO:34)
9 HC1-2 (SEQ ID NO:40) LC1-3 (SEQ ID NO:35)
10 HC1-2 (SEQ ID NO:40) LC2-1 (SEQ ID NO:36)
11 HC1-2 (SEQ ID NO:40) LC2-2 (SEQ ID NO:37)
12 HC1-2 (SEQ ID NO:40) LC2-3 (SEQ ID NO:38)
13 HC1-3 (SEQ ID NO:41) LC1-1 (SEQ ID NO:33)
14 HC1-3 (SEQ ID NO:41) LC1-2 (SEQ ID NO:34)
15 HC1-3 (SEQ ID NO:41) LC1-3 (SEQ ID NO:35)
16 HC1-3 (SEQ ID NO:41) LC2-1 (SEQ ID NO:36)
17 HC1-3 (SEQ ID NO:41) LC2-2 (SEQ ID NO:37)
18 HC1-3 (SEQ ID NO:41) LC2-3 (SEQ ID NO:38)
19 HC2-1 (SEQ ID NO:42) LC1-1 (SEQ ID NO:33)
20 HC2-1 (SEQ ID NO:42) LC1-2 (SEQ ID NO:34)
21 HC2-1 (SEQ ID NO:42) LC1-3 (SEQ ID NO:35)
22 HC2-1 (SEQ ID NO:42) LC2-1 (SEQ ID NO:36)
23 HC2-1 (SEQ ID NO:42) LC2-2 (SEQ ID NO:37)
24 HC2-1 (SEQ ID NO:42) LC2-3 (SEQ ID NO:38)

25 HC2-2 (SEQ ID NO:43) LC1-1 (SEQ ID NO:33)
26 HC2-2 (SEQ ID NO:43) LC1-2 (SEQ ID NO:34)
27 HC2-2 (SEQ ID NO:43) LC1-3 (SEQ ID NO:35)
28 HC2-2 (SEQ ID NO:43) LC2-1 (SEQ ID NO:36)
29 HC2-2 (SEQ ID NO:43) LC2-2 (SEQ ID NO:37)
30 HC2-2 (SEQ ID NO:43) LC2-3 (SEQ ID NO:38)
31 HC2-3 (SEQ ID NO:44) LC1-1 (SEQ ID NO:33)
32 HC2-3 (SEQ ID NO:44) LC1-2 (SEQ ID NO:34)
33 HC2-3 (SEQ ID NO:44) LC1-3 (SEQ ID NO:35)
34 HC2-3 (SEQ ID NO:44) LC2-1 (SEQ ID NO:36)
35 HC2-3 (SEQ ID NO:44) LC2-2 (SEQ ID NO:37)
36 HC2-3 (SEQ ID NO:44) LC2-3 (SEQ ID NO:38)

[00236] Данные секвенирования химерного антитела 4.5 представлены ниже:

[00237] Последовательность нуклеиновой кислоты тяжелой цепи:

ATGGAATGGTCCTGGGTGTTCCTGTTCTTCCTGTCCGTGACCACCGGCGTGCACTCCCAGATCCAGCTGCAGGAATCTGGCCCTGGCCTCGTGAAGCCTTCCCAGTCCCTGTCCCTGACCTGCAGCGTGACCGGCTTCTCTATCACAACCGGCGGCTACTACTGGAACTGGATCCGGCAGTTCCCCGGCAAGAAACTGGAATGGATGGGCTACATCTATACCAGCGGCCGGACCTCCTACAACCCCAGCCTGAAGTCCCGGATCTCCATCACCCGGGACACCTCCAAGAACCAGTTCTTTCTGCAGCTGAACTCCATGACCACCGAGGACACCGCCACCTACTACTGCGCCGACATGGCCGATAAGGGCGGATGGTTCGCTTACTGGGGCCAGGGCACACTCGTGACCGTGTCCTCTGCTTCCACCAAGGGCCCCTCCGTGTTTCCTCTGGCCCCTTGCTCCAGATCCACCTCCGAGTCTACCGCCGCTCTGGGCTGCCTCGTGAAAGACTACTTCCCCGAGCCCGTGACAGTGTCTTGGAACTCTGGCGCCCTGACCTCTGGCGTGCACACCTTTCCAGCTGTGCTGCAGTCCTCCGGCCTGTACTCCCTGTCCTCCGTCGTGACTGTGCCCTCCAGCTCTCTGGGCACCAAGACCTACACCTGTAACGTGGACCACAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGGAATCTAAGTACGGCCCTCCCTGCCCTCCTTGCCCAGCCCCTGAATTTCTGGGCGGACCTTCTGTGTTTCTGTTCCCCCCAAAGCCCAAGGACACCCTGATGATCTCCCGGACCCCCGAAGTGACCTGCGTGGTGGTGGATGTGTCCCAGGAAGATCCCGAGGTGCAGTTCAATTGGTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACCAAGCCTAGAGAGGAACAGTTCAACTCCACCTACCGGGTGGTGTCCGTGCTGACCGTGCTGCACCAGGATTGGCTGAACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCAGCTCCATCGAAAAGACCATCTCCAAGGCTAAGGGCCAGCCCCGCGAGCCCCAGGTGTACACACTGCCTCCAAGCCAGGAAGAGATGACCAAGAATCAGGTGTCACTGACCTGTCTCGTGAAGGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAGTCCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGACTCCGACGGCTCCTTCTTTCTGTACTCTCGCCTGACCGTGGACAAGTCCCGGTGGCAGGAAGGCAACGTGTTCTCCTGCTCTGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGTCCCTGAGCCTGTCCCCCGGCTGATGA (SEQ ID NO:13).

[00238] Последовательность нуклеиновой кислоты легкой цепи:

ATGTCCGTGCCCACCCAGGTGCTGGGATTGCTGCTGCTGTGGCTGACCGACGCCAGATGCGACATCGTGATGACCCAGTCCCCCTCCTCCCTGGCTGTGTCTGCTGGCGAGAAAGTGACCATCTCCTGCCTGTCCTCCCAGTCCCTGTTCTCCAGCAACACCAAGCGGAACTACCTGAACTGGTATCTGCAGAAGCCCGGCCAGTCCCCTAAGCTGCTGATCTACCACGCCTCCACCAGACTGACCGGCGTGCCCGGAAGATTCATCGGCTCTGGCTCTGGCACCGACTTCACCCTGACCGTGTCTACCGTGCAGGCCGAGGACCTGGGCGACTACTTCTGCCAGCAGCACTACGAGACACCCCTGACCTTTGGCGACGGCACCCGGCTGGAAATCAAGAGAACCGTGGCCGCTCCCTCCGTGTTCATCTTCCCACCTTCCGACGAGCAGCTGAAGTCCGGCACCGCTTCTGTCGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAATCCGTGACCGAGCAGGACTCCAAGGACAGCACCTACTCCCTGTCCTCTACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAAGTGACCCACCAGGGCCTGTCTAGCCCCGTGACCAAGTCTTTCAACCGGGGCGAGTGCTGATGA (SEQ ID NO:14).

[00239] Белковая последовательность тяжелой цепи:

MEWSWVFLFFLSVTTGVHSQIQLQESGPGLVKPSQSLSLTCSVTGFSITTGGYYWNWIRQFPGKKLEWMGYIYTSGRTSYNPSLKSRISITRDTSKNQFFLQLNSMTTEDTATYYCADMADKGGWFAYWGQGTLVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSPG** (SEQ ID NO:15).

[00240] Белковая последовательность легкой цепи:

MSVPTQVLGLLLLWLTDARCDIVMTQSPSSLAVSAGEKVTISCLSSQSLFSSNTKRNYLNWYLQKPGQSPKLLIYHASTRLTGVPGRFIGSGSGTDFTLTVSTVQAEDLGDYFCQQHYETPLTFGDGTRLEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC** (SEQ ID NO:16).

[00241] Все публикации и патенты, упомянутые в данном описании, включены в данный документ с помощью ссылки в той же степени, в которой каждая отельная публикация или патентная заявка была конкретно и отдельно указана как включенная с помощью ссылки во всей своей полноте. Несмотря на то, что настоящее изобретение было описано в связи с конкретными вариантами его осуществления, будет понятно, что существует возможность дополнительных изменений, и предполагается, что данная заявка охватывает любые варианты, применения или адаптации настоящего изобретения, следующие, в целом, идеям настоящего изобретения и включающие такие отступления от настоящего раскрытия, которые относятся к известной или обычной практике в пределах области техники, к которой принадлежит настоящее изобретение, и которые можно применять по отношению к основным признакам, изложенным в данном документе выше.

1. Антитело или его антигенсвязывающий фрагмент, которое специфически связывает B7-H7CR человека,

где антитело или его антигенсвязывающий фрагмент является генноинженерным и содержит:

(1) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 23;

(2) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 24;

(3) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 25;

(4) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 26;

(5) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 27;

(6) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 17, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 28;

(7) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 18, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 24;

(8) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 18, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 25;

(9) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 18, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 27;

(10) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 18, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 28;

(11) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 19, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 24;

(12) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 19, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 25;

(13) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 19, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 27; или

(14) вариабельную область легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 19, и вариабельную область тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 28.

2. Антитело или его антигенсвязывающий фрагмент по п.1, где указанный специфически связанный H7CR:

(A) расположен на поверхности живой клетки или

(B) экспрессируется в эндогенной концентрации.

3. Антитело или его антигенсвязывающий фрагмент по п.2, где указанной живой клеткой является Т-клетка, NK-клетка или плазмацитоидная дендритная клетка.

4. Антитело или его антигенсвязывающий фрагмент по п.1, где указанное антитело или его антигенсвязывающий фрагмент практически неспособно блокировать взаимодействие B7-H7CR с В7-Н7.

5. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент модулирует активность H7CR или выступает в роли агониста активности H7CR.

6. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело является биспецифическим или мультиспецифическим антителом или его антигенсвязывающим фрагментом.

7. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-6, где антигенсвязывающий фрагмент выбран из группы, состоящей из одноцепочечных Fv (scFv), фрагмента Fab, фрагмента F(ab'), фрагмента F(ab')2 и биспецифических связанных дисульфидными связями Fv (sdFv).

8. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-7, где антитело или его антигенсвязывающий фрагмент принадлежит к классу иммуноглобулинов, выбранному из IgG, IgE, IgM, IgD, IgA или IgY.

9. Антитело или его антигенсвязывающий фрагмент по п.8, где IgG представляет собой изотип IgG1, IgG2, IgG3 или IgG4.

10. Антитело или его антигенсвязывающий фрагмент по п.1, где указанное антитело или его антигенсвязывающий фрагмент имеет детектируемую метку.

11. Антитело или его антигенсвязывающий фрагмент по п.1, которое содержит конъюгированный токсин, лекарственное средство, рецептор, фермент или лиганд рецептора.

12. Фармацевтическая композиция для лечения или профилактического лечения заболевания, связанного с экспрессией B7-H7CR, содержащая терапевтически эффективное количество антитела или его антигенсвязывающего фрагмента по п.1 и физиологически приемлемый носитель или вспомогательное вещество.

13. Способ лечения заболевания, связанного с экспрессией В7-H7CR, у индивида с симптомом указанного заболевания, включающий введение указанному индивиду, нуждающемуся в этом, терапевтически эффективного количества фармацевтической композиции по п.12.

14. Способ по п.13, где указанным заболеванием является злокачественная опухоль.

15. Способ по п.14, где злокачественная опухоль выбрана из группы, состоящей из лейкоза, лимфомы, меланомы, злокачественной опухоли прямой кишки, злокачественной опухоли легкого, злокачественной опухоли молочной железы, злокачественной опухоли предстательной железы, злокачественной опухоли шейки матки, злокачественной опухоли печени, злокачественной опухоли яичек, злокачественной опухоли мозга, злокачественной опухоли поджелудочной железы и злокачественной опухоли почки.

16. Способ по п.14 или 15, где индивиду со злокачественной опухолью вводится одно или несколько дополнительных средств или терапий.

17. Способ по п.16, где одно или несколько дополнительных средств представляют собой химиотерапевтический препарат, клеточную вакцину, гормональный препарат, ингибитор точки иммунологического пути или их комбинацию.

18. Способ по п.13, где указанным заболеванием является инфекционное заболевание.

19. Способ по п.18, где указанным инфекционным заболеванием является хроническое вирусное заболевание.

20. Способ усиления иммунного ответа, связанного с взаимодействием В7 и B7-H7CR, у индивида, нуждающегося в этом, включающий введение индивиду терапевтически эффективного количества фармацевтической композиции по п.12.

21. Способ по п.20, где указанная фармацевтическая композиция выступает в роли агониста функции H7CR.

22. Способ по п.20 или 21, где фармацевтическая композиция вводится перорально, внутрикожно, внутримышечно, интраперитонеально, внутривенно, подкожно, интраназально, трансдермально, посредством имплантанта, через слизистую прямой кишки, легкое, кишечник, слизистую оболочку, или с помощью эпидурального способа введения.

23. Способ профилактического лечения заболевания, связанного с экспрессией B7-H7CR, у индивида, нуждающегося в профилактическом лечении, включающий введение индивиду перед проявлением симптома указанного заболевания профилактически эффективного количества фармацевтической композиции по п.12.

24. Способ диагностики заболевания, связанного с экспрессией B7-H7CR, у индивида, включающий:

(i) анализ клеток или ткани, полученных из биологического образца указанного индивида в отношении их способности связываться с антителом или его антигенсвязывающим фрагментом, которое специфически связывает B7-H7CR человека по п.1;

(ii) сравнение уровней связывания антитела или его антигенсвязывающего фрагмента с B7-H7CR человека, экспрессируемого клеткой или тканью биологического образца индивида; и

(iii) диагностику заболевания у индивида на основе повышенных или пониженных уровней экспрессии B7-H7CR по сравнению с уровнями B7-H7CR в соответствующем контроле.

25. Способ по п.24, где указанным заболеванием является злокачественная опухоль.

26. Антитело или его антигенсвязывающий фрагмент, которое специфически связывается с B7-H7CR человека, где антитело или его антигенсвязывающий фрагмент содержит CDR 1 легкой цепи с последовательностью SEQ ID NO: 29, CDR 2 легкой цепи с последовательностью SEQ ID NO: 32, CDR 3 легкой цепи с последовательностью SEQ ID NO: 45, и CDR1 тяжелой цепи с последовательностью SEQ ID NO: 49, CDR 2 тяжелой цепи с последовательностью SEQ ID NO: 52 и CDR 3 тяжелой цепи с последовательностью SEQ ID NO: 56.

27. Антитело или его антигенсвязывающий фрагмент по п.26, где антитело или его антигенсвязывающий фрагмент представляют собой гуманизированное моноклональное антитело или его антигенсвязывающий фрагмент.

28. Антитело или его антигенсвязывающий фрагмент по п.27, которое является биспецифическим или мультиспецифическим антителом.

29. Антитело или его антигенсвязывающий фрагмент по п.26, которое имеет детектируемую метку или содержит конъюгированный токсин, лекарственное средство, рецептор, фермент или лиганд рецептора.

30. Антитело или его антигенсвязывающий фрагмент по п.1 или 26, которое не блокирует взаимодействие В7-Н7 и B7-H7CR.

31. Антитело или его антигенсвязывающий фрагмент по п.1 или 26, которое активирует антиген-специфические ответы Т-лимфоцитов памяти через подвергание Т-лимфоцитов действию антигена и антитела или его антигенсвязывающего фрагмента.

32. Антитело или его антигенсвязывающий фрагмент по п.31, где подвергание Т-лимфоцитов действию антитела или его антигенсвязывающего фрагмента вызывает продуцирование одного или нескольких цитокинов Т-лимфоцитами.

33. Антитело или его антигенсвязывающий фрагмент по п.32, где один или несколько цитокинов включают IFNγ, TNFα, GM-CSF и IL-10.



 

Похожие патенты:

Изобретение относится к методам исследования материалов, а именно к исследованию пористости бумаги. Предложен способ определения пористости бумаги, включающий нанесение одной или нескольких капель каменноугольной смолы на исследуемый лист бумаги, сопоставление диаметра проявившегося центрального однотонного пятна каменноугольной смолы с эталонным значением диаметра центрального пятна, соответствующим конкретному размеру пор бумаги.

Изобретение относится к биоорганической химии и может быть использовано для определения аминокислотной последовательности пептидов и их фрагментов методом масс-спектрометрии.

Изобретение относится к области биотехнологии и может быть использовано при оптимизации процессов, связанных с производством живых сухих вакцин, содержащих остаточную влажность.
Изобретение относится к способам определения содержания (концентрации) воды в нефтесодержащих эмульсиях и отложениях, в отработанных нефтепродуктах и других нефтесодержащих отходах (нефтешламах), а также в почвах и грунтах с мест розлива нефтепродуктов или территорий с высоким уровнем загрязнения углеводородами по другой причине.

Изобретение относится к медицине, а именно к эндокринологии, и может быть использовано для одновременной диагностика неклассических форм врожденной дисфункции коры надпочечников (НФ ВДКН) с недостаточностью 21-гидроксилазы и 11β-гидроксилазы.

Изобретение относится к биотехнологии и контролю качества и может быть использовано в фармацевтической промышленности и научно-исследовательской деятельности для количественного определения гиалуронидазной активности лекарственных средств.
Изобретение относится к ветеринарной терапии и может быть использовано для диагностики интерстициального цистита у кошек. Способ диагностики интерстициального цистита у кошек, включающий анализ мочи, отличается тем, что дополнительно вводят в мочевой пузырь физиологический раствор натрия хлорида в объеме, превышающем физиологический объем наполнения мочевого пузыря на 10%, отбирают пробу физиологического раствора натрия хлорида из мочевого пузыря, определяют количество эритроцитов в физиологическом растворе натрия хлорида из мочевого пузыря и в моче, и при увеличении количества эритроцитов в физиологическом растворе натрия хлорида более чем на 50% по сравнению с содержанием в моче диагностируют интерстициальный цистит.
Изобретение относится к области медицины, а именно к акушерству, и найдет применение для прогнозирования у беременных женщин нарушений вегетативной регуляции в послеродовом периоде.

Изобретение относится к области геохимии и может быть использовано при проведении геохимических исследований. Предложен способ, позволяющий определить с пространственным разрешением геохимию геологических материалов или других материалов.

Использование: для физико-химического анализа жидких и газообразных сред с использованием акустических волн. Сущность изобретения заключается в том, что акустический сенсор системы электронный нос и электронный язык содержит плоскопараллельную пластину из пьезоэлектрического кристалла с кристаллографической осью, лежащей в плоскости пластины, имеющей лицевую и тыльную стороны; электроакустические встречно-штыревые преобразователи (ВШП), размещенные парами и образующие две совокупности акустических каналов для поверхностных акустических волн (ПАВ) с длиной волны, много меньшей толщины пластины, и семейства пластинчатых мод колебаний (ПМК) с длиной волны, меньшей или равной толщине пластины; локальную зону для внесения анализируемой жидкости, размещенную на пластине, при этом в акустических каналах для ПАВ размещены пленки веществ, чувствительных к составу газовой пробы, имеющие форму полосок, длина которых совпадает с направлением распространения ПАВ, а ширина составляет не менее ширины ВШП, локальная зона для внесения анализируемой жидкости образована на лицевой поверхности пластины, ограничена по меньшей мере одной цилиндрической кюветой для жидкости с открытым горлом, дном которой является упомянутая пластина, при этом ВШП для возбуждения ПМК размещены по периферии вокруг цилиндрической кюветы, а акустические каналы для ПАВ размещены вне зоны размещения кюветы.
Изобретение относится к области медицины, а именно к пульмонологии и неонатологии, и может быть использовано для раннего прогнозирования бронхолегочной дисплазии (БЛД) тяжелой степени у недоношенных детей, родившихся с экстремально низкой массой тела (ЭНМТ).
Изобретение относится к области медицины, а именно к акушерству, и может быть использовано для выбора акушерской тактики у беременных с сахарным диабетом. Для этого в сыворотке крови беременной в 37-38 недель гестации определяют уровень ИЛ-1β и окситоцина.

Изобретение относится к области медицины, а именно к кардиологии, и касается способа прогнозирования исхода острой ишемии миокарда. Способ включает определение в плазме крови уровня свободно циркулирующей митохондриальной ДНК (мтДНК) крови методом полимеразной цепной реакции в реальном времени с амплифицированием фрагмента гена 16S рРНК прямым и обратным праймерами.
Изобретение относится к области медицины, а именно к акушерству, и найдет применение для прогнозирования у беременных женщин нарушений вегетативной регуляции в послеродовом периоде.
Изобретение относится к области медицины, а именно к акушерству, и найдет применение для прогнозирования у беременных женщин нарушений вегетативной регуляции в послеродовом периоде.

Изобретение относится к медицине, а именно к кардиологии и может быть использовано для оценки риска формирования хронической сердечной недостаточности у молодых мужчин при артериальной гипертензии.

Изобретение относится к медицине и может быть использовано в кардиологии, ангиологии, кардиохирургии, реабилитологии, и может быть использовано в качестве способа диагностики рестенозов стентов у больных ишемической болезнью сердца (ИБС) с хронической сердечной недостаточностью (ХСН).

Изобретение относится к области ветеринарной вирусологии, в частности к способу диагностики оспы овец и коз. Способ экспресс-диагностики вируса оспы коз и овец включает отбор проб патологического материала из очага инфекционного заболевания, экстракцию ДНК бактерий инфекционного заболевания из полученных проб, идентификацию видовой принадлежности возбудителя болезни методом полимеразной цепной реакции с флуоресцентным учетом результатов в режиме реального времени с применением термоциклера типа RotorGene на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией.

Изобретение относится к области ветеринарной вирусологии, в частности к способу экспресс-диагностики нодулярного дерматита крупного рогатого скота (КРС). Способ экспресс-диагностики вируса нодулярного дерматита КРС включает отбор проб патологического материала из очага инфекционного заболевания от всех животных, находящихся в очаге инфекционного заболевания, и проведение экспресс-диагностики полученного патологического материала в течение суток методом ПЦР с флуоресцентным учетом результатов в режиме реального времени с применением термоциклера типа RotorGene для выявления животных-носителей вируса нодулярного дерматита на начальной стадии инфицирования, при этом учет результатов ПЦР проводят по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, если наблюдают рост специфического сигнала, то образец считают положительным - вирус нодулярного дерматита КРС присутствует, при этом значения контрольных образцов находятся в пределах нормы, если не наблюдают рост специфического сигнала, то образец считают отрицательным - вирус нодулярного дерматита крупного рогата скота отсутствует, и значения контрольных образцов также находятся в пределах нормы.
Изобретение относится к области медицины, а именно к стоматологии, и предназначено для качественного определения стоматологического статуса пациента с воспалением слизистой оболочки альвеолярного отростка челюсти.

Изобретение относится к биохимии. Описано антитело, которое специфично связывается с IL-6, где это антитело включает аминокислотные последовательности SEQ ID NO: 9 и SEQ ID NO: 10.

Настоящая группа объектов изобретения относится к области иммунологии. Предложено антитело, которое специфически связывает B7-H7CR человека, и его антигенсвязывающий фрагмент. Также рассмотрены: фармацевтическая композиция, способ лечения заболевания, связанного с экспрессией В7-H7CR, способ усиления иммунного ответа, связанного с взаимодействием В7 и B7-H7CR, способ профилактического лечения заболевания, связанного с экспрессией B7-H7CR, и способ диагностики заболевания, связанного с экспрессией B7-H7CR. Антитело по настоящему изобретению обеспечивает усиление иммунного ответа, в связи с чем может найти дальнейшее применение в терапии и диагностике различных заболеваний. 7 н. и 26 з.п. ф-лы, 23 ил., 11 табл., 8 пр.

Наверх