Способ проведения пцр с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям а и к гена dgat1



Способ проведения пцр с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям а и к гена dgat1
Способ проведения пцр с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям а и к гена dgat1
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2662972:

Федеральное государственное бюджетное научное учреждение "Центр экспериментальной эмбриологии и репродуктивных биотехнологий" (ФГБНУ ЦЭЭРБ) (RU)

Изобретение относится к области биотехнологии и молекулярно-генетической диагностики. Раскрыт способ проведения ПЦР с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1. Изобретение позволяет расширить арсенал способов генотипирования крупного рогатого скота по аллелям А и К DGAT1 на основе ПЦР в реальном времени и повысить их надежность. 2 ил.

 

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики, генетики и селекции сельскохозяйственных животных, в частности к оценке аллельного полиморфизма гена, кодирующего диацилглицерол-О-ацилтрансферазу 1 (DGAT1) крупного рогатого скота молекулярно-генетическим методом исследования.

Диацилглицерол-О-ацилтрансфераза 1 (DGAT1, ЕС 2.3.1.20) является одним из ключевых ферментов метаболизма триглицеридов - катализирует заключительную стадию их биосинтеза, используя 1,2-диациллицерол и ацил-СоА в качестве субстрата (Farese Jr R.V., Cases S., Smith S.J. Triglyceride synthesis:insights from the cloning of diacylglycerol acyltransferase // Curr.Opin.Lipidol. - 2000. - Vol. 11. - P. 229-234). DGAT1 играет важную роль в ряде физиологических процессов высших эукариот, таких как регуляция концентрации триацилглицеридов в крови, формирование жировой ткани, созревание ооцитов и др. (Homa S.T., Racowsky С., McGaughey R.W. Lipid analysis of immature pig oocytes // J. Reprod. Fertil. - 1986. - Vol. 77. - P. 425-434.; Cases S., Smith S.J., Zheng Y.W., Myers H.M., Lear S.R., Sande E., Novak S., Collins C., Welch C.B., Lusis A.J., Erickson S.K., Farese R.V. Jr. Identification of a gene encoding an acyl CoA: diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis // Proc. Natl. Acad. Sci. USA. - 1998. - Vol. 95. No. 22. - P. 13018-13023). Дефицит DGAT1 приводит к нарушению синтеза жирных кислот в жировой ткани и скелетных мышцах (Chen Н.С., Smith S.J., Ladha Z. Increased insulin and leptin sensitivity in mice lacking acyl CoA: diacylglycerol acyltransferase 1 // J. Clin. Invest. - 2002. - Vol. 109. - P. 1049-1055), a также лактации вплоть до ее отсутствия (Smith S.J., Cases S., Jensen D.R., Chen H.C., Sande E., Tow В., Sanan D.A., Raber J., Eckel R.H. and FareseR.V.Jr. Obesty resistance and multiple mechanisms of triglyceride // Nat. Genet. - 2000. - Vol. 25. - No. 1. - P. 87-90).

Ген, кодирующий DGAT1 у Bos taurus, расположен в центромерном участке хромосомы 14 вместе с другими генами, определяющими молочную продуктивность и качество молока и формирующими так называемый локус количественных признаков QTL (Quantitative trait loci) (Riquet J., Coppieters W., Cambisano N., et al. Identity-bydecent fine-mapping of QTL in outbred populations: Application to milk production in dairy cattle // Proc. Natl. Acad. Sci. - 1999. - Vol. 96. - P. 9252-9257; Farnir F.B., Grisart W., Coppieters J., et al. Simultaneous mining of linkage and linkage disequilibrium to fine map quantitative trait loci in outbred half-sib pedigrees: revisting the location of a quantitative trait locus with major effect on milk production on bovine chromosome 14 // Genetics. - 2002. - Vol. 161. - P. 275-287). Изучение аллельного полиморфизма гена DGAT1 позволило выявить в общей сложности около двух десятков однонуклеотидных замен, большинство из которых локализованы в некодирующих участках гена и, таким образом, не влияет на структуру самого фермента (Winter A., W, Werner F.A, Kollers S., Kata S., Durstewitz G., Buitkamp J., Womack J.E., Thaller G., Fries R. Association of a lysine-232/alanine polymorphism in a bovine gene encoding acyl-CoA: diacylglycerol acyltransferase (DGAT1) with variation at a quantitative trait locus for milk fat content // Proc. Natl. Acad. Sci. - 2002. - Vol. 99. - P. 9300-9305; Grisart В., Coppieters W., Farnir F., Karim L et al. Positional candidate cloning of a QTL in dairy cattle: identification of a missense mutation in the bovine DGAT1 gene with major effect on milk yield and composition // Genome Res. - 2002. - Vol. 12. - No. 2, P. 222-231; Kong H.S., OhJ.D., LeeJ.H., YoonD.H., ChoiY.H., ChoB.W., Lee H.K. and JeonG.J. Association of Sequence Variations in DGAT 1 Gene with Economic Traits in Hanwoo (Korea Cattle) // Asian-Aust. J. Anim. Sci. - 2007. - No. 6. - P. 817-820; Rosse Ida C., Steinberg Rda S., Coimbra R.S., Peixoto M.G., Verneque R.S., Machado M.A., Fonseca C.G., Carvalho M.R. Novel SNPs and INDEL polymorphisms in the 3'UTR of DGAT1 gene: in silico analyses and a possibleassociation // Mol. Biol. Rep. - 2014. - Vol. 41. - No. 7. - P. 4555-4563). Исключением является двунуклеотидная замена GC→АА в экзоне 8 (позиция 10433/10434 в нуклеотидной последовательности гена DGAT1 GenBank No. AJ318490), которая приводит к замене аминокислотного остатка аланина на лизин в позиции 232 зрелого белка DGAT1 (А→K). Исследования, проведенные на разных породах крупного рогатого скота, выявили связь между наличием аллеля 232K и повышенным содержанием жира в молоке и преобладанием насыщенных жирных кислот С16:0 и С18:0 над ненасыщенными (Grisart В., Coppieters W., Farnir F., Karim L et al. Positional candidate cloning of a QTL in dairy cattle: identification of a missense mutation in the bovine DGAT1 gene with major effect on milk yield and composition // Genome Res. - 2002. - Vol. 12. - No. 2, P. 222-231; Spelman R.J., Ford C.A., Mcelhinney P., Gregory G.C., Snell R.G. Characterization of the DGAT1 gene in the New Zealand dairy population // J. Dairy Sci - 2002. - Vol. 85. - P. 3514-3517; Fisher P.J., Spelman R.J.. Verification of selective DNA pooling methodology through identification and estimation of the DGAT1 effect // Anim. Genet - 2004-. Vol. 35. - P. 201-205; Winter A., W, Werner F.A, Kollers S., Kata S., Durstewitz G., Buitkamp J., Womack J.E., Thaller G., Fries R. Association of a lysine-232/alanine polymorphism in a bovine gene encoding acyl-CoA: diacylglycerol acyltransferase (DGAT1) with variation at a quantitative trait locus for milk fat content // Proc. Natl. Acad. Sci. - 2002. - Vol. 99. - P. 9300-9305; A., Balteanu V.A., Gal E., Pusta D., Mihaiu R., Dan S.D., A.F., Mihaiu M. Influence of DGAT1 K232A polymorphism on milk fat percentage and fatty acid profiles in Romanian holstein cattle. Anim. Biotechnol. - 2015 - Vol. 26. - No. 2. - P. 105-111). Также имеются данные о связи аллеля К с повышенным содержанием внутримышечного жира и мраморностью говядины (Thaller G., С., Winter A., Ewald G., Bellmann О., Wegner J., H., Fries R. DGAT1, a new positional and functional candidate gene for intramuscular fat deposition in cattle // Anim. Genet. - 2003. Vol. 34. - No. 5. - P. 354-357; Kong H.S., OhJ.D., LeeJ.H., YoonD.H., ChoiY.H., ChoB.W., Lee H.K. and JeonG.J. Association of Sequence Variations in DGAT 1 Gene with Economic Traits in Hanwoo (Korea Cattle) // Asian-Aust. J. Anim. Sci. - 2007. - No. 6. - P. 817-820; , PolvilloO., , , , Molina A. Associations between DGAT1, FABP4, LEP, RORC, and SCD1 gene polymorphisms and fat deposition in Spanish commercial beef // J. Anim. Sci. - 2013. - Vol. 91. - No. 10. - P. 4571-4577). Таким образом, ген DGAT1 признан геном-кандидатом для контроля содержания и состава жиров в молоке и мясе крупного рогатого скота. Селекция крупного рогатого скота по аллелю А может улучшить качество молока по содержанию ненасыщенных жиров, в то время как отбор животных по аллелю К может способствовать увеличению содержания насыщенных жиров в молоке и мясе.

Известны методы идентификации аллельных вариантов А и K гена DGAT1 с использованием ПЦР-ПДРФ (полимеразная цепная реакция с последующим анализом полиморфизма длины рестрикционных фрагментов). Метод ПЦР-ПДРФ включает следующие этапы: 1) выделение геномной ДНК; 2) амплификация полиморфного участка гена; 3) рестрикцию ампликона специфической эндонуклеазой (рестриктазой); 4) электрофоретическое разделение образующихся фрагментов ДНК и анализ полученных электрофореграмм. Существуют различные способы проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и K DGAT. Различия касаются используемых праймеров для ПЦР и эндонуклеазы для рестрикции ампликона. Так, в способе, предложенном Komisarek с соавторами (Komisarek J., Michalak A. A relationship between DGAT1 K232A polymporphism and selected reproductive traits in Polish Holstein-Friesian cattle // Anim. Sci. Pap. and Rep - 2008. - Vol. 26 - №2. - P. 89-95), используются праймеры F: 5-TGCCGCTTGCTCGTAGCTTTGGCC-3 R: 5-ACCTGGAGCTGGGTGAGGAACAGC-3, инициирующие амплификацию фрагмента гена DGAT1 длиной 378 п.н., и рестриктаза BglI. При этом получаются следующие генотип-специфичные профили: генотип АА=254/96/28 п.н., генотип KK=282/96 п.н., генотип AK=282/254/96/28 п.н. В способе, предложенном в статье Тюлькина С.В. с соавторами (Тюлькин С.В., Вафин P.P., Муратова А.В., Хатыпов И.И., Загидуллин Л.Р., Рачкова Е.Н., Ахметов Т.М., Равилов Р.Х. Разработка способа проведения ПЦР-ПДРФ на примере DGAT1-гена крупного рогатого скота // Фундаментальные исследования. - 2015. - №2-17. - С. 3773-3775) используются три праймера (DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3', DGAT 1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' и DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3'), два из которых являются аллель-специфичными, а третий- общий для обоих аллелей гена DGAT1. С помощью праймеров осуществляется амплификация участка гена длиной 100 п.н., который затем расщепляется рестриктазой TaqI, создавая следующие профили: генотип АА=82/18 п.н., генотип КК=100 п.н. и АК=100/82/18 п.н. В методе, предложенном Kong с соавторами (Kong и др., 2007), использовались праймеры Forward: 5'-TTCCTCAAGCTGTTCTCCTA-3' и Reverse: 5'-CACGTACCTGCTGGATCA-3' и рестриктаза EaeI. Получаемые профили генотипов: КК=558 п.н., АА=369/189 п.н., АК=558/369/189 п.н. В методе, предложенном Winter (Winter и др., 2002) используются праймеры F: 5'-GCACCATCCTCTTCCTCAAG-3' и R: 5'-GGAAGCGCTTTCGGATG-3' и рестриктаза CfrI (профили генотипов -АА=203/208 п.н., КК=411 п.н., АК=411/203/208 п.н). В методе, предложенном нами ранее (Глазко и др., 2016), использовались праймеры DGAT1-dir: 5'-TGCTGGCCCTGATGGTCTACAC-3' и DGAT1-rev: 5-GAAGGAAGCAAGCGGACAGT-3' и рестриктаза AcoI. Получаемые профили генотипов: КК=540, АА=220/320, АК=540/220,320.

Основными недостатками метода ПЦР-ПДРФ являются: длительность и трудоемкость анализа (более 6-8 часов до получения результата), низкая производительность, отсутствие возможности автоматизации анализа, вероятность недостоверных результатов в случае неоптимального соотношения количества ДНК, рестриктазы и времени рестрикции. Лимитирующим фактором для применения данного метода является отсутствие рестриктаз к необходимому полиморфному участку гена.

Эффективной альтернативой ПЦР-ПДРФ анализу является метод ПЦР в реальном времени с использованием аллель-специфичных линейный разрушаемых зондов (TaqMan). Зонд типа TaqMan представляет собой олигонуклеотид, комплементарный нужному участку ПЦР-продукта и меченый флюорофором и гасителем флюоресценции. В структуре зонда TaqMan флуорофор и гаситель TaqMan зонда сближены настолько, что флуоресценция подавлена. При накоплении продукта реакции зонд гибридизуется на соответствующий участок ампликона, после чего разрушается за счет 5'-концевой активности Taq-полимеразы. Разрушение зонда приводит к отрыву флуорофора от гасителя и началу флуоресценции. Интенсивность флуоресцентного сигнала возрастает с каждым циклом ПЦР пропорционально накоплению целевого ПЦР-продукта. Дифференциация аллелей с помощью аллель-специфичных зондов TaqMan основана на эффективности их гибридизации на содержащие полиморфную позицию продукты ПЦР. И хотя различие в эффективности гибридизации зондов при однонуклеотидных заменах незначительна, эта небольшая разница накапливается от цикла к циклу и, в итоге, позволяет достоверно различать аллели (Ребриков Д.В., Саматов Г.А., Трофимов Д.Ю., Семенов П.А., Савилова A.M., Кофиади И.А., Абрамов Д.Д. ПЦР в реальном времени // Бином. Лаборатория знаний, 2009).

Таким образом, в настоящее время существует несколько подходов для определения аллельных вариантов гена DGAT1, ассоциированных с содержанием и составом жиров в молоке и мясе крупного рогатого скота.

Из уровня техники известен способ генотипирования крупного рогатого скота по аллелям А и K гена DGAT1, обеспечивающий их идентификацию на основе ПЦР в реальном времени в формате гибридизационно-флуоресцентной детекции (прототип - патент РФ №2619167, 2017 г.). Способ состоит в том, что аллели диагностируют методом анти-праймер-опосредованной количественной ПЦР в реальном времени (anti-primer-based quantitative real-time PCR, aQRT-PCR) с помощью аллель-специфичных 5'-флуоресцентно-меченых праймеров с использованием анти-праймера, меченого гасителем флуоресценции с 3'-конца. Недостатком данного метода можно обозначить использование в реакции аллель-специфичных праймеров, которые при использовании неоптимальных условий проведения реакции способны неспецифично отжигаться на матрице ДНК, что может приводить к получению ложноположительных результатов и снижению надежности способа.

Техническим результатом предлагаемого способа является расширение арсенала способов генотипирования крупного рогатого скота по аллелям А и К DGAT1 на основе ПЦР в реальном времени и повышение их надежности.

Технический результат достигается тем, что способ проведения ПЦР с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся тем, что используются:

прямой общий праймер 5'-TGCTGGCCCTGATGGTCTACAC-3' (SEQ ID NO 1),

обратный общий праймер 5'-GCGGTAGGTCAGGTTGTCGG-3' (SEQ ID NO 2),

А-аллель-специфичный флуоресцентно-меченый зонд

5'-(FAM)TAAGGCGGCCAACGGGGGAGCTGC(BHQ1)-3' (SEQ ID NO 3),

К-аллель-специфичный флуоресцентно-меченый зонд

5'-(CY5)TAAGAAGGCCAACGGGGGAGCTGC(BHQ2)-3' (SEQ ID NO 4).

Перечень графических материалов.

На фиг. 1 представлены нуклеотидные последовательности фрагмента гена DGAT1 длиной 279 п.н., кодирующие аллели А и К DGAT1. Жирным шрифтом отмечены последовательности праймеров и зондов.

На фиг. 2 представлены: А - пример диаграммы распределения аллелей А и К DGAT1, Б - результат исследования гомозиготного образца по аллелю А (генотип АА), В - результат исследования гомозиготного образца по аллелю К (генотип КК), Г - кривые флуоресценции для гетерозигот АК.

Патентуемый способ заключается в проведения ПЦР в реальном времени для генотипирования крупного рогатого скота по аллельным вариантам GC/AA гена DGAT1 в позиции 10433/10434 последовательности GenBank No. AJ318490, кодирующим в позиции 232 белка DGAT1 аланин/лизин, соответственно. Заявленный способ отличается тем, что используются два общих для аллельных вариантов праймера: прямой праймер DGAT1-F: 5'- TGCTGGCCCTGATGGTCTACAC-3' (SEQ ID NO: 1) и обратный праймер DGAT1-R: 5'-GCGGTAGGTCAGGTTGTCGG-3' (SEQ ID NO: 2) фланкирующие участок гена DGAT1 длиной 279 п.н., и два аллель-специфичных флуоресцентно-меченых зонда типа TaqMan: DGAT1 - A: 5'-(FAM)TAAGGCGGCCAACGGGGGAGCTGC(BHQ1)-3' (SEQ ID NO: 3) и DGAT1-К:5'-(Cy5)TAAGAAGGCCAACGGGGGAGCTGC(BHQ2)-3' (SEQ ID NO: 4). Точки мутаций те же, что и в прототипе (патент на изобретение 2619167 опубл. 12.05.2017 Бюл. №14), однако подход детекции иной: в заявленном изобретении осуществляется идентификация полиморфизма GC/AA гена DGAT1 в позиции 10433/10434 (локус №) с помощью двух аллель-специфичных TaqMan зондов.

В патентуемом способе идентификации аллельных вариантов А и K DGAT1 на основе ПЦР в реальном времени используются два праймера, общие для обоих аллелей гена DGAT1, и два аллель-специфичных флуоресцентно-меченых зонда типа TaqMan (Фиг. 1). Праймеры DGAT1-D и DGAT1-R инициируют амплификацию участка гена DGAT1 крупного рогатого скота длиной 279 п.н. Реакцию амплификации проводили в 10 мкл смеси ПЦР, содержащей 5 мкл реактива LightCycler® 480 ProbesMaster («Roche», Швейцария), по 0.4 мкМ прямого и обратного праймера, по 0.2 мкМ аллель-специфичных зондов, 20 нг ДНК. ПЦР проводили с помощью прибора LightCycler 96 («Roche», Швейцария) при следующих условиях: начальная денатурация в течение 10 мин при 95°С; последующие 40 циклов амплификации в следующем режиме - денатурация при 95°С в течение 15 с, отжиг при 60°С в течение 15 с, элонгация при 72°С в течении 15 с. Детекция флуоресценции проводилась на стадии элонгации по каналам FAM и Су5.

Идентификация аллелей А и К проводится на основании сравнения интенсивности флуоресценции красителей Fam и Су5, соответственно. Для определения генотипа животного используются конечные значения флуоресценции красителей Fam и Су5. Анализ результатов генотипирования проводили с использованием программного обеспечения для амплификатора LightCycler® 96 версии SW1.1. Программное обеспечение представляет результаты генотипирования в виде распределения аллелей (Фиг. 2А). Для гомозиготных образцов по аллелю А (генотип АА) детектируется нарастание флуоресценции по каналу Fam (Фиг. 2Б). Для гомозиготных образцов по аллелю К (генотип КК) детектируется сигнал по каналу Су5 (Фиг. 2В). Для гетерозиготного образца (генотип АК) наблюдается нарастание флуоресценции по обоим каналам детекции (Фиг. 2Г).

Наличие двух красителей, Fam и Су5, позволяет однозначно определить присутствие каждого из исследуемых аллелей гена DGAT1 в анализируемом образце ДНК и, соответственно, генотип животного.

Разработанный способ был апробирован на 50 образцах ДНК коров черно-пестрого голштинизированного скота. По результатам генотипирования 50% животных являлись гетерозиготами (генотип АК), 29,2% - гомозиготами по аллелю А (генотип АА) и 20,8% животных - гомозитотами по аллелю К (генотип КК). Валидацию способа проводили с помощью ПЦР-ПДРФ анализа (Глазко В.И., Андрейченко И.Н., Ковальчук С.Н., Глазко Т.Т., Косовский Г.Ю. Гены-кандидаты контроля характеристик молочной продуктивности крупного рогатого скота // Доклады Российской академии сельскохозяйственных наук. - 2016. - №5. - С. 45-50). Результаты обоих способов генотипирования полностью совпали. Однако патентуемый способ генотипирования крупного рогатого скота по аллелям К и А DGAT1 методом ПЦР в реальном времени позволяет значительно (до 1 часа) сократить время проведения анализа, что выгодно отличает его от ПЦР-ПДРФ анализа. На той же выборке патентуемый способ сравнивали со способом по прототипу: для 49-ти образцов результаты обоих способов и результаты ПЦР-ПДРФ анализа совпали. Один образец с генотипом АК определялся по методу прототипа как АА (ошибка составила 2%).

Таким образом, разработан эффективный и надежный способ для экспресс-идентификации аллельных вариантов К и А гена DGAT1 крупного рогатого скота методом ПЦР в реальном времени с использование аллель-специфичных зондов, который может быть использован при селекция крупного рогатого скота для прогноза качества молока и мяса по содержанию насыщенных и ненасыщенных жиров.

Способ проведения ПЦР с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся тем, что используются:

прямой общий праймер 5'-TGCTGGCCCTGATGGTCTACAC-3'(SEQ ID NO 1),

обратный общий праймер 5'-GCGGTAGGTCAGGTTGTCGG-3'(SEQ ID NO 2),

А - аллель-специфичный флуоресцентно-меченый зонд

5'-(FAM)TAAGGCGGCCAACGGGGGAGCTGC(BHQ1)-3'(SEQ ID NO 3),

К - аллель-специфичный флуоресцентно-меченый зонд

5'-(CY5)TAAGAAGGCCAACGGGGGAGCTGC(BHQ2) (SEQ ID NO 4).



 

Похожие патенты:

Изобретение относится к биотехнологии и предусматривает способы тестирования образца на наличие одной или нескольких мишеней. Способы включают приведение образца в контакт с одним или несколькими специфичными для мишени партнерами по связыванию, где каждый специфичный для мишени партнер по связыванию соединен с докинг-цепью и где специфичные для мишени партнеры по связыванию с разной специфичностью соединены с разными докинг-цепями, приведение образца в контакт с мечеными визуализирующими цепями с нуклеотидной последовательностью, которая комплементарна докинг-цепям, с получением меченых визуализирующих цепей, стабильно связанных с докинг-цепями, визуализацию образца и тушение сигнала от связанной меченой визуализирующей цепи или удаление связанных меченых визуализирующих цепей от докинг-цепей путем ферментативного расщепления, модификации или разрушения меченых визуализирующих цепей.

Изобретение относится к биотехнологии. Описан способ отбора клинического материала из шейки матки при выявлении дисплазии эпителия шейки матки и проведение его иммуногистохимических исследований с выявлением диагностических признаков хламидиоза.

Изобретение относится к биотехнологии. Изобретение предназначено для выявления и идентификации в пробах ДНК, выделенных из чистых культур, клинических образцов, проб пищевых продуктов и элюатов, полученных в результате концентрирования из воды, генетических детерминант пяти факторов патогенности бактерий группы кишечной палочки методом ПЦР с помощью набора маркерных детерминант 25 затравочных пар.

Изобретение относится к области биотехнологии, в частности к способу оценки высокой мясной продуктивности овец сальской породы. Указанный способ включает выделение ДНК, амплификацию фрагмента гена GH с использованием праймеров 5'-GGAGGCAGGAAGGGATGAA-3' и 5'-CCAAGGGAGGGAGAGACAGA-3', рестрикцию амплифицированного фрагмента гена GH эндонуклеазой HaeIII, определение генотипов и отбор животных с генотипом АВ/GH.

Изобретение относится к области биотехнологии, молекулярной генетики и молекулярной биологии. Используется для синтеза, детектирования и последующего секвенирования ДНК с метилированными CpG-динуклеотидами.

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития эссенциальной гипертензии. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, осуществляют выделение ДНК из периферической венозной крови и анализ генетических маркеров матриксных металлопротеиназ.

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 ед/мкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ.

Изобретение относится к области биотехнологии, а именно к способу определения наличия/отсутствия мутации fl2 с применением растительной ткани кукурузы, а также к генетически сконструированному растению кукурузы.

Группа изобретений относится к биотехнологии, в частности к способу прогнозирования резистентности к инфекционному некрозу поджелудочной железы у лосося и способу отбора лосося для использования в качестве производителя.

Изобретение относится к биотехнологии и предусматривает способы тестирования образца на наличие одной или нескольких мишеней. Способы включают приведение образца в контакт с одним или несколькими специфичными для мишени партнерами по связыванию, где каждый специфичный для мишени партнер по связыванию соединен с докинг-цепью и где специфичные для мишени партнеры по связыванию с разной специфичностью соединены с разными докинг-цепями, приведение образца в контакт с мечеными визуализирующими цепями с нуклеотидной последовательностью, которая комплементарна докинг-цепям, с получением меченых визуализирующих цепей, стабильно связанных с докинг-цепями, визуализацию образца и тушение сигнала от связанной меченой визуализирующей цепи или удаление связанных меченых визуализирующих цепей от докинг-цепей путем ферментативного расщепления, модификации или разрушения меченых визуализирующих цепей.

Изобретение относится к биотехнологии. Описан способ отбора клинического материала из шейки матки при выявлении дисплазии эпителия шейки матки и проведение его иммуногистохимических исследований с выявлением диагностических признаков хламидиоза.

Изобретение относится к биотехнологии. Описан способ отбора клинического материала из шейки матки при выявлении дисплазии эпителия шейки матки и проведение его иммуногистохимических исследований с выявлением диагностических признаков хламидиоза.

Изобретение относится к биотехнологии. Изобретение предназначено для выявления и идентификации в пробах ДНК, выделенных из чистых культур, клинических образцов, проб пищевых продуктов и элюатов, полученных в результате концентрирования из воды, генетических детерминант пяти факторов патогенности бактерий группы кишечной палочки методом ПЦР с помощью набора маркерных детерминант 25 затравочных пар.

Изобретение относится к области биотехнологии, в частности к способу оценки высокой мясной продуктивности овец сальской породы. Указанный способ включает выделение ДНК, амплификацию фрагмента гена GH с использованием праймеров 5'-GGAGGCAGGAAGGGATGAA-3' и 5'-CCAAGGGAGGGAGAGACAGA-3', рестрикцию амплифицированного фрагмента гена GH эндонуклеазой HaeIII, определение генотипов и отбор животных с генотипом АВ/GH.

Изобретение относится к области биотехнологии, в частности к способу оценки высокой мясной продуктивности овец сальской породы. Указанный способ включает выделение ДНК, амплификацию фрагмента гена GH с использованием праймеров 5'-GGAGGCAGGAAGGGATGAA-3' и 5'-CCAAGGGAGGGAGAGACAGA-3', рестрикцию амплифицированного фрагмента гена GH эндонуклеазой HaeIII, определение генотипов и отбор животных с генотипом АВ/GH.

Изобретение относится к области биотехнологии, молекулярной генетики и молекулярной биологии. Используется для синтеза, детектирования и последующего секвенирования ДНК с метилированными CpG-динуклеотидами.

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора.

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора.

Группа изобретений относится к области биохимии. Предложен аппарат и способ обработки нуклеотидных последовательностей, а также средство для секвенирования нуклеиновых кислот, молекулярной диагностики, анализа биологического образца, анализа химического образца, анализа пищевых продуктов и/или судебно-медицинского анализа.

Изобретение относится к биотехнологии и предусматривает способы тестирования образца на наличие одной или нескольких мишеней. Способы включают приведение образца в контакт с одним или несколькими специфичными для мишени партнерами по связыванию, где каждый специфичный для мишени партнер по связыванию соединен с докинг-цепью и где специфичные для мишени партнеры по связыванию с разной специфичностью соединены с разными докинг-цепями, приведение образца в контакт с мечеными визуализирующими цепями с нуклеотидной последовательностью, которая комплементарна докинг-цепям, с получением меченых визуализирующих цепей, стабильно связанных с докинг-цепями, визуализацию образца и тушение сигнала от связанной меченой визуализирующей цепи или удаление связанных меченых визуализирующих цепей от докинг-цепей путем ферментативного расщепления, модификации или разрушения меченых визуализирующих цепей.

Изобретение относится к области биотехнологии и молекулярно-генетической диагностики. Раскрыт способ проведения ПЦР с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1. Изобретение позволяет расширить арсенал способов генотипирования крупного рогатого скота по аллелям А и К DGAT1 на основе ПЦР в реальном времени и повысить их надежность. 2 ил.

Наверх