Олигонуклеотидные днк праймеры для выявления и филогенетического анализа провирусной днк вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3'). Изобретение может быть использовано диагностическими ветеринарными лабораториями, научно-исследовательскими учреждениями, биотехнологическими компаниями. Техническим результатом предполагаемого изобретения является синтез целевого фрагмента ДНК, кодирующиго фрагмент поверхностного гликопротеина gp70 вируса лейкоза кошек, который может быть использован для проведения филогенетического анализа и синтеза вирусного антигена. 1 ил., 3 табл., 3 пр.

 

Изобретение относится к генной инженерии и биотехнологии и может быть использовано для выявления провирусной ДНК вируса лейкоза кошек, для филогенетического анализа данного вируса, а также для биотехнологического синтеза продукта гена gp70, содержащего иммуногенные эпитопы вируса. Изобретение может быть использовано диагностическими ветеринарными лабораториями, научно-исследовательскими учреждениями, занимающимися эпизоотологией, биотехнологическими компаниями, занимающимися производством рекомбинантных ветеринарных вакцин для мелких домашних животных.

Вирус лейкоза кошек (ВЛК) относится к группе ретровирусов, которые широко распространены среди людей и животных, вызывая тяжелые заболевания и приводя к смерти. Жизненный цикл ретровирусов следующий: сначала РНК-содержащая форма вируса проникает в цитоплазму, где за счет ресурсов клетки хозяина, при помощи обратной транскрипции создает свою комплементарную ДНК-содержащую форму (провирус). В структуре вируса различают белки, связанные с сердцевиной (p10, p12, p15 и p27), и 2 оболочечных белка - гликозилированный 70 кД (gp70) и не гликозилированный 15кД(р15).

Вирусный лейкоз является неизлечимым заболеванием. Профилактика заключается в вакцинации и своевременном выявлении и изоляции животных-носителей. Для своевременного выявления больных животных необходимо проводить скрининговые обследования кошек на присутствие провирусной ДНК. Применение в этих целях полимеразной цепной реакции (ПЦР) является распространенным подходом, зарекомендовавшим себя во всем мире. Целевой фрагмент (мишень) ДНК ограничен двумя олигонуклеотидами (праймерами), которые используют в ПЦР для синтеза множества копий целевого фрагмента. В рамках этого подхода не так важно, какой именно фрагмент генома выбран в качестве мишени.

За прототип взяты синтетические олигонуклеотиды-праймеры, используемые для выявления ДНК провируса лейкоза кошек эндогенного и экзогенного типа и имеющих следующие последовательности: 5'TGTCTGATGTCTGGAGCC-3', 3'TTTGGCCCATGACGGCTT-5' (патент РФ 2317329 «Пара синтетических олигонуклеотидов-праймеров, используемых для выявления днк провируса лейкоза кошек эндогенного и экзогенного типа, и условия полимеразной цепной реакции с их использованием».)

Технической проблемой является необходимость создания олигонуклеотидных праймеров для выявления провирусной ДНК вируса лейкоза кошек в целях клинической диагностики с одновременной возможностью типирования вируса по результатам диагностических исследований и с одновременной возможностью использовать продукт диагностической реакции (ПЦР) для создания компонентов вакцин против выявленных циркулирующих штаммов вируса лейкоза кошек.

Техническим результатом предполагаемого изобретения является синтез (в результате реакции ПЦР) целевого фрагмента ДНК, кодирующиго фрагмент поверхностного гликопротеина gp70 вируса лейкоза кошек, который может быть использован для проведения филогенетического анализа и синтеза вирусного антигена.

Сущность предполагаемого изобретения состоит в том, что оно включает амплификацию участка вирусного генома, отвечающего за синтез единственного протективного антигена вируса (гликопротеин gp70). Вирусный гликопротеин gp70 несет протективные антигены и может быть использован в составе рекомбинантных или субъединичных вакцин.

Филогенетический анализ на основе гликопротеина gp70 имеет дополнительный смысл, т.к. генетическое родство или расхождение вирусных изолятов должно иметь корреляцию с антигенным родством.

Антигенные детерминанты гликопротеина gp70 описаны в литературе и испытаны в виде пептидов (Bayer Н, Hunsmann G. Synthetic vaccines against Friend murine leukaemia virus nduced erythroleukaemia: in vivo and in vitro studies with synthetic oligopeptides and sequence-specific antisera. J Gen Virol. 1987 Feb; 68 (Pt 2): 515-22). Они расположены в

следующих позициях: аминокислоты с 6 по 12 (пептид 1), с 124 t по 131 (пептид 2), с 256 t по 262 (пептид 3), с 283 по 290 (пептид 4), с 434 по 441 (пептид 5). Специфические антисыворотки, полученные на каждый из 5 пептидов, не нейтрализовали вирусную репродукцию in vitro. Тем не менее, антитела к пептидам 4 и 5, расположенным на гидрофобной части белковой молекулы, провоцировал комплемент-зависимый лизис клеток, инфицированных схожим ретровирусом мышей FLV (Friend murine leukaemia virus). В опытах по иммунизации мышей-гнотобиотов были испытаны комбинации из трех (1+4+5) и всех пяти пептидов. Применение этих экспериментальных вакцин привело к удлинению инкубационного периода и увеличению доли выживших животных после экспериментального заражения. Таким образом, установлено, что применение комбинации пептидов для иммунизации вызывает иммунный ответ, отличный по механизму от вирус-нейтрализации специфическими иммуноглобулинами, следовательно, относящийся к клеточному типу иммунного ответа. Данный иммунный ответ обеспечивает частичную защиту от лейкемии, что на сегодняшний день удовлетворяет требованиям к противолейкозным вакцинам.

Используемые штаммы вируса лейкоза кошек:

Для подбора олигонуклеотидных праймеров нами были использованы последовательности ДНК гена gp70 из международной базы данных ГенБанк, ниже указаны коды и названия штаммов ВЛК:

М18247.1:5981-7909 Feline leukemia virus, subgroup A (FeLV-FAIDS)

KP728112.1:5988-7916 Feline leukemia virus strain Glasgow-1

AF052723.1:5988-7916 Feline leukemia virus strain Rickard subgroup A

AB060732.3:6071-7999 Feline leukemia virus DNA, gp70, clone: clone33

AB672612.1:6152-8143 Feline leukemia virus DNA, gp70, clone: pJ7E2

Положение олигонуклеотидных праймеров по отношению ко всем перечисленным штаммам вируса лейкоза кошек указаны в Приложении 2.

Нумерацию нуклеотидов и аминокислот мы приводим, основываясь на структуре белка gp70 штамма Glasgow-1. Нахождение гена белка gp70 в полном геноме соответствует следующим нуклеотидным позициям: 5988-7916. В Приложении 1 приведены пары олигонуклеотидных праймеров с размещением их на нуклеотидной последовательности гена gp70 (первый нуклеотид стартового кодона располагается в положении 1 на карте гена, последний нуклеотид стоп-код она - в положении 2300)

Для амплификации кодирующего фрагмента гена, содержащего все пять антигенно значимых пептидов, а также в качестве внешних праймеров для гнездовой диагностической ПЦР используются следующие олигонуклеотиды (1fwd и 1rev):

Для амплификации малого фрагмента гена в качестве внутренних праймеров для гнездовой диагностической ПЦР используются следующие олигонуклеотиды (2fwd и 2rev):

Разработанные праймеры 1fwd, 1rev, 2fwd, 2rev позволяют проводить диагностические исследования по выявлению провирусной ДНК вируса лейкоза кошек методом гнездовой ПЦР, что описано в примере 1.

Разработанные праймеры 1fwd и 1rev позволяют синтезировать методом ПЦР участок гликопротеина gp70 для проведения филогенетического анализа в сравнении с указанными референтными штаммами вируса лейкоза кошек, что описано в примере 2.

Разработанные праймеры 1fwd и 1rev позволяют синтезировать методом ПЦР участок гликопротеина gp70 в виде одной открытой рамки считывания с фланкирующими уникальными сайтами эндонуклеаз рестрикции, годной для немедленного встраивания в экспрессирующие векторы всех типов с целью получения антигенно активного протеина вируса лейкоза кошек, что описано в примере 3.

Праймеры изготавливаются по приведенной в настоящей заявке последовательности при помощи автоматического нуклеотидного синтезатора. Чистота праймеров контролируется методом ВГЖХ и должна составлять не менее 95%.

Праймеры хранятся при -20°С в течение года.

Осуществление изобретения иллюстрируется следующими примерами:

Пример 1.

Выявление провирусной ДНК вируса лейкоза кошек методом гнездовой ПЦР.

В качестве ДНК-матрицы использовали геномную ДНК, полученную из крови и органов кошек. ДНК выделяли с помощью набора ДНК-сорб Б для цельной крови и тканей (ЦНИИ Эпидемиологии, Москва).

Прямая ПЦР:

ПЦР проводили в объеме 25 мкл. Реакционная смесь содержала 10 ммоль Tris-HCl (рН 9.0), 50 ммоль KCl, 0.1% Triton Х-100, 1.5 ммоль MgCl2, 10 пмоль каждого праймера 1fwd и 1rev, 0.25 ммоль каждого dNTP, 1.25 ед. Taq-полимеразы и 5 мкл выделенной ДНК. Результаты ПЦР анализировали методом электрофореза в агарозном геле. Программа ПЦР: 1 цикл: 95°С - 1 мин.; 40 циклов: 95°С - 20 сек., 55°С - 20 сек., 72°С - 20 сек.; 1 цикл: 72°С - 5 мин. Поверх смеси наслаивали 40 мкл минерального масла. В результате получится фрагмент двуцепочечной ДНК, имеющий в своем составе 1394 нуклеотидных пар. Он применяется для гнездовой ПЦР (в случае, если не ярко выражен), для секвенирования и построения филогенетичевких дендрограмм.

Гнездовая ПЦР:

После проведения реакции прямой ПЦР, материал для нее использовали во второй реакции:

ПЦР проводили в объеме 25 мкл. Реакционная смесь содержала 10ммоль Tris-HCl (рН 9.0), 50 ммоль КСl, 0.1% Triton Х-100, 1.5 ммоль MgCl2, 10пмоль каждого праймера 2fwd и 2rev, 0.25 ммоль каждого dNTP, 1.25ед. Taq-полимеразы и 5 мкл материала из реакции прямой ПЦР (см выше). Результаты ПЦР анализировали методом электрофореза в агарозном геле. Программа ПЦР: 1 цикл: 95°С - 1 мин.; 30 циклов: 95°С - 20 сек., 55°С - 20 сек., 72°С - 20 сек.; 1 цикл: 72С° - 5 мин. Поверх смеси наслаивали 40 мкл минерального масла. В результате получится фрагмент двуцепочечной ДНК, имеющий в своем составе 1394 нуклеотидных пар.

Пример 2

Филогенетический анализ вирусов лейкоза кошек на основе фрагмента гена поверхностного гликопротеина gp70.

Анализ фрагментов ДНК проводили методом электрофореза в агарозном геле.

ПЦР-фрагменты, соответствующие по электрофоретической подвижности размеру в 1394 пар нуклеотидов, вырезали и выделяли из геля при помощи набора для очистки ПЦР-продуктов Silica Bead DNA Gel Extraction Kit (TermoScientific) по методике производителя.

Анализ полученных нуклеотидных последовательностей проводили с помощью пакетов программ BioEdit (version 7.0.0. Copyright © 1997-2004) и пакет программ Lasergene (version 7.1.0.(44) Copyright © 1993-2006).

Нуклеотидную последовательность определяли по методу Сэнгера с использованием набора Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, США) на автоматическом секвенаторе ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, США) по методике производителя.

Филогенетические дендрограммы были построены в программе MEGA software v. 6.0 используя метод присоединения ближайшего соседа (MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0 Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S (2013) Molecular Biology and Evolution 30:2725-2729).

Результат филогенетического анализа приведен в Фигуре 1.

Пример 3.

Встраивание фрагмента гена gp70 ВЛК в экспрессирующий вектор pUC19.

Плазмидный вектор обеспечивает экспрессию генов, встраиваемых под контролем промотора lacZ, в штаммах Echserichia coli "top 10", "DH5 alpha" или им подобным. Индукция экспрессии достигается добавлением в ростовую среду изопропилтиогалактозида (IPTG). Полилинкер плазмидного вектора с обозначением кодирующих триплетов, аминокислотами и сайтами узнавания эндонуклеазами рестрикции приведен на фигуре 2

Полилинкер плазмидного вектора pUC19.

Рамка считывания определяется кодирующими триплетами, начиная со стартового кодона в положении 469 на карте вектора.

Для получения кодирующего фрагмента гена поверхностного гликопротеина gp70 вируса лейкоза кошек, проводят прямую ПЦР как описано в примере 1, но с применением модифицированных праймеров 1fwd и 1rev.

В таблице 3 малыми буквами указаны добавленные нуклеотиды, а олигонуклеотиды для наглядности разбиты на кодирующие триплеты. Подчеркиванием и цветом выделены сайты узнавания эндонуклеаз рестрикции PstI и EcoRI. После гидролиза ДНК ПЦР-продукта и вектора с последующим лигированием, получится следующая конструкция приведенная на фигуре 3.

Звездочкой обозначен стоп-кодон. Подчеркиванием и цветом выделены последовательности вируса лейкоза кошек, стоящие в правильной рамке считывания под контролем промотора лактозного оперона. В результате экспрессии данного химерного гена получится белковый продукт, состоящий из 483 аминокислот, причем первые 11 аминокислот будут принадлежать N концевой части β-галактозидазы, а остальные 476 аминокислот - фрагменту поверхностного гликопротеина gp70 вируса лейкоза кошек, содержащему 5 антигенно-значимых доменов.

Список используемой литературы

1. Патент РФ 2317329 «Пара синтетических олигонуклеотидов-праймеров, используемых для выявления днк провируса лейкоза кошек эндогенного и экзогенного типа, и условия полимеразной цепной реакции с их использованием».

2. Bayer Н, Hunsmann G. Synthetic vaccines against Friend murine leukaemia virus nduced erythroleukaemia: in vivo and in vitro studies with synthetic oligopeptides and sequence-specific antisera. J Gen Virol. 1987 Feb; 68 (Pt 2):515-22

3. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0 Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S (2013) Molecular Biology and Evolution 30:2725-2729

Набор для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, включающий олигонуклеотидные ДНК-праймеры, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').



 

Похожие патенты:

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Группа изобретений относится к области биотехнологии. Предложены способ извлечения нуклеиновых кислот из являющегося пластичным в живом организме полимера, способ обнаружения микроорганизма, прикрепленного или закрепленного в пластичном в живом организме полимере, способ идентификации резистентных к адгезии микроорганизма пластичных полимеров в живом организме, способ создания микробного профиля полости рта субъекта–млекопитающего и in vitro способ диагностики инфекции в полости рта млекопитающего или определения восприимчивости млекопитающего к развитию инфекции в полости рта.

Изобретение относится к области медицины, в частности к кардиологии, и предназначено для прогнозирования типа раннего ремоделирования левого желудочка (РЛЖ) у больных острым инфарктом миокарда.

Изобретение относится к биохимии и к медицине и представляет собой пептид формулы HD[pS]GYEVHH, где остаток серина является фосфорилированным. Данный пептид способен образовывать стабильный цинк-опосредованный межмолекулярный комплекс с металлсвязывающим доменом человеческого бета-амилоида и используется для лечения болезни Альцгеймера.

Предложенная группа изобретений относится к области медицины. Предложены способ обнаружения модифицированного основания в молекуле двуцепочечной нуклеиновой кислоты и способ идентификации по меньшей мере одного соединения, способного предотвращать взаимодействие белка с его сайтом связывания.

Изобретение относится к биотехнологии. Предложен набор для обнаружения РНК вируса болезни Гамборо, где указанный набор включает олигонуклеотиды, имеющие следующие последовательности: SEQ ID NO:1, SEQ ID NO:2 и SEQ ID NO:3.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3. Образцы замораживают при температуре -25°С для хранения. В день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф и смешивают с 0,6 мл реагента «ДНК-экспресс-кровь», встряхивают в течение 10 сек, проводят осаждение микрокапель на микроцентрифуге. Далее пробы помещают в твердотельный термостат при температуре +99°С и инкубируют в течение 15 мин, центрифугируют и осуществляют отбор супернатанта, содержащего ДНК. Изобретение дает возможность длительного хранения замороженных образцов крови и экономит время проведения процедуры выделения ДНК. 4 ил., 4 пр.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии. Способ включает взятие образца крови у пациента, измерение уровней для группы клеточно-связанных продуктов активации комплемента (CB-CAP) в указанном образце крови, где указанная группа CB-CAP включает по меньшей мере восемь из следующих: E-C4d, E-C3d, R-C4d, R-C3d, T-C4d, T-C3d, B-C4d, B-C3d, М-C4d, М-C3d, G-C4d, G-C3d, P-C4d и E-CR1, сравнение уровней CB-CAP пациента с контрольными уровнями, вычисление процента CB-CAP, для которых уровни у пациента являются аномальными по сравнению с контрольными уровнями, и принятие вычисленного процента за вероятность того, что пациент имеет волчанку в доклинической стадии. Клеточно-связанные продукты активации комплемента (CB-CAP) служат в качестве диагностических биомаркеров волчанки в доклинической стадии у пациентов, которые не соответствуют по меньшей мере четырем критериям Американской коллегии ревматологов (или подобным, например SLICC) установленного диагноза волчанки. 6 з.п. ф-лы, 4 ил., 7 табл., 1 пр.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние, внутренние. Изобретение может быть использовано диагностическими ветеринарными лабораториями, научно-исследовательскими учреждениями, биотехнологическими компаниями. Техническим результатом предполагаемого изобретения является синтез целевого фрагмента ДНК, кодирующиго фрагмент поверхностного гликопротеина gp70 вируса лейкоза кошек, который может быть использован для проведения филогенетического анализа и синтеза вирусного антигена. 1 ил., 3 табл., 3 пр.

Наверх