Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток



Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток
Средства для поддержания недифференцированного состояния и стимуляции пролиферации стволовых клеток

Владельцы патента RU 2679741:

НИППОН МЕНАРД КОСМЕТИК КО., ЛТД. (JP)

Изобретения относятся к области биотехнологии, в частности к средствам для поддержания или стимуляции, косметическому продукту, фармацевтическому продукту, лечебно-профилактическому препарату, продукту питания и напитку недифференцированного состояния эмбриональных стволовых клеток или соматических стволовых клеток, средству для лечения раны и способу выращивания эмбриональных стволовых клеток, исключая эмбриональные стволовые клетки человека, или соматических стволовых клеток при поддержании недифференцированного состояния. Изобретения включают использование одного или смеси двух и более диглициридов жирных кислот, представленных общей формулой (I)

,

где по меньшей мере один из R1, R2 и R3 являются одинаковыми или различными, означают ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а оставшийся один означает атом водорода или где один из R1, R2 и R3 означает ацильную группу, полученную из насыщенной жирной кислоты, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а оставшийся один означает атом водорода. Изобретения позволяют оказать эффективное влияние на поддержание недифференцируемого состояния и стимуляцию пролиферации стволовых клеток. 9 н. и 2 з.п. ф-лы, 4 табл., 3 пр.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

[0001]

Настоящее изобретение относится к средству для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для обработки раны и к способу стимуляции пролиферации стволовых клеток и способу поддержания недифференцированного состояния стволовых клеток.

УРОВЕНЬ ТЕХНИКИ

[0002]

Ткань позвоночных (в частности, млекопитающих) отвечает на повреждение клетки или органа, ассоциированного с травмой, заболеванием или старением, активацией регенерирующей системы для восстановления после повреждения клетки или органа. Стволовые клетки (тканевые стволовые клетки, соматические стволовые клетки), которые находятся в ткани, играют важную роль в таком ответе. Стволовые клетки обладают мультипотентностью и дифференцируются в любую клетку или орган и, как полагают, благодаря такому свойству компенсируют повреждение клетки или органа, что приводит к восстановлению. На регенеративную медицину, медицину следующего поколения, в которой используют такие стволовые клетки, возлагают большие надежды.

[0003]

Тканью, в отношении которой исследования стволовых клеток у млекопитающих наиболее продвинулись вперед, является костный мозг. Было обнаружено, что костный мозг содержит гематопоэтические стволовые клетки живого организма и является источником репродукции всех гемоцитов. Кроме того, сообщалось, что костный мозг помимо гематопоэтических стволовых клеток содержит стволовые клетки, которые могут дифференцироваться в органы и ткани (например, кость, хрящ, мышцу, жировую ткань и тому подобное) (смотри непатентный документ 1).

[0004]

Недавно было дополнительно показано, что стволовые клетки, находящиеся помимо костного мозга в каждом органе и ткани, например, в коже, печени, поджелудочной железе и жировой ткани, ответственны за регенерацию каждого органа или ткани и поддержание гомеостаза (смотри непатентные документы 2-5). Кроме того, стволовые клетки, которые находятся в органах и тканях, обладают превосходной пластичностью и могут быть подходящими для регенерации органа или ткани, саморепликация в которых до настоящего времени была невозможна.

[0005]

С другой стороны, было известно, что количество некоторых из таких стволовых клеток снижается с возрастом, и активно проводились исследования в отношении способов предотвращения снижения количеств стволовых клеток для поддержания гомеостаза тканей (непатентный документ 6). Недавно в области терапии на основе трансплантации клеток и в области конструирования тканей (регенеративная медицина и регенеративное косметическое лечение) также были разработаны методики культивирования стволовых клеток после выделения из живой ткани для их пролиферации с целью применения способности (мультипотентности) стволовых клеток к регенерации органа или ткани (непатентные документы 7 и 8).

[0006]

В частности, для культивирования стволовых клеток in vitro очень важна пролиферация стволовых клеток при поддержании состояния, при котором сохраняется способность стволовых клеток к мультипотентности, то есть недифференцированного состояния. Индукция дифференцировки в результате невозможности сохранить недифференцированное состояние стволовых клеток во время культивирования приведет к утрате способности (мультипотентности) полученных в итоге стволовых клеток и невозможности достичь представляющего интерес эффекта (регенерации органа или ткани или тому подобного).

[0007]

Исходя из вышесказанного, должно быть можно культивировать стволовые клетки, поддерживая недифференцированное состояние, с целью применения стволовых клеток в основанной на трансплантации клеток терапии и в конструировании тканей (регенеративной медицине и регенеративном косметическом лечении) для регенерации органа или ткани.

[0008]

До настоящего времени сообщалось о некоторых методиках пролиферации стволовых клеток при поддержании недифференцированного состояния, но такие методики все еще разрабатываются. Например, эмбриональные стволовые клетки (ES-клетки) и гематопоэтические стволовые клетки можно поддерживать в недифференцированном состоянии посредством их совместного культивирования с поддерживающими клетками (стромальными или питающими клетками) (смотри патентный документ 1 и непатентные документы 9-11). Однако недавно сообщалось об инфекции эндогенным вирусом, происходящим из питающих клеток, передаваемым между разными видами животным (см. непатентный документ 12), и культивирование стволовых клеток с использованием поддерживающих клеток не подходит для культивирования стволовых клеток для медицинских применений.

[0009]

Другие способы включают способ поддержания недифференцированного состояния стволовых клеток посредством сложного комбинирования цитокинов. Например, мышиные ES-клетки можно поддерживать в недифференцированном состоянии посредством добавления LIF (ингибирующий лейкоз фактор)) в среду (смотри патентный документ 2 и непатентный документ 13). Кроме того, сообщалось, что недифференцированное состояние поддерживается в присутствии цитокинов раннего действия тромбопоэтина (TPO), интерлейкина-6 (IL-6), лиганда FLT-3 и фактора стволовых клеток (SCF) в эмбриональных стволовых клетках, соматических стволовых клетках и тому подобных (смотри патентный документ 3 и непатентный документ 14).

[0010]

Однако цитокины являются дорогостоящими, Проблематичными с точки зрения сбора их источников и хранения и трудности их применения. Кроме того, было обнаружено, что влияние LIF ограничивается очень специфичными клеточными линиями, и ES-клетки и соматические стволовые клетки у приматов, в частности, невозможно поддерживать в недифференцированном состоянии только путем добавления LIF (см. непатентный документ 10).

[0011]

Как следует из вышесказанного, способы поддержания недифференцированного состояния стволовых клеток, о которых недавно сообщалось, требуют сложных действия и не эффективны для поддержания недифференцированного состояния. Таким образом, существует необходимость в способе пролиферации стволовых клеток при поддержании недифференцированного состояния для применения стволовых клеток в регенеративной медицине. Соответственно, требуется безопасный, простой и эффективный способ пролиферации стволовых клеток при сохранении недифференцированного состояния

[0012]

В последнее время возрастает число пациентов с хроническими ранами, такими как диабетическая язва стопы или пролежни, которые трудно поддаются лечению только эпидермизацией, с ростом количества случаев диабета и артериосклероза и старением. Обычно рану на коже обрабатывают, используя меры первой помощи, такие как промывание раны, и она может спонтанно излечиваться благодаря заживляющей способности живого организма. Однако иногда требуется стимуляция заживления раны, так как естественное заживление может занимать много времени, в зависимости от тяжести ранения, и у пожилых людей и пациентов с диабетом особенно медленно протекает естественное заживление, по сравнению с молодыми людьми. В качестве средств стимуляции заживления ран на коже известны хлорид лизозима, солкосерил и тому подобные, но каждый из них едва ли достаточно эффективен для стимуляции заживления ран. При заживлении раны на коже реконструируется ткань и поэтому стимулируется миграция необходимых клеток и продуцирование внеклеточного матрикса, такого как коллаген. Коллаген типа 3, который, главным образом, продуцируется на ранних стадиях заживления раны и важен для реконструкции ткани, оказывает стимулирующее действие на заживление раны, и его применяют в качестве средства для стимуляции ранозаживления (непатентный документ 15 и патентный документ 4). Кроме того, в качестве вещества, которое стимулирует пролиферацию или дифференцировку стволовых клеток и стимулирует ранозаживление, известно вещество P (патентный документ 5) и тому подобные. Однако такие вещества являются проблематичными из-за их стоимости и стабильности при хранении, поскольку являются белками и не подходят в случае, когда требуется регенеративное лечение большого участка кожного покрова за короткий период времени, такое как аппликативная терапия. Кроме того, повышенная осведомленность о косметическом лечении и омолаживании повысила интерес к регенеративному косметическому лечению кожи для исправления морщин, вялости и пигментации, вызванных старением и ультрафиолетовыми лучами. Поэтому для регенеративной медицины кожи, такой как заживление ран или регенеративное косметическое лечение кожи, требуется вещество, которое можно легко, безопасно и недорого получить.

ДОКУМЕНТЫ ПРЕДШЕСТВУЮЩЕГО УРОВНЯ ТЕХНИКИ

Патентные документы

[0013]

[Патентный документ 1] публикация патента Японии (Kokai) No. 2004-24089 A.

[Патентный документ 2] публикация патента Японии (Kohyo) No. 2002-525042 A.

[Патентный документ 3] патент Японии No. 3573354.

[Патентный документ 4] публикация патента Японии (Kokai) No. 7-17844 A (1995).

[Патентный документ 5] публикация патента Японии (Kokai) No. 2006-124389 A.

Непатентные документы

[0014]

[Непатентный документ 1] Pittenger M.F., et al., Science, 1999, Vol. 284, pp. 143-147.

[Непатентный документ 2] Goodell M.A., et al., Nat. Med., 1997, Vol. 3, pp. 1337-1345.

[Непатентный документ 3] Zulewski H., et al., Diabetes, 2001, Vol. 50, pp. 521-533.

[Непатентный документ 4] Suzuki A., et al., Hepatology, 2000, Vol. 32, pp. 1230-1239.

[Непатентный документ 5] Zuk P.A., et al., Ткань Engineering, 2001, Vol. 7, pp. 211-228.

[Непатентный документ 6] HASEGAWA Seiji, et al., Aesthetic Dermatology, 2013, Vol. 23, pp. 1-11.

[Непатентный документ 7] MABUCHI Yo, et al., Regenerative Medicine (The Japanese Society for Regenerative Medicine), 2007, Vol. 6, pp. 263-268.

[Непатентный документ 8] KITAGAWA Akira, et al., Regenerative Medicine (The Japanese Society for Regenerative Medicine), 2008, Vol. 7, pp. 14-18.

[Непатентный документ 9] Thomson J.A., et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848.

[Непатентный документ 10] Thomson J.A., et al., Science, 1998, Vol. 282, pp. 1145-1147.

[Непатентный документ 11] Reubinoff B.E., et al., Nature Biotech., 2000, Vol. 18, pp. 399-404.

[Непатентный документ 12] van der Laan L.J., et al., Nature, 2000, Vol. 407, pp. 90-94.

[Непатентный документ 13] Smith A.G., et al., Dev. Biol., 1987, Vol. 121, pp. 1-9.

[Непатентный документ 14] Madlambayan G.J., et al., J. Hematother. Stem Cell Res., 2001, Vol. 10, pp. 481-492.

[Непатентный документ 15] R. H. CHAMPION et al, Textbook of Dermatology, vol.1: 342-343, 1998.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

ПРОБЛЕМЫ, РЕШАЕМЫЕ ИЗОБРЕТЕНИЕМ

[0015]

Ввиду описанных выше обстоятельств целью настоящего изобретения является нахождение нового вещества, которое способно эффективно стимулировать пролиферацию стволовых клеток, сохраняя при этом их недифференцированное состояние и получить такое вещество в качестве средства для поддержания недифференцированного состояния стволовых клеток или средства для стимуляции пролиферации стволовых клеток. Другой целью настоящего изобретения является предоставление средства для лечения раны, которое оказывает ранозаживающее действие на кожу и легко доступно в области регенеративной медицины кожи или регенеративного косметического лечения и является безопасным и недорогим.

СПОСОБЫ РЕШЕНИЯ ПРОБЛЕМЫ

[0016]

Авторы настоящего изобретения провели надлежащие исследования для достижения указанных выше целей и в результате обнаружили, что глицериды жирных кислот, имеющие ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей определенное количество атомов углерода, причем глицериды жирных кислот, являющиеся основными ингредиентами растительных и животных масел и жиров и тому подобных и широко используемые качестве эмульгаторов и пищевых масел в косметике и продуктах питания, обладают превосходным поддерживающим недифференцированное состояние эффектом, стимулирующим пролиферацию эффектом и ранозаживляющим эффектом по отношению к стволовым клеткам, которые до настоящего времени не были известны, тем самым осуществив настоящее изобретение.

[0017]

Соответственно, настоящее изобретение охватывает следующее.

[0018]

(1) Средство для поддержания недифференцированного состояния стволовых клеток, содержащее в качестве активного ингредиента один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 1]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты или атом водорода.

(2) Средство для стимуляции пролиферации стволовых клеток, содержащее в качестве активного ингредиента один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 2]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(3) Средство для лечения раны, содержащее в качестве активного ингредиента один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 3]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(4) Средство по любому из пп.(1)-(3), где ненасыщенная жирная кислота выбрана из группы, состоящей из докозагексаеновой кислоты, эйкозапентаеновой кислоты, арахидоновой кислоты, α-линоленовой кислоты, γ-линоленовой кислоты, линолевой кислоты и олеиновой кислоты.

(5) Косметический продукт, содержащий средство по любому из пп. (1)-(3).

(6) Фармацевтический продукт или лечебно-профилактический препарат, содержащий средство по любому из пп. (1)-(3).

(7) Продукт питания или напиток, содержащий средство по любому из пп. (1)-(3).

(8) Способ получения стволовых клеток, включающий культивирование стволовых клеток в среде, содержащей один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 4]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(9) Способ поддержания недифференцированного состояния стволовых клеток, включающий в себя культивирование стволовых клеток в среде, содержащей один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 5]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(10) Способ стимуляция пролиферации стволовых клеток, включающий в себя культивирование стволовых клеток в среде, содержащей один или смесь двух или более глицеридов жирных кислот, представленных следующей общей формулой (I):

[Формула 6]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(11) Способ по любому из пп. (8)-(10), в котором ненасыщенная жирная кислота выбрана из группы, состоящей из докозагексаеновой кислоты, эйкозапентаеновой кислоты, арахидоновой кислоты, α-линоленовой кислоты, γ-линоленовой кислоты, линолевой кислоты и олеиновой кислоты.

(12) Способ лечения раны у млекопитающего, включающий в себя введение млекопитающему эффективного количества средства для лечения раны по п. (3).

(13) Глицерид жирной кислоты для применения при лечении раны, при этом глицерид жирной кислоты представлен следующей общей формулой (I):

[Формула 7]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

(14) Применение глицерида жирной кислоты для получения средства для лечения раны, при этом глицерид жирной кислоты представлен следующей общей формулой (I):

[Формула 8]

где, по меньшей мере, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

[0019]

Настоящая заявка на выдачу патента притязает на приоритет на основании заявки на выдачу патента Японии № 2014-226389, поданной 6 ноября 2014, описание которой включено в настоящую публикацию в виде ссылки.

ЭФФЕКТЫ ИЗОБРЕТЕНИЯ

[0020]

Согласно настоящему изобретению стволовые клетки можно эффективно размножать, поддерживая недифференцированное состояние. Согласно настоящему изобретению также эффективно можно заживлять рану. Таким образом, настоящее изобретение может внести большой вклад в область регенеративной медицины и регенеративного косметического лечения.

ВАРИАНТЫ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

[0021]

Настоящее изобретение будет подробно описано ниже.

Средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или средство для лечения раны согласно настоящему изобретению содержит глицерид жирной кислоты, представленный следующей общей формулой (I), имеющий ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей определенное количество атомов углерода (далее просто называемые «глицеридами жирной кислоты»).

[0022]

[Формула 9]

где, по меньшей мере, один из R1, R2, и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а каждый из других означает ацильную группу, полученную из насыщенной жирной кислоты, или атом водорода.

[0023]

Ненасыщенные жирные кислоты, имеющие от 16 до 22 атомов углерода, из которых происходит вышеуказанная ацильная группа, являются широко распространенными в природе жирными кислотами, имеющими от 1 до 6 двойных связей, и конкретные примеры включают такие кислоты, как пальмитолеиновая кислота (9-гексадеценовая кислота), олеиновая кислота (цис-9-октадеценовая кислота), линолевая кислота (9Z,12Z-октадекадиеновая кислота), вакценовая кислота (11-октадеценовая кислота), сопряженная линолевая кислота (9Z,11E-октадекадиеновая кислота, 10Z,12E-октадекадиеновая кислота, 10E,12Z-октадекадиеновая кислота, 10Z,12Z-октадекадиеновая кислота), дигомо-γ-линоленовая кислота ((8Z,11Z,14Z)-эйкоза-8,11,14-триеновая кислота), α-линоленовая кислота ((9Z,12Z,15Z)-9,12,15-октадекатриеновая кислота), γ-линоленовая кислота ((6Z,9Z,12Z)-6,9,12-октадекатриеновая кислота), элеостеариновая кислота ((9E,11E,13E)-9,11,13-октадекатриеновая кислота), стеаридоновая кислота ((6Z,9Z,12Z,15Z)-октадека-6,9,12,15-тетраеновая кислота), арахидоновая кислота ((5Z,8Z,11Z,14Z)-эйкоза-5,8,11,14-тетраеновая кислота), эйкозапентаеновая кислота ((5Z,8Z,11Z,14Z,17Z)-эйкоза-5,8,11,14,17-пентаеновая кислота), докозагексаеновая кислота ((4Z,7Z,10Z,13Z,16Z,19Z)-докоза-4,7,10,13,16,19-гексаеновая кислота), (n-6) докозапентаеновая кислота ((4Z,7Z,10Z,13Z,16Z)-4,7,10,13,16-докозапентаеновая кислота) и (n-3)докозапентаеновая кислота ((7Z,10Z,13Z,16Z,19Z)-7,10,13,16,19-докозапентаеновая кислота).

[0024]

Среди ненасыщенных жирных кислот, перечисленных выше, докозагексаеновая кислота, эйкозапентаеновая кислота, арахидоновая кислота, α-линоленовая кислота, γ-линоленовая кислота, линолевая кислота и олеиновая кислота являются предпочтительными с точки зрения эффекта и пригодности для применения, и линолевая кислота является более предпочтительной.

[0025]

Насыщенные жирные кислоты, из которых получена указанная выше ацильная группа, могут представлять собой любую неразветвленную или разветвленную насыщенную жирную кислоту, без ограничения количеством атомов углерода, но предпочтительно представляют собой насыщенную жирную кислоту, имеющую от 5 до 22 атомов углерода. Конкретные примеры включают неразветвленные насыщенные жирные кислоты, такие как капроновая кислота, каприловая кислота, каприновая кислота, лауриловая кислота, миристиновая кислота, пальмитиновая кислота, стеариновая кислота, арахидоновая кислота и докозановая кислота; и разветвленные насыщенные жирные кислоты, такие как 2-этилгексановая кислота, 3,5,5-триметилгексановая кислота, изотридекановая кислота, 2-гексилдекановая кислота, 2-гексилдодекановая кислота, 2-октилдекановая кислота, изостеариновая кислота и 2-октилдодекановая кислота.

[0026]

Глицериды жирных кислоты, используемые в настоящем изобретении, могут представлять собой любые моноглицериды, диглицериды и триглицериды, но диглицериды являются предпочтительными, 1,3-диглицериды, имеющие ненасыщенные жирные кислоты, описанные выше, связанные с первым и третьим положениями глицерина, являются более предпочтительными, и 1,3-диглицериды, имеющие линолевую кислоту, связанную с третьим положением являются еще более предпочтительными. В том случае, когда они являются диглицеридами или триглицеридами, ненасыщенные жирные кислоты, связанные с первым, вторым или третьим положением глицерина, могут быть одинаковыми или разными.

[0027]

Глицериды жирных кислот, используемые в настоящем изобретении, могут представлять собой один глицерид жирной кислоты, но предпочтительно они являются смесью двух или более глицеридов жирных кислот. Применение двух или более глицеридов жирных кислот вместе усиливает поддерживающее недифференцированное состояние влияние на стволовые клетки, стимулирующее пролиферацию влияние на стволовые клетки или ранозаживляющее действие. В том случае, когда два или более глицеридов жирных кислот применяют вместе, их сочетание особым образом не ограничено и может представлять собой сочетание моноглицерида и диглицерида, моноглицерида и триглицерида, диглицерида и триглицерида, и моноглицерида, диглицерида и триглицерида. Кроме того, когда два или более глицерида жирных кислот применяют вместе, их соотношение особым образом не ограничено и может варьировать соответствующим образом, в зависимости от типа глицеридов жирных кислот, но примером является соотношение от 10:90 до 90:10 при использовании двух типов диглицеридов вместе. Кроме глицеридов жирных кислот согласно настоящему изобретению вместе можно применять глицериды жирных кислот, не являющиеся глицеридами согласно настоящему изобретению.

[0028]

Глицериды жирных кислот, применяемые в настоящем изобретении, могут быть получены способом, включающим в себя прессование, экстракцию или прессование и экстракцию растительных или животных материалов, ферментативным способом или способом органического синтеза. Кроме того, моноглицериды и диглицериды среди указанных выше глицеридов жирных кислот обычно применяют в качестве эмульгаторов, загустителей, стабилизаторов и пластификаторов при производстве продуктов питания, косметических продуктов, фармацевтических продуктов, промышленных химикатов и тому подобного. Триглицериды являются основными ингредиентами растительных масел и жиров, таких как пальмовое масло, масло какао, кокосовое масло и пальмовое косточковое масло, и животных масел и жиров, таких как молочный жир, говяжий жир, свиное сало, рыбий жир и китовый жир, и широко применяются, главным образом, в косметических продуктах и пищевых продуктах. Таким образом, глицериды жирных кислот, применяемые в настоящем изобретении, могут быть коммерчески доступными продуктами, обычно применяемыми в продукции, описанной выше.

[0029]

В том случае, когда глицериды жирных кислот экстрагируют, например, из растительных материалов (семян, фруктов, коры и т.д. растений), способ экстракции особым образом не ограничен, и может представлять собой экстракцию при нагревании или экстракцию при нормальной или низкой температуре.

[0030]

Примеры растворителей, используемых для экстракции, включают воду, низшие спирты (метанол, этанол, 1-пропанол, 2-пропанол, 1-бутанол, 2-бутанол и тому подобные), жидкие поливалентные спирты (1,3-бутиленгликоль, пропиленгликоль, глицерин и тому подобные), кетоны (ацетон, метилэтилкетон и тому подобные), ацетонитрил, сложные эфиры (этилацетат, бутилацетат и тому подобные), углеводороды (гексан, гептан, жидкий парафин и тому подобные) и простые эфиры (этиловый эфир, тетрагидрофуран, пропиловый эфир и тому подобные). Можно использовать один растворитель или смесь двух или более растворителей из указанных растворителей. Предпочтительно можно использовать смесь воды и низшего спирта (водный раствор низшего спирта), особенно предпочтительно смесь воды и этанола (водный раствор этанола), и например, водный раствор этанола от 50 до 90% об./об.. Кроме того, можно использовать вышеуказанные растворители для экстракции, значение pH которых корректируют добавлением кислоты или щелочи.

[0031]

Примеры процентного содержания растительных материалов в растворителях для экстракции включают от 1 до 50% (масс./массю), и предпочтительно от 5 до 25% (масс./масс.). Например, глицериды жирных кислот могут быть получены добавлением вышеуказанных растворителей к высушенному растительному материалу и проведением экстракции при 5-80°C. Альтернативно, глицериды жирных кислот могут быть получены добавлением низшего спирта (например, этанола) или жидкого многоатомного спирта (например, пропиленгликоля, 1,3-бутиленгликоля) к высушенному растительному материалу и проведением экстракции при нормальной температуре (например, от 5 до 35°C).

[0032]

После экстракции с использованием растворителя полученную фазу в растворителе как таковую можно использовать в качестве раствора глицеридов жирных кислот. Альтернативно, полученную фазу в растворителе можно при необходимости подвергать обработке, такой как концентрирование (концентрирование посредством концентрирования при пониженном давлении, концентрирование с использованием мембран или тому подобное), разбавление, фильтрация или сушка, или обработка для обесцвечивания или дезодорирования с использованием активированного угля или тому подобного, чтобы получить раствор глицеридов жирных кислот из полученного продукта. Также перед применением предпочтительно проводят очистку установленным способом очистки, таким как хроматография, дистилляция при пониженном давлении и кристаллизация. Кроме того, раствор после экстракции можно подвергнуть концентрированию и сушке, или раствор после экстракции вместе с эксципиентами можно подвергнуть такой обработке, как концентрирование и сушка, сушка распылением и сушка вымораживанием, и полученный в результате сухой препарат можно применять в качестве глицеридов жирных кислот.

[0033]

В том случае, когда глицериды жирных кислот экстрагируют из животных материалов (например, частей рыбы, такой как сардина и тунец), глицериды жирных кислот могут быть получены прессованием животного материала, центрифугированием жировой фракции, чтобы получить жир, и экстрагированием жирового содержимого с использованием органического растворителя, такого как этиловый спирт, гексан, этилацетат или смеси указанных растворителей. После экстракции растворителем можно осуществлять очистку посредством хроматографии или тому подобного способом, подобным способу, применяемому для растительных материалов.

[0034]

Структура глицеридов жирных кислот, полученных из растительных или животных материалов, может быть подтверждена посредством определения структуры боковых цепей жирных кислот, идентифицированных при гидролизе, и положения связывания могут быть подтверждены в анализе с использованием ядерного магнитного резонанса.

[0035]

Типичным примером ферментативного способа является способ с использованием липазы, и другие примеры включают способы, в которые вовлечен гидролиз масел и жиров, этерификация жирной кислоты, полученной из масел и жиров, и глицерина, и трансэтерификация между маслами и жирами и глицерином (межмолекулярная реакция, внутримолекулярная реакция, кислотный гидролиз, спиртовой гидролиз). Масла и жиры могут быть любыми растительными маслами и жирами (рапсовое, кунжутное масло, соевое масло, кукурузное масло, подсолнечное масло, пальмовое масло, пальмовое косточковое масло, кокосовое масло, сафлоровое масло, льняное масло, масло из хлопкового жмыха, кокосовое масло и тому подобные), животными маслами и жирами (говяжий жир, свиной жир, рыбий жир), используемыми маслами различных съедобных масел (отработанными при приготовлении пищи маслами) и тому подобными.

[0036]

Способом органического синтеза можно добиться реакций, сходных с реакциями, описанными выше, с использованием химических катализаторов вместо ферментов. Примеры химических катализаторов, которые можно использовать, включают щелочные катализаторы (гидроксид натрия, гидроксид калия, карбонат натрия, карбонат калия и тому подобные), кислотные катализаторы (серная кислота, сульфоновая кислота, фосфорная кислота и тому подобные), твердые кислотные катализаторы (металлические композитные соединения, сульфаты металлов, гетерополикислоты, синтетический цеолит, ионообменные смолы и тому подобные). Кроме того, глицериды жирных кислот могут быть получены способами, включающими в себя взаимодействие хлорида жирной кислоты с глицерином, моноглицеридом или диглицеридом, которые являются обычными способами органического синтеза. Такие глицериды жирных кислот также могут быть подвергнуты очистке, как описано выше.

[0037]

Глицериды жирных кислот, полученные таким образом, обладают функцией, обеспечивающей эффективную пролиферацию стволовых клеток при сохранении недифференцированного состояния на уровне живого организма или на уровне культуры без прогрессирования дифференцировки во время пролиферации стволовых клеток, и могут быть использованы в качестве средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток. Кроме того, средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению также можно применять в качестве добавки в культуру клеток для эффективной пролиферации стволовых клеток при сохранении недифференцированного состояния или реагента для исследования.

[0038]

Средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению могут быть применимы по отношению к стволовым клеткам млекопитающих, включая человека, чтобы поддержать недифференцированное состояние стволовой клетки и стимулировать пролиферацию стволовых клеток. Стволовые клетки, по отношению к которым применимы средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению, особым образом не ограничены, при условии, что они соответствуют цели настоящего изобретения, и их примеры включают эмбриональные стволовые клетки (ES-клетки); соматические стволовые клетки, которые находятся в костном мозге, крови, коже (эпидермис, дерма, подкожная ткань), жировой ткани, волосяных фолликулах, головном мозге, нервах, печени, поджелудочной железе, почке, мышечной и других тканях; и стволовые клетки, полученные искусственно путем генетической интродукции (индуцированные плюрипотентные стволовые клетки: iPS-клетки). Предпочтительно средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению более эффективны в случае стволовых клеток, полученных из костного мозга, крови, кожи или жировой ткани. Примеры ES-клеток включают ES-клетки, полученные культивированием раннего эмбриона перед имплантацией, ES-клетки, полученные культивированием раннего эмбриона, полученного в результате ядерной трансплантации с использованием соматического ядра, и ES-клетки, полученные в результате модификации гена в хромосоме в таких ES-клетках с использованием способа генетической инженерии. Например, такие ES-клетки, могут быть получены известным способом, могут быть получены из некоторых организаций и могут быть приобретены в виде продаваемого на рынке продукта. Кроме того, такие стволовые клетки могут представлять собой любые клетки первичной культуры, последовательно культивируемые клетки или замороженные клетки.

[0039]

Кроме того, средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению могут быть применены по отношению к стволовым клеткам, полученным из всех млекопитающих, если стволовые клетки обладают эквивалентным свойством в отношении направления дифференцировки стволовых клеток и процесса дифференцировки. Средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению могут быть эффективными в случае стволовых клеток у млекопитающих таких как человек, обезьяны, мыши, крысы, морские свинки, кролики, кошки, собаки, лошади, коровы, овцы, козы и свиньи.

[0040]

Средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению могут быть применимы по отношению к стволовым клеткам in vitro или in vivo, и они могут быть эффективными в любом случае. Таким образом, средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению могут быть добавлены в эффективном количестве в среду для культивирования стволовых клеток, чтобы культивировать стволовые клетки в среде или вводить млекопитающим, включая человека, чтобы поддержать недифференцированное состояние и стимулировать пролиферацию стволовых клеток.

[0041]

Средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению действуют на стволовые клетки в тканях и органах в живом организме, таких как кожа, остеобласт, хрящ, мышца, нерв, жировая ткань и печень и являются эффективными в лечении, ослаблении и предотвращении расстройств и повреждений в соответствующих тканях и органах, так как глицериды жирных кислот, входящие в состав таких средств в качестве активного ингредиента, оказывают превосходное поддерживающее недифференцированное состояние и стимулирующее пролиферацию влияние на стволовые клетки. Кроме того, средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению эффективны в лечении, ослаблении и предотвращении заболеваний, связанных со снижением количества или угасанием функции стволовых клеток в вышеуказанных тканях и органах в живом организме, так как с возрастом наблюдается снижение количества или угасание функции стволовых клеток. Примеры расстройств или повреждений в тканях или органах и заболеваний, связанных со снижением количества или угасанием функции стволовых клеток, в части примеров, связанных с кожей, включают морщины, дряблость, пятна, потемнение, огрубление кожи, утолщение кожи, открытые поры, рубцы от угревой сыпи, раны, шрамы и келоиды, а также повреждения кожи черепа и волос, такие как истончение волос и потеря волос. Примеры, связанные с костями, включают остеопороз, переломы костей (компрессионный перелом позвоночника, перелом шейки бедра), и тому подобные; примеры заболевания хрящей включают остеоартрит, ревматоидный артрит, протрузии дисков и тому подобное; примеры, связанные с нервами, включают повреждение спинного мозга, паралич лицевого нерва, болезнь Альцгеймера, боковой амиотрофический склероз, болезнь Паркинсона, возрастное нарушение памяти и тому подобное; примеры, связанные с кровью, включают апластическую анемию, лейкоз и тому подобное; примеры, связанные с сердечно-сосудистым заболеванием, включают инфаркт миокарда, облитерирующий артериосклероз и тому подобное; примеры, связанные со стоматологией, включают пародонтоз, повреждение альвеолярной кости вследствие пиореи и тому подобное; примеры, связанные с офтальмологией, включают пигментную дистрофию сетчатки, возрастную макулярную дегенерацию, глаукому и тому подобное; примеры, связанные с печенью или поджелудочной железой, включают гепатит, цирроз печени, диабет и тому подобное; но не ограничены указанным.

[0042]

Вышеупомянутые глицериды жирных кислоты такде можно применять в качестве средства для лечения раны, так как они обладают превосходным стимулирующим ранозаживление эффектом. В частности, они эффективны при лечении ран на коже, которые представляют собой повреждение эпидермиса или дермы кожи. Кожные раны особым образом не ограничены по тяжести или глубине. Примеры включают обычные раны, такие как раны при порезах, рваные раны, рубленые раны, ссадины, повреждение с размозжением тканей, контузии, колотые раны и раны от укусов, а также пролежни, ошпаривание, ожег, диабетическую язву, язву ног/аневризму ног и тому подобное.

[0043]

Содержание глицеридов жирных кислот в средстве для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны согласно настоящему изобретению особым образом не ограничено. Например, содержание предпочтительно составляет от 0,00001 до 10% масс. и более предпочтительно от 0,0001 до 1% масс. от общего количества сухой массы средства. Эффект может недостаточно проявляться, когда содержание составляет менее 0,00001% масс.

[0044]

В том случае, когда средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны согласно настоящему изобретению вводят в живой организм, его можно вводить как таковое или можно вводить с подходящей добавкой, находящейся в различных композициях, таких как косметические продукты, лечебно-профилактические препараты, фармацевтические продукты и продукты питания и напитки и содержащейся в диапазоне, не ухудшающим эффект настоящего изобретения. Фармацевтические продукты согласно настоящему изобретению должны включать лекарственные средства, применяемые для животных или в ветеринарии.

[0045]

В том случае, когда средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны согласно настоящему изобретению входит в состав косметического продукта или лечебно-профилактического препарата дозированная форма может быть любой из системы водного раствора, солюбилизированной системы, эмульгированной системы, порошковой системы, системы в виде мелкодисперсного порошка, масляной системы, гелевой системы, системы в виде мази, аэрозольной системы, двухфазной системы вода-масло или трехфазной системы вода-масло-порошок. Кроме того, косметические продукты и лечебно-профилактические препараты могут быть получены способом, известным в данной области, посредством смешивания средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны с различными компонентами, добавками, основами и тому подобным, выбранными в зависимости от их типа, которые обычно используют в композициях для наружного применения на коже в соответствующих случаях. Косметические продукты и лечебно-профилактические препараты могут быть в любой форме, в виде жидкости, эмульсии, крема, геля, пасты, спрея и тому подобного. Примеры компонентов, входящих в состав композиций для внутреннего применения на коже, включают масла и жиры (оливковое масло, кокосовое масло, масло первоцвета вечернего, масло жожоба, касторовое масло, гидрогенизированное касторовое масло и тому подобные), воски (ланолин, пчелиный воск, карнаубский воск и тому подобные), углеводороды (жидкий парафин, сквален, сквалан, вазелин и тому подобные), жирные кислоты (лауриловую кислоту, миристиновую кислоту, пальмитиновую кислоту, стеариновую кислоту, бегеновую кислоту и тому подобные), высшие спирты (миристиловый спирт, цетанол, цетостеариловый спирт, стеариловый спирт, бегениловый спирт и тому подобные), сложные эфиры (изопропилмиристат, изопропилпальмитат, цетилоктаноат, глицеринтриоктаноат, октилдодецилмиристат, октилстеарат, стерилстеарат и тому подобные), органические кислоты (лимонную кислоту, молочную кислоту, α-гидроксиукусуную кислоту, пирролидонкарбоновую кислоту и тому подобные), сахариды (мальтит, сорбит, ксилобиозу, N-ацетил-D-глюкозамин и тому подобные), белки и гидролизаты белков, аминокислоты и их соли, витамины, растительные и животные экстракты, различные поверхностно-активные вещества, увлажнители, поглотители ультрафиолетовых лучей, антиоксиданты, стабилизаторы, консерванты, биоциды, отдушки и тому подобные.

[0046]

Примеры типов косметических продуктов и лечебно-профилактических препаратов включают лосьон, эмульсию, гель, сыворотку, обычный крем, крем от загара, повязку, примочку, средства для умывания, туалетное мыло, основу, пудру для лица, соль для ванны, лосьон для тела, шампунь для тела, шампунь для волос, кондиционер для волос, восстановитель для волос и тому подобные.

[0047]

В том случае, когда средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны согласно настоящему изобретению входит в состав фармацевтического продукта, различные дозированные формы препаратов, подходящих для применения на пораженной части, могут быть приготовлены смешиванием средства с фармакологически и фармацевтически приемлемой добавкой. В качестве фармакологически и фармацевтически приемлемой добавки, основы или носителя для препарата, выбранного в качестве подходящего, может быть добавлен наполнитель, разбавитель, связывающее средство, скользящее вещество, средства для покрытия, разрыхлитель или дезинтегрирующее средство, стабилизатор, консервант, антисептик, объемообразующее средство, диспергирующее средство, увлажнитель, буфер, растворитель или солюбилизатор, средство для корректировки тоничности, модификатор pH, пропеллент, краситель, подсластитель, корригент или вкусовую добавку, в зависимости от соответствующей формы дозирования и применения, и различные формы дозирования могут быть введены перорально или парентерально, системно или местно различными известными способами. Когда фармацевтические продукты согласно настоящему изобретению представлены в указанных выше формах, они могут быть приготовлены способами получения, обычно применяемыми специалистами в данной области, например, способами получения, проиллюстрированными в [2] Monographs for Preparations in General Rules for Preparations in the Japanese pharmacopeia.

[0048]

Формы фармацевтических продуктов согласно настоящему изобретению не ограничены, но примеры включают пероральные препараты, такие как таблетка, покрытая сахаром таблетка, капсула, пастилка, гранулированное средство, порошкообразное средство, раствор, пилюля, эмульсия, сироп, суспензия, элексир, инъекционное средство (например, для подкожной инъекции, внутривенной инъекции, внутримышечной инъекции, внутрибрюшинной инъекции), парентеральные препараты, такие как инфузионный препарат, суппозиторий, мазь, лосьон, средство для истилляции, воздушный спрей, трансдермальный абсорбент, трансмукозальный абсорбент и адгезивный препарат. Кроме того, они могут быть приготовлены в виде сухих продуктов, которые необходимо перерастворить перед применением; и инъекционные препараты предоставляются в виде ампул, содержащих единичные дозы, или емкостей, содержащих множество доз.

[0049]

В том случае, когда средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или средство для лечения раны применяют в качестве фармацевтического продукта для лечения, ослабления и предотвращения вышеупомянутых связанных с кожей повреждений и заболеваний, подходящими формами фармацевтического продукта являются препараты для наружного применения, и примеры включают мазь, крем, гель, раствор, адгезивный препарат (компресс, пластырь), пену, спрей и аэрозоль. Мазь относится к гомогенному полутвердому препарату для наружного применения и включает масляные мази, эмульсионные мази и водорастворимые мази. Гель относится к препарату для наружного применения, в котором гидратное соединение водорастворимого компонента суспендировано в водной жидкости. Раствор относится к жидкому препарату для наружного применения и включает лосьон, суспензию, эмульсию и линимент. При использовании в качестве средства для лечения раны на коже, более предпочтительными являются мазь, крем, раствор и спрей с точки зрения ранозаживляющего эффекта на коже и простоты применения.

[0050]

Фармацевтический продукт согласно настоящему изобретению функционирует в качестве профилактического средства, которое предотвращает развитие вышеуказанных заболеваний, и/или терапевтического средства, которое восстанавливает нормальное состояние. Активные ингредиенты фармацевтического продукта согласно настоящему изобретению являются встречающимися в природе продуктами и поэтому очень безопасными без побочных эффектов. Соответственно, фармацевтический продукт можно вводить перорально или парентерально в широком диапазоне доз при использовании в качестве лекарственного средства для лечения, ослабления и профилактики вышеуказанных заболеваний у млекопитающих, таких как человека, мышь, крыса, кролик, собака и кошка.

[0051]

Содержание средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны в косметическом продукте, фармацевтическом продукте или лечебно-профилактическом препарате согласно настоящему изобретению особым образом не ограничено, но предпочтительно составляет от 0,001 до 30% масс. и более предпочтительно от 0,01 до 10% масс. от общей массы препарата (композиции) в расчете на содержание сухого твердого вещества глицеридов жирных кислот. Эффект ниже, когда содержание составляет менее 0,001% масс., и вряд ли можно выявить большое усиление эффекта при содержании более 30% масс. Количества, описанные выше, являются только иллюстрацией и могут быть соответствующим образом установлены/скорректированы с учетом типа и формы, обычно применяемых количеств и эффективности и эффектов композиции. Чтобы добавить активный ингредиент в препарат, ингредиент может быть добавлен до приготовления препарата или во время приготовления, что может быть выбрано при необходимости с учетом пригодности.

[0052]

Средства для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или для лечения раны согласно настоящему изобретению могут входить в состав продуктов питания и напитков. В настоящем изобретении подразумевается, что продукты питания и напитки включают, кроме обычных продуктов питания и напитков, продукты питания, которые можно принимать в целях поддержания и улучшения здоровья, не фармацевтические продукты, например, продукты для здорового питания, функциональные пищевые продукты, функциональные диетические продукты или продукты, применяемые при специальных диетах. Продукты здорового питания включают пищевые продукты, называемые пищевыми добавками, добавками для здорового питания и биологически активными добавками. Функциональные продукты для здорового питания определены в Санитарных правилах о пищевых продуктах или Законе об охране здоровья и включают пищевые продукты для применения при определенном состоянии здоровья и пищевые функциональные продукты, которые могут оказывать специфичное влияние на здоровье, функции пищевых компонентов и снижение риска заболевания.

[0053]

Формы пищевых продуктов и напитков могут представлять собой любую форму, подходящую для применения в питании, включая, например, твердую, жидкую, гранулярную, порошкообразную форму, капсулу, крем или пастообразную форму. В частности, предпочтительные формы указанных выше продуктов для здорового питания включают формы таблетки, пилюли, капсулы, порошка, гранулы, мелкой гранулы, пастилки и жидкости (включая сироп, эмульсию, суспензию).

[0054]

Типы пищевых продуктов и напилков включают без ограничения, хлеб, макаронные изделия, кондитерские изделия, молочные продукты, переработанные рыбные продукты и продукты животноводства, масла и жиры и продукты переработки масел и жиров, пряности, различные напитки (прохладительные напитки, газированные напитки, полезные напитки для красоты, питательные напитки, фруктовые напитки, молочные напитки), и концентрированные стоковые растворы и порошок для получения напитков и тому подобные.

[0055]

Добавки, которые обычно используют в зависимости от типов, при необходимости могут быть добавлены в напитки и пищевые продукты согласно настоящему изобретению. Любая добавка, которая может быть разрешена в соответствии с Санитарными правилами для пищевых продуктов, может быть использована в качестве добавки, и примеры включают подсластители, такие как глюкоза, сахароза, фруктоза, изомеризованный сахарный сироп, аспартам, стевия и тому подобные; подкислители, такие как лимонная кислота, яблочная кислота, винная кислота и тому подобные; наполнители, такие как декстриин, крахмал, связывающее средство, разбавитель, корригент, краситель, буфер, загуститель, желирующее средство, стабилизатор, консервант, эмульгатор, диспергирующее средство, суспендирующее средство, антисептик и тому подобные.

[0056]

Когда пищевые продукты и напитки согласно настоящему изобретению представляют собой обычные пищевые продукты и напитки, пищевые продукты и напитки согласно настоящему изобретению могут быть получены при включении стадии добавления глицеридов жирных кислот в обычный способ производства пищевых продуктов и напитков. Кроме того, когда пищевые продукты и напитки согласно настоящему изобретению представляют собой пищевые продукты для здорового питания, они могут быть получены соглансо способу производства вышеупомянутых фармацевтических продуктов: например, добавки в виде таблеток могут быть получены посредством добавления таких дополнительных веществ, как наполнители, к глицеридам жирных кислот, перемешивания и таблетирования под давлением в таблетирующем аппарате или тому подобного. Кроме того, при необходимости могут быть добавлены другие материалы (например, витамины, такие как витамин C, витамин B2, витамин B6, минералы, такие как кальций, пищевые волокна и тому подобное).

[0057]

Используемое в смеси количество глицеридов жирных кислот в напитках и пищевых продуктах согласно настоящему изобретению должно быть таким количеством, в котором глицериды жирных кислот могут оказывать поддерживающий недифференцированное состояние эффект и стимулирующий пролиферацию эффект на стволовые клетки и ранозаживляющий эффект, и количество при необходимости должно быть установлено с учетом общего потребления напитков и пищевых продуктов, форм напитков и пищевых продуктов, эффективности и эффектов, вкуса, предпочтений и стоимости.

[0058]

Настоящее изобретение также относится к способу стимуляции пролиферации стволовых клеток при поддержании недифференцированного состояния стволовых клеток посредством культивирования стволовых клеток в среде, содержащей глицериды жирных кислот. Другими словами, способ согласно настоящему изобретению считается способом получения стволовых клеток, способом поддержания недифференцированного состояния стволовых клеток или способом стимуляции пролиферации стволовых клеток, включающим в себя стадию культивирования стволовых клеток в среде, содержащей глицериды жирных кислот.

[0059]

В способах согласно настоящему изобретению могут быть использованы среды, которые обычно применяют для поддержания недифференцированного состояния и пролиферации стволовых клеток, для культивирования стволовых клеток. Примеры включают базовые среды, содержащие компоненты (неорганические соли, углеводы, гормоны, незаменимые аминокислоты, заменимые аминокислоты, витамины, жирные кислоты), необходимые для выживания и пролиферации стволовых клеток. Конкретные примеры включают модифицированную Дульбекко среду Игла (D-MEM), минимальную необходимую среду (MEM), RPMI 1640, базовую среду Игла (BME), среду Игла в модификации Дульбекко и смесь питательных веществ F-12 (D-MEM/F-12), минимальную необходимую среду Глазго (Glasgow MEM), раствор Хенкса (сбалансированный солевой раствор Хенкса) и тому подобные. Кроме того, основной фактор роста фибробластов (bFGF) и/или фактор ингибирования миграции лейкоцитов (LIF) могут быть добавлены в среду в качестве фактора роста. Кроме того, среды при необходимости могут содержать эпидермальный фактор роста (EGF), фактор некроза опухолей (TNF), витамины, интерлейкины, инсулин, трансферрин, гепарин, гепарансульфат, коллаген, фибронектин, прогестерон, целенит, добавку B27, добавку N2, добавку ITS, антибиотики и тому подобные.

[0060]

Кроме того, помимо указанных выше компонентов предпочтительно содержание сыворотке в среде в количестве от 1 до 20%. Однако, предпочтительно использование сыворотки после проверки партии, поскольку сыворотка содержит разные компоненты в зависимости от партии, и эффект сыворотки может быть разным.

[0061]

Доступны следующие коммерчески доступные среды: базовая среда для мезенхимных стволовых клеток производства Invitrogen, базовая среда для мезенхимных стволовых клеток производства Sanko Junyaku Co., Ltd., среда MF производства Toyobo Co., Ltd., и раствор Хенкса (сбалансированный солевой раствор Хенкса) производства Sigma.

[0062]

Инкубаторы, используемые для культивирования стволовых клеток особым образом не ограничены, при условии, что можно культивировать стволовые клетки, и примеры включают флаконы, чашки для культивирования, чашки, планшеты, слайд-камеры, пробирки, лотки, культуральные мешки, вращающиеся бутыли и тому подобное.

[0063]

Инкубаторы могут быть неадгезивными для клеток или могут быть адгезивными для клеток, которые при необходимости выбирают в зависимости от цели. Инкубаторы, которые являются адгезивными для клеток, могут представлять собой инкубаторы, обработанные подложкой для поддержания клеток, сделанной из внеклеточного матрикса для повышения адгезивности по отношению к клеткам. Примеры подложки для поддержания клеток включают коллаген, желатин, поли-L-лизин, поли-D-лизин, ламинин, фибронектин и тому подобное.

[0064]

Концентрации глицеридов жирных кислот в среде, используемой для культивирования стволовых клеток при необходимости могут быть определены в соответствии с указанным выше содержанием глицеридов жирных кислот в средстве для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению, и примеры включают концентрации от 0,1 до 1000 мкг/мл, предпочтительно от 1 до 100 мкг/мл. Кроме того, глицериды жирных кислот можно периодически добавлять в среду в течение периода культивирования стволовых клеток.

[0065]

Условия культивирования стволовых клеток должны представлять собой обычные условия, используемые для культивирования стволовых клеток, и специального контроля не требуется. Температура культивирования, например, особым образом не ограничена, но она составляет приблизительно от 30 до 40°C, и предпочтительно от 36 до 37°C. Концентрация газа CO2 составляет, например, приблизительно от 1 до 10%, и предпочтительно приблизительно от 2 до 5%. Замену среду предпочтительно осуществляют один раз в 2-3 дня и более предпочтительно осуществляют каждый день. Указанные выше условия культивирования могут быть изменены и при необходимости установлены в диапазоне, который обеспечивает жизнеспособность и пролиферацию стволовых клеток.

[0066]

Поддержание недифференцированного состояния стволовых клеток можно оценить, например, сравнивая уровень экспрессии маркерного гена отсутствия дифференцировки стволовых клеток в стволовых клетках, культивируемых в присутствии средства для поддержания недифференцированного состояния стволовых клеток согласно настоящему изобретению, с уровнем экспрессии в таких же стволовых клетках, культивируемые в отсутствие средства для поддержания недифференцированного состояния стволовых клеток согласно настоящему изобретению; и определяя поддерживается ли значимо уровень экспрессии маркерного гена отсутствии дифференцировки стволовых клеток на том же самом уровне, что и уровень экспрессии в начале культивирования на уровне мРНК или белка. Примером маркерного гена отсутствия дифефренцировки стволовых клеток является ген Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embryonic stem cell pluripotency. Pan G, Thomson JA.).

[0067]

Примеры способов измерения уровня экспрессии маркерного гена отсутствия дифференцировки стволовых клеток на уровне мРНК включают такие способы, как ОТ-ПЦР с использованием праймеров или зонда, которые являются специфичными для маркерного гена отсутствия дифференцировки стволовых клеток, количественная ПЦР и Нозерн-блоттинг. Примеры измерения на уровне белка включают иммунологические способы, такие как ELISA, проточная цитометрия и Вестерн-блоттинг с использованием антитела, которое является специфичным по отношению к белку, кодируемому маркерным геном отсутствия дифференцировки стволовых клеток.

[0068]

В результате измерения уровня экспрессии, если отношение уровня экспрессии маркерного гена отсутствии дифференцировки стволовых клеток в стволовых клетках после культивирования в течение предварительно определяемого периода времени в присутствии средства для поддержания недифференцированного состояния стволовых клеток согласно настоящему изобретению к уровню экспрессии маркерного гена отсутствии дифференцировки стволовых клеток в стволовых клетках в начале культивирования (100% недифференцированное состояние) выше, чем отношение (контроль), полученное при культивировании стволовых клеток в отсутствие средства для поддержания недифференцированного состояния стволовых клеток согласно настоящему изобретению, то можно определить, что недифференцированное состояние стволовых клеток сохраняется.

[0069]

Также стимуляцию пролиферации стволовых клеток можно оценить, например, сравнивая количество стволовых клеток, культивируемых в присутствии средства для стимуляции пролиферации стволовых клеток согласно настоящему изобретению, с количеством стволовых клеток, культивируемых в отсутствие средства для стимуляции пролиферации стволовых клеток согласно настоящему изобретению, и определяя увеличилось ли значимо количество клеток. Измерение количества клеток можно осуществлять, используя коммерчески доступный набор для цитометрии, например, для MTT-способа или WST-способа. В результате измерения, если отношение количества стволовых клеток после культивирования в течение предварительно определяемого периода времени в присутствии средства для стимуляции пролиферации стволовых клеток согласно настоящему изобретению, с количеством стволовых клеток в начале культивирования больше, чем отношение (контроль), полученное культивированием стволовых клеток в отсутствие средства для стимуляции пролиферации стволовых клеток согласно настоящему изобретению, то можно определить, что пролиферация стволовых клеток была стимулирована.

[0070]

Стволовые клетки, полученные способом согласно настоящему изобретению, описанные выше, можно применять в качестве трансплантируемых материалов (средства в виде клеточных трансплантатов) и можно трансплантировать такими же способами, как способы обычной трансплантации костного мозга или пуповинной крови.

[0071]

Соответственно, в случае средств для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток согласно настоящему изобретению или способов согласно настоящему изобретению, описанных выше, глицериды жирных кислот, отдельно или раздельно со средой или смешанные со средой, могут быть предоставлены в виде набора реагентов для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток. Набор при необходимости может содержать руководство по применению или тому подобное. Альтернативно, глицериды жирных кислот могут быть смешаны со средой и предоставлены в виде среды для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток

ПРИМЕРЫ

[0072]

Настоящее изобретение более подробно описано ниже с помощью примеров. Однако технический объем настоящего изобретения не ограничен приведенными примерами.

[0073]

Глицериды жирных кислот, используемые в оценочных тестах в примерах, и их структуры проиллюстрированы в таблице 1. В качестве глицеридов жирных кислот 1-9, трипальмитина и пальмитиновой кислоты в сравнительных примерах, использовали следующие коммерчески доступные продукты или продукты, синтезированные способом, проиллюстрированным в примере получения или сходным способом.

Глицериды жирных кислот 1: Wako Pure Chemical Industries, Ltd.

Глицериды жирных кислот 2: INDOFINE Chemical Company, Inc.

Глицериды жирных кислот 3: NU-CHEK-PREP

Глицериды жирных кислот 5: NU-CHEK-PREP

Глицериды жирных кислот 6: MP Biomedicals

Глицериды жирных кислот 8: Sigma-Aldrich Co. LLC

Глицериды жирных кислот 9: Funakoshi Co., Ltd.

Глицериды жирных кислот 4, 7: синтезированные в примере получения, описанном ниже.

Трипальмитин: Wako Pure Chemical Industries, Ltd.

Пальмитиновая кислота: Wako Pure Chemical Industries, Ltd.

[0074]

(ПРИМЕР ПОЛУЧЕНИЯ) СИНТЕЗ ДИГЛИЦЕРИДОВ

Хлорид линолевой кислоты добавляли к охлажденной на льду смеси 1-моноолеина и пиридина, и смесь перемешивали при 0°C в течение 24 часов. После взаимодействия добавляли диэтиловый эфир, пиридин удаляли, используя 0,5 N хлористоводородную кислоту, и проводили экстракцию разбавленным водным раствором карбоната натрия. Раствор в эфире концентрировали и сушили, получая неочищенный диглицерид. Его очищали хроматографией на колонке с силикагелем в обычных условиях, получая глицерид жирной кислоты 4. Глицерид жирной кислоты 7 получали способом, подобным способу, описанному выше, за исключением того, что использовали 2-монолинолеин вместо 1-моноолеина, и использовали хлорид пальмитиновой кислоты вместо хлорида линолевой кислоты.

0075]

[Таблица 1]

[0076]

[ПРИМЕР 1]

Оценка поддерживающего недифференцированное состояние эффекта и стимулирующего пролиферацию эффекта глицеридов жирных кислот на стволовые клетки.

Экспериментальные примеры и их результаты о поддерживающем недифференцированное состояние влиянии и стимулирующем пролиферацию влиянии на стволовые клетки с использованием одного или смеси (глицериды жирных кислот 2+3, глицериды жирных кислот 4+5) глицеридов жирных кислот 1-9 описаны ниже. Когда использовали смесь двух глицеридов жирных кислот из соотношение было равно 1:1 (отношение по массе).

[0077]

(ЭКСПЕРИМЕНТАЛЬНЫЙ ПРИМЕР 1) Оценка поддерживающего недифференцированное состояние эффекта на стволовые клетки.

Используя среду, полученную добавлением фетальной сыворотки теленка (FBS, 15%, производства Sigma-Aldrich Co. LLC), раствора нуклеозида (100-кратное разведение, производства Sumitomo Dainippon Pharma Co., Ltd.), раствора заменимых аминокислот (100-кратное разведение, производства Sumitomo Dainippon Pharma Co., Ltd.), раствора β2-меркаптоэтанола (100-кратное разведение, производства Sumitomo Dainippon Pharma Co., Ltd.), раствора L-глутамина (100-кратное разведение, производства Sumitomo Dainippon Pharma Co., Ltd.), пенициллина (100 единиц/мл, производства Sigma-Aldrich Co. LLC) и стрептомицина (100 мкг/мл, производства Sigma-Aldrich Co. LLC) к среде Игла в модификации Дульбекко (производства Gibco), высевали 5×105 мышиных эмбриональных стволовых клеток (мышиные ES-клетки: производства COSMO BIO Co., Ltd.) в чашки диаметром 6 см, покрытые желатином (производства Sigma-Aldrich Co. LLC), к среде добавляли один или смесь глицеридов жирных кислот 1-9 в конечной концентрации 0,001%, и культивирование продолжали в течение 3 суток.

[0078]

После 3-дневного культивирования клетки собирали и промывали дважды в PBS(-) и РНК экстрагировали из клеток, используя реагент тризол (Invitrogen). Экстрагированную РНК подвергали обратной транскрипции в кДНК, используя набор для 2-стадийной ПЦР в реальном времени (Applied Biosystems), и затем осуществляли ПЦР в реальном времени (95°C: 15 секунд, 60°C: 30 секунд, 40 циклов) в ABI7300 (Applied Biosystems), используя следующие наборы праймеров, для подтверждения экспрессии гена Nanog (маркер отсутствия дифференцировки: Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embryonic stem cell pluripotency. Pan G, Thomson JA.). Другие операции осуществляли согласно определенному способу.

[0079]

Набор праймеров для Nanog (аркера отсутствия дифференцировки):

ATGCCTGCAGTTTTTCATCC (SEQ ID NO: 1)

GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)

Набор праймеров для Gapdh (внутренний стандарт):

TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)

TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)

[0080]

Поддерживающий недифференцированное состояние эффект оценивали следующим образом: значение относительного уровня экспрессии гена Nanog (уровень экспрессии гена Nanog/уровень экспрессии гена Gapdh) вычисляли в виде отношения уровня экспрессии мРНК Nanog к уровню экспрессии мРНК Gapdh, который является внутренним стандартом, в мышиных ES-клетках в начале культивирования определяли как 100% отсутствие дифференцировки; и относительно него вычисляли и оценивали значение относительного уровня экспрессии гена Nanog в ES-клетках после 3 дней культивирования.

Полученные результаты тестирования показаны в таблице 2 ниже.

[0081]

[Таблица 2]

Оценка поддерживающего недифференцированное состояние эффекта глицеридов жирных кислот на стволовые клетки.

Тестируемое вещество Уровень экспрессии Nanog (%) после 3 дней культивирования
Без добавки (контроль)
Глицерид жирной кислоты 1
25
33
Глицерид жирной кислоты 2 71
Глицерид жирной кислоты 3
Глицерид жирной кислоты 4
65
59
Глицерид жирной кислоты 5 57
Глицерид жирной кислоты 6
Глицерид жирной кислоты 7
43
41
Глицерид жирной кислоты 8 35
Глицерид жирной кислоты 9 34
Глицерид жирной кислоты 2+3
Глицерид жирной кислоты 4+5
83
77
Трипальмитин (сравнительный пример 1) 26
Пальмитиновая кислота (сравнительный пример 2) 27

*анализируемый с использованием относительного уровня экспрессии гена Nanog, экспрессированного в ES-клетках в начале культивирования, определенного как 100% отсутствия дифференцировки.

[0082]

Как показано в таблице 2, обнаружено, что все глицериды жирных кислот 1-9 обладают значимым поддерживающим недифференцированное состояние эффектов по отношению к стволовым клеткам, и эффект усиливался при использовании двух или более глицеридов жирных кислот вместе. На основании вышесказанного, выявлен превосходный поддерживающий недифференцированное состояние эффект глицеридов жирных кислот на стволовые клетки. Помимо стволовых клеток, используемых в данном экспериментальном примере, значимые поддерживающие недифференцированное состояние эффекты на стволовые клетки были обнаружены в отношении соматических стволовых клеток в сходных тестах.

[0083]

(ЭКСПЕРИМЕНТАЛЬНЫЙ ПРИМЕР 2). Оценка стимулирующего пролиферацию эффекта на стволовые клетки.

3×105 соматических стволовых клеток человека (производства DS Pharma Biomedical Co., Ltd.), культивируемых с использованием среды для культивирования стволовых клеток человека (производства Toyobo Co., Ltd.) высевали в чашки диаметром 6 см, добавляли один или смесь (глицериды жирных кислот 2+3, глицериды жирных кислот 4+5) глицеридов жирных кислот 1-9 в конечной концентрации 0,001% и культивирование продолжали в течение 3 суток. При использовании смеси двух глицеридов жирных кислот их соотношение составляло 1:1 (соотношение по массе).

[0084]

После культивирования в течение 3 суток клетки три раза промывали в PBS(-), затем собирали с использованием резиновой палочкой и подсчитывали клетки в каждой культуре.

[0085]

Общее количество клеток без добавления глицеридов жирных кислот определяли как контрольное значение и контроль принимали за 100 (%). Вычисляли увеличение или уменьшение (%) количества клеток при добавлении глицеридов жирных кислот и оценивали стимулирующий пролиферацию стволовых клеток эффект.

Полученные результаты тестирования показаны в таблице 3 ниже.

[0086]

[Таблица 3]

Оценка стимулирующего пролиферацию эффекта глицеридов жирных кислот на стволовый клетки

Тестируемое вещество Пролиферация клеток в процентах (%)
Без добавления (контроль) 100,0
Глицерид жирной кислоты 1 115,1
Глицерид жирной кислоты 2
Глицерид жирной кислоты 3
160,3
157,8
Глицерид жирной кислоты 4 148,3
Глицерид жирной кислоты 5
Глицерид жирной кислоты 6
145,3
130,1
Глицерид жирной кислоты 7 129,3
Глицерид жирной кислоты 8
Глицерид жирной кислоты 9
118,3
117,3
Глицерид жирной кислоты 2+3 180,6
Глицерид жирной кислоты 4+5 178,3
Трипальмитин (сравнительный пример 1)
Пальмитиновая кислота (сравнительный пример 2)
103,2
102,1

* Показано увеличение количества клеток в процентах в каждой группе добавления глицеридов жирных кислот относительно количества клеток в группе без добавления (контроль) после культивирования в течение 3 суток, которое принимали за 100%.

[0087]

Как показано в таблице 3, было обнаружено, что все глицериды жирных кислот 1-9 оказывают значимый стимулирующий пролиферацию эффект на стволовые клетки. Также, эффект усиливался при использовании двух или более глицеридов жирных кислот вместе. Количество соматических стволовых клеток человека в начале культивирования составляло 25%, когда количество в вышеупомянутом контроле выражали в виде 100%. На основании вышесказанного был выявлен превосходный стимулирующий пролиферацию стволовых клеток эффект глицеридов жирных кислот. Помимо стволовых клеток, используемых в данном экспериментальном примере, значимые стимулирующие пролиферацию стволовых клеток эффекты были обнаружены в отношении эмбриональных стволовых клеток (ES-клеток) в сходных тестах.

[0088]

[ПРИМЕР 2]

Тест на ранозаживление in vitro (анализ зарастания царапины)

Проводили анализ зарастания царапины (публикация JP (Kokai) No. 2013-18756), который обычно используют для оценки эффективности в стимуляции ранозаживления. В частности, 5×105 соматических стволовых клеток человека высевали начашки размером 3,5 см, культивировали, используя среду для культивирования стволовых клеток человека до слияния в монослой и затем на дне чашек наносили царапины концом стерильного наконечника, создавая пробел в слое клеток. Затем заменяли среду на среду с добавлением одного или смеси (глицериды жирных кислот 2+3, глицериды жирных кислот 4+5) глицеридов жирных кислот 1-9 в конечной концентрации 0,001% и процент зарастания пробела клеток оценивали спустя 48 часов. Чтобы получить такую же ту же самую область под фазово-контрастным микроскопом при получении изображения до и после зарастания, делали пометку вблизи царапины, которую можно использовать в качестве референтной точки.

[0089]

Область царапины спустя 48 часов определяли как [область царапины спустя 48 часов]=100 × [площадь области царапины через 48 часов]/[площадь области царапины в 0 часов], используя коммерчески доступную компьютерную программу для анализа изображений. Полученные результаты тестирования показаны в таблице 4 ниже.

[0090]

[Таблица 4]

Оценка ранозаживляющего эффекта глицеридов жирных кислот in vitro на стволовые клетки

Тестируемое вещество Область царапины спустя 48 час (%)
Без добавления (контроль) 61
Глицерид жирной кислоты 1 54
Глицерид жирной кислоты 2 30
Глицерид жирной кислоты 3
Глицерид жирной кислоты 4
Глицерид жирной кислоты 5
32
38
40
Глицерид жирной кислоты 6 44
Глицерид жирной кислоты 7 45
Глицерид жирной кислоты 8
Глицерид жирной кислоты 9
Глицерид жирной кислоты 2+3
52
53
21
Глицерид жирной кислоты 4+5 25
Трипальмитин (сравнительный пример 1) 59
Пальмитиновая кислота (сравнительный пример 2) 60

* [Область царапины спустя 48 часов]= 100х[площадь области царапины через 48 часов]/[площадь области царапины в 0 часов].

[0091]

Как показано в таблице 4, был обнаружен значимый ранозаживляющий эффект in vitro в случае всех глицеридов жирных кислот. Также эффект усиливался при использовании двух или более глицеридов жирных кислот вместе.

[0092]

Как показано в экспериментальных примерах выше, стало возможным легко и эффективно стимулировать пролиферацию стволовых клеток при поддержании недифференцированного состояния по сравнению с обычными способами благодаря применению глицеридов жирных кислот по отношению к стволовым клеткам. Глицериды жирных кислот согласно настоящему изобретению также проявляли превосходный ранозаживляющий эффект.

[0093]

[ПРИМЕР 3]

Примеры препаратов для продуктов

Примеры препаратов для продуктов, содержащих один или смесь глицеридов жирных кислот 1-9 приведены ниже. В примерах препаратов, приведенных ниже, «глицерид жирной кислоты» означает один из глицеридов жирных кислот 1-9 или любое равное количество смеси глицеридов жирных кислот 2 и 3 и равное количество смеси глицеридов жирных кислот 4 и 5.

[0094]

(Пример препарата 1) Лосьон

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. 1,3-бутиленгликоль 8,0

3. Глицерин 2,0

4. Ксантановая камедь 0,02

5. Лимонная кислота 0,01

6. Цитрат натрия 0,1

7. Этанол 5,0

8. Метилпарагидроксибензоат 0,1

9. Полиоксиэтилированное гидрогенизированное касторовое масло (40 E.O.) 0,1

10. Отдушка 0,1

11. Очищенная вода остальная часть

Лосьон готовят посредством гомогенного растворения компонентов 2-6 и 11 и компонентов 1 и 7-10 по отдельности, затем их смешиванием и фильтрованием смеси.

[0095]

(Пример препарата 2) Крем

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. Сквалан 5,5

3. Оливковое масло 3,0

4. Стеариновая кислота 2,0

5. Пчелиный воск 2,0

6. Октилдодецилмиристат 3,5

7. Полиоксиэтилированный цетиловый эфир (20 E.O.)

3,0

8. Бегениловый спирт 1,5

9. Глицерилмоностеарат 2,5

10. Отдушка 0,1

11. Метилпарагидроксибензат 0,2

12. Этилпарагидроксибензоат 0,05

13. 1,3-бутиленгликоль 8,5

14. Очищенная вода остальная часть

Компоненты 1-9 нагревают, растворяют, перемешивают и выдерживают при 70°C с образованием масляной фазы. Компоненты 11-14 нагревают, растворяют, перемешивают и выдерживают при 75°C с образованием водной фазы. Затем водную фазу добавляют к масляной фазе и смесь эмульгируют и охлаждают при встряхивании. Компонент 10 добавляют при 45°C и затем смесь охлаждают до 30°C, получая продукт.

[0096]

(Пример препарата 3) Эмульсия

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. Сквалан 5,0

3. Оливковое масло 5,0

4. Масло жожоба 5,0

5. Цетанол 1,5

6. Глицерилмоностеарат 2,0

7. ПОлиоксиэтилированный цетиловый эфир (20 E.O.)

3,0

8. Олиоксиэтилированный моноолеат сорбитана (20 E.O.)

2,0

9. Отдушка 0,1

10. Пропиленгликоль 1,0

11. Глицерин 2,0

12. Метилпарагидроксибензоат 0,2

13. Очищенная вода остальная часть

Компонент 1-8 нагревают, растворяют, перемешивают и выдерживают при 70°C с образованием масляной фазы. Компоненты 10-13 нагревают, растворяют, перемешивают и выдерживают при 75°C с образованием водной фазы. Водную фазу добавляют к масляной фазе и смесь эмульгируют и охлаждают при встряхивании. Компонент 9 добавляют при 45°C и затем смесь охлаждают до 30°C, получая продукт.

[0097]

(Пример препарата 4) Гель

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. Этанол 5,0

3. Метилпарагидроксибензоат 0,1

4. Полиоксиэтилированное гидрогенизированное касторовое масло 0,1

5. Отдушка q.s.

6. 1,3-бутиленгликоль 5,0

7. Глицерин 5,0

8. Ксантановая камедь 0,1

9. Карбоксивиниловый полимер 0,2

10. Гидроксид калия 0,2

11. Очищенная вода остальная часть

Каждый из компонентов 1-5 и компоненты 6-11 растворяют до гомогенности и смешивают, получая продукт.

[0098]

(Пример препарата 5) Мазь

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 2,0

2. Полиоксиэтилированный цетиловый эфир (30 E.O.)

2,0

3. Глицерилмоностеарат 10,0

4. Жидкий парафин 5,0

5. Цетанол 6,0

6. Метилпарагидроксибензоат 0,1

7. Пропиленгликоль 10,0

8. Очищенная вода остальная часть

Компоненты 1-5 нагревают, растворяют, перемешивают и выдерживают при 70°C с образованием масляной фазы. Компоненты 6- 8 нагревают, растворяют, перемешивают и выдерживают при 75°C с образованием водяной фазы. Водную фазу добавляют к масляной фазе и смесь эмульгируют, охлаждают до 30°C при встряхивании, получая продукт.

[0099]

(Пример препарата 6) Примочка

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. Поливиниловый спирт 12,0

3. Этанол 5,0

4. 1,3-бутиленгликоль 8,0

5. Метилпарагидроксибензоат 0,2

6. Пара-оксиэтилированное гидрогенизированное касторовое масло (20 E. O.) 0,5

7. Лимонная кислота 0,1

8. Цитрат натрия 0,3

9. Отдушка q.s.

10. Очищенная вода остальная часть

Компоненты 1-10 растворяют до гомогенности, получая продукт.

[0100]

(Пример препарата 7) Таблетка

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 1.0

2. Сухой кукурузный крахмал 25,0

3. Кальций-карбоксиметилцеллюлоза 20,0

4. Кристаллическая целлюлоза 40,0

5. Поливинилпирролидон 8,0

6. Тальк 6,0

Компоненты 1-5 смешивают, затем к ним добавляют 10% воды в качестве связующего средства и смесь подвергают экструзии, гранулируют и затем сушат. Добавляют компонент 6 и смешивают с образованными гранулами и прессуют в таблетки. Таблетка должна весить 0,52 г.

[0101]

(Пример препарата 8) Напиток

Препарат Количество в смеси (% масс.)

1. Глицерид жирной кислоты 0,1

2. Стевия 0,05

3. Яблочная кислота 5,0

4. Корригент 0,1

5. Очищенная вода остальная часть

Компоненты 1-4 растворяют в части компонента 5, очищенной воде при перемешивании. Затем добавляют остальную часть очищенной воды компонента 5 и перемешивают. Раствор нагревают до 90°C и наполняют стеклянную бутылку объемом 50 мл.

ПРОМЫШЛЕННАЯ ПРИМЕНИМОСТЬ

[0102]

Примеры предполагаемого применения настоящего изобретения включают регенеративную медицину и регенеративное косметическое лечение. Например, стало возможным легко и эффективно получать стволовые клетки в недифференцированном состоянии для применения в регенеративной медицине или регенеративном косметическом лечении с применением настоящего изобретения. Кроме того, глицериды жирных кислот согласно настоящему изобретению можно инъецировать непосредственно или вводить посредством перорального введения, наложения, намазывания или тому подобного после трансплантации стволовых клеток или к стволовым клеткам, которые находятся в ткани, чтобы обеспечить пролиферацию стволовых клеток при поддержании недифференцированнго состояния. Кроме того, глицериды жирных кислот согласно настоящему изобретению можно применять в качестве превосходного средства для лечения раны.

[0103]

Более конкретно в настоящем изобретении предлагается способ получения стволовых клеток для регенеративной медицины и регенеративного косметического лечения и/или средство для поддержания недифференцированного состояния или стимуляции пролиферации стволовых клеток или средство для лечения раны.

[0104]

Все публикации, патенты и заявки на выдачу патентов, цитированные в настоящем описании, включены как таковые в настоящую публикацию в виде ссылки.



 

Похожие патенты:

Изобретение относится к области клеточной биологии и биотехнологии, в частности к способу выделения мезенхимальных стволовых клеток шейки матки, не являющихся опухолевыми, которые экспрессируют клеточные маркеры CD29, CD44, CD73, CD105 и CD90 и не экспрессируют клеточные маркеры CD117, CD133, HLA-DR, TRA-81, CD45, CD34 и CD31, применению выделенной ткани шейки матки и способу получения кондиционированной среды.

Изобретение относится к области биотехнологии, а именно к способу получения стволовых клеток (СК) из зуба. Способ включает заполнение внутренней полости отделенного зуба через апикальную часть его корневого канала 0,1-0,4% раствором коллагеназы и выдерживание в диапазоне от примерно 25°С до примерно 39°С в течение 20-120 минут.

Изобретение относится к области биотехнологии, конкретно к способу выделения клеток внелуковичной дермальной оболочки волосяного фолликула (NBDS), и может быть использовано в медицине.

Группа изобретений относится к биотехнологии, а именно к способам использования композиции сред клеточной культуры для выращивания клеток и/или белкового производства.

Изобретение относится к области медицины, а именно к онкогинекологии и репродуктивной медицине, и предназначено для сохранения репродуктивной функции женщин с онкологическими заболеваниями, желающих в дальнейшем иметь детей.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для лечения злокачественных опухолей. Способы по изобретению включают получение и введение внутрь опухоли незрелых дендритных клеток, после этого введение внутрь опухоли цитотоксических T-лимфоцитов и/или NKT-клеток и антитела против TNF и/или антитела против IL-10.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ оценки антимикобактериального действия противотуберкулезных препаратов с использованием биологического материала пациентов, больных туберкулезом легких, включающий забор биологического материала, культивирование в питательной среде, ее замену на свежую питательную среду в контрольной культуре и на такую же питательную среду в опытной культуре, дополнительно содержащую противотуберкулезный препарат, сопоставление роста микобактерий туберкулеза в контрольной и опытной культурах, где в качестве биологического материала используют образцы ткани легкого из операционного материала; получают из него ex vivo культуру альвеолярных макрофагов; культивируют ее в течение 1 суток в питательной среде; заменяют питательную среду на свежую в контрольной культуре клеток и на такую же среду с добавлением противотуберкулезного препарата в опытных культурах клеток, различающихся концентрациями одного и того же противотуберкулезного препарата; продолжают культивирование в течение трех дней; фиксируют клетки на покровных стеклах; окрашивают по методу Циля-Нильсена; проводят цитологический анализ на наличие признаков цитотоксического воздействия противотуберкулезного препарата на альвеолярные макрофаги; определяют доли альвеолярных макрофагов, содержащих микобактерии туберкулеза, от общего числа альвеолярных макрофагов в контрольной и опытной культурах клеток; при отсутствии признаков цитотоксического воздействия противотуберкулезного препарата на альвеолярные макрофаги в опытной культуре, отсутствии микобактерий в альвеолярных макрофагах или снижении доли альвеолярных макрофагов, содержащих микобактерии туберкулеза, в 2 и более раз в опытной культуре относительно контрольной делают положительное заключение об антимикобактериальном действии противотуберкулезного препарата и его минимальной концентрации, достаточной для достижения антимикобактериального эффекта, и при проведении цитологического анализа на наличие признаков цитотоксического воздействия противотуберкулезного препарата на альвеолярные макрофаги учитывают наличие ядра с признаками конденсации хроматина, и/или отсутствие целостности плазматической мембраны, и/или образование апоптозных телец, и/или разрушение клеток до отдельных участков цитоплазмы, и/или появление клеток без ядер; при наличии по меньшей мере одного из них делают заключение о наличии признаков цитотоксического воздействия.

Изобретение относится к медицине, а именно к способу выделения хондроцитов. Способ выделения хондроцитов включает забор материала, срезание хрящевой ткани с кости, нарезание хрящевой ткани на фрагменты, далее полученные фрагменты хрящевой ткани помещают в фильтрующее устройство, инкубируют в растворе трипсина, полученную суспензию хондроцитов центрифугируют, супернатант отбрасывают, а образовавшийся осадок хондроцитов промывают раствором фосфатного буфера PBS 2 раза, осуществляют отбор первой фракции хондроцитов, затем нелизированные фрагменты хрящевой ткани, находящиеся в фильтрующем устройстве, инкубируют в растворе коллагеназы II типа, полученный осадок хондроцитов промывают раствором фосфатного буфера PBS 2 раза, осуществляют отбор второй фракции хондроцитов, затем первую и вторую фракцию хондроцитов объединяют, далее нелизированные фрагменты хрящевой ткани удаляют из фильтрующего устройства и инкубируют в культуральной среде DMEM/F12, содержащей FBS, пенициллин, стрептомицин, амфотерицин В, затем вышеописанную культуральную среду отбрасывают и добавляют раствор коллагеназы II типа, полученный после осаждения хондроцитов центрифугированием на втором этапе, инкубируют, полученную суспензию хондроцитов центрифугируют, образовавшийся супернатант, содержащий коллагеназу II типа, отбрасывают, а полученный осадок хондроцитов промывают раствором фосфатного буфера PBS 2 раза, осуществляют отбор третьей фракции хондроцитов и соединяют ее с первой и второй фракциями хондроцитов, затем полученную суспензию хондроцитов высевают на культуральный пластик для адгезионных культур в среде DMEM/F12 содержащей FBS, пенициллин, стрептомицин, амфотерицин В, получая первичную клеточную популяцию нулевого пассажа.

Изобретение относится к области биотехнологии, конкретно к клеточной нейротрансплантологии, и может быть использовано в медицине для лечения травм спинного мозга.

Группа изобретений относится к области биотехнологии. Предложена заготовка микрофлюидного чипа и микрофлюидный чип для культивирования и/или исследования клеток.

Изобретение относится к органическому синтезу и касается усовершенствованного способа получения эфиров бис- , -ненасыщенных дикарбоновых кислот, заключающийся в том, что диалкилмалеаты подвергают взаимодействию с циклическими олефинами в присутствии катализатора метатезиса при температуре от 20°С до 90°С.

Изобретение относится к способам получения метилового эфира 9Z11Е-октадекадиеновой кислоты (1) - потенциального тестирующего и диагностического агента аллергических и воспалительных состояний, что обусловлено наличием в его структуре системы сопряженных двойных связей, идентичной образующейся при действии ферментов липоксигеназ на природные полиненасыщенные кислоты.
Описан способ получения гранул с энтеросолюбильным покрытием, содержащих ингибитор протонного насоса с бензимидазоловой структурой, выбранный из омепразола, эзомепразола, ланзопразола, пантопразола и рабепразола, и используемых для приготовления фармацевтических композиций из множества частиц для перорального введения.

Группа изобретений относится к области фармацевтики и раскрывает композицию и фармацевтический состав, а также способ приготовления указанной композиции. Композиция характеризуется тем, что содержит гидрогели из функционализированных производных гиалуроновой кислоты, загруженные экзогенными ферментами, выбранными из группы, состоящей из пролил-эндопептидазы (ПЭП) и эндопротеазы (ЭП).

Изобретение относится к медицине, в частности к таблетке ондансетрона для лечения тошноты и рвоты, а также к упакованному фармацевтическому препарату и способу лечения тошноты и рвоты.

Группа изобретений относится к химико-фармацевтической промышленности и представляет устройство для изготовления растворимой пленки для перорального применения, содержащей несколько медикаментов, расположенных в несколько рядов, содержащее узел нанесения растворимой пленки для перорального применения, выполненный с возможностью нанесения исходного раствора растворимой пленки для перорального применения в виде пленки, при этом узел нанесения растворимой пленки для перорального применения содержит: сопло подачи первого медикамента, соединенное с емкостью для первого медикамента, из которой поступает исходный раствор первого медикамента, выполненное с возможностью подачи первого медикамента для нанесения на нижний оберточный лист в виде пленки, и сопло подачи второго медикамента, соединенное с емкостью для второго медикамента, расположенной рядом с соплом подачи первого медикамента, из которой поступает исходный раствор второго медикамента, отличающегося от первого медикамента, выполненное с возможностью подачи второго медикамента для нанесения на нижний оберточный лист в виде пленки, и при этом разные медикаменты наносят в несколько рядов на нижний оберточный лист таким образом, чтобы они соприкасались друг с другом в одном слое, не перекрываясь.
Изобретение относится к медицине, в частности к фармацевтической композиции для поддержания устойчивой стабильной суспензии или дисперсии малорастворимого в воде лекарственного средства, а также к фармацевтическому препарату, упакованному в стик-пакет.

Группа изобретений относится к области медицины, а именно к онкологии, и раскрывает способ лечения рака предстательной железы, способ введения лекарственного средства пациенту и медицинское устройство.

Изобретения относятся к области биотехнологии, в частности к средствам для поддержания или стимуляции, косметическому продукту, фармацевтическому продукту, лечебно-профилактическому препарату, продукту питания и напитку недифференцированного состояния эмбриональных стволовых клеток или соматических стволовых клеток, средству для лечения раны и способу выращивания эмбриональных стволовых клеток, исключая эмбриональные стволовые клетки человека, или соматических стволовых клеток при поддержании недифференцированного состояния. Изобретения включают использование одного или смеси двух и более диглициридов жирных кислот, представленных общей формулой ,где по меньшей мере один из R1, R2 и R3 являются одинаковыми или различными, означают ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а оставшийся один означает атом водорода или где один из R1, R2 и R3 означает ацильную группу, полученную из насыщенной жирной кислоты, один из R1, R2 и R3 означает ацильную группу, полученную из ненасыщенной жирной кислоты, имеющей от 16 до 22 атомов углерода, а оставшийся один означает атом водорода. Изобретения позволяют оказать эффективное влияние на поддержание недифференцируемого состояния и стимуляцию пролиферации стволовых клеток. 9 н. и 2 з.п. ф-лы, 4 табл., 3 пр.

Наверх