Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации рнк коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом



Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации рнк коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации рнк коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом

 


Владельцы патента RU 2504585:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для выявления генетического материала (РНК) коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом (ТОРС). Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного ДНК-зонда для идентификации коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом, содержит пару внутренних и один внешний олигонуклеотиды, обладающие активностью прямого и обратного праймеров в полимеразной цепной реакции, а также флуоресцентно-меченный ДНК-зонд, имеющие следующую структуру: внешний обратный праймер

NR: 5`-CTTTTGGCAATGTTGTK(G/T)CCTT-3`; внутренние прямой (F) и обратный (R) праймеры 5`→3` F: 5`-AAAATGTCTGATAATGGACCCC-3` и R: 5`-ACCACCACGAR(A/G)CTCGTCG-3`; флуоресцентно-меченный ДНК-зонд

Z: 5`-TY(C/T)CACCAAATGTAATGCGGGG-3`. Набор праймеров и зонд позволяют идентифицировать коронавирус человека, ассоциированный с ТОРС, а также коронавирусы, подобные ТОРС-коронавирусу человека, выделенные от пальмовых циветт, енотовых собак и плодоядных летучих мышей методом ПЦР в реальном времени с получением более продолжительного амплифицированного фрагмента NP-гена коронавируса (513 п.н.). 2 ил., 5 табл., 2 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для выявления генетического материала (РНК) коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом (ТОРС), в клинических образцах, секционных пробах, образцах окружающей среды, культуральных вируссодержащих жидкостях и прочих биопрепаратах с целью постановки диагноза, коррекции лечения, эпидемиологического расследования, а также для решения научно-исследовательских задач по мониторингу и изучению свойств коронавируса, созданию диагностических, профилактических и лечебных препаратов и может быть использовано в медицине, биотехнологии и эпидемиологии.

При помощи разработанных диагностических праймеров и флуоресцентно-меченного зонда возможно выявление генетического материала (РНК) коронавируса, ассоциированного с ТОРС.

Метод обратно-транскриптазной полимеразной цепной реакции (ОТ-ПЦР) с детекцией продуктов амплификации в режиме реального времени обладает высокой чувствительностью и является основным методом выявления вирусной РНК. Метод ОТ-ПЦР основан на получении комплементарной ДНК (кДНК) на матрице вирусной РНК с последующим многократным избирательным удвоением участка кДНК. Амплифицируемый участок кДНК, являясь маркерным, позволяет выявить вирусный агент в исследуемом образце. Для эффективного проведения ОТ-ПЦР в режиме реального времени необходимы флуоресцентно-меченный ДНК-зонд и ДНК-затравки - праймеры (синтетические олигонуклеотиды), строго специфичные к кДНК вирусного генома. Сложность выбора праймеров и зонда обусловлена требованием их строгой видоспецифичности. Праймеры должны быть комплементарны нуклеотидным последовательностям кДНК, ограничивая амлифицируемый участок справа и слева таким образом, чтобы синтез ДНК ДНК-полимеразой проходил строго в выбранном регионе. Флуоресцентно-меченный ДНК-зонд, в свою очередь, должен лежать внутри участка кДНК, ограниченного праймерами. Правильный выбор праймеров позволяет осуществить экспоненциальное увеличение количества копий целевого участка кДНК. Правильный выбор сочетания пары праймеров и ДНК-зонда позволяет осуществлять детекцию накопления продуктов амплификации в режиме реального времени. В целом от правильности выбора олигодезоксирибонуклеотидных праймеров и ДНК-зонда зависит специфичность проводимой ОТ-ПЦР, а значит и точность диагностики вирусного заболевания.

Ниже приведены зарубежные аналоги, представляющие собой наборы праймеров и наборы реагентов, обеспечивающие детекцию кДНК коронавируса, ассоциированного с ТОРС.

Известный патент Китая №CN101603096 (опубл. 2009 г.) получен на набор реагентов и готовый ПЦР-набор для детекции вируса гриппа типа А субтипов Н5 и Н7, ТОРС ассоциированного коронавируса, хантавируса, чумной палочки (Yersinia pestis), возбудителя сибирской язвы (Bacillus anthracis).

Известная заявка США №US2009117537 (опубл. 2009 г.) касается набора праймеров и набора реагентов, позволяющего детектировать ТОРС, ассоциированный коронавирус, причем, праймеры локализуются в гене РНК-полимеразы коронавируса.

Известная Международная заявка №WO2006022459 (опубл. 2006 г.) касается детекции ТОРС ассоциированного коронавируса методом ПЦР в реальном времени.

Известный патент Сингапура № SG161740 (опубл. 2010 г.) касается выявления одного и более неизвестных коронавирусов, в том числе и ТОРС, ассоциированный коронавирус, причем праймеры фланкируют участок гена РНК-полимеразы и ген Nspl.

Известный патент Китая № CN1597984 (опубл. 2005 г.) касается биочипа, в основе которого лежит видоспецифическая ПЦР с последующей детекцией продуктов амплификации на твердой фазе ДНК-биочипа.

Известная заявка США № US2004265796 (опубл. 2004 г.) касается набора праймеров, фланкирующих участок N-гена и 3`-нетранслируемую область ТОРС ассоциированного коронавируса.

Известный патент Германии №DE20315159 (опубл. 2004 г.) касается набора реагентов, позволяющего детектировать ТОРС, ассоциированный коронавирус, методом ОТ-ПЦР в режиме реального времени.

Известный патент Китая №CN1570139 (опубл. 2005 г.) касается набора реагентов для выявления ТОРС ассоциированнго коронавируса методом ОТ-ПЦР с электрофоретической и гибридизационно-флуоресцентной детекцией накопления продуктов амплификации.

Известный патент Китая №CN1514010 (опубл. 2005 г.) касается набора реагентов, позволяющего выявлять ТОРС, ассоциированный коронавирус, методом ОТ-ПЦР. Праймеры, использующиеся в этом наборе реагентов, фланкируют ген РНК-полимеразы.

Известный патент Китая №CN1548550 (опубл. 2005 г.) касается набора реагентов, позволяющего выявлять ТОРС, ассоциированный коронавирус, методом ОТ-ПЦР. Заявка США №20040265796 (опубл. 2004 г.) касается набора реагентов, включающего праймеры, фланкирующие участок N-гена коронавируса, ассоциированного с ТОРС.

Известные патенты Китая № CN1609230 (опубл. 2005 г.), № 20080194422(А1) (опубл. 2008 г.), №20090117537 (опубл. 2009 г.), заявка США № US2008194422 (опубл. 2008 г.) также касаются наборов праймеров и наборов реагентов для выявления ТОРС ассоциированного коронавируса в исследуемых образцах.

Известен набор праймеров (внешнего и внутреннего) для детекции ТОРС ассоциированного коронавируса с электрофоретической детекцией продуктов амплификации (патент Респ. Корея № KR20100094968, опубл. 2010 г.).

Однако праймеры, используемые в вышеприведенных аналогах, имеют недостаточную гомологию к последовательностям генома ТОРС подобных коронавирусов, циркулирующих в настоящее время в дикой природе. Кроме того, указанные наборы праймеров не позволяют получить продолжительный амплифицированный фрагмент NP-гена (нуклеопротеид), нуклеотидную последовательность которого можно проанализировать и спрогнозировать патогенность и контагеозность выявленного коронавируса. Указанные наборы не могут быть использованы в количественной ПЦР.

Наиболее близким аналогом (прототипом) является http://www.interlabservice.ru/catalog/reagents/index.php?sid=1450&id=6187 (ЦНИИ Эпидемиологии, г. Москва) - набор реагентов, включающий праймеры для амплификации кДНК коронавируса человека, ассоциированного с тяжёлым острым респираторным синдромом, из клинического материала методом ПЦР с электрофоретической детекцией продуктов амплификации в агарозном геле (http://www.pcr.ru/sem_who/shipulin1.pdf).

Однако указанный набор реагентов был разработан в период вспышки заболеваемости тяжелым острым респираторным синдромом, вызванным коронавирусом, в 2003 году. За прошедшие 9 лет в ходе эпидемиологических исследований учеными были выделены вирусы, идентичные вирусу ТОРС человека, от пальмовых циветт (Paguma larvata), енотовых собак (Nyctereutes procyonoides), плодоядных летучих мышей (Rousettus, Cynopterus и т.д.). Это говорит о широком распространении в природе коронавирусов, подобных ТОРС-коронавирусу человека, а следовательно, возможности перехода геновариантов коронавирусов, подобных ТОРС-коронавирусу человека, из популяций животных в человеческую. Для этих геновариантов вышеназванные наборы праймеров не будет обладать достаточной специфичностью, чтобы обеспечить надежный синтез целевых фрагментов ДНК. Таким образом, праймеры, используемые в вышеприведенном прототипе, имеют недостаточную гомологию к последовательностям генома ТОРС подобных коронавирусов, циркулирующих в настоящее время в дикой природе. Кроме того, указанный набор праймеров не позволяет получить продолжительный амплифицированный фрагмент NP-гена (нуклеопротеид), нуклеотидную последовательность которого можно проанализировать и спрогнозировать патогенность и контагеозность выявленного коронавируса. Указанные наборы не могут быть использованы в количественной ПЦР.

Техническим результатом заявленного изобретения является разработка такого набора олигонуклеотидных праймеров и флуоресцентно-меченного зонда, который обеспечивал бы более надежную детекцию коронавируса человека, ассоциированного с ТОРС-инфекцией, в клинических образцах.

Указанный технический результат достигается разработкой набора олигодезоксирибонуклеотидных праймеров для детекции РНК коронавируса человека, ассоциированного с ТОРС, содержащего пару внутренних и один внешний олигонуклеотиды, обладающие активностью прямого и обратного праймеров в полимеразной цепной реакции, а также флуоресцентно-меченный ДНК-зонд. Указанные олигонуклеотиды имеют следующую структуру:

внешний обратный праймер (NR) 5`→3`
NR: 5`-CTTTTGGCAATGTTGTK(G/T)CCTT-3` (21 н.)
внутренние прямой (F) и обратный (R) праймеры 5`→3`
F: 5`-AAAATGTCTGATAATGGACCCC-3` (22 н.)
R: 5`-ACCACCACGAR(A/G)CTCGTCG-3` (18 н.)
флуоресцентно-меченный ДНК-зонд (Z) 5`→3`
Z: 5`-TY(C/T)CACCAAATGTAATGCGGGG-3` (21 н.)

В рамках заявляемого технического решения разработанные праймеры и ДНК-зонд обладают высокой степенью гомологии ко всем известным нуклеотидным последовательностям NP-гена изолятов коронавируса человека, ассоциированного с ТОРС, а также к коронавирусам, обнаруженным у пальмовых циветт, енотовых собак и плодоядных летучих мышей, подобным ТОРС-коронавирусу человека, доступным в международной базе данных биотехнологической информации GenBank.

Апробация праймеров была осуществлена с использованием культуры клеток Vero, зараженной коронавирусом, ассоциированным с ТОРС, штамм Frankfurt 1, полученный из Американской типовой коллекции клеточных культур (ATCC). Экспериментально было показано, что выбранные праймеры и ДНК-зонд обеспечивают надежный синтез целевых ДНК-фрагментов. Специфичность амплификации дополнительно подтверждали секвенированием.

Созданный набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда позволяет идентифицировать коронавирус человека, ассоциированный с ТОРС, а также коронавирусы, подобные ТОРС-коронавирусу человека, выделенные от пальмовых циветт, енотовых собак и плодоядных летучих мышей методом ПЦР в реальном времени с получением более продолжительного амплифицированного фрагмента NP-гена коронавируса (513 п.н.), что позволяет провести секвенирование выявленного в образце коронавируса и провести более точный эпидемиологический анализ.

Характеристика набора праймеров и участка амплифицируемой геномной РНК. Предлагаемые к патентованию праймеры фланкируют участок гена, кодирующего нуклеопротеид (NP-ген). В первом раунде ПЦР амплифицируется фрагмент генома с 28117 по 28630 нуклеотид (513 п.н.), во втором раунде амплифицируется фрагмент с 28117 по 28413 нуклеотид (296 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченного ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Важно отметить, что оптимизация условий проведения ПЦР осуществлялась с использованием наборов коммерчески доступных реагентов, приборов и ферментов, предназначенных для массового использования в лабораторной практике, что позволяет быстрое и надежное применение данного изобретения в медицинских и научно-исследовательских лабораториях.

Перечень графических материалов. На фиг.1 представлены результаты анализа образцов методом ПЦР в реальном времени. В эксперименте методом ПЦР в реальном времени были проанализированы три последовательных десятикратных разведения кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1.

На фиг.2 приведена типичная электрофореграмма разделения в 2% агарозном геле продуктов ПЦР, полученных с использованием патентуемых олигонуклеотидов.

Пример 1. Методика конструирования набора диагностических праймеров и флуоресцентно-меченного зонда

На основе теоретического изучения структуры генома коронавируса, ассоциированного с ТОРС, на консервативную область гена нуклеопротеина (NP-ген) были рассчитаны и синтезированы праймеры и флуоресцентно-меченный ДНК-зонд для проведения полимеразной цепной реакции (таблица 1). В ходе работы было проанализировано 329 имеющихся в базе данных нуклеотидных последовательностей NP-гена коронавируса, ассоциированного с ТОРС, а также коронавирусов, обнаруженных у пальмовых циветт, енотовых собак и плодоядных летучих мышей, подобных ТОРС-коронавирусу человека.

Таблица 1
Праймеры и зонд для детекции коронавируса человека, ассоциированного с ТОРС-инфекцией
Вирус Праймеры и зонды Структура олигонуклеотидной последовательности
5' → 3'
Т отжига,
°С
Размер ампликона, п.н.
ТОРС КоВ 28117-28138 AAAATGTCTGATAATGGACCCC 51.4 296
28181-28159 FAM-TYCACCAAATGTAATGCGGGG-BHQ1 58.0
28413-28396 ACCACCACGARCTCGTCG 51.2
28630-28610 CTTTTGGCAATGTTGTKCCTT 51.2 513

Референс-последовательности базы данных Национального центра биотехнологической информации США (Blast NCBI): SARS coronavirus, complete genome (NC_004718.3)

Методика получения положительных контрольных образцов. Положительные контрольные образцы были получены методом ТОРО-Т/А клонирования. После чего компетентные клетки E. coli линии TOP 10 (Invitrogen, США) были трансформированы полученными плазмидами pCR2.1 (Invitrogen, США), несущими вирусспецифическую вставку синтезированных фрагментов ДНК. В ходе проделанной работы была сконструирована рекомбинантная плазмида: pHCoV-SARS. Наличие специфической к вирусному геному ДНК-вставки подтверждали секвенированием.

Анализ эффективности проведенной трансформации осуществляли проведением ПЦР в режиме реального времени в соответствии с протоколом, описанным ниже, где в реакционную смесь в качестве положительного образца добавляли 1×ТЕ-буфер, содержащий рекомбинантную плазмиду pHCoV-SARS, со встройкой вирусспецифического синтезированного ДНК-дуплекса. В качестве отрицательного контрольного образца в реакционную смесь добавляли 1×ТЕ-буфер.

Экстракция вирусной РНК. Вирусную РНК выделяли из 100 мкл культуральной вируссодержащей жидкости с использованием набора РИБО-преп» (ФБУН ЦНИИ эпидемиологии Роспотребнадзора, г. Москва) согласно инструкции производителя.

Реакция обратной транскрипции. Синтез комплементарной ДНК (кДНК) проводили на матрице суммарной РНК с использованием набора реагентов «Реверта-L» (ФБУН ЦНИИ эпидемиологии Роспотребнадзора, г. Москва) согласно инструкции производителя.

Пример 2. Проведение полимеразной цепной реакции

Условия проведения амплификации оптимизировали по концентрации ионов магния, концентрации праймеров и зондов в реакционной смеси, температуре отжига праймеров.

Таблица 2
ПЦР-смесь для первого раунда (из расчета на одну пробирку)
Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Прямой праймер - F (10 нМ) 2
Обратный праймер - NR (10 нМ) 2
Образец 3
diH2O 17.2

Реакцию амплификации проводили в 30 мкл смеси для ПЦР (табл. 2 и табл. 3), содержащей 1×Taq буфер для амплификации, 2.5 мМ MgCl2, 0.17 мМ каждого из нуклеозид-трифосфатов, 1.5 активных единиц Smart Taq ДНК-полимеразы (все компоненты ООО «Лаборатория МЕДИГЕН»), 20 пМ прямого и обратного праймеров и 8 пМ флуоресцентно-меченного ДНК-зонда.

Реакцию амплификации с электрофоретической детекцией продукта амплификации проводили на приборе Mastercycler gradient (Eppendorf, Германия) согласно программе табл. 4.

Таблица 3
ПЦР-смесь для второго раунда (из расчета на одну пробирку)
Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Прямой праймер - F (10 нМ) 2
Обратный праймер - R (10 нМ) 2
ДНК-зонд - Z (15 нМ) 0.5
Продукт первого раунда ПЦР 1
diH2O 18.7
Таблица 4
Программа амплификатора для ПЦР
Операция T, °C T, мин:с
1 Hold/Активация Smart-Taq-ДНК-полимеразы 95 05:00
2 Cycling/Циклирование (40 циклов) 95 00:10
50 00:30
72 00:20
3 Hold/Финальная элонгация 72 10:00

Продукты ПЦР разделяли методом электрофореза в 2 % агарозном геле в присутствии бромистого этидия. Результаты оценивали по наличию флуоресцирующих полос, соответствующих фрагментам ДНК в 513 п.н. (первый раунд ПЦР), 296 п.н. (второй раунд ПЦР) и 720 п.н. (положительный контрольный образец). На фиг.2 представлена электрофореграмма разделения в 2% агарозном геле продуктов ПЦР, полученных с использованием патентуемых олигонуклеотидов.

Примечание:

1) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1, первый раунд ПЦР (513 п.н.);

2) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1, второй раунд ПЦР (разведение 1:100) (296 п.н.);

3) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1, второй раунд ПЦР (разведение 1:1000) (296 п.н.);

4) положительный контрольный образец (плазмидная конструкция pHCoV-SARS) (720 п.н.);

К - отрицательный контрольный образец (однократный ТЕ-буфер);

М - маркер молекулярного веса.

Полосы флуоресценции в геле соответствовали полученным в реакции амплификации участкам плазмидной ДНК и кДНК коронавируса.

ПЦР в режиме реального времени проводили согласно программе амплификации, таблица 5.

Таблица 5
Программа амплификатора для ПЦР-РВ
Операция T, °C T, мин:с
1 Hold/Активация Smart-Taq-ДНК-полимеразы 95 05:00
2 Cycling 1/Циклирование 1 (10 циклов) 95 00:10
50 00:30
72 00:20
3 Cycling 2/Циклирование 2 (30 циклов) 95 00:10
50 00:30 детекция
72 00:20

Детекцию интенсивности флуоресценции проводили по каналу - Green 470/510 нм (краситель FAM). Измерение флуоресценции проводили на приборах “Rotor Gene 6000” (Corbet Research, Австралия) и iQ5 (BioRad, США). Результаты оценивали по наличию флюоресценции до 30 цикла. На фиг.1 представлены результаты анализа образцов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов.

Примечание:

1) положительный контрольный образец (плазмидная конструкция pHCoV-SARS);

2) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1 (разведение 1:100);

3) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1 (разведение 1:1000);

4) кДНК коронавируса, ассоциированного с ТОРС, штамм Frankfurt 1 (разведение 1:10000);

5) отрицательный контрольный образец (однократный ТЕ-буфер).

Таким образом, предлагаемый к патентованию набор олигонуклеотидов обладает высокой степенью гомологии не только к коронавирусу человека, ассоциированному с ТОРС, но и к коронавирусам, обнаруженным у пальмовых циветт, енотовых собак и плодоядных летучих мышей, подобным ТОРС-коронавирусу человека. Кроме того, предлагаемая к патентованию разработка сочетает в себе, помимо олигонуклеотидных праймеров, также флуоресцентно-меченный ДНК-зонд, что позволяет детектировать накопление продуктов амплификации в режиме реального времени, к тому же известно, что ПЦР в реальном времени обладает большей чувствительностью, чем ПЦР с электрофоретической детекцией продуктов амплификации. Наличие в наборе внешнего обратного праймера позволяет увеличить чувствительность ПЦР за счет проведения реакции в два раунда, а также получить продолжительный фрагмент ДНК (513 п.н.), что позволяет провести секвенирование выявленного в образце коронавируса, и провести более точный эпидемиологический анализ. Помимо этого, использование в качестве положительного контроля плазмидной конструкции несущей вирусспецифическую вставку (как описано ниже), позволяет разработать количественную ПЦР, что в свою очередь дает возможность оценить вирусную нагрузку в исследуемом образце.

Приложение

<110> Федеральное бюджетное учреждение науки «Государственный научный центр вирусологии и биотехнологии "Вектор"» (ФБУН ГНЦ ВБ "Вектор").

<120> Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации РНК коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом.

<210> 4

<223> Последовательности олигонуклеотидов видоспецифические к коронавирусу человека, ассоциированному с тяжелым острым респираторным синдромом.

<400> 1

внешний обратный праймер 5`→3`
5`-CTTTTGGCAATGTTGTK(G/T)CCTT-3` 21

<400> 2

внутренний прямой праймер 5`→3`
5`-AAAATGTCTGATAATGGACCCC-3` 22

<400> 3

внутренний обратный праймер 5`→3`
5`-ACCACCACGAR(A/G)CTCGTCG-3` 18

<400> 4

флуоресцентно-меченный ДНК-зонд 5`→3`
5`-FAM-TY(C/T)CACCAAATGTAATGCGGGG-BHQ1-3` 21

Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного ДНК-зонда для идентификации коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом, содержащий пару внутренних и один внешний олигонуклеотиды, обладающие активностью прямого и обратного праймеров в полимеразной цепной реакции, а также флуоресцентно-меченный ДНК-зонд, имеющие следующую структуру:
● внешний обратный праймер (NR) 5`→3`
NR: 5`-CTTTTGGCAATGTTGTK(G/T)CCTT-3`
● внутренние прямой (F) и обратный (R) праймеры 5`→3`
F: 5`-AAAATGTCTGATAATGGACCCC-3`
R: 5`-ACCACCACGAR(A/G)CTCGTCG-3`
● флуоресцентно-меченный ДНК-зонд (Z) 5`→3`
Z: 5`-TY(C/T)CACCAAATGTAATGCGGGG-3`



 

Похожие патенты:

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен способ выявления воспалительного заболевания кишечника млекопитающего посредством детекции повышенной экспрессии генов LY6 в желудочно-кишечных тканях или клетках по сравнению с контролем.

Изобретение относится к области биотехнологии, а именно к способу получения терапевтического агента для лечения клещевого энцефалита людей. Способ включает получение аптамеров, которые способны образовывать комплекс с третичной структурой поверхностного белка вируса.
Изобретение относится к области биотехнологии. Тест-система для обнаружения РНК вируса блютанга 14-го серотипа путем проведения полимеразной цепной реакции в реальном времени включает олигонуклеотидные праймеры и ДНК-зонд, комплементарные участкам вариабельного 2-го сегмента, имеющие следующий нуклеотидный состав (5'-3'): 14/2/qf GCT GTC GGG TAT AGG TAG GA; 14/2/z FAM - GTG AAC GTG GGG TCA TCT TCA С - BHQ1; 14/2/qr ACG TGT CCG ATG CTG СТА TC.

Изобретение относится к способу скрининга веществ, способных влиять на процесс старения клетки путем использования нуклеосомных матриц. Способ включает в себя сборку нуклеосом из донорного хроматина с использованием очищенных препаратов гистонов Н2А, Н2В, Н3, Н4 натурального происхождения на ДНК-матрицах, где ДНК несет определенные мутации, ассоциированные с различными заболеваниями или со старением, активацию элонгации, внесение различных тестируемых агентов, способных стабилизировать или дестабилизировать компоненты матрицы, проведение транскрипции, оценку продуктов транскрипции.
Изобретение относится к биотехнологии и представляет собой способ мультиплексного ПЦР-анализа и набор для его осуществления. Способ включает использование неблокированных прямых и обратных праймеров и гомологичных им блокированных прямых и обратных праймеров.

Изобретение раскрывает дифференциацию штаммов возбудителя чумы основного подвида античного и средневекового биоваров. Определение проводят методом полимеразной цепной реакции (ПЦР).

Изобретение относится к области медицины. Предложен набор для многопрофильного иммунологического анализа антител в препаратах крови.
Изобретение относится к области медицинской микробиологии, а именно к способу молекулярно-генетического типирования штаммов Bordetella pertussis. Способ включает выделение ДНК из штаммов B.pertussis, проведение полимеразной цепной реакции с одновременным введением специфических праймеров PF-PR для получения ампликонов фрагмента промотора коклюшного токсина ptxP, рестрикции полученных ампликонов эндонуклеазами KpnI и MluI и электрофорезу продуктов рестрикции в агарозном геле.

Изобретение относится к области биотехнологии, а именно к реагенту для предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР), способу предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР-амплификация) и наборам, которые включают данный реагент.

Изобретение относится к области биотехнологии. Раскрыты способы, композиции и наборы для диагностики остеоартрита у животных семейства кошачьих. Способы по изобретению включают детектирование дифференциальной экспрессии, по меньшей мере, одного маркера в образце из организма, предпочтительно в образце крови, где биомаркер дифференциально экспрессируется при остеоартрите. 6 н. и 17 з.п. ф-лы, 4 ил., 7 табл., 3 пр.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты. Способ включает выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции. Проводят полимеразную цепную реакцию с возможностью проведения анализа флуоресценции по конечной точке. Амплифицируют одновременно два участка гена SLC26A5 в смеси двух пар последовательностей олигонуклеотидов с флуоресцентной меткой: CACCACAAAGAAGAGATG, TCAGCATGATCCATAGTAC, FAM-agtgtCacTagGggaaaa-BHQ-1, VIC-agtgtCacCagGggaaaa-BHQ-2, фланкирующих область с возможным содержанием мутации c.-53-2A>G в гене SLC26A5. Предложенное изобретение позволяет получить точный, объективный клинический диагноз наследственной аутосомно-рецессивной потери слуха. 1 ил., 2 табл., 2 пр.

Изобретение относится к области молекулярной биологии. Предложены способ, композиция и применение полярного апротонного растворителя с циклической основной структурой для гибридизации последовательностей нуклеиновых кислот. Изобретение может быть использовано в гибридизационных анализах. 3 н. и 16 з.п. ф-лы, 25 табл., 2 ил., 22 пр.

Изобретение относится к способу получения новых соединений-диад (I) с двумя разными, не сопряженными друг с другом, хромофорными фрагментами, содержащими азогруппы и остатки ферроцена, и их использованию для тушения флуоресценции флуорофоров. где Fc - ферроценил; R1 - Н или Fc; R2 - H или орто- или пара-гидрокси-; R3 - орто- или мета-, или пара-нитро-, или орто- или мета-, или пара-нитрофенилазо-, или пара-N,N-диметиламино-, или пара-карбокси-; L - группа пара-карбамоилвинилиденацетофенона или пара-карбоксамидовинилиденацетофенона, или пара-N-(2-карбамоилэтил)-карбоксамидовинилиденацетофенона, или пара-(4-[метиламино]бутокси)-винилиденацетофенона, или N,N-ди[4{1-(пара-винилиденацетофениламино)-метил-1,2,3-триазолил}бутил]аминогруппа. Способ получения (I) включает альдольно-кротоновую конденсацию ферроценальдегида с пара-замещенным ацетофеноном и взаимодействие полученного ферроценилиденацетофенона (2) с азосоединением, или введение в (2) реакционноспособных групп и азосочетание с диазосолью. Соединения-диады (I) имеют высокие коэффициенты молярной экстинкции, широкий спектр поглощения и электроактивность. Описан также способ тушения флуоресценции флуорофоров в двуцепочечных структурах нуклеиновых кислот с использованием (I). Показана эффективность (I) для тушения флуорофоров в растворе и в составе нуклеиновых кислот в широком спектральном диапазоне, что позволяет использовать (I) для мечения биологических макромолекул и создания олигонуклеотидных гибридизационных зондов для молекулярных методов диагностики. 2 н.п. ф-лы, 8 ил., 2 табл., 8 пр.

Изобретение относится к области биотехнологии, а именно к способу и диагностическому набору для диагностики коклюша и определения авирулентных мутантов возбудителя коклюша. Способ предусматривает осуществление полимеразной цепной реакции в режиме реального времени и регистрацию продуктов амплификации с помощью гибридизации с флюоресцентными специфическими ДНК-зондами. Осуществляют полимеразную цепную реакцию с использованием ПЦР реакционной смеси, которая включает две пары праймеров, подходящих для амплификации фрагментов последовательностей IS481 и IS 1002, пару праймеров для амплификации последовательности, сформированной в результате инсерции IS481 и IS 1002 в cctagg сайт оперона bvgAS В.pertussis, два флуоресцентных зонда, специфичных к последовательностям IS481, IS 1002 и последовательностям, сформированным в результате инсерции IS481 и IS 1002 в cctagg сайт оперона bvgAS B.pertussis. Определяют количество бактериальных геномов в образце по наличию последовательностей IS481 и IS 1002 в хромосоме бактерий B.pertussis и определяют количество авирулентных мутантов возбудителя по наличию инсерции IS481 или IS 1002 в cctagg сайте оперона bvgAS B.pertussis. Диагностический набор содержит ПЦР-реакционную смесь, включающую две пары праймеров, подходящих для амплификации фрагментов последовательностей IS481 и IS 1002, пару праймеров для амплификации последовательности, сформированной в результате инсерции IS481 и IS 1002 в cctagg сайт оперона bvgAS, два флуоресцентных зонда, специфичных к последовательностям IS481, IS 1002 и последовательностям, сформированным в результате инсерции IS481 и IS 1002 в cctagg сайт оперона bvg. Предложенное изобретение позволяет диагностировать коклюш и определять авирулентные мутанты возбудителя коклюша. 2 н. и 3 з.п. ф-лы, 1 ил., 2 табл., 1 пр.

Изобретение относится к области лабораторной диагностики, медицинской вирусологии, молекулярной биологии и эпидемиологии. Изобретение предназначено для выявления и идентификации в клинических образцах и элюатах, полученных в результате концентрирования из воды, одиннадцати групп кишечных вирусов (энтеровирусов (ЭВ), полиовирусов (ПВ), ротавирусов А и С (РВА и РВС соответственно), аденовирусов (АДВ), норовирусов (НВ), саповирусов (СВ), вирусов гепатита А и Е (ВГА и ВГЕ соответственно), астровирусов (АВ), ортореовирусов (ОРВ) в присутствии внутреннего положительного контроля (ВПК) посредством мультиплексной ПЦР с детекцией в режиме реального времени. Данный подход позволяет усовершенствовать технику ПЦР-анализа для диагностики острых кишечных инфекций (ОКИ) и может найти применение в эпидемиологических службах для мониторинга эпидемиологической обстановки и быстрой расшифровки вспышек ОКИ. 2 н. и 5 з.п. ф-лы, 4 табл., 6 пр.
Изобретение относится к области медицины, в частности молекулярной биологии и онкологии, и касается системы маркеров, представляющую собой группу генов микроРНК: miR-129-2, miR-125b1, miR-137 и miR-375, для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному. Выявление метилирования по крайней мере одного маркера из этой системы служит диагностическим признаком. Система маркеров позволяет выявить немелкоклеточный рак легкого на ранних клинических стадиях заболевания с высокой клинической чувствительностью и специфичностью. 4 табл., 3 пр.

Изобретение относится к области генетики, медицины и молекулярной биологии. Предложен способ определения трисомии хромосом плода, где из плазмы беременных женщин выделяют внеклеточную ДНК, подвергают её бисульфидной конвертации с последующей ПЦР и дальнейшему массовому параллельному секвенированию дифференциально метилированных участков; в качестве контроля дифференциально метилированных участков используют участки с различным уровнем метилирования у матери и плода, анализируют данные путем определения отношения количества чтений, полученных при секвенировании дифференциально метилированных участков ДНК на целевой и контрольной хромосомах, где в случае трисомии, при константном количестве чтений ДНК плода, картированных на дифференциально метилированных участках хромосом, будет наблюдаться количество чтений, картированных на целевую хромосому к количеству чтений на контрольных хромосомах, равное 3/2, тогда как в норме это отношение будет постоянным и равным 1. Способ может быть использован в медицине для пренатальной диагностики генетических болезней плода. 2 з.п. ф-лы, 1 табл.

Изобретение относится к области биотехнологии и касается способа видовой идентификации лактобацилл L.casei/paracasei, L.fermentum, L.plantarum, L.rhamnosus. Предлагаемый способ включает постановку реакции ПЦР с видоспецифическими праймерами, причем конструируют праймеры, специфичные к первому гену оперона F1F0 АТФ синтазы (гену субъединицы а) и предшествующего ему гена урацилфосфорибозилтрансферазы для L.casei/paracasei и L.rhamnosus и гена урацилтранспортного белка для L.plantarum и L. fermentum. Представленное решение может быть использовано для идентификации видов лактобацилл в различных образцах микрофлоры человека и животных, в фармацевтических препаратах и в продуктах питания. 1 з.п. ф-лы, 1 ил., 3 табл.
Изобретение относится к молекулярной биологии и генетике клетки. Предложен способ, включающий этапы предварительной экстракции геномной ДНК, выделения специфической фракции однонитевых G-оверхенгов теломерной ДНК и последующей амплификации их минусовой цепи с дуплекс-специфическим анализом, причем этапы амплификации включают модификацию 3'-концов теломерных оверхенгов с помощью терминальной дезоксинуклеотидилтрансферазы и осуществляются с использованием набора праймеров SEQ ID NO: 1-5. Дуплекс-специфический анализ основан на гибридизации минусовых цепей оверхенгов с набором специфических флуоресцентно-меченных зондов SEQ ID NO: 6-11, соответствующих шести возможным вариантам нуклеотидных окончаний G-цепи теломерной ДНК человека. Степень разгорания зондов в присутствии фермента дуплекс-специфической нуклеазы служит критерием присутствия соответствующего варианта нуклеотидного окончания и мерой его количественного содержания. Полученные профили терминальных нуклеотидов G-цепи теломерной ДНК служат пролиферативными маркерами, указывающими на степень активации деления клетки и определяющими временную продолжительность клеточного цикла. Изобретение является новой разновидностью ДНК-диагностики, предназначено для выявления изменений нуклеотидных окончаний ДНК теломерных областей хромосом, происходящих в ходе клеточного цикла, и может быть использовано в медицине для диагностики и лечения онкологических заболеваний, в иммунологии, трансплантологии, косметологии, дерматологии, геронтологии, клеточной биотехнологии и других областях, заинтересованных в оценке пролиферативного статуса клетки и методах его направленного регулирования. 3 н. п. и 12 з. п. ф-лы, 9 ил., 8 табл., 5 пр.
Наверх