Способ экспресс-выделения днк из размороженной крови



Способ экспресс-выделения днк из размороженной крови
Способ экспресс-выделения днк из размороженной крови
C12N15/1003 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2679907:

Федеральное государственное бюджетное образовательное учреждение дополнительного профессионального образования "Российская медицинская академия непрерывного профессионального образования" Министерства здравоохранения Российской Федерации (ФГБОУ ДПО РМАНПО Минздрава России) (RU)

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3. Образцы замораживают при температуре -25°С для хранения. В день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф и смешивают с 0,6 мл реагента «ДНК-экспресс-кровь», встряхивают в течение 10 сек, проводят осаждение микрокапель на микроцентрифуге. Далее пробы помещают в твердотельный термостат при температуре +99°С и инкубируют в течение 15 мин, центрифугируют и осуществляют отбор супернатанта, содержащего ДНК. Изобретение дает возможность длительного хранения замороженных образцов крови и экономит время проведения процедуры выделения ДНК. 4 ил., 4 пр.

 

Изобретение относится к биологии и медицине, а именно, к молекулярной биологии, биохимии, клинической лабораторной диагностике и может быть использовано для экспресс-выделения геномной ДНК человека из размороженной крови.

Выделение геномной ДНК является первым этапом молекулярно-генетических исследований. Массовое генотипирование, направленное на выявление генетических особенностей популяций, создание геномных библиотек, научные разработки, проводимые на больших выборках, требуют консервации биоматериала - источника геномной ДНК, поскольку срочное выделение ДНК из большого количества образцов затруднительно или невозможно, например, в экспедиционных условиях. Чаще для генотипирования используют ДНК, выделенную из крови, стабилизированной ЭДТА-К3 (трикалиевый этилендиаминтетраацетат или трилон Б, или ЭДТА). Образцы такой крови можно заморозить для длительного сохранения. Но предлагаемые на рынке молекулярно-биологической продукции коммерческие комплекты реагентов для выделения нуклеиновых кислот рассчитаны, в основном, на другие источники ДНК/РНК - плазму крови, соскобы эпит. клеток, мокроту, мочу и др. (http://www.dna-technology.ru/dnaproducts/reagents/), а также свежую незамороженную кровь (ООО НПФ «ЛИТЕХ»). Для образцов замороженной крови предлагается сорбентный способ выделения ДНК на магнитных частицах (ЗАО «Sileks»). Общая схема обработки крови сводится к лизису клеток образцов и высвобождению содержащихся в них нуклеиновых кислот, которые затем связываются на магнитных частицах. Адсорбированные нуклеиновые кислоты проходят ряд отмывок с использованием трех буферов из набора, после чего их элюируют (http://www.sileks.com/ru/production.php?folder=214). Многоэтапность выделения (лизис, отмывки, элюция), высокая стоимость набора (8000 руб./100 образцов), а также другие проблемы, указанные в инструкции (например, возможный низкий выход ДНК, связанный с неполным лизисом, неполным высушиванием или длительным хранением образца крови (http://www.sileks.com/ru/librarian/librarian_ajax.php?ajaxaction=GetObjectByVName&VName=Guideline_NAIsolation_Blood-DNA-RNA_ru.pdf), являются несомненными недостатками данного способа.

С помощью набора реагентов BloodPrep™ (Applied Biosystems, США) по заверениям его поставщика, ООО "СПЕКТРТРЭЙДИНГ (Минск), можно выделить ДНК из большого количества (до 96 одновременно) образцов свежей или замороженной крови любых видов животных, клеток культур тканей или буккальных соскобов менее чем за 1 час. Однако данные реагенты и расходные материалы оптимизированы для использования исключительно в системах очистки нуклеиновых кислот Applied Biosystems (http://spt.by/index2.php?option=com_content&task=view&id=1007&Itemid=9&pop=1&page=0), что требует, очевидно, дополнительных вложений на их приобретение.

Известен способ выделения ДНК из цельной венозной крови, стабилизированной ЭДТА, с помощью имеющегося на рынке реагента "ДНК-ЭКСПРЕСС-кровь" производства ООО НПФ «Литех», г. Москва. Геномная ДНК, выделенная с помощью этого реагента, используется для выявления полиморфизмов в геноме человека методом ПЦР с флуоресцентной, в режиме реального времени, масс-спектрометрической и электрофоретической схемами детекции результата. По инструкции к реагенту (Руководство по применению «SNP»-экспресс. Универсальная система для выявления точечных мутаций в геноме человека, ООО НПФ «Литех», Москва, 2009), выделение ДНК проводят из образцов свежей цельной крови, стабилизированной ЭДТА или цитратом натрия. Способ включает забор 2 мл венозной крови в пробирку с антикоагулянтом, перенос 1 мл крови в пробирку Эппендорфа с крышкой и замком, центрифугирование при 3000 об/мин при комнатной температуре в течение 5 минут, удаление плазмы, замораживание осадка при -20°С в течение 1 часа, размораживание при комнатной температуре, смешивание с реактивом «ДНК-экспресс-кровь» в соотношении 1:1, встряхивание в течение 10 секунд, осаждение капель на микроцентрифуге, прогревание при +99°С в течение 15 минут, центрифугирование и отбор супернатанта, содержащего искомую ДНК, т.е. 12 этапов, занимающих по времени около 1,5 часа для 1 образца крови. Кровь для выделения ДНК запрещено замораживать изначально, т.е. для процедуры выделения используется свежая не замороженная кровь, что является ограничением данного способа.

Назначением настоящего изобретения является разработка способа экспресс-выделения ДНК из размороженной крови, позволяющего сократить процедуру выделения ДНК и использовать в качестве ее источника длительно хранящиеся образцы замороженной крови.

Назначение изобретения достигается способом экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3, образцы замораживают при температуре - 25°С для хранения. В день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф, с крышкой и замком Safe-Lock и смешивают с 0,6 мл реагента «ДНК-экспресс-кровь», встряхивают в течение 10 сек, проводят осаждение микрокапель на микроцентрифуге. Далее пробы помещают в твердотельный термостат при температуре +99°С и инкубируют в течение 15 мин, центрифугируют при 13000 об/мин в течение 30 сек и осуществляют отбор супернатанта, содержащего ДНК.

Новизна изобретения:

1. Реагент «ДНК-экспресс-кровь» производства НПФ «Литех (Москва), рекомендуемый для выделения ДНК из свежей незамороженной крови,

стабилизированной антикоагулянтами, используется для выделения ДНК из замороженной крови, стабилизированной ЭДТА.

2. Замороженные образцы крови, стабилизированной ЭДТА, могут храниться при -25°С в течение нескольких лет до использования для выделения ДНК и постановки метода полимеразной цепной реакции.

3. В процедуре выделения ДНК исключены этапы отделения плазмы и 1-часовой заморозки и последующего размораживания. Это экономит время выделения ДНК.

В патентной и научной литературе отсутствуют сведения об аналогичном способе экспресс-выделения ДНК из размороженной крови.

Совокупность существенных признаков изобретения позволяет получить новый технический результат:

1. Уменьшение количества этапов выделения ДНК за счет исключения из протокола метода промежуточных этапов центрифугирования при 3000 об/мин в течение 5 минут, удаления плазмы и последующего замораживания в течение 1 часа и размораживания.

2. Возможность длительного хранения замороженных образцов крови как источника геномной ДНК.

3. Экономия времени проведения процедуры выделения ДНК достигается за счет одновременной обработки большего количества проб крови, взятых у разных доноров в различное время, и за счет сокращения длительности выделения, составляющей около 30 минут для одного образца крови.

Способ осуществляется следующим образом.

Проводят забор образцов цельной венозной крови в количестве 2 мл каждый в стандартные стерильные вакуумные одноразовые пластиковые пробирки, содержащие ЭДТА-К3 (IMPROVE, China). Образцы замораживают при температуре -25°С для хранения. В день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф, с крышкой и замком Safe-Lock (Eppendorf AG, Germany) и приливают по 0,6 мл реагента «ДНК-экспресс-кровь» (НПФ «Литех», Москва). После вортексирования в течение 10 сек и осаждения микрокапель на микроцентрифуге пробы помещают в твердотельный термостат при температуре +99°C и инкубируют в течение 15 мин. Далее пробы центрифугируют при 13000 об/мин в течение 30 сек. Супернатант содержит ДНК, готовую для использования в ПНР.

Таким образом, предлагаемый способ состоит из 10 этапов выделения ДНК - забор крови, замораживание, размораживание, перенос части крови в пробирки Эппендорфа, смешивание с реагентом «ДНК-экспресс-кровь» (НПФ «Литех», Москва) в соотношении 1:1, вортексирование, осаждение микрокапель на микроцентрифуге, термостатирование, ультрацентрифугирование, отбор супернатанта - и не содержит промежуточных этапов замораживания в течение 1 часа и последующего размораживания, значительно удлиняющих процедуру выделения ДНК.

Возможность применения полученных образцов ДНК для генотипиро-вания проверяли методом аллель-специфической полимеразной цепной реакции (ПЦР) с электрофоретической детекцией результатов, используя коммерческие комплекты реагентов «SNP-экспресс» (ООО НПФ Литех, Москва) для выявления однонуклеотидных полиморфизмов в гене глутатион-S-трансферазы P1, GSTP1 (rs1695, нуклеотидная замена 313A>G, аминокислотная замена Ilel05Val, альтернативное название GSTP1I105V), в гене рецептора лептина, LEPR (rs 1137101, нуклеотидная замена 668A>G, аминокислотная замена Gln223Arg, альтернативное название LEPRGln223Arg или Q223R), в гене ариламин-N-ацетилтрансферазы 2, NAT2 (rs1799930, нуклеотидная замена 590G>A, аминокислотная замена Argl97Gln, альтернативное название NAT2Mg197Gln).

Реакционная смесь для ПЦР состояла из 5 мкл исследуемого образца ДНК и 20 мкл рабочей амплификационной смеси, содержащей 0,2 мкл рабочего раствора Taq-полимеразы. Амплификацию проводили в автоматическом термоциклере Терцик («ДНК-Технология», Москва). Программа амплификации, соответственно инструкции, включала следующий температурный режим - 1 цикл при 93°C в течение 1 мин, 35 циклов с этапами денатурации ДНК в течение 10 сек при 93°C, отжига праймеров в течение 10 сек при 64°C и синтеза цепей в течение 20 сек при 72°C, и 1 цикл при 72°C в течение 1 мин. Анализ ПЦР-продуктов проводили после их электрофоретического разделения в 50 мл 3%-агарозного геля на 50×ТАЕ-буфере, в который до застывания вносили 5 мкл 1% раствора бромистого этидия. В каждом геле вырезали два ряда лунок - для детекции аллеля дикого (нормального) типа и редкого (мутантного) аллеля. Фрагменты анализируемой ДНК проявлялись в виде светящихся полос. Гели анализировали в УФ-трансиллюминаторе ЕСХ-15М (Vilber Lourmat, Франция) с помощью гельдокументирующей видеосистемы GL-2 (Россия).

Изобретение иллюстрируется фотографиями электрофореграмм, представленными на Фиг. 1-4.

Фиг. 1. Электрофореграмма продуктов амплификации полиморфного локуса LEPRGln223Arg гена рецептора лептина LEPR. Образцы ДНК выделяли предлагаемым способом из замороженной крови тубаларов, хранившейся до постановки ПЦР три года при -25°C. Верхний ряд - аллель LEPRGln223, нижний ряд - аллель LEPR223Arg. Дорожки: К- - отрицательный контрольный образец; 2,3,6,8,11,12,14,15 - гомозиготный нормальный генотип LEPRGln223Gln; 1,4,5,7,9,10 - гетерозиготный генотип LEPRGln223Arg; 13 - гомозиготный мутантный генотип LEPRArg223Arg.

Фиг. 2. Электрофореграмма продуктов амплификации полиморфного локуса GSTP1I105V гена глутатион-S-трансферазы Пи1 GSTP1. Образцы ДНК выделяли предлагаемым способом из замороженной крови телеутов, хранившейся до исследования 8 лет при -25°C (4 образца ДНК, дорожки 1-4) и по инструкции к реагенту «ДНК-экспресс-кровь» (1 образец ДНК пациента терапевтической клиники, русского по национальности, дорожка 5). Верхний ряд - аллель GSTP11105, нижний ряд - аллель GSTP1105V. Дорожки: К- - отрицательный контрольный образец; дорожки 1-4 - гетерозиготный генотип GSTP1I105V, дорожка 5 - гомозиготный нормальный генотип GSTP1I105I.

Фиг. 3. Электрофореграмма продуктов амплификации полиморфного локуса GSTP1I105V гена глутатион-S-трансферазы Пи1 GSTP1. Образцы ДНК выделяли из замороженной крови беременных женщин предлагаемым способом (5 образцов ДНК, дорожки 1-5) и из свежей незамороженной крови беременных женщин по коммерческой инструкции к реагенту «ДНК-экспресс-кровь» (10 образцов ДНК, дорожки 6-15): К- - отрицательный контрольный образец; дорожки 1,5,7,9,12-14 - гомозиготный нормальный генотип GSTP1I105I, дорожки 2-4, 10-11,15 - гетерозиготный генотип GSTP1I105V, дорожки 6,8 - гомозиготный мутантный генотип GSTP1V105V.

Фиг. 4. Электрофореграмма продуктов амплификации полиморфного локуса NAT2Arg197Gln гена ариламин-N-ацетилтрансферазы 2 NAT2. Образцы ДНК выделяли из крови 5 беременных женщин двумя способами: 1. из образцов свежей незамороженной крови по коммерческой инструкции к реагенту «ДНК-экспресс-кровь» (5 образцов ДНК, дорожки 1-5) и образцов замороженной крови предлагаемым способом (5 образцов ДНК, дорожки 1*-5*): К- - отрицательный контрольный образец; дорожки 1,1*, 5,5* - гомозиготные нормальные генотипы 2-х женщин NAT2Arg197Arg,, дорожки 2,2*, 3,3*, 4,4* - гетерозиготные генотипы 3-х женщин NAT2Arg197Gln, одинаково определенные в двух образцах ДНК, выделенных от каждой женщины с помощью коммерческого способа и предлагаемого способа.

При выполнении поставленной задачи были проведены четыре ПЦР-исследования.

Исследование №1 (Фиг. 1.). Обследовано 15 образцов замороженной крови, забранной в экспедиционных условиях у представителей коренных народов республики Алтай, тубаларов, исторически проживающих по берегам реки Бия. До постановки ПЦР образцы крови хранились при - 25°C в течение трех лет. Генотипирование проводили по локусу LEPRGln223Arg гена рецептора лептина LEPR. Треки ДНК, представленные на Фиг. 1, свидетельствуют об успешно полученных результатах ПЦР-исследования, т.е. о пригодности ДНК, выделенной предлагаемым способом из образцов длительно хранящейся замороженной крови, для генотипирования методом ПЦР.

Исследование №2 (Фиг. 2). Образцы замороженной крови взяты из коллекции образцов, собранной в экспедиционных условиях у представителей тюркского коренного малочисленного народа, телеутов, проживающих в южных районах Кемеровской области. Коллекция хранится в замороженном состоянии при -25°C 8 лет. Выделение ДНК провели предлагаемым способом. Для сравнения взята свежая кровь у 1 пациента, находившегося на стационарном лечении в терапевтической клинике г. Новокузнецка. Выделение его ДНК провели из свежей не замороженной крови. Генотипирование проводили по генному локусу GSTP1I105V. Результаты электрофореза представлены на Фиг. 3. Полученные одинаковые яркие треки ДНК во всех образцах свидетельствуют, что ДНК, выделенная предлагаемым способом, не отличается от ДНК, выделенной из незамороженной крови по коммерческой инструкции по пригодности к использованию в методе ПЦР.

Исследование №3 (Фиг. 3).

Образцы крови взяты у 15 беременных женщин, находившихся на сохранении беременности в роддомах г. Новокузнецка, в разное время в течение 4-х месяцев. Образцы крови 5 женщин до выделения ДНК и постановки ПЦР хранили в замороженном состоянии при -25°C от одной недели до 3-х месяцев, и ДНК выделяли из образцов предлагаемым способом. ДНК 10 других женщин выделяли из свежей незамороженной крови с помощью реагента «ДНК-экспресс-кровь» по коммерческой инструкции (ООО НПФ «ЛИТЕХ»). Генотипирование проводили по генному локусу GSTP1I105V. Результаты электрофореза продуктов амплификации представлены на Фиг. 3. Не выявлено различий в интенсивности свечения треков ДНК, выделенной двумя способами, и варианты генотипов легко определяются в исследуемых образцах.

Исследование №4 (Фиг. 4.). Образцы крови взяты у 5 беременных женщин, находившихся на сохранении беременности в роддомах г. Новокузнецка. Половина каждого образца крови была немедленно использована для выделения геномной ДНК с помощью реагента «ДНК-экспресс-кровь» по соответствующей инструкции к реагенту (ООО НПФ «ЛИТЕХ»). Полученные образцы ДНК были заморожены до постановки ПЦР. Вторая половина каждого образца крови была сразу же после забора заморожена и хранилась до выделения ДНК при -25°С в течение 4-х месяцев, после чего все образцы были одновременно разморожены и использованы для выделения ДНК по предлагаемому способу. Генотипирование проводили по генному локусу NAT2Arg197Gln. Результаты электрофореза продуктов амплификации представлены на Фиг. 4. Не выявлено различий в наличии и интенсивности свечения треков и вариантах генотипов каждой женщины, определенных предлагаемым способом из замороженной крови и коммерческим способом из незамороженной крови.

Следовательно, предлагаемый способ экспресс-выделения ДНК из размороженной крови с целью постановки ПЦР позволяет использовать для выделения геномной ДНК с целью генотипирования длительно (до нескольких лет) хранящуюся в замороженном состоянии кровь, а также экономить время на процедуру выделения ДНК за счет уменьшения ее длительности и количества этапов.

Способ экспресс-выделения ДНК из размороженной крови, характеризующийся тем, что проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3, образцы замораживают при температуре -25°С для хранения, в день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф с крышкой и замком Safe-Lock и смешивают с 0,6 мл реагента «ДНК-экспресс-кровь», встряхивают в течение 10 сек, проводят осаждение микрокапель на микроцентрифуге, далее пробы помещают в твердотельный термостат при температуре +99°С и инкубируют в течение 15 мин, центрифугируют при 13000 об/мин в течение 30 сек и осуществляют отбор супернатанта, содержащего ДНК.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Группа изобретений относится к области биотехнологии. Предложены способ извлечения нуклеиновых кислот из являющегося пластичным в живом организме полимера, способ обнаружения микроорганизма, прикрепленного или закрепленного в пластичном в живом организме полимере, способ идентификации резистентных к адгезии микроорганизма пластичных полимеров в живом организме, способ создания микробного профиля полости рта субъекта–млекопитающего и in vitro способ диагностики инфекции в полости рта млекопитающего или определения восприимчивости млекопитающего к развитию инфекции в полости рта.

Изобретение относится к области медицины, в частности к кардиологии, и предназначено для прогнозирования типа раннего ремоделирования левого желудочка (РЛЖ) у больных острым инфарктом миокарда.

Изобретение относится к биохимии и к медицине и представляет собой пептид формулы HD[pS]GYEVHH, где остаток серина является фосфорилированным. Данный пептид способен образовывать стабильный цинк-опосредованный межмолекулярный комплекс с металлсвязывающим доменом человеческого бета-амилоида и используется для лечения болезни Альцгеймера.

Предложенная группа изобретений относится к области медицины. Предложены способ обнаружения модифицированного основания в молекуле двуцепочечной нуклеиновой кислоты и способ идентификации по меньшей мере одного соединения, способного предотвращать взаимодействие белка с его сайтом связывания.

Изобретение относится к области биотехнологии. Раскрывается заполняющий компонент аденоассоциированного вируса, состоящий из нуклеиновой кислоты длиной от 3300 до 4200 нуклеотидов.

Изобретение относится к области биотехнологии, в частности к способу получения растения из популяции клеток, включающему выделение при помощи активируемой флуоресценцией сортировки клеток (FACS) инкапсулированного в альгинат натрия протопласта растения, содержащего представляющий интерес полинуклеотид; регенерацию растения из выделенного растительного протопласта и культивирование данного растения.

Изобретение относится к области биохимии и молекулярной биологии. Предложено применение молекулы нуклеиновой кислоты, способной к связыванию с SDF-1 и блокированию взаимодействия между SDF-1 и рецептором SDF-1 CXCR7.

Группа изобретений относится к области биотехнологии. Предложены способ извлечения нуклеиновых кислот из являющегося пластичным в живом организме полимера, способ обнаружения микроорганизма, прикрепленного или закрепленного в пластичном в живом организме полимере, способ идентификации резистентных к адгезии микроорганизма пластичных полимеров в живом организме, способ создания микробного профиля полости рта субъекта–млекопитающего и in vitro способ диагностики инфекции в полости рта млекопитающего или определения восприимчивости млекопитающего к развитию инфекции в полости рта.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения слитого белка MBP84-106-Fc, состоящего из лидерного пептида тяжелой цепи моноклонального антитела FI0, слитого с фрагментом основного белка миелина 84-106 (МВР84-106) и затем с Fc-фрагментом антитела IgG 1 (домены СН2-СН3) человека, в клетках яичника китайского хомячка (СНО).

Изобретение относится к биохимии. Описано двухцепочечное средство для РНКи для ингибирования экспрессии транстиретина (TTR), содержащее смысловую цепь, комплементарную антисмысловой цепи, где указанная антисмысловая цепь содержит последовательность, комплементарный нуклеотидам 504-526 гена транстиретина (TTR) (SEQ ID NO:1), где смысловая цепь имеет длину 21 нуклеотид, а антисмысловая цепь имеет длину 23 нуклеотида.

Изобретение относится к генной инженерии и биотехнологии, в частности к генотерапевтическому ДНК-вектору VTvaf17 размером 3165 п.н. и способу его получения.

Изобретение относится к области биотехнологии, конкретно к способам для идентификации связывающих полипептидов (например, антител или их антигенсвязывающих фрагментов), которые специфически связываются с антигеном клеточной поверхности, что может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoM депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-797.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoB депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-796.

Группа изобретений относится к области биотехнологии. Предложены способ извлечения нуклеиновых кислот из являющегося пластичным в живом организме полимера, способ обнаружения микроорганизма, прикрепленного или закрепленного в пластичном в живом организме полимере, способ идентификации резистентных к адгезии микроорганизма пластичных полимеров в живом организме, способ создания микробного профиля полости рта субъекта–млекопитающего и in vitro способ диагностики инфекции в полости рта млекопитающего или определения восприимчивости млекопитающего к развитию инфекции в полости рта.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3. Образцы замораживают при температуре -25°С для хранения. В день выделения ДНК образцы размораживают при комнатной температуре, переносят по 0,6 мл крови в пластиковые пробирки объемом 1,5 мл типа Эппендорф и смешивают с 0,6 мл реагента «ДНК-экспресс-кровь», встряхивают в течение 10 сек, проводят осаждение микрокапель на микроцентрифуге. Далее пробы помещают в твердотельный термостат при температуре +99°С и инкубируют в течение 15 мин, центрифугируют и осуществляют отбор супернатанта, содержащего ДНК. Изобретение дает возможность длительного хранения замороженных образцов крови и экономит время проведения процедуры выделения ДНК. 4 ил., 4 пр.

Наверх