Способ выявления кишечных вирусов в клинических образцах и воде методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления



Способ выявления кишечных вирусов в клинических образцах и воде методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления
Способ выявления кишечных вирусов в клинических образцах и воде методом мультиплексной пцр с детекцией в режиме реального времени и перечень последовательностей для его осуществления

 


Владельцы патента RU 2506317:

Российская Федерация, от имени которой выступает Министерство промышленности и торговли Российской Федерации (Минпромторг России) (RU)

Изобретение относится к области лабораторной диагностики, медицинской вирусологии, молекулярной биологии и эпидемиологии. Изобретение предназначено для выявления и идентификации в клинических образцах и элюатах, полученных в результате концентрирования из воды, одиннадцати групп кишечных вирусов (энтеровирусов (ЭВ), полиовирусов (ПВ), ротавирусов А и С (РВА и РВС соответственно), аденовирусов (АДВ), норовирусов (НВ), саповирусов (СВ), вирусов гепатита А и Е (ВГА и ВГЕ соответственно), астровирусов (АВ), ортореовирусов (ОРВ) в присутствии внутреннего положительного контроля (ВПК) посредством мультиплексной ПЦР с детекцией в режиме реального времени. Данный подход позволяет усовершенствовать технику ПЦР-анализа для диагностики острых кишечных инфекций (ОКИ) и может найти применение в эпидемиологических службах для мониторинга эпидемиологической обстановки и быстрой расшифровки вспышек ОКИ. 2 н. и 5 з.п. ф-лы, 4 табл., 6 пр.

 

Изобретение относится к области лабораторной диагностики, медицинской вирусологии, молекулярной биологии и эпидемиологии. Изобретение предназначено для выявления и идентификации в клинических образцах и элюатах, полученных в результате концентрирования из воды, одиннадцати групп кишечных вирусов (энтеровирусов (ЭВ), полиовирусов (ПВ), ротавирусов А и С (РВА и РВС соответственно), аденовирусов (АДВ), норовирусов (НВ), саповирусов (СВ), вирусов гепатита А и Е (ВГА и ВГЕ соответственно), астровирусов (АВ), ортореовирусов (ОРВ) в присутствии внутреннего положительного контроля (ВПК) посредством мультиплексной ПЦР с детекцией в режиме реального времени. Данный подход позволяет усовершенствовать технику ПЦР-анализа для диагностики острых кишечных инфекций (ОКИ) и может найти применение в эпидемиологических службах для мониторинга эпидемиологической обстановки и быстрой расшифровки вспышек ОКИ.

Уровень техники

Острые кишечные инфекции занимают второе место в структуре инфекционных заболеваний человека. Возбудителями ОКИ могут быть энтеровирусы, ротавирусы, аденовирусы, калицивирусы, астровирусы, коронавирусы и другие.

Энтеровирусы оказывают самое различное воздействие на организм, в том числе вызывают более 20 различных синдромов: полиомиелит, миокардит, перикардит, плевралгия, респираторные заболевания, конъюнктивит, гепатит, асептический менингит, энцефалит, диабет и др. Около 90-95% случаев полиовирусной инфекции и примерно 50% случаев ЕСНО и коксакивирусной инфекции протекают бессимптомно. Ротавирусы высококонтагиозны и являются главной причиной диареи у детей. Более чем у 90% детей антитела к ротавирусам появляются до трехлетнего возраста. Норовирусы и другие калицивирусы являются частой причиной вспышек гастроэнтеритов в школах, детских садах, больницах, лагерях отдыха. Большинство подростков имеют антитела к энтеральным калицивирусам. Аденовирусы и астровирусы чаще вызывают гастроэнтериты у детей и ограниченно патогенны для взрослых.

До настоящего времени «золотым стандартом» лабораторной диагностики энтеровирусной и аденовирусной инфекции и выявления энтеровирусов в окружающей среде остается реакция нейтрализации (РН) с типоспецифическими сыворотками в культуре чувствительных клеток. Для выявления кишечных вирусов также эффективно применяют реакции прямой и непрямой иммунофлуоресценции, иммунохроматографию (для ротавирусов, норовирусов и аденовирусов) и реакцию латекс-агглютинации, характеризующиеся меньшими затратами времени по сравнению с РН, но более низкой чувствительностью. Сложность, длительность и трудоемкость РН обусловлена различной чувствительностью клеточных культур к отдельным представителям рода Enterovirus и множеством их антигенных вариантов. По этой причине затруднена и разработка унифицированных диагностикумов, позволяющих быстро и эффективно проводить выявление и дифференциацию энтеровирусов. Кроме того, ряд кишечных вирусов (например, калицивирусы и вирусы гепатитов А и Е) с трудом или вовсе не поддаются культивированию. Выявление антител к вирусам в сыворотке пациентов с помощью твердофазного ИФА, как например для вирусов гепатита А и Е, является ретроспективным методом (выявляет не самого возбудителя, а регистрирует ответ организма на инфекцию). Все перечисленные методы в основном моноспецифичны, что затрудняет выявление смешанных кишечных инфекций. Решение перечисленных проблем в последние годы связывают с развитием молекулярных методов амплификации нуклеиновых кислот (МАНК), специфичность которых основана на уникальности нуклеотидных последовательностей вирусных геномов. К числу МАНК относятся различные модификации полимеразной цепной реакции (ПЦР), в том числе ПЦР с детекцией в режиме реального времени (ПЦР-РВ). Внедрение метода ПЦР в лабораторную практику стало одним из наиболее важных событий в клинической лабораторной диагностике. Достоинствами метода ПЦР являются высокая специфичность, чувствительность, универсальность процедуры, простота и удобство проведения анализа, автоматизация процессов, возможность выявления сразу нескольких патогенов в одной пробирке, при условии наличия в реакционной смеси нескольких пар соответствующих праймеров (мультиплексная ПЦР). Мультиплексный формат ПЦР-РВ сокращает трудоемкость, стоимость и продолжительность анализа.

Все МАНК включают три этапа:

- подготовка образца, обычно заключающаяся в выделении и концентрировании нуклеиновых кислот (НК), а также в освобождении от присутствующих в образце ингибиторов;

- ферментативная амплификация НК;

- выявление продуктов амплификации.

Известны научные публикации, в которых описано применение ПЦР для выявления и идентификации различных вирусов в биологических образцах (http://www.ncbi.nlm.nih.gov/pubmed/21256076" \o "Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology. - 2011-50(4) - P.308-313, J http://www.ncbi.nlm.nih.gov/pubmed/15645373" \o "Archives of virology. - 2005 - 150(6) - P.1175-1185, J Clin Microbiol. - 2004. - №42. - Р.1564-1569), а также ряд патентов (RU 2306341 C1, RU 2271003 C2, US 2006/0110724 A1, US 2007/0172835 A1, WO 2007/058499 A1, WO 2008/042450 A2). В перечисленных публикациях и патентах описаны различные форматы ПЦР, которые применяются для диагностики ОКИ, в том числе мультиплексная ПЦР с детекцией в агарозном геле, и ПЦР-РВ. Наиболее близкими аналогамим являются ПЦР-тест-системы, представленные в публикации Liu J. с соавторами (http://www.ncbi.nlm.nih.gov/pubmed/21256076" \o "Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology. - 2011-50(4) - P.308-313) и патенте WO 2008/042450 A2. Признаками, отличающими настоящее изобретение от перечисленных аналогов являются:

- нуклеотидные последовательности праймеров и зондов, приведенные в перечне последовательностей;

- принцип учета результатов ПЦР;

- возможность проведения дифференциальной диагностики энтеровирусов и полиовирусов;

- использование внутреннего положительного контроля, представленного РНК-содержащим вирусом, который добавляется непосредственно в клинический образец перед выделением нуклеиновых кислот и позволяет контролировать эффективность выделения НК и наличие ингибиторов.

Технической задачей изобретения является создание способа идентификации кишечных вирусов с помощью мультиплексного ПЦР-анализа с детекцией продуктов амплификации в режиме реального времени. Данный подход позволяет одновременно выявлять в биологических образцах нуклеиновые кислоты 11 групп кишечных вирусов, не прибегая к использованию дополнительных методов выявления ампликонов (электрофорез ДНК в агарозном геле, ДНК-микрочипы), тем самым сокращая риск контаминации продуктами амплификации и процент технологических ошибок. Мультиплексный формат ПЦР-РВ сокращает трудоемкость, стоимость и продолжительность анализа.

1. Указанная задача достигается за счет того, что способ дифференциальной диагностики кишечных вирусов, характеризующийся выявлением в клинических образцах нуклеиновых кислот основных возбудителей кишечных вирусных инфекций человека - энтеровирусов, полиовирусов, ротавирусов А и С, аденовирусов, норовирусов, саповирусов, вирусов гепатита А и Е, астровирусов, ортореовирусов в присутствии внутреннего положительного контроля, предусматривающий проведение мультиплексной реакции обратной транскрипции (ОТ) и ПЦР-амплификации с детекцией в режиме реального времени, причем в качестве клинических образцов используют по выбору: 10-20% фекальные экстракты, образцы культуральной жидкости, элюаты, полученные в результате концентрирования вирусов из образцов сточной, водопроводной, речной воды и воды из других источников, отличающийся тем, что для его осуществления используют олигонуклеотиды - SEQ ID NO 1-61, на основе которых готовят смеси праймеров и зондов для проведения ПЦР-РВ; затем с использованием подобранных праймеров и зондов формируют реакционные смеси для мультиплексной ОТ и ПЦР, в которых флуоресцентномеченные зонды распределяют по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями; затем проводят мультиплексную реакцию обратной транскрипции и мультиплексную ПЦР-РВ (каждый образец анализируется в пяти реакционных смесях); наличие в изучаемой пробе нуклеиновых кислот того или иного кишечного вируса определяют ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей; причем при проведении анализа проводят ряд контролей для исключения ложноположительных и ложноотрицательных результатов, для чего формируют пулы положительных контрольных образцов (ПКО), которые, наряду с внутренним положительным контролем (ВПК), анализируются при анализе каждой серии образцов, а в состав пулов положительных контролей входят нуклеиновые кислоты кишечных вирусов (КВ) или фрагменты геномов КВ, включающие области связывания праймеров для ОТ и ПЦР, полученные в реакции транскрипции (РНК-транскрипты), разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 25-30 цикле; в том случае, когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК - это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при выделении РНК или постановке реакции; такой образец анализируют повторно. Кроме того, для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в который, наряду со всеми исследуемыми и контрольными образцами вносится ВПК. В качестве ОКО используют дистиллированную воду. Кроме того, на стадии ПЦР с детекцией в режиме реального времени используют следующие олигонуклеотиды (распределенные по четырем реакционным смесям): смесь №1: SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12; смесь №2: SEQ ID NO 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27; смесь №3: SEQ ID NO 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46; смесь №4: SEQ ID NO 47, 48, 49, 50, 51, 52, 53; смесь №5: SEQ ID NO 54, 55, 56, 57, 58, 59, 60, 61. Кроме того, каждый вирусспецифический набор праймеров и зондов может быть использован для выявления в образцах нуклеиновых кислот соответствующих вирусов в моноспецифическом формате, в том числе для выявления аденовирусов - SEQ ID NO 1, 2, 3, 4; энтеровирусов - SEQ ID NO 5, 6, 7, 8; ротавирусов А - SEQ ID NO 13, 14, 15, 16, 17; норовирусов - SEQ ID NO 18, 19, 20, 21, 22, 23; астровирусов - SEQ ID NO 24, 25, 26, 27; саповирусов - SEQ ID NO 28, 29, 30, 31, 32, 33, 34, 35; ортореовирусов - SEQ ID NO 36, 37, 38, 39, 40, 41, 42, 43; ротавирусов С - SEQ ID NO 44, 45, 46; вируса гепатита Е - SEQ ID NO 47, 48, 49, 50; вируса гепатита А - SEQ ID NO 51, 52, 53, 54; полиовирусов - SEQ ID NO 55, 56, 57; 58, 59, 60, 61. Кроме того, анализ предусматривает выявление ВПК (SEQ ID NO 9, 10, 11, 12), представленного РНК-содержащим вирусом или РНК-транскриптом, с целью контроля эффективности и качества выделения нуклеиновых кислот, в том числе наличие в образце ингибиторов реакций обратной транскрипции и ПЦР. Кроме того, при анализе образцов в реакционных смесях №1 и №5, проводят дифференциальное выявление энтеровирусов и полиовирусов.

Способ позволяет дифференциально выявлять в биологических образцах нуклеиновые кислоты основных возбудителей ОКИ - энтеровирусов, полиовирусов, ротавирусов А и С, аденовирусов, норовирусов, саповирусов, вирусов гепатита А и Е, астровирусов, ортореовирусов. Наличие в изучаемой пробе нуклеиновых кислот того или иного кишечного вируса определяется ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей.

Способ может быть реализован на основе следующего перечня последовательностей.

Поставленная задача была решена путем подбора 12 наборов вирусспецифических праймеров (специфичные 11 кишечным вирусам и ВПК) для этапов анализа ОТ и ПЦР-РВ, а также формированием оптимальных реакционных смесей для проведения анализа. Выбор праймеров для ПЦР-РВ ограничивался несколькими критериями, такими как специфичность по отношению к геномным последовательностям вирусов соответствующей группы, высокая эффективность ПЦР, температура плавления не ниже 60°C, соотношение G/C в пределах от 40 до 70%, размер ПЦР-продуктов до 250 п.н.

Также были подобраны последовательности 17 гибридизационных зондов (по 1 или 2 на каждую группу вирусов, см. табл.1), нацеленных на область между праймерами. 5'-концевой нуклеотид каждого зонда модифицирован одним из 4 флуоресцентных красителей (FAM, ROX, R6G, Cy5 или аналогичными), а 3'-конец - одним из гасителей флуоресценции (BHQ1, BHQ2, BHQ3 или аналогичными). «Разгорание» флуоресцентного сигнала при накоплении специфического ампликона в процессе ПЦР-РВ происходит по принципу выщепления 5'-концевой метки зонда. Праймеры и зонды были направлены к следующим участкам вирусных геномов: АДВ - ген гексона, ЭВ - 5' NTR, РВА - сегмент 10, ген белка NSP4, НВ - ген белка VP1, АВ - ORF2, СВ - ORF1, ОРВ - сегмент 3, ген белка L1, РВС - сегмент 8, ген белка VP7, ПВ - ген белка VP1, ВГЕ - ORF1, ВГА - ген белка 2С.

Последовательности праймеров и зондов для ПЦР-РВ, соответствующие им расчетные размеры продуктов амплификации, выявляемые с их помощью вирусы и гены-мишени представлены в перечне последовательностей и в табл.1.

Таблица 1
Характеристика олигонуклеотидов для мультиплексной ПЦР-РВ.
Название Размер ПЦР-продукта, п.н. Выявляемый вирус, ген-мишень
SEQ ID NO 1 160 Аденовирусы, ген гексона
SEQ ID NO 2
SEQ ID NO 3
SEQ ID NO 4
SEQ ID NO 5 163 Энтеровирусы, 5'NTR
SEQ ID NO 6
SEQ ID NO 7
SEQ ID NO 8
SEQ ID NO 9 242 ВПК
SEQ ID NO 10
SEQ ID NO 11
SEQ ID NO 12
SEQ ID NO 13 130 Ротавирус А, сегмент 10, ген белка NSP4
SEQ ID NO 14
SEQ ID NO 15
SEQ ID NO 16
SEQ ID NO 17
SEQ ID NO 18 90 Норовирусы, ген белка VP1
SEQ ID NO 19
SEQ ID NO 20
SEQ ID NO 21
SEQ ID NO 22
SEQ ID NO 23
SEQ ID NO 24 165 Астровирусы, ORF2
SEQ ID NO 25
SEQ ID NO 26
SEQ ID NO 27
SEQ ID NO 28 116 Саповирусы, ORF1
SEQ ID NO 29
SEQ ID NO 30
SEQ ID NO 31
SEQ ID NO 32
SEQ ID NO 33
SEQ ID NO 34
SEQ ID NO 35
SEQ ID NO 36 146 Ортореовирусы, сегмент 3, ген белка L1
SEQ ID NO 37
SEQ ID NO 38
SEQ ID NO 39
SEQ ID NO 40
SEQ ID NO 41
SEQ ID NO 42
SEQ ID NO 43
SEQ ID NO 44 Ротавирус С, сегмент 8, ген белка VP7
SEQ ID NO 45
SEQ ID NO 46
SEQ ID NO 47 169 Вирус гепатита Е, ORF1
SEQ ID NO 48
SEQ ID NO 49
SEQ ID NO 50
SEQ ID NO 51 137 Вирус гепатита А, ген белка 2С
SEQ ID NO 52
SEQ ID NO 53
SEQ ID NO 54
SEQ ID NO 55 211 Полиовирус, ген белка VP1
SEQ ID NO 56
SEQ ID NO 57
SEQ ID NO 58
SEQ ID NO 59
SEQ ID NO 60
SEQ ID NO 61

С использованием подобранных праймеров и зондов сформированы 5 реакционных смесей для мультиплексной ОТ и ПЦР, которые включают оптимальные комбинации праймеров и зондов: смесь №1 - для выявления АДВ, ЭВ, ВПК; смесь №2 - РВА, НВ, АВ; смесь №3 - СВ, ОРВ, РВС; смесь №4 - ВГЕ, ВГА; смесь №5 - ПВ (табл.2). Флуоресцентномеченные зонды распределены по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями.

Таблица 2
Распределение вирусспецифических праймеров и зондов по реакционным смесям в мультиплексной ПЦР-РВ.
Краситель Реакционная смесь
№1 №2 №3 №4 №5
FAM АДВ РВА СВ - -
ROX ЭВ НВ - - ПВ
R6G ВПК АВ ОРВ ВГЕ -
Cy5 - - РВС ВГА -

Так как все перечисленные вирусы (кроме, аденовирусов) являются РНК-содержащими, то для их выявления необходимо проведение реакции обратной транскрипции (ОТ). В качестве праймеров для проведения мультиплексной реакции обратной транскрипции используют олигонуклеотиды, комплементарные фрагменту вирусного генома. Праймеры для проведения ОТ характеризуются температурой плавления ниже 59°C, но выше 45°C и особенностями первичной структуры, которые снижают вероятность отжига праймеров для ОТ на неспецифической РНК-матрице, увеличивая тем самым эффективность амплификации в образцах с высоким содержанием неспецифических НК. Смесь праймеров для проведения мультиплексной реакции ОТ содержит следующие праймеры в концентрации 2 пкмоль/реакцию каждого: SEQ ID NO 5, 9, 13, 20, 21, 24, 28, 29, 36, 37, 44, 48, 49, 51, 57, 58, 59.

Применение разработанной тест-системы на основе метода мультиплексной ПЦР-РВ подразумевает, что для анализа одного образца на наличие 11 кишечных вирусов, его необходимо проанализировать в 5-и реакционных смесях (табл.2). Наличие в изучаемой пробе нуклеиновых кислот того или иного кишечного вируса определяется ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей.

При проведении анализа предусмотрен ряд контролей для исключения ложноположительных и ложноотрицательных результатов. Для этого сформированы пулы положительных контрольных образцов (ПКО-1, ПКО-2, ПКО-3, ПКО-4, ПКО-5), которые, наряду с ВПК, анализируются при анализе каждой серии образцов и контролируют этапы ОТ и ПЦР-РВ. В состав пулов положительных контролей входят лабораторные штаммы кишечных вирусов и охарактеризованные клинические образцы или РНК-транскрипты фрагментов геномов вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 25-30 цикле. ПКО-1 содержит нуклеиновые кислоты АДВ, ЭВ, ВПК; ПКО-2 - РВА, НВ, АВ; ПКО-3 - СВ, ОРВ, РВС; ПКО-4 - ВГЕ, ВГА; ПКО-5 - ПВ. Положительные контрольные образцы разводят для того, чтобы контролировать возможность выявления вирусов в образцах с низким содержанием вируса. В каждый исследуемый образец включают ВПК, который при отсутствии ингибиторов должен определяться до 30 цикла амплификации. В том случае, когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК, либо он не выявляется - это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при постановке реакции. Такие образцы необходимо анализировать повторно. Таким образом, постановка ряда положительных контролей позволяет исключить ложноотрицательные образцы. Для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого используют дистиллированную воду.

Таким образом, сущность изобретения заключается в том, что разработан подход для одновременного выявления в клинических образцах нуклеиновых кислот основных возбудителей кишечных вирусных инфекций человека - энтеровирусов, полиовирусов, ротавирусов А и С, аденовирусов, норовирусов, саповирусов, вирусов гепатита А и Е, астровирусов, ортореовирусов в присутствии внутреннего положительного контроля. В качестве образцов для исследования могут быть использованы 10-20% фекальные экстракты, образцы культуральной жидкости, элюаты, полученные в результате концентрирования вирусов из образцов сточной, водопроводной, речной воды и воды из других источников.

Способ дифференциальной диагностики кишечных вирусных инфекций методом мультиплексной ПЦР с детекцией в режиме реального времени включает следующие этапы:

1) подготовка смесей праймеров, зондов для проведения ОТ и ПЦР-РВ и контрольных образцов (ВПК, ПКО-1, ПКО-2, ПКО-3, ПКО-4, ПКО-5 и ОКО);

2) выделение нуклеиновых кислот кишечных вирусов из исследуемых и контрольных образцов;

3) проведение мультиплексной реакции обратной транскрипции и мультиплексной ПЦР-РВ (каждый образец анализируется в пяти пробирках);

4) учет и интерпретация результатов анализа.

Этап 3 (проведение мультиплексной реакции обратной транскрипции и мультиплексной ПЦР-РВ) проводится в одном из трех вариантов.

1-й вариант - «Двухэтапная ОТ и ПЦР-РВ», предусматривающая последовательное проведение реакций ОТ и ПЦР в отдельных пробирках. После завершения реакции ОТ, часть продуктов ОТ (кДНК) переносится в пробирки, стрипы или 96-луночные ПЦР-планшеты для проведения ПЦР-РВ, в которые затем добавляется необходимое количество реакционной смеси для ПЦР-РВ.

2-й вариант - «Двухэтапная ОТ и ПЦР-РВ в одной пробирке», предусматривающая последовательное проведение реакций ОТ и ПЦР в одной пробирке. Реакция ОТ проводится в пробирках, стрипах или 96-луночных ПЦР-планшетах, пригодных для проведения ПЦР-РВ, в небольшом объеме. После завершения реакции ОТ в пробирки с продуктами реакции ОТ (кДНК) вносится реакционная смесь для проведения ПЦР-РВ.

3-й вариант - «Одноэтапная ОТ и ПЦР-РВ», предусматривающая проведение реакций ОТ и ПЦР в одной пробирке в реакционной смеси, изначально содержащей все необходимые компоненты для реакций ОТ и ПЦР-РВ. «Одноэтапная ОТ и ПЦР» представляет собой наиболее удобный и наименее трудоемкий вариант постановки ОТ и ПЦР.

Осуществление изобретения.

Пример 1. Выделение вирусных нуклеиновых кислот.

Суммарную нуклеиновую кислоту (НК) выделяют при помощи одного из коммерческих наборов: «QIAmp Viral RNA mini kit», (Qiagen, Германия), ZR Viral RNA Kit™ (Zymo Research, США), «РИБО-сорб» (ИнтерЛабСервис, Россия), либо других специализированных коммерческих наборов для одновременного выделения вирусной РНК и ДНК, руководствуясь инструкцией фирмы-производителя. В основе перечисленных коммерческих наборов лежат модификации метода выделения НК, предложенного Boom R. с соавторами [Boom R., et al. Rapid and simple method for purification of nucleic acids//J Clin Microbiol. - 1990. - №28. - P.495-503]. Перед выделением НК к каждому исследуемому образцу и ОКО добавляют 10 мкл ВПК.

Пример 2. Проведение ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ».

На первом этапе анализа в мультиплексной реакции ОТ получают кДНК, которая на этапе ПЦР служит матрицей для амплификации. В состав реакционной смеси для мультиплексной ОТ входят праймеры, которые вносят в пробирки, стрипы или планшеты для ПЦР в количестве 3 пкмоль каждого праймера (в объеме 5 мкл) на реакционную смесь.

В пробирки с праймерами добавляют по 10 мкл РНК, выделенной из исследуемых образцов, ПКО-1, ПКО-2, ПКО-3, ПКО-4 и ОКО, прогревают в течение 1 минуты при 95°C, затем охлаждают до комнатной температуры в течение 2-3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее, доводят объем реакционной смеси до 30 мкл, заранее приготовленной смесью, содержащей Буфер для M-MLV-ревертазы, дНТФ 0,15 мМ каждого, 30 ед. ревертазы вируса лейкоза Молони, и в течение 10 минут при 45°C получают кДНК. Все реагенты для реакции ОТ производства компании Синтол (Россия) или аналогичные. Для инактивации фермента смесь прогревают при 95°C в течение 5 минут и после охлаждения центрифугируют с целью осаждения конденсата. Далее, с образцами кДНК проводят ПЦР-РВ.

Реакцию мультиплексной ПЦР-РВ проводят в пробирках, стрипах или планшетах для ПЦР в объеме 50 мкл. Каждый образец анализируется в 5-и пробирках (реакционная смесь №1, №2, №3, №4 и №5), каждая из которых содержит реакционную смесь для ПЦР («Набор реагентов для проведения ПЦР-РВ с Taq ДНК-полимеразой и ингибирующими активность фермента антителами», кат. №М-428, «Синтол», Россия или аналогичную), соответствующий ПЦР-смеси набор праймеров (по 6 пмоль каждого праймера - табл.3) и набор зондов (по 5 пмоль каждого зонда - табл.3), 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами («СибЭнзим», кат. №E351, Россия или аналогичной) и 10 мкл кДНК. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. Программа ПЦР: 95°C - 90 сек - 1 цикл; 95˚C - 20 сек, 59°C - 35 cек - 45 циклов. Определение значений пороговых циклов осуществляют согласно руководству к прибору.

Таблица 3
Олигонуклеотиды, используемые в составе реакционных смесей в мультиплексной ПЦР-РВ
Название праймеров и зондов Реакционная смесь
№1 №2 №3 №4 №5
SEQ ID NO 1 SEQ ID NO 13 SEQ ID NO 28 SEQ ID NO 47 SEQ ID NO 55
SEQ ID NO 2 SEQ ID NO 14 SEQ ID NO 29 SEQ ID NO 48 SEQ ID NO 56
SEQ ID NO 3 SEQ ID NO 15 SEQ ID NO 30 SEQ ID NO 49 SEQ ID NO 57
SEQ ID NO 5 SEQ ID NO 17 SEQ ID NO 31 SEQ ID NO 50 SEQ ID NO 58
SEQ ID NO 6 SEQ ID NO 18 SEQ ID NO 32 SEQ ID NO 51 SEQ ID NO 59
SEQ ID NO 7 SEQ ID NO 19 SEQ ID NO 34 SEQ ID NO 52 SEQ ID NO 60
SEQ ID NO 9 SEQ ID NO 21 SEQ ID NO 35 SEQ ID NO 53
SEQ ID NO 10 SEQ ID NO 22 SEQ ID NO 36 SEQ ID NO 54
SEQ ID NO 11 SEQ ID NO 23 SEQ ID NO 37
SEQ ID NO 12 SEQ ID NO 24 SEQ ID NO 38
SEQ ID NO 25 SEQ ID NO 39
SEQ ID NO 26 SEQ ID NO 40
SEQ ID NO 27 SEQ ID NO 41
SEQ ID NO 33 SEQ ID NO 42
SEQ ID NO 43
SEQ ID NO 44
SEQ ID NO 45
SEQ ID NO 46

При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в пяти реакционных смесях на наличие НК 11 кишечных вирусов. Качество каждой реакционной смеси контролируют соответствующим ПКО и ОКО. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать по 60 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующий ПКО и ОКО, табл.4).

Таблица 4
Схема анализа 10 клинических образцов
Образцы после выделения НК 1 2 3 4 5 6 7 8 9 10 ПКО-1 ПКО-2 ПКО-3 ПКО-4 ПКО-5 ОКО
Реак. смесь №1 1 2 3 4 5 6 7 8 9 10 11 12
Реак. смесь №2 13 14 15 16 17 18 19 20 21 22 23 24
Реак. смесь №3 25 26 27 27 29 30 31 32 33 34 35 36
Реак. смесь №4 37 38 39 40 41 42 43 44 45 46 47 48
Реак. смесь №5 49 50 51 52 53 54 55 56 57 58 59 60

Пример 3. Проведение ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке».

Существенное отличие ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» от ПЦР-анализа в формате «Двухэтапная ОТ и ПЦР-РВ» заключается в отсутствии необходимости переноса кДНК из пробирок с продуктами ОТ, в отдельные пробирки для проведения ПЦР-РВ. Реакции ОТ и ПЦР-РВ проводят в одной пробирке (в пробирках, стрипах, планшетах, удовлетворяющих требованиям оборудования для проведения ПЦР-РВ). ПЦР-анализ в формате «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» проводят следующим образом. При постановке реакции ОТ смеси праймеров вносят в пробирки, стрипы или планшеты для ПЦР в количестве 2 пкмоль каждого праймера (в объеме 5 мкл) на реакционную смесь. В пробирки с праймерами добавляют по 10 мкл РНК, выделенной из исследуемых образцов, ПКО-1, ПКО-2, ПКО-3, ПКО-4, ПКО-5 и ОКО и прогревают в течение 1 минуты при 95°C, затем охлаждают до комнатной температуры в течение 2-3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее доводят объем реакционной смеси до 25 мкл, заранее приготовленной смесью для ОТ, содержащий реакционную смесь для проведения ПЦР-РВ (кат. №М-428, Синтол, Россия, или аналогичную), 30 ед. ревертазы вируса лейкоза Молони, и в течение 10 минут при 45°C получают кДНК. Для инактивации фермента смесь прогревают при 95°C в течение 5 минут.

После стадии ОТ образцы центрифугируют с целью осаждения конденсата. К образцам кДНК добавляют реакционную смесь для ПЦР-РВ (кат. №М-428, Синтол, Россия, или аналогичную), соответствующий ПЦР-смеси набор праймеров (по 6 пмоль каждого праймера - табл.3) и набор зондов (по 5 пмоль каждого зонда - табл.3), 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами («СибЭнзим», кат. №E351, Россия или аналогичной), доводя общий объем смеси до 50 мкл, и проводят реакцию ПЦР-РВ. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в пяти реакционных смесях в присутствии контрольных образцов. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать 60 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующий ПКО и ОКО, табл.4).

Пример 4. Проведение ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ».

При постановке ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ» используются те же исходные реагенты, что и в примере 3. Существенным отличием ПЦР-анализа в формате «Одноэтапная ОТ и ПЦР-РВ» от ПЦР-анализа в форматах «Двухэтапная ОТ и ПЦР-РВ» и «Двухэтапная ОТ и ПЦР-РВ в одной пробирке» заключается в отсутствии необходимости открывания пробирок с продуктами ОТ с целью внесения реакционной смеси для ПЦР-РВ, так как в реакционной смеси изначально присутствуют все необходимые компоненты для реакций ОТ и ПЦР-РВ.

Смеси праймеров вносят в пробирки, стрипы или планшеты, удовлетворяющие требованиям оборудования для проведения ПЦР-РВ, в количестве 2 пкмоль каждого праймера на реакционную смесь (в объеме 5 мкл). В пробирки с праймерами добавляют в соответствии со схемой эксперимента (табл.4) по 10 мкл исследуемой РНК, ПКО-1, ПКО-2, ПКО-3, ПКО-4, ПКО-5 и ОКО, и прогревают в течение 1 минуты при 95ºС, затем охлаждают до комнатной температуры в течение 2-3 минут. Пробирки с образцами центрифугируют с целью осаждения конденсата. Далее доводят объем реакционной смеси до 50 мкл, заранее приготовленной смесью, содержащей реакционную смесь для ПЦР (кат. №М-428, Синтол, Россия, или аналогичную), соответствующий ПЦР-смеси набор праймеров (по 6 пмоль каждого праймера - табл.3) и набор зондов (по 5 пмоль каждого зонда - табл.3), 30 ед. ревертазы вируса лейкоза Молони, 2,5 ед. Taq ДНК полимеразы с ингибирующими активность фермента антителами. Реакцию проводят в одном из перечисленных ниже термоциклеров: ДТ-96 (ДНК-Технология, Россия), АНК-32 (НИИ аналитического приборостроения РАН, Россия), Rotor-Gene™ 6000 (Corbett Research, Австралия), ICycler IQ5, Bio-Rad (США) или аналогичном. Программа для проведения одноэтапной ОТ и ПЦР-РВ: 45°C - 5 мин, 95°С - 120 сек - 1 цикл; 95°С - 20 сек, 59°С - 35 cек- 45 циклов. Определение значений пороговых циклов осуществляют согласно руководству к прибору. При планировании анализа следует учитывать, что каждый исследуемый образец анализируется в четырех реакционных смесях в присутствии контрольных образцов. Например, для того чтобы проанализировать 10 клинических образцов, на стадии ОТ и ПЦР нужно использовать 60 пробирок - по 12 на каждую реакционную смесь (10 исследуемых образцов, соответствующий ПКО и ОКО, табл.4).

Пример 5. Учет и интерпретация результатов анализа.

Учет результатов анализа, расчет пороговых циклов производят с помощью программного обеспечения к тому прибору для ПЦР-РВ, на котором проводился анализ, руководствуясь инструкцией производителя. Положительным считается образец, при анализе которого наблюдается рост флуоресцентного сигнала на одном из цветовых каналов амплификатора. Для интерпретации результатов анализа следует пользоваться таблицей 2. Например, при анализе образца в смеси №2 рост сигнала на канале FAM свидетельствует о присутствии в образце НК ротавируса А, на канале R6G - норовируса, ROX - астровируса. При анализе клинических образцов положительными считаются образцы, которые определяются до 33 цикла амплификации. Если образец выявляется на более позднем цикле, но при этом значения пороговых циклов ПКО и ВПК - в пределах нормы, а отрицательный контроль не определяется - он считается спорным и анализируется повторно. Если при повторной постановке результат сохраняется - образец считается положительным. Следует обращать внимание на значения пороговых циклов для ПКО и ВПК. В состав ПКО входят НК лабораторных штаммов и охарактеризованных образцов кишечных вирусов или РНК-транскрипты фрагментов геномов кишечных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 25-30 цикле. Также в каждое исследование включают ВПК, который при отсутствии ингибиторов должен определяться на 27-30 циклах амплификации. Если при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК, например, вместо 27-30 цикла он определяется на 35-37, либо не определяется совсем - это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, на ошибки при постановке реакции или при выделении НК. Такой образец должен быть проанализирован повторно со стадии выделения НК. Таким образом, постановка контролей с ПКО и ВПК позволяет исключить ложноотрицательные результаты исследования. Для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого можно использовать дистиллированную воду.

Пример 6. Дифференциальное выявление энтеровирусов и полиовирусов.

Энтеровирусы и полиовирусы по современной классификации относятся к одному роду (Enterovirus) семейства Picornaviridae и, следовательно, являются филогенетически-родственными вирусами. Праймеры и зонды для выявления энтеровирусов в реакции ОТ и ПЦР-РВ направлены к высококонсервативному для всего семейства 5'-нетранслируемому участку генома, таким образом олигонуклеотиды для выявления энтеровирусов выявляют и полиовирусы, что затрудняет интерпретацию результатов анализа. Для дифференциальной диагностики полиовирусов и энтеровирусов необходимо пользоваться следующими правилами.

1. Если отмечается одновременное нарастание сигнала флуоресценции на канале R6G в реакционной смеси №1 и смеси №5, либо только на канале R6G в смеси №5, то такой образец считать положительным по полиовирусу.

2. Если рост флуоресцентного сигнала наблюдается только в смеси №1 на канале R6G, то такой образец считать положительным по энтеровирусу.

1. Способ дифференциальной диагностики кишечных вирусных инфекций, характеризующийся выявлением и идентификацией в клинических образцах и элюатах, полученных в результате концентрирования из воды, одиннадцати групп кишечных вирусов: энтеровирусов (ЭВ), полиовирусов (ПВ), ротавирусов А и С (РВА и РВС соответственно), аденовирусов (АДВ), норовирусов (НВ), саповирусов (СВ), вирусов гепатита А и Е (ВГА и ВГЕ соответственно), астровирусов (АВ), ортореовирусов (ОРВ) в присутствии внутреннего положительного контроля (ВПК), предусматривающий проведение мультиплексной реакции обратной транскрипции и ПЦР-амплификации с детекцией в режиме реального времени, причем в качестве клинических образцов используют по выбору: 10-20% фекальные экстракты, образцы культуральной жидкости, элюаты, полученные в результате концентрирования вирусов из образцов сточной, водопроводной, речной воды и воды из других источников, отличающийся тем, что для его осуществления используют олигонуклеотиды - SEQ ID NO 1-61 на основе которых готовят смеси праймеров, зондов для проведения ПЦР-РВ; затем с использованием подобранных праймеров и зондов формируют реакционные смеси для мультиплексной ОТ и ПЦР-РВ, в которых олигонуклеотиды распределены по реакционным смесям следующим образом: смесь №1: SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12; смесь №2: SEQ ID NO 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27; смесь №3: SEQ ID NO 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46; смесь №4: SEQ ID NO 47, 48, 49, 50, 51, 52, 53, 54; смесь №5: SEQ ID NO 55, 56, 57, 58, 59, 60, 61, причем флуоресцентномеченные зонды распределяют по реакционным смесям таким образом, чтобы в одной смеси находились зонды, меченные разными красителями в соответствии с таблицей:

Краситель Реакционная смесь
№1 №2 №3 №4 №5
FAM АДВ РВ СВ - -
А
ROX ЭВ НВ - - ПВ
R6G ВПК АВ ОР В -
В ГЕ
Су5 - - РВ В -
С ГА

затем проводят мультиплексную реакцию обратной транскрипции и мультиплексную ПЦР-РВ (каждый образец анализируется в четырех реакционных смесях); наличие в изучаемой пробе нуклеиновых кислот того или иного кишечного вируса определяют ростом сигнала флуоресценции определенного красителя в одной из реакционных смесей; причем при проведении анализа проводят ряд контролей для исключения ложноположительных и ложноотрицательных результатов, для чего формируют пулы положительных контрольных образцов (ПКО), которые, наряду с внутренним положительным контролем (ВПК), анализируются при анализе каждой серии образцов, а в состав пулов положительных контролей входят нуклеиновые кислоты кишечных вирусов или РНК-транскрипты фрагментов геномов кишечных вирусов, разведенные и смешанные в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 25-30 цикле; причем при анализе клинических образцов положительными считают образцы, которые определяются до 33 цикла амплификации, если образец выявляется на более позднем цикле, но при этом значения пороговых циклов ПКО и ВПК - в пределах нормы, а отрицательный контроль не определяется - он считается спорным и анализируется повторно; образец анализируют повторно и в том случае, когда при постановке ПЦР-РВ наблюдается задержка в значениях пороговых циклов ВПК - это указывает на возможное присутствие ингибиторов в пробе, которые снизили чувствительность анализа, или на ошибки при выделении РНК или постановке реакции.

2. Способ по п.1, отличающийся тем, что каждый вирусспецифический набор праймеров и зондов используют для выявления в образцах нуклеиновых кислот соответствующих вирусов в моноспецифическом формате, в том числе для выявления аденовирусов - SEQ ID NO 1, 2, 3, 4; энтеровирусов -SEQ ID NO 5, 6, 7, 8; ротавирусов A - SEQ ID NO 13, 14, 15, 16, 17; норовирусов - SEQ ID NO 18, 19, 20, 21, 22, 23; астровирусов - SEQ ID NO 24, 25, 26, 27; саповирусов - SEQ ID NO 28, 29, 30, 31, 32, 33, 34, 35; ортореовирусов - SEQ ID NO 36, 37, 38, 39, 40, 41, 42, 43; ротавирусов С -SEQ ID NO 44, 45, 46; вируса гепатита E -SEQ ID NO 47, 48, 49, 50; вируса гепатита A - SEQ ID NO 51, 52, 53, 54; полиовирусов - SEQ ID NO 55, 56, 57; 58, 59, 60, 61.

3. Способ по п.1, отличающийся тем, что для исключения ложноположительных результатов наряду со всеми образцами анализируют отрицательный контрольный образец (ОКО), в качестве которого используют дистиллированную воду.

4. Способ по п.1, отличающийся тем, что анализ предусматривает выявление внутреннего положительного контроля (ВПК), представленного РНК-содержащим вирусом или РНК-транскриптом фрагмента генома вируса с целью контроля эффективности и качества выделения нуклеиновых кислот, в том числе для выявления в образце ингибиторов реакций обратной транскрипции и ПЦР-РВ, и для исключения ложноотрицательных результатов.

5. Способ по п.1, отличающийся тем, что для исключения ложноотрицательных результатов анализ предусматривает выявление для каждой ПЦР-смеси соответствующего пула положительных контрольных образцов (ПКО), представляющего собой смесь нуклеиновых кислот кишечных вирусов или РНК-транскриптов фрагментов геномов кишечных вирусов, разведенных и смешанных в определенной концентрации так, чтобы в мультиплексной ПЦР-РВ они определялись на 25-30 цикле.

6. Способ по п.1, отличающийся тем, что при анализе образцов в реакционных смесях №1 и №5 проводят дифференциальное выявление энтеровирусов и полиовирусов.

7. Набор для осуществления способа дифференциальной диагностики кишечных вирусных инфекций по п.1 включает праймеры и зонды для мультиплексной ПЦР-РВ со следующими нуклеотидными последовательностями:
5'-3'
SEQ ID NO 1 CTCCAGCAACTTCATGTCYATGGG
SEQ ID NO 2 CACTCTGACCACGTCGAARACTTC
SEQ ID NO 3 CGCACRACGTCGAAAACTTC
SEQ ID NO 4 FAM-AGGGTGGGCTCRTCCATGGGRTCCA-BHQ1
SEQ ID NO 5 GGATGGCCAATCCA
SEQ ID NO 6 CTCCGGCCCCTGAAT
SEQ ID NO 7 RATTGTCACCATAAGCAGCC
SEQ ID NO 8 R6G-GCGGAACCGACTACTTTGGGTGTCCG-BHQ1
SEQ ID NO 9 CAGGACTATGAAAACCATTTAC
SEQ ID NO 10 AAGCTGTTCAGTCACTGCTATACC
SEQ ID NO 11 TGCAGGATTGATTGTGGC
SEQ ID NO 12 ROX-CTGATCTAGCTGAACTGAGACTTGCTTTC-BHQ2
SEQ ID NO 13 AWGGAAAATACGCCAT
SEQ ID NO 14 CTGTTCCGAGAGAGCGC
SEQ ID NO 15 GGAAAATACGCCATTCCWGG
SEQ ID NO 16 FAM-CGGAAAGATGGAWAAGCTTGCCGACC-BHQ1
SEQ ID NO 17 FAM-CGGAAAGATGGAAAAGTTTACCGACC-BHQ1
SEQ ID NO 18 CAATGTTCAGRTGGATGAGRTTCTC
SEQ ID NO 19 ATGTTCCGCTGGATGCG
SEQ ID NO 20 TCGACGCCATCTTCATTCAC
SEQ ID NO 21 TCCTTAGACGCCATCATCATTTAC
SEQ ID NO 22 R6G-TGGGAGGGCGATCGCAATCT-BHQ1
SEQ ID NO 23 R6G-GAGATCGCRATCTCCTGCCCGA-BHQ1
SEQ ID NO 24 CTAGCCATCACACTYCTTT
SEQ ID NO 25 GTTGCTTGCTGCGTTCATG
SEQ ID NO 26 CTAGCCATCACACTYCTTTGGTCC
SEQ ID NO 27 ROX-CTCACAGAAGAGCAACTCCATCGCATTTG-BHQ2
SEQ ID NO 28 CAACAGCCARCTCCA
SEQ ID NO 29 CCATTGCAAGTTCCA
SEQ ID NO 30 AATGTSAACTAYGACCAGGCT
SEQ ID NO 31 AACACCAACTATGACCAGGC
SEQ ID NO 32 RAATACAAATTTTGATTTGGCC
SEQ ID NO 33 CCCTCCATYTCAAACACTAWTTTG
SEQ ID NO 34 FAM-TYGTAGGTGGCGAGAGCCTGG-BHQ1
SEQ ID NO 35 FAM-TTGTAGGTGGCGAGGGCCAAA-BHQ1
SEQ ID NO 36 ATGACTGCGACTGGAG
SEQ ID NO 37 ATGACGGCGACTG
SEQ ID NO 38 ATGACTGCGACTGGAGTTGC
SEQ ID NO 39 ATGACGGCGACTGGG
SEQ ID NO 40 GATGAGTTGACGCACCACG
SEQ ID NO 41 GATGAATTAACGTACGACAGCC
SEQ ID NO 42 ROX-ACGGTCAGCATGAGTCTACCGTGG-BHQ2
SEQ ID NO 43 ROX-ACGGTCAGCGTGAGTCTACCATGG-BHQ2
SEQ ID NO 44 GAAGCTGTCTGACAAACTGGTC
SEQ ID NO 45 GTATCAGTTATTAGGTGGAACATTTTTCTA
SEQ ID NO 46 Cy5-ATGGTTTGTACAACATTGTACACTGTTTGCG-
BHQ3
SEQ ID NO 47 CGAYGCCATGGAGGCC
SEQ ID NO 48 CTGCCGGGGYTGCAT
SEQ ID NO 49 AGCTGSCGAGGTTGCAT
SEQ ID NO 50 ROX-ACYACCACAGCATTCGCCAAGGCGGA-BHQ2
SEQ ID NO 51 ATTGCATCATTTGTTTTAGC
SEQ ID NO 52 GTGTCAGGATGYCCAATGAGA
SEQ ID NO 53 CGATCAATTGCTTCCTTAACATAAAC
SEQ ID NO 54 Cy5-GGAGARGAAAAATGYCTGCCCTTCTCCTCAAG-
BHQ3
SEQ ID NO 55 AGAGAGATGGACATCCTBGG
SEQ ID NO 56 AAGAGTATGAGCATGCTGGG
SEQ ID NO 57 GAGTGTGCTGGWCCACTGG
SEQ ID NO 58 GAATGCGCCGGGCCACT
SEQ ID NO 59 GARTGGGCTGGACCRCT
SEQ ID NO 60 R6G-CGCACRCTGAARTCATTACACGCTGACAC-BHQ1
SEQ ID NO 61 R6G-CGCACGCTGAAATCGTTACAYGCTGACAC-BHQ1
где:
FAM, ROX, R6G, Cy5 - флуоресцентные красители; BHQ1, BHQ2, BHQ3 - гасители флуоресценции; R-A или G, Y-C или T, S-G или С, W-T или А, В-С, G и Т.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к способу и диагностическому набору для диагностики коклюша и определения авирулентных мутантов возбудителя коклюша.

Изобретение относится к способу получения новых соединений-диад (I) с двумя разными, не сопряженными друг с другом, хромофорными фрагментами, содержащими азогруппы и остатки ферроцена, и их использованию для тушения флуоресценции флуорофоров. где Fc - ферроценил; R1 - Н или Fc; R2 - H или орто- или пара-гидрокси-; R3 - орто- или мета-, или пара-нитро-, или орто- или мета-, или пара-нитрофенилазо-, или пара-N,N-диметиламино-, или пара-карбокси-; L - группа пара-карбамоилвинилиденацетофенона или пара-карбоксамидовинилиденацетофенона, или пара-N-(2-карбамоилэтил)-карбоксамидовинилиденацетофенона, или пара-(4-[метиламино]бутокси)-винилиденацетофенона, или N,N-ди[4{1-(пара-винилиденацетофениламино)-метил-1,2,3-триазолил}бутил]аминогруппа.

Изобретение относится к области молекулярной биологии. Предложены способ, композиция и применение полярного апротонного растворителя с циклической основной структурой для гибридизации последовательностей нуклеиновых кислот.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты.

Изобретение относится к области биотехнологии. Раскрыты способы, композиции и наборы для диагностики остеоартрита у животных семейства кошачьих.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для выявления генетического материала (РНК) коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом (ТОРС).

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен способ выявления воспалительного заболевания кишечника млекопитающего посредством детекции повышенной экспрессии генов LY6 в желудочно-кишечных тканях или клетках по сравнению с контролем.

Изобретение относится к области биотехнологии, а именно к способу получения терапевтического агента для лечения клещевого энцефалита людей. Способ включает получение аптамеров, которые способны образовывать комплекс с третичной структурой поверхностного белка вируса.
Изобретение относится к области биотехнологии. Тест-система для обнаружения РНК вируса блютанга 14-го серотипа путем проведения полимеразной цепной реакции в реальном времени включает олигонуклеотидные праймеры и ДНК-зонд, комплементарные участкам вариабельного 2-го сегмента, имеющие следующий нуклеотидный состав (5'-3'): 14/2/qf GCT GTC GGG TAT AGG TAG GA; 14/2/z FAM - GTG AAC GTG GGG TCA TCT TCA С - BHQ1; 14/2/qr ACG TGT CCG ATG CTG СТА TC.
Изобретение относится к области медицины, в частности молекулярной биологии и онкологии, и касается системы маркеров, представляющую собой группу генов микроРНК: miR-129-2, miR-125b1, miR-137 и miR-375, для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному. Выявление метилирования по крайней мере одного маркера из этой системы служит диагностическим признаком. Система маркеров позволяет выявить немелкоклеточный рак легкого на ранних клинических стадиях заболевания с высокой клинической чувствительностью и специфичностью. 4 табл., 3 пр.

Изобретение относится к области генетики, медицины и молекулярной биологии. Предложен способ определения трисомии хромосом плода, где из плазмы беременных женщин выделяют внеклеточную ДНК, подвергают её бисульфидной конвертации с последующей ПЦР и дальнейшему массовому параллельному секвенированию дифференциально метилированных участков; в качестве контроля дифференциально метилированных участков используют участки с различным уровнем метилирования у матери и плода, анализируют данные путем определения отношения количества чтений, полученных при секвенировании дифференциально метилированных участков ДНК на целевой и контрольной хромосомах, где в случае трисомии, при константном количестве чтений ДНК плода, картированных на дифференциально метилированных участках хромосом, будет наблюдаться количество чтений, картированных на целевую хромосому к количеству чтений на контрольных хромосомах, равное 3/2, тогда как в норме это отношение будет постоянным и равным 1. Способ может быть использован в медицине для пренатальной диагностики генетических болезней плода. 2 з.п. ф-лы, 1 табл.

Изобретение относится к области биотехнологии и касается способа видовой идентификации лактобацилл L.casei/paracasei, L.fermentum, L.plantarum, L.rhamnosus. Предлагаемый способ включает постановку реакции ПЦР с видоспецифическими праймерами, причем конструируют праймеры, специфичные к первому гену оперона F1F0 АТФ синтазы (гену субъединицы а) и предшествующего ему гена урацилфосфорибозилтрансферазы для L.casei/paracasei и L.rhamnosus и гена урацилтранспортного белка для L.plantarum и L. fermentum. Представленное решение может быть использовано для идентификации видов лактобацилл в различных образцах микрофлоры человека и животных, в фармацевтических препаратах и в продуктах питания. 1 з.п. ф-лы, 1 ил., 3 табл.
Изобретение относится к молекулярной биологии и генетике клетки. Предложен способ, включающий этапы предварительной экстракции геномной ДНК, выделения специфической фракции однонитевых G-оверхенгов теломерной ДНК и последующей амплификации их минусовой цепи с дуплекс-специфическим анализом, причем этапы амплификации включают модификацию 3'-концов теломерных оверхенгов с помощью терминальной дезоксинуклеотидилтрансферазы и осуществляются с использованием набора праймеров SEQ ID NO: 1-5. Дуплекс-специфический анализ основан на гибридизации минусовых цепей оверхенгов с набором специфических флуоресцентно-меченных зондов SEQ ID NO: 6-11, соответствующих шести возможным вариантам нуклеотидных окончаний G-цепи теломерной ДНК человека. Степень разгорания зондов в присутствии фермента дуплекс-специфической нуклеазы служит критерием присутствия соответствующего варианта нуклеотидного окончания и мерой его количественного содержания. Полученные профили терминальных нуклеотидов G-цепи теломерной ДНК служат пролиферативными маркерами, указывающими на степень активации деления клетки и определяющими временную продолжительность клеточного цикла. Изобретение является новой разновидностью ДНК-диагностики, предназначено для выявления изменений нуклеотидных окончаний ДНК теломерных областей хромосом, происходящих в ходе клеточного цикла, и может быть использовано в медицине для диагностики и лечения онкологических заболеваний, в иммунологии, трансплантологии, косметологии, дерматологии, геронтологии, клеточной биотехнологии и других областях, заинтересованных в оценке пролиферативного статуса клетки и методах его направленного регулирования. 3 н. п. и 12 з. п. ф-лы, 9 ил., 8 табл., 5 пр.

Изобретение относится к молекулярной генетике. Способ включает: получение кДНК EML4-ALK с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) на матрице РНК гена EML4-ALK с использованием специфичных праймеров; амплификацию фрагментов гена EML4-ALK методом мультиплексной ПЦР на матрице кДНК, полученной на первом этапе ОТ-ПЦР, с помощью набора высокоспецифичных праймеров; получение флуоресцентно-меченого ПЦР-продукта на втором этапе ОТ-ПЦР; создание биочипа для анализа транслокаций EML4-ALK, содержащего набор иммобилизованных зондов; гибридизацию флуоресцентно-меченого ПЦР-продукта с зондами в гелевых ячейках на пластиковой подложке биочипа; регистрацию и интерпретацию результатов гибридизации. Способ предусматривает использование технологии ДНК-биочипов, сконструированных с целью определения 6 вариантов транслокаций EML4-ALK (V2, V3, V5, V4, V7, V1). Способ обладает высокой чувствительностью и специфичностью, универсален, его осуществление возможно с операционным материалом и опухолевой тканью, заключенной в парафиновые блоки; регистрацию результатов производят однократно в конце исследования, способ занимает менее 24 часов. 2 з.п. ф-лы, , 3 табл., 3 ил.

Изобретение относится к паразитологии и касается способа видовой ДНК-дифференциации гельминтов - возбудителей церкариального дерматита человека. Дифференциацию четырех видов Trichobilharzia: Т. szidati, T.regenti, T.franki и T.sp.var.narochanica осуществляют путем амплификации участков последовательности ядерной рибосомальной ДНК (рДНК) в образцах половозрелых гельминтов, их личиночной стадии и/или на рДНК инфицированных указанными гельминтами пресноводных моллюсков из семейства Lymnaeidae с помощью ПЦР и четырех олигонуклотидных праймеров следующего состава: F: 5'-CTTTCCATCTATCACGATGCACT-3' R1: 5'-ATGATAATGTGCATAACACACC-3' R2: 5'-GCCGTTTATTTATATGTATGTG-3' R3: 5'-CAAGCCGTTTATTWATATATAACGG-3'. Полученные амплификационные продукты визуализируют и дифференцируют и идентифицируют по размеру (длине), причем один амплификационный фрагмент размером 255 п.н. характерен для вида T.regenti, один фрагмент длиной 316 п.н. характерен для вида Т.szidati, два фрагмента размером 255 и 316 п.н. характерны для вида T.sp.var.narochanica, а амплификационный фрагмент размером 258 п.н. детектируется только у вида T.franki. Представленный способ позволяет одновременно детектировать и проводить видовую идентификацию четырех видов птичьих шистосом рода Trichobilharzia на разных стадиях жизни. 2 ил., 2 табл., 2 пр.

Группа изобретений относится к области молекулярной биологии и электрохимии. По первому варианту способ осуществляют путем регистрации циклических вольтамперограмм рабочего электрода, модифицированного углеродными нанотрубками с нековалентно иммобилизованным на их поверхности олигонуклеотидным зондом, до и после внесения в исследуемый раствор образца нуклеиновой кислоты и по изменению емкостной характеристики делают вывод о наличии или отсутствии в образце участка, комплементарного олигонуклеотидному зонду. Второй вариант способа отличается тем, что нековалентную иммобилизацию олигонуклеотидного зонда на поверхность нанотрубок осуществляют посредством якорной группы, предварительно введенной в зонд. В этом варианте регистрируют не только изменение площади вольтамперограмм от цикла к циклу, но и появление специфического пика на циклической вольтамперограмме, связанного с фиксацией детектируемой НК в комплексе с модифицированным зондом. Интенсивность пика на циклической вольтамперограмме пропорциональна концентрации определяемой НК, что позволяет проводить количественную оценку. Устройство для реализации способа детекции специфических последовательностей нуклеиновых кислот представляет собой электрохимический, анализатор, который состоит из трехэлектродной электрохимической ячейки, электроды которой соединены с регистрирующим устройством, а рабочий электрод выполнен из кремниевой подложки, модифицированной вертикально ориентированными углеродными нанотрубками с иммобилизированным олигонуклеотидным зондом, комплементарным определяемой НК. 3 н. и 5 з.п. ф-лы, 5 ил., 4 пр.

Изобретение относится к биотехнологии и представляет собой способ диагностики чувствительности М. tuberculosis (МБТ) к инъекционным противотуберкулезным препаратам резервного ряда. Способ включает этап выделения ДНК, амплификацию исследуемых участков ДНК методом полимеразной цепной реакции и анализ конформационного полиморфизма одноцепочечных фрагментов (SSCP). Амплифицируют участок гена rrs в 50 мкл реакционной смеси с внесением 5 мкл образца. Амплифицируют промоторную область гена eis в 30 мкл реакционной смеси, содержащей прямой 5'CGGAGCCGTCGGGGTATGC и обратный 5'GCCGCGGCCAGTAGGAACA праймеры и 3 мкл образца по программе амплификации: 1-ый этап - 95°- 4 мин; 2-ой этап - 95° - 20 сек, 59° - 30 сек, 72° - 20 сек (30 циклов); 3-ий этап: 72° - 4 мин; 10° - хранение. Разделение продуктов амплификации в соотношении 4 мкл образца и 6 мкл денатурирующего красителя проводят электрофорезом в 8% полиакриламидном геле с 5% глицерином при напряжении 400 вольт в течение 5 часов при 8°C. Окраску геля проводят с помощью азотнокислого серебра. Предложенное изобретение позволяет диагностировать чувствительность М. tuberculosis (МБТ) к инъекционным противотуберкулезным препаратам резервного ряда с высокой точностью. 2 ил.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностических исследованиях, направленных на выявление возбудителей острых кишечных инфекций (ОКИ). Предложен набор дифференцирующих олигонуклеотидов (зондов), обеспечивающий возможность определения в биологическом образце ДНК патогенных микроорганизмов, вызывающих ОКИ, и их видовой идентификации, где указанные микроорганизмы относятся к группе, включающей Shigella spp. и Enteroinvasive E.coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis, Klebsiella pneumoniae. Описано конструирование биочипа с иммобилизованным на нем набором зондов по изобретению, предназначенного для проведения экспресс-анализа возбудителей ОКИ в клинических образцах и материале, полученном из объектов окружающей среды. 2 н.п. ф-лы, 4 табл., 2 ил., 5 пр.

Изобретение относится к области онкологии и молекулярной биологии. Предложен способ определения чувствительности клеток немелкоклеточного рака легких к действию препаратов, реактивирующих р53 белок, включающий выделение РНК из образцов, синтез кДНК генов CDKN1A, BTG2 и E2F1 методом обратной транскрипции и полимеразной цепной реакции с детекцией результатов в режиме реального времени с последующим определением соотношения количества кДНК гена E2F1 к количеству кДНК гена CDKN1A или гена BTG2, где при величине соотношения E2F1/CDKN1A>3 или E2Fl/BTG2>1,5 считают клетки немелкоклеточного рака легких чувствительными к препаратам, реактивирующим белок р53. Изобретение может быть использовано при лечении онкологических заболеваний. 3 ил., 3 табл., 1 пр.
Наверх